Evaluation of the impact of 16-dehydropregnenolone on the activity and expression of rat hepatic cytochrome P450 enzymes

Article abstract of DOI:10.1016/j.jsbmb.2016.05.018

16-dehydropregnenolone (DHP) is a promising novel antihyperlipidemic agent developed and patented by Central Drug Research Institute (CDRI), India. The purpose of the present study was to investigate whether DHP influences the activities and mRNA expression of hepatic drug-metabolizing cytochrome P450 (CYP) enzymes (CYP1A2, CYP2C11, CYP2D2, CYP2E1 and CYP3A1) in Sprague-Dawley (SD) rats. A cocktail suspension of CYP probe substrates which contained caffeine (CYP1A2), tolbutamide (CYP2C11), dextromethorphan (CYP2D2), chlorzoxazone (CYP2E1) and dapsone (CYP3A1) was administered orally on eighth- or fifteenth-day to rats pre-treated with DHP intragastrically at a dose of 36 and 72?mg/kg for one week and two weeks. The concentrations of probe drugs in plasma were estimated by liquid chromatography-tandem mass spectrometry (LC–MS/MS). Alongside, the effect of DHP on CYPs activity and mRNA expression levels were assayed in isolated rat liver microsomes and by real-time reverse transcription-polymerase chain reaction (RT-PCR), respectively. DHP had significant inducing effects on CYP1A2, 2C11, 2D2 and 2E1 with no effect on CYP3A1 in dose- and time-dependent manner, as revealed from the pharmacokinetic profiles of the probe drugs in rats. In-vitro microsomal activities and mRNA expression results were in good agreement with the in-vivo pharmacokinetic results. Collectively, the results unveiled that DHP is an inducer of rat hepatic CYP enzymes. Hence, intense attention should be paid when DHP is co-administered with drugs metabolized by CYP1A2, 2C11, 2D2 and 2E1, which might result in drug-drug interactions and therapeutic failure.

Full text of DOI:10.1016/j.jsbmb.2016.05.018

Accepted Manuscript
Title: Evaluation of the impact of 16-dehydropregnenolone on
the activity and expression of rat hepatic cytochrome P450
enzymes
Author: Rachumallu Ramakrishna Manisha Bhateria Rajbir
Singh Rabi Sankar Bhatta
PII:
S0960-0760(16)30148-0
DOI:
Reference:
http://dx.doi.org/doi:10.1016/j.jsbmb.2016.05.018
SBMB 4733
To appear in:
Journal of Steroid Biochemistry & Molecular Biology
Received date:
Revised date:
Accepted date:
8-2-2016
13-5-2016
15-5-2016
Please cite this article as: Rachumallu Ramakrishna, Manisha Bhateria, Rajbir Singh,
Rabi Sankar Bhatta, Evaluation of the impact of 16-dehydropregnenolone on the
activity and expression of rat hepatic cytochrome P450 enzymes, Journal of Steroid
Biochemistry and Molecular Biology http://dx.doi.org/10.1016/j.jsbmb.2016.05.018
This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof
before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that
apply to the journal pertain.

Evaluation of the impact of 16-dehydropregnenolone on the activity and expression of
rat hepatic cytochrome P450 enzymes
Rachumallu Ramakrishna 1, 2 #, Manisha Bhateria 1, 2 #, Rajbir Singh , Rabi Sankar Bhatta
1
1, 2*
#
Authors contributed equally to this work
1Pharmacokinetics and Metabolism Division, CSIR-Central Drug Research Institute,
Lucknow-226031, Uttar Pradesh (India)
2Academy of Scientific and Innovative Research, New Delhi -110001 (India)
*
Address for correspondence
Dr. Rabi Sankar Bhatta
Pharmacokinetics & Metabolism Division
CSIR-Central Drug Research Institute
B.S. 10/1, Sector 10, Jankipuram Extension
Sitapur Road, Lucknow ‐ 226031
Email ID: rabi_bhatta@cdri.res.in; rabi.cdri@gmail.com
Tel.: +91-522 2772974 (Ext-4853)
1

Graphical Abstract
2

Highlights:
•
DHP decreases AUC, Cmax and increases CL of CYP1A2, 2C11, 2D2 and 2E1
substrates.
•
•
•
DHP has no significant effect on pharmacokinetic parameters of CYP3A1 substrate.
DHP increases enzyme activity of CYP1A2, 2C11, 2D2 and 2E1.
DHP induces CYP1A2, 2C11, 2D2 and 2E1 mRNA levels with no influence on
CYP3A1.
•
Care should be taken when DHP is co-administered with CYP substrate drugs.
Abstract
6-dehydropregnenolone (DHP) is a promising novel antihyperlipidemic agent developed
1
and patented by Central Drug Research Institute (CDRI), India. The purpose of the present
study was to investigate whether DHP influences the activities and mRNA expression of
hepatic drug-metabolizing cytochrome P450 (CYP) enzymes (CYP1A2, CYP2C11,
CYP2D2, CYP2E1 and CYP3A1) in Sprague-Dawley (SD) rats. A cocktail suspension of
CYP probe substrates which contained caffeine (CYP1A2), tolbutamide (CYP2C11),
dextromethorphan (CYP2D2), chlorzoxazone (CYP2E1) and dapsone (CYP3A1) was
administered orally on eighth- or fifteenth-day to rats pre-treated with DHP intragastrically at
a dose of 36 and 72 mg/kg for one week and two weeks. The concentrations of probe drugs in
plasma were estimated by liquid chromatography-tandem mass spectrometry (LC-MS/MS).
Alongside, the effect of DHP on CYPs activity and mRNA expression levels were assayed in
isolated rat liver microsomes and by real-time reverse transcription-polymerase chain
3

reaction (RT-PCR), respectively. DHP had significant inducing effects on CYP1A2, 2C11,
D2 and 2E1 with no effect on CYP3A1 in dose- and time-dependent manner, as revealed
2
from the pharmacokinetic profiles of the probe drugs in rats. In-vitro microsomal activities
and mRNA expression results were in good agreement with the in-vivo pharmacokinetic
results. Collectively, the results unveiled that DHP is an inducer of rat hepatic CYP enzymes.
Hence, intense attention should be paid when DHP is co-administered with drugs
metabolized by CYP1A2, 2C11, 2D2 and 2E1, which might result in drug-drug interactions
and therapeutic failure.
Keywords: 16-dehydropregnenolone, CYP450, cocktail, pharmacokinetics, microsomes, real
time RT-PCR.
1
. Introduction
1
6-dehydropregnenolone (DHP) (Figure 1) is a promising antihyperlipidemic agent
developed and patented by CSIR-Central Drug Research Institute (CDRI), India, in its drug
discovery program [1, 2]. DHP has also been identified in the circulation of pre-term
neonates but not in adult human or rat [3]. It acts as a farnesoid X receptor (FXR) antagonist
and has shown significant lipid lowering activity in pre-clinical studies [4]. DHP also possess
indispensable pharmacological actions, notably anticancer, hypoglycemic, antiplatelet and
antioxidant activities [5-7]. Chronic toxicity studies indicated that it possess a good
therapeutic window without any untoward effects [2].
Cytochrome P450 (CYP) is a hemoprotein superfamily, among which CYP1, CYP2 and
CYP3 play a major role in the metabolism of vast array of xenobiotics and endobiotics [8, 9].
Although the available reports hitherto on DHP shed a light on pharmacological activities,
bioanalytical methods [10, 11] and pharmacokinetic studies in rats and rabbits [12, 13], there
4

is paucity of information regarding the impact of DHP on CYP enzymes. In the drug
development process, it is highly plausible to anticipate undesirable drug-drug interactions
(DDIs), the foremost contributing cause to drug failure in polypharmacy. DDIs arise when
one of the concomitant drugs modulates the metabolism of co-administered drug by induction
or inhibition of CYP enzymes involved in its metabolism, which may bring about detrimental
consequences such as alteration of the concentration of drug in the blood, pharmacological
activity and/or adverse drug reactions. [14-16] .
Animal models are routinely used in pre-clinical development of new compounds to predict
their metabolic behaviour in humans, irrespective of the fact that humans differ from animals
with regard to isoform composition, expression and catalytic activities of drug-metabolizing
enzymes (DMEs) [17]. Moreover, quantification of CYP modulation in pre-clinical species
can be tested as part of toxicological/safety evaluation before the candidate drug is selected
for clinical development [18]. It has been established that human CYP1A2, CYP2C9,
CYP2D6, CYP2E1 and CYP3A4/5 are homologues of rat CYP1A2, CYP2C11, CYP2D2,
CYP2E1 and CYP3A1/2, respectively [19-22], which are most often implicated in DDI
studies [23]. It is well-known fact that the multi-pill combination strategy is usually
implemented in clinical practice. Exclusively in the treatment of hyperlipidemia, two or more
drugs from different pharmacological categories are frequently co-administered to obtain
desired therapeutic effects [24]. Furthermore, many antihyperlipidemic drugs are substrates
of CYPs [25].
Under the scope of aforementioned evidences, it becomes imperative to elucidate the effect of
DHP on regulating the hepatic CYP enzymes for better understanding its differential effect
on regulating pharmacokinetic profiles of CYP substrates following oral administration in
Sprague-Dawley (SD) rats. The changes in CYP enzyme catalytic activities were evaluated
by comparing the plasma pharmacokinetics of probe substrates (caffeine for CYP1A2,
5

tolbutamide for CYP2C11, dextromethorphan for CYP2D6, chlorzoxazone for CYP2E1 and
dapsone for CYP3A1/2) between control and DHP pre-treated groups in-vivo. Alongside this,
the rate of formation of metabolite from specific CYP probe substrate was determined in
isolated liver microsomes in-vitro. However, the major mechanism of CYP induction or
inhibition is via altered rates of transcription, this biological phenomenon is addressed by
studying the changes in messenger RNA (mRNA) levels using real-time reverse
transcriptase-polymerase chain reaction (RT-PCR) [26]. The outcomes of the present study
would be beneficial for better forecast of drug-drug metabolic interactions mediated by DHP,
which may provide valuable insights about safe and effective use of DHP with prescription
drugs.
2
. Experimental
2
.1. Chemicals and reagents
DHP (5, 16-pregnadien-3β-ol-20-one) (purity > 99%) is a synthetic steroid molecule, which
was synthesized at the Medicinal Process Chemistry Division of CDRI. Phenacetin (purity >
9
8%), paracetamol (purity > 98%), caffeine (purity > 98%), tolbutamide (purity > 98%),
diclofenac (purity > 98%), 4′-hydroxy diclofenac (purity > 98%), dextromethorphan (purity >
8%), dextrorphan (purity > 98%), chlorzoxazone (purity > 98%), 6-hydroxy chlorzoxazone
9
(purity > 98%), dapsone (purity > 98%), midazolam (purity > 98%), 1-hydroxy midazolam
(purity > 98%), rosuvastatin (internal standard 1, IS1) (purity > 98%), chlorthalidone
(internal standard 2, IS2) (purity > 98%), trizma base (Tris), β -Nicotinamide adenine
dinucleotide phosphate (NADPH) reduced tetra sodium salt, magnesium chloride (MgCl ),
2
potassium chloride (KCl), sodium carboxymethylcellulose (Na.CMC), HPLC-grade tert-butyl
methyl ether (TBME) and formic acid were purchased from Sigma-Aldrich (St. Louis, MO).
Chromatographic grade acetonitrile and methanol were obtained from Merck Chemicals
6

(Darmstadt, Germany). Heparin was purchased from Gland Pharma Ltd (Hyderabad, India).
Ultrapure water (resistance > 18.2 mΩ) was obtained in-house using a Milli-Q PLUS PF
water purifying system (Millipore, Bedford, MA). All other reagents and solvents were of
analytical grade and purchased from standard chemical suppliers.
2
.2. Animals
Male SD rats (220 ± 20g) were obtained from National Laboratory Animal Center (NLAC) of
CSIR-CDRI. All experiments were executed according to the guidelines of Institutional
Animal Ethical Committee (IAEC approval no: IAEC/2014/155) at CSIR-CDRI. The animals
were acclimatized for one week in properly ventilated polypropylene cages under standard
ο
laboratory conditions with temperature (23-25 C), relative humidity (50-70%) and day /night
cycle (12/12 h) before initiation of experimental procedures. Animals were fed with standard
chow diet and had free access to water ad libitum in hygienic conditions. Drug-free plasma
containing heparin as anticoagulant was collected from adult healthy rats.
2
2
.3 Effect of DHP on systemic exposure of CYP probe substrates
.3.1 Study design, formulation and dosage regimen
The effect of DHP on rat CYP enzymes was studied at low dose (36 mg/kg) and high dose
72 mg/kg) administered orally for one week (short period) and two weeks (long period).
(
Rats were randomly allocated into 5 groups (total 25 rats, n=5 per each group) to ensure
equivalent mean body weight across the dose groups before dosing: vehicle control group
(VCG), low dose for short period group (L-1W), high dose for short period group (H-1W),
low dose for long period group (L-2W), high dose for long period group (H-2W). The VCG
and other four treatment groups were administered orally 0.5% w/v Na.CMC suspension
7

(vehicle) and DHP suspended in a vehicle, respectively, by gavage once daily on every
morning for specified treatment duration.
2
.3.2 Pharmacokinetic study
On the eighth or the fifteenth day, all rats were administered orally with the cocktail
substrates containing caffeine (20 mg/kg) [27], tolbutamide (15 mg/kg) [8],
dextromethorphan (20 mg/kg) [20], chlorzoxazone (50 mg/kg) [28] and dapsone (20 mg/kg)
[
27] suspended in 0.5% w/v Na. CMC at a dose of 5 mL/kg. At pre-defined time intervals
0.25, 0.5, 0.75, 1, 2, 4, 6, 8, 12 and 24 h), blood samples were withdrawn from each rat into
(
heparinized polypropylene tubes via the oculi chorioideae vein under light ether anesthesia.
The total volume of blood collected within 24 h was less than 5% of the total blood volume.
Plasma was harvested by centrifuging the blood samples at 4000×g for 10 min and stored at -
8
0 C until LC-MS/MS analysis.
2
.3.3 Sample preparation
All the biosamples were processed by one-step liquid-liquid extraction (LLE) method. To an
aliquot of 50 μL plasma, 10 μL of IS (10 ng/mL) and subsequently extracted with TBME by
vortexing (Vibrax VXR basic, staufen, Germany) for 5 min and centrifuging (Eppendorf,
Hamburg, Germany) at 4000×g for 10 min. The clear organic supernatant was transferred to
another set of clean tubes and evaporated to dryness under a nitrogen stream at 40 C and 20
®
psi (Turbovap , MA, United States). The dried residues were then reconstituted with 50 μL
acetonitrile and vortex mixed. The resultant mixture was subjected to liquid chromatography-
tandem mass spectrometry (LC-MS/MS) analysis. The plasma samples were also analyzed
for the presence of DHP using the previously reported extraction method and LC-MS/MS
method [11].
8

2
.3.4 Bioanalysis using cocktail LC-MS/MS method
LC was performed on Waters HPLC unit (Waters Corp., Manchester, UK) equipped to API
200 triple quadrupole mass spectrometer with TurboIon spray interface (AB Sciex, Canada).
3
The chromatographic separation of cocktail substrates was achieved on a Waters Symmetry-
shield C18 reversed phase column (150 × 4.6 mm i.d., 5 μm) preceded with a guard column of
ο
same stationary phase (Thermo Scientific, USA), maintained at a temperature of 40 C. The
mobile phase comprising of solvent A (0.1% formic acid in triple distilled water) and solvent
B (acetonitrile) was pumped isocratically in the ratio of 30:70, v/v at a flow rate of 0.6
mL/min. The injection volume was 10 μL and the time taken for each analytical run was 4
min. Quantitation of analytes was performed in both positive and negative multiple reaction
monitoring (MRM) mode due to its selectivity and sensitivity [29]. The instrument
parameters such as curtain gas, collision gas (CAD), nebulizer gas (GS1), turboIon gas (GS2)
and temperature were set at 15 psi, medium, 50 psi, 50 psi and 450 C, respectively. The
dwell time was 200 ms per MRM channel under unit mass resolution in the mass analyzers.
All MS/MS parameters were optimized to ensure the reproducible response and are listed in
Table 1. Analyst 1.6 software (AB Sciex, Canada) controlled the equipment, data acquisition
and analysis.
2
.3.5 Pharmacokinetic data analysis
Plasma concentration-time profiles were analysed by non-compartmental model and
pharmacokinetic parameters including maximum plasma concentration (Cmax), area under the
plasma concentration-time curve from time zero to infinity (AUC0-∞) and clearance (CL)
were determined using Phoenix WinNonlin software (version 6.3, Pharsight Corporation,
Mountain view, USA). Cmax is the maximum plasma concentration that a drug achieves in the
body after dosing. AUC represents the total integrated area under the plasma concentration-
9

time profile and expresses the total amount of drug that enters into the systemic circulation
following its administration. Clearance is the rate at which the drug is cleared or removed
from the body per unit time.
2
2
.4 In-vitro assessment of CYP-associated activities in liver microsomes
.4.1 Drug administration and sample collection
Animal subjects, study design, formulation and dosage regimen were similar to those
mentioned in section 2.3.1. Twenty-four hours after the last treatment, all rats were
euthanized with anaesthetic ether and the liver tissues were excised quickly, perfused with
ice-cold saline to remove blood residue, blotted dry and stored at -80 C. The liver tissues
were divided to provide samples for microsomes preparation and RNA isolation.
2
.4.2 Preparation of microsomes from rat liver
Microsomes were prepared by differential centrifugation method [30]. Briefly, liver samples
were homogenized in Tris-HCl buffer (50 mM, pH 7.4) containing KCl (0.15 M), EDTA (1
mM) and sucrose (0.25 M) using a Potter-Elvjhem type homogenizer. The homogenate was
centrifuged (Eppendorf, Hamburg, USA) at 10,000×g for 30 minutes at 4C. The supernatant
was further centrifuged (Optima Max-XP, Beckman Coulter, USA) at 1, 05,000×g for 60
minutes at 4 C. The microsomal pellet, thus obtained from each experimental group was
washed and resuspended in microsomal storage buffer containing Tris-HCl (50 mM, pH 7.4),
KCl (0.15 M), EDTA (1 mM), glycerol (20%, v/v) and aliquots were stored at -80 C until
use. Protein content in the microsomal fraction was estimated by Lowry method [31] using
bovine serum albumin (BSA) as a calibration standard. Absorbance was measured at 660 nM
on multimode microplate reader (Tecan, Switzerland) using Magellan TM software.
1
0

2
.4.3 Measurement of microsomal CYP enzyme activities
Probe substrates are used to determine the activity of each specific CYP enzyme. Phenacetin
5 µM), diclofenac (4 µM), dextromethorphan (5 µM), chlorzoxazone (50 µM) and
(
midazolam (5 µM) are used as probe substrates for index reactions such as phenacetin O-
deethylation (CYP1A2), diclofenac 4-hydroxylation (CYP2C11), dextromethorphan O-
demethylation (CYP2D2), chlorzoxazone 6-hydroxylation (CYP2E1) and midazolam 1-
hydroxylation (CYP3A1/2), respectively [32] . The incubation mixture (n=5) consisted of
Tris-HCl buffer (50 mM, pH 7.4), MgCl (20 mM), microsomes (0.5 mg/ml) and NADPH (2
2
mM) in a final volume of 0.2 mL. Following pre-incubation in a heated water bath at 37 °C
for 5 min, the enzymatic reactions were initiated by spiking substrates (0.5%, v/v organic
content) and incubated for 15 min. Subsequently, the reactions were terminated by quenching
with 400 μL ice-cold acetonitrile containing IS (10 ng/mL) to terminate the reaction. All
samples were vortex mixed, centrifuged at 12,000×g for 20 min and the supernatant was
collected for determination of metabolites (paracetamol, 4-hydroxy diclofenac, dextrorphan,
6
-hydroxy chlorzoxazone and 1-hydroxy midazolam) by LC-MS/MS analysis. All
metabolites were separated on Thermo Accucore aQ C18 (150×4.6 mm i.d., 2.1 µm) column
with a mobile phase consisting of solvent A (0.1% formic acid in triple distilled water) and
solvent B (acetonitrile with 0.1% formic acid) in the ratio 80:20, v/v at a flow rate of 0.7
mL/min. The injection volume and total run time was set to 10 μL and 7 min, respectively.
The instrument parameters such as curtain gas, collision gas (CAD), nebulizer gas (GS1),
turboIon gas (GS2) and temperature were set at 15 psi, medium, 45 psi, 45 psi and 450 C,
respectively. The optimized MRM transitions for all the metabolites are listed in Table 1. The
enzyme catalytic activity was expressed as pmol of metabolite formation/min/mg microsomal
protein.
1
1

2
2
.5 Effect of DHP on mRNA expression of CYP enzymes
.5.1 RNA isolation
Total RNA was extracted from 0.1-0.2g liver tissue by TRIzol reagent (Invitrogen, USA)
according to the manufacturer’s protocol. The RNA concentration was determined, and the
quality of isolated RNA was evaluated using the 260/280 nm absorbance ratio (1.8-2.0
indicates a highly pure sample) using NanoDrop 2000c spectrophotometer (Thermo
Scientific, USA). RNA integrity was confirmed by running samples on gel electrophoresis
using 1% agarose gel.
2
.5.2 cDNA synthesis and RT-PCR analysis
RNA samples (2 µg) were reverse transcribed to cDNA by Verso cDNA Synthesis Kit
Thermo Scientific, USA) according to the manufacturer’s instructions using SureCycler
800 (Agilent Technologies, USA). Further, RT-PCR analysis was performed in 96-well
(
8
plates (LightCycler 480) for a 20 µL reaction mixture consisting of 2× master mix, forward
and reverse primer, cDNA, and nuclease free water using DyNAmo Flash SYBR Green
qPCR Kit recommendations (Thermo Scientific, USA) on Light Cycler 480 II (Roche

Diagnostics). Each PCR thermo cycle consisted of initial denaturation at 95 C for 10 min
followed by 40 cycles of denaturation at 95 C for 30 sec, annealing at 60 C for 30 sec,
extension at 72 C for 30 sec and final extension at 65C for 5 min. Glyceraldehyde-3-
phosphate dehydrogenase (GAPDH) was used as housekeeping gene. The fold change in the
expression level of target gene following DHP treatment relative to untreated control was
calculated using 2-
Ct
method, where Ct represents the differences in cycle threshold (Ct)
numbers between the target gene and GAPDH, and Ct represents the relative change in the
differences between treatment and control groups. The data are represented as the fold change
1
2

in gene expression relative to the control. The sequences of the forward and reverse
oligonucleotide primers are summarized in the Table 2.
2
.6 Statistical analyses
Experimental data were represented as mean ± standard error of mean (SEM). Statistical
comparisons were executed using GraphPad Prism 5.0 software (GraphPad Inc., USA).
Statistical significant differences were evaluated between control and treatment groups using
student’s unpaired t-test and/or one-way ANOVA with post-hoc dunnett test when
appropriate. P-values less than 0.05 are considered to be significantly different for all tests.
3
. Results
3
.1 Effect of DHP on the pharmacokinetics of CYP probe substrates
3
.1.1 Effect of DHP on CYP1A2
The effect of different dosage regimens of DHP on pharmacokinetic parameters of caffeine in
SD rats are represented in Table 3. Mean plasma concentration-time profiles of caffeine in
different groups are depicted in Figure 2. After pretreatment with DHP, the AUC0–∞ and Cmax
of caffeine in H-1W group were significantly reduced by 31.2% and 33.8%, respectively, and
the CL of caffeine was significantly accelerated by 30.3% in comparison to VCG. The AUC0-
∞
and Cmax of caffeine in L-2W group were decreased significantly by 85.9% and 54.6%,
respectively and CL of caffeine was increased significantly by 84.5% compared to those of
VCG. The AUC0-∞ and Cmax of caffeine in H-2W group were decreased significantly by
1
51.1% and 98.0%, respectively and CL was increased by 149.1% in comparison to VCG.
The pharmacokinetic parameters of caffeine showed no significant difference between L-1W
group and VCG.
1
3

3
.1.2 Effect of DHP on CYP2C11
Pharmacokinetic profiles of tolbutamide in control and treatment groups were used to
describe the activity of CYP2C11. Conferring to the results shown in Table 3 and Figure 2,
the influence of DHP on pharmacokinetic parameters of tolbutamide in L-1W group was
insignificant when compared to those of VCG. After pretreatment with DHP at high dose for
short period in H-1W group, the AUC0–∞ and Cmax of tolbutamide were decreased
significantly by 4.6% and 3.9%, respectively compared to those of VCG, whereas CL of
tolbutamide was increased significantly by 6.3%. On the other hand, the AUC0-∞ and Cmax of
tolbutamide in L-2W group were decreased significantly by 9.4% and 7.8%, respectively and
CL of tolbutamide was increased significantly by 9.4% compared to those of VCG. The
AUC0-∞ and Cmax of tolbutamide in H-2W group were decreased significantly by 18.4% and
1
3.8%, respectively and CL was significantly increased by 18.4% in comparison to VCG.
3
.1.3 Effect of DHP on CYP2D2
CYP2D2 activity was assessed by comparing the pharmacokinetics of dextromethorphan in
the study groups. The mean plasma concentration-time curves of dextromethorphan and the
corresponding pharmacokinetic parameters are presented in Table 3 and Figure 2,
respectively. In all DHP pre-treated groups except H-2W group, the AUC0-∞, Cmax and CL of
dextromethorphan were not modulated significantly, as compared to those observed in the
VCG. Interestingly, it was found that the AUC0-∞ and Cmax were lessened significantly by
8
7.5% and 36.3%, respectively; in contrast CL was enhanced by 77.2% for dextromethorphan
in H-2W group compared to those of VCG.
3
.1.4 Effect of DHP on CYP2E1
CYP2E1 activity was determined by comparing pharmacokinetic behaviours of
chlorzoxazone between control and DHP treatment groups. The impact of DHP on mean
1
4

plasma concentration-time profile and pharmacokinetic parameters of chlorzoxazone in rats
are given in Table 3 and Figure 2, respectively. The effect of DHP at low and high dose given
for one week on AUC0-∞, Cmax and CL of chlorzoxazone was nondistinctive, while a marked
difference existed at same doses administered for two weeks, in comparison to VCG. It is
noteworthy that the AUC0-∞ and Cmax of chlorzoxazone in L-2W group were declined
significantly by 44.0% and 15.5%, respectively and CL of chlorzoxazone was augmented by
4
3.8%. But in H-2W group, the AUC0-∞ and Cmax of chlorzoxazone were significantly
dropped by 102.57% and 43.8%, respectively, however CL of chlorzoxazone was enhanced
by 103.6%.
3
.1.5 Effect of DHP on CYP3A1
The pharmacokinetic parameters and mean plasma concentration-time profiles of dapsone in
rats from different study groups are presented in Table 3 and Figure 2, respectively. There
was no significant change in the systemic exposure levels (AUC0-∞ and Cmax) and CL of
dapsone between VCG and treatment groups.
3
.2 Effect of DHP on CYP activities in rat liver microsomes
The potential influence of DHP on CYP enzyme activities was investigated with the liver
microsomes prepared from the rats pre-treated with DHP and the results are represented in
Figure 3. Compared with the VCG, the formation of paracetamol from phenacetin by
CYP1A2 was unconspicuous in L-1W group but it was significantly increased to 1.79-fold,
2
.07-fold and 2.80-fold in H-1W, L-2W and H-2W groups, respectively. Similar trend was
observed for CYP2C11 catalyzing the formation of 4-hydroxy diclofenac from diclofenac in
which the activity was remarkably augmented to 1.28-fold, 1.36-fold and 1.40-fold in H-1W,
L-2W and H-2W groups, respectively, but with no effect on the activity in L-1W group in
comparison to VCG. The formation of dextrorphan from dextromethorphan was not changed
1
5

significantly in L-1W, H-1Wand L-2W groups; besides, a 1.91-fold increase in the activity
was recorded in H-2W group compared with the VCG. The activity of CYP2E1 towards the
metabolism of chlorzoxazone to 6-hydroxy chlorzoxazone was insignificantly affected by
DHP in L-1W and H-1W groups, but markedly increased to 1.45-fold and 2.0-fold in L-2W
and H-2W groups, respectively, in comparison to VCG. DHP had no significant effect on the
activity of CYP3A1 at low and high dose administered for short and long period compared to
that of VCG.
3
.3 Effect of DHP on mRNA expression of CYP enzymes
As represented in Figure 4, the mRNA expression level of CYP1A2 in H-1W group, L-2W
group and H-2W group was significantly increased to 1.75-fold, 1.96-fold and 2.26-fold to
that observed in the VCG, respectively. However, the mRNA expression level of CYP2C11
in H-1W group, L-2W group and H-2W group was significantly up-regulated to 1.45-fold,
1
.57-fold and 1.63-fold to that observed in the VCG, respectively. In addition, no significant
differences in the mRNA expression level of CYP2D2 were observed between VCG and
DHP treated groups except H-2W group in which the expression level was increased to 2.12-
fold. Compared to VCG, DHP treatment increased the CYP2E1 mRNA expression to 1.58-
fold and 2.03-fold in L-2W group and H-2W group, respectively, without any significant
effect in L-1W group and H-1W group. The mRNA expression for CYP3A1 showed no
significant difference among all treatment groups.
4
. Discussion
A wide variety of drugs are metabolized by CYP enzymes in the liver, and more than 90% of
DDIs occur at the CYP enzyme-catalyzed step [33]. During the drug development process,
investigators often conduct two types of drug metabolism studies to assess the potential for
CYP450-based drug interactions. One type of study characterizes the metabolic pathway of
1
6

the new drug and the potential for other drugs to modify the metabolism of the new drug. The
other type of study evaluates the potential for the new drug to alter the metabolism of other
drugs which is more challenging than the first type of study [34]. The present report sought to
investigate the potential of DHP to alter the metabolism of CYP probe substrate drugs. The
modulation (induction or inhibition) of CYPs is recognized as the major mechanism of
metabolic DDIs [35]. Drug regulatory authorities of United States, Europe and China require
that metabolic research based on the CYP system should be included in new drug
evaluations. Thus, a full characterization of DHP for its influence on CYP enzymes is
necessary in order the best to understand the likely extent of DDIs.
It has been reported that DHP had very low bioavailability (~3%), quick absorption and rapid
elimination (t1/2 = 2-3h) at an oral dose of 72 mg/kg in male SD rats. 5-pregnene-3β-ol-16,
1
7-epoxy-20-one (M1) is the major metabolite in rat plasma [12]. The plasma concentration-
time profile of DHP following oral (36, 72, 100 and 150 mg/kg) and intravenous (1, 5 and 10
mg/kg) administration has revealed that DHP exhibited multiple peak phenomenon at ~0.25,
~1.5-2, ~3-4 and ~7-8 h post dose [13]. Preliminary studies on CYP mediated metabolism of
DHP have been performed in-house (data not shown) wherein we found that CYP3A was
mainly responsible for its metabolism among CYP1A2, 2C11, 2D2 and 2E1. However, the
detailed metabolic pathway of DHP needs further investigation.
DHP exhibited antihyperlipidemic activity at a dose range of 36-72 mg/kg in SD rats [13].
Based on the dose proportionality studies, it was proved that both pharmacokinetics and
pharmacodynamic activity of DHP exhibited saturation above 72 mg/kg dose [12, 13].
Hence, in accordance to the literature, we have chosen 36 mg/kg as low dose and 72 mg/kg as
high dose for consecutive 7 days (short period) or 14 days (long period) treatment to evaluate
the effect of DHP on the five pivotal rat hepatic CYP enzymes, notably, CYP1A2, 2C11,
2
D2, 2E1 and 3A1 based on the fact that they are homologous to human CYP1A2, CYP2C9,
1
7

CYP2D6, CYP2E1 and CYP3A4 by 78%, 76%, 77%, 71% and 78%, respectively [36].
Currently, DHP is in pre-clinical stage for which regulatory toxicology studies are ongoing in
male Sprague-Dawley (SD) rats. The present study was performed in male SD rats such that
the findings could be correlated well with the outcomes of toxicological studies.
The study represented herein is the first attempt in demonstrating the effect of DHP on five
major CYP enzymes in rats using a probe drug cocktail approach. The selection of different
probe drugs for in vitro and in vivo evaluation of CYP enzyme activity was based on the
recommendations given by United States Food and Drug Administration (USFDA) regulatory
authority and the literature preference [22, 27, 34, 37-40]. Previous reports have
demonstrated the selection criteria of probe substrates for CYPs which includes the
availability of substrate and metabolite standards, selectivity, sensitivity, sufficient metabolite
production at low substrate concentrations, effect of organic solvents, inter-substrate
interactions, metabolic and kinetic properties, etc [41, 42]. In each case, the substrate is
metabolized exclusively or primarily by its specific enzyme. The activity levels of the
multiple enzymes are less than 10% of the activity of the main enzyme, which indicate that
the substrates are specific for the desired enzyme [43]. The results showed that DHP at a low
dose of 36 mg/kg given for one week had no effect on any of the CYPs studied, but when the
treatment duration increased from one week to two weeks, the metabolic clearance of
caffeine, tolbutamide and chlorzoxazone was increased and consequently, their plasma levels
were dropped to several folds. The rate of formation of paracetamol, 4-hydroxy tolbutamide
and 6-hydroxy chlorzoxazone from the respective CYP1A2, 2C11 and 2E1 substrates was
increased in liver microsomes, indicating the rise in the CYP enzyme catalytic activity in rats
treated with DHP at low dose given for two weeks. Interestingly, the gene expression study
revealed that the mRNA expression levels of CYP1A2, 2C11 and 2E1 were clearly enhanced
to varying degrees, which were consistent with the outcomes of in vivo pharmacokinetic and
1
8

in vitro microsomal studies. Furthermore, at high dose (72 mg/kg) given for seven days, the
effect of DHP was observed only on CYP1A2 and 2C11. But, after fourteen days treatment
with the high dose DHP had accelerated the activities and mRNA levels of CYP1A2, 2C11,
2
D2 and 2E1. Hence, DHP has the potential to induce rat CYP1A2, 2C11, 2D2 and 2E1 in a
dose- and time-dependent manner. On the other hand, CYP3A which represents the major
isoenzyme in the liver [44, 45] and responsible for metabolism of vast array of xenobiotics,
was not significantly affected by DHP as reflected from pharmacokinetic parameters of
dapsone, the rate of 1-hydroxy midazolam formation and the mRNA expression level of
CYP3A1 in control and DHP-treated rats. Also, it was found that DHP and its metabolites
were completely eliminated from rats demonstrating the absence of accumulation when CYP
substrates were administered. Hence, the possibility of competition between DHP and
dapsone and/or other CYP substrates could be ruled out, which was confirmed by
insignificant alteration of AUC, Cmax and CL of dapsone in DHP treated rats compared to
those of control rats. Thus, it is speculated that a typical dose of DHP is unlikely to have
clinically relevant effects on the pharmacokinetic disposition of drugs primarily dependent on
CYP3A pathways for metabolism.
Based on the findings, it is anticipated that the prolonged treatment with DHP could induce
CYP1A2, 2C9, 2D6 and 2E1 in humans which leads to a reduction in concentration of
concomitant drug in the blood due to increased metabolism and makes it hard to achieve the
therapeutic effect at target site. Enzyme induction may also result in increased toxicity if the
metabolites formed during biotransformation are chemically reactive. The clinical
significance of a metabolic drug interaction will depend on the magnitude of the change in
the concentration of active species (parent drug and/or metabolites) at the site of
pharmacological action and the therapeutic index of the drug. The smaller the difference
between toxicity and efficacy, the greater the likelihood that a drug interaction will have
1
9

serious clinical consequences [46]. Numerous studies demonstrated that the induction of drug
metabolizing enzymes contributes to approximately 30% of drug interactions [35]. Thus, the
modulating effects described herein might have substantial clinical consequences for the
evaluation of potential risk of drug interactions with DHP. Knowledge about the effect of
induction on CYPs by DHP could guide clinical co-administration of drugs reasonably well,
and prevent therapeutic failure due to decrease in subtherapeutic drug concentrations or
toxicological implications due to higher levels of a toxic metabolite [47, 48].
5
. Conclusion
In conclusion, the current investigation provides ample scientific evidences that DHP up-
regulate the activities and expression of CYP1A2, 2C11, 2D2 and 2E1 in rats. Hence, we
could not disregard that the co-medication of DHP with drugs metabolized by human
CYP1A2, CYP2C9, CYP2D6 and CYP2E1 may induce metabolism of these drugs and alters
the plasma levels of these drugs, thereby leading to relevant drug-DHP interactions.
However, the insignificant effect of DHP on CYP3A1 implies that there could be no
clinically relevant drug-DHP interactions between the drugs metabolized by human CYP3A4
and DHP when both are administered concomitantly. These findings provide a safety
reminder for precautious co-administration of DHP and the drugs metabolized by CYP1A2,
CYP2C9, CYP2D6 and CYP2E1. Further studies in human in vitro systems are ongoing in
our research laboratory to delineate the clinical relevance of DHP-mediated impact on CYP
enzymes. Our results may serve as a valuable tool to provide a basis for the prediction of
clinical drug-drug interactions observed during early/late drug development process. Besides,
these findings may provide the rational basis for the selection of suitable antihyperlipidemic
drugs in the development of combination therapy with DHP for the treatment of
hyperlipidemia.
2
0

6
. Conflict of interest
There is no potential conflict of interest.
7
. Acknowledgements
We are thankful to project BSC0102 and The Director, CDRI, for providing facilities and
infrastructure for the study. Authors (Rachumallu Ramakrishna, Manisha Bhateria and Rajbir
Singh) are also thankful to the Council of Scientific and Innovative Research (CSIR) for
providing fellowship. CSIR-CDRI communication number for this manuscript is.
2
1

8
. References
[
1] R. Pratap, R.C. Gupta, R. Chander, A.K. Khanna, A.K. Srivastava, D. Raina, S. Singh, S. Srivastava,
A.K. Rastogi, O.P. Asthana, Method of treating hyperlipidemic and hyperglycemic conditions in
mammals using pregnadienols and pregnadienones, Google Patents, 2005.
[
2] R. Pratap, R. Gupta, R. Chander, A. Khanna, A. Srivastava, Medicaments for hyperlipidemic and
hyperglycemic conditions, Eur Pat EP, 1020191 (2000).
3] N. TAGAWA, K. SAIKI, Y. KOBAYASHI, Development of an enzyme immunoassay for serum 16-
dehydropregnenolone, Biological and Pharmaceutical Bulletin, 24 (2001) 867-871.
4] J. Wu, C. Xia, J. Meier, S. Li, X. Hu, D.S. Lala, The hypolipidemic natural product guggulsterone acts
as an antagonist of the bile acid receptor, Molecular Endocrinology, 16 (2002) 1590-1597.
5] R. Pratap, R. Gupta, R. Chander, A. Khanna, V. Singh, O. Asthana, S. Nityanand, S. Dev, N. Anand,
β-Hydroxy-5, 16-pregnadien-20-one exhibits both hypolipidemic and hypoglycemic activities,
CURRENT SCIENCE, 108 (2015) 1634-1646.
6] A.K. Verma, P. Khemaria, J. Gupta, D.P. Singh, B.S. Joshi, R. Roy, A.K. Mishra, R. Pratap, Bio-
transformation of FXR antagonist CDRI 80/574, Arkivoc, 9 (2010) 1-11.
7] Z. Deng, X. Wang, F. Wang, Z. Qin, Y. Cui, Y. Sun, L. Sun, Pharmacokinetics and tissue distribution
[
[
[
3
[
[
study of 16-dehydropregnenolone liposome in female mice after intravenous administration, Drug
Delivery, (2015) 1-9.
[
8] S. Yin, Y. Cheng, T. Li, M. Dong, H. Zhao, G. Liu, Effects of notoginsenoside R1 on CYP1A2,
CYP2C11, CYP2D1, and CYP3A1/2 activities in rats by cocktail probe drugs, Pharmaceutical biology,
(
[
2015) 1-6.
9] C. Mekjaruskul, M. Jay, B. Sripanidkulchai, Modulatory effects of Kaempferia parviflora extract on
mouse hepatic cytochrome P450 enzymes, Journal of ethnopharmacology, 141 (2012) 831-839.
10] S. Singh, N. Mehrotra, S. Sabarinath, R. Gupta, HPLC-UV method development and validation for
6-dehydropregnenolone, a novel oral hypolipidaemic agent, in rat biological matrices for
application to pharmacokinetic studies, Journal of pharmaceutical and biomedical analysis, 33 (2003)
55-764.
11] S. Suryawanshi, S. Singh, R. Gupta, A sensitive and selective HPLC/ESI-MS/MS assay for the
[
1
7
[
simultaneous quantification of 16-dehydropregnenolone and its major metabolites in rabbit plasma,
Journal of Chromatography B, 830 (2006) 54-63.
[
12] S. Suryawanshi, R.C. Gupta, S.K. Singh, Preclinical pharmacokinetics, dose proportionality,
gender difference and protein binding study of 16‐dehydropregnenolone, an antihyperlipidemic
agent, in rats, Journal of Pharmacy and Pharmacology, 63 (2011) 41-48.
[
13] D. Kumar, A.K. Khanna, R. Pratap, J.K. Sexana, R.S. Bhatta, Dose escalation pharmacokinetics and
lipid lowering activity of a novel farnesoid X receptor modulator: 16-Dehydropregnenolone, Indian
journal of pharmacology, 44 (2012) 57.
[
14] A. Zacharová, M. Šiller, A. Špicáková, E. Anzenbacherová, N. Škottová, P. Anzenbacher, R.
Vecera, Rosuvastatin suppresses the liver microsomal CYP2C11 and CYP2C6 expression in male
Wistar rats, Xenobiotica, 42 (2012) 731-736.
[
15] P.A. De Smet, Clinical risk management of herb–drug interactions, British journal of clinical
pharmacology, 63 (2007) 258-267.
16] N. Ai, X. Fan, S. Ekins, In silico methods for predicting drug–drug interactions with cytochrome P-
50s, transporters and beyond, Advanced drug delivery reviews, (2015).
17] M. Martignoni, G.M. Groothuis, R. de Kanter, Species differences between mouse, rat, dog,
monkey and human CYP-mediated drug metabolism, inhibition and induction, (2006).
18] S.J. Baldwin, J.L. Bramhall, C.A. Ashby, L. Yue, P.R. Murdock, S.R. Hood, A.D. Ayrton, S.E. Clarke,
[
4
[
[
Cytochrome P450 gene induction in rats ex vivo assessed by quantitative real-time reverse
transcriptase-polymerase chain reaction (TaqMan), Drug metabolism and disposition, 34 (2006)
1
063-1069.
2
2

[
19] Y. Zhou, S. Wang, T. Ding, M. Chen, L. Wang, M. Wu, G. Hu, X. Lu, Evaluation of the effect of
apatinib (YN968D1) on cytochrome P450 enzymes with cocktail probe drugs in rats by UPLC–MS/MS,
Journal of Chromatography B, 973 (2014) 68-75.
[
20] R.-a. Xu, Z.-s. Xu, R.-s. Ge, Effects of hydroxysafflor yellow A on the activity and mRNA
expression of four CYP isozymes in rats, Journal of ethnopharmacology, 151 (2014) 1141-1146.
21] O. Videau, S. Pitarque, S. Troncale, P. Hery, E. Thévenot, M. Delaforge, H. Bénech, Can a cocktail
[
designed for phenotyping pharmacokinetics and metabolism enzymes in human be used efficiently
in rat?, Xenobiotica, 42 (2012) 349-354.
[
22] T. Geng, H. Si, D. Kang, Y. Li, W. Huang, G. Ding, Z. Wang, Y.a. Bi, H. Zhang, W. Xiao, Influences of
RE Du Ning injection, a traditional Chinese medicine injection, on the CYP450 activities in rats using a
cocktail method, Journal of ethnopharmacology, 174 (2015) 426-436.
[
23] Y.L. Teo, H.K. Ho, A. Chan, Metabolism‐related pharmacokinetic drug− drug interactions with
tyrosine kinase inhibitors: current understanding, challenges and recommendations, British journal
of clinical pharmacology, 79 (2015) 241-253.
[
24] A.S. Brown, Use of combination therapy for dyslipidemia: a lipid clinic approach, The American
journal of cardiology, 90 (2002) 44-49.
25] M. Igel, T. Sudhop, K. Von Bergmann, Metabolism and drug interactions of 3-hydroxy-3-
methylglutaryl coenzyme A-reductase inhibitors (statins), European journal of clinical pharmacology,
7 (2001) 357-364.
26] T.E. Godfrey, L.A. Kelly, Development of quantitative reverse transcriptase PCR assays for
measuring gene expression, Molecular Toxicology Protocols, Springer2005, pp. 423-445.
27] W. Lin, J. Zhang, X. Ling, N. Yu, J. Li, H. Yang, R. Li, J. Cui, Evaluation of the effect of TM208 on
[
5
[
[
the activity of five cytochrome P450 enzymes using on-line solid-phase extraction HPLC–DAD: A
cocktail approach, Journal of Chromatography B, 923 (2013) 29-36.
[
28] T. Su, C. Mao, F. Yin, Z. Yu, Y. Lin, Y. Song, T. Lu, Effects of unprocessed versus vinegar-processed
Schisandra chinensis on the activity and mRNA expression of CYP1A2, CYP2E1 and CYP3A4 enzymes
in rats, Journal of ethnopharmacology, 146 (2013) 734-743.
[
29] R. Ramakrishna, S. kumar Puttrevu, M. Bhateria, V. Bala, V.L. Sharma, R.S. Bhatta, Simultaneous
determination of azilsartan and chlorthalidone in rat and human plasma by liquid chromatography-
electrospray tandem mass spectrometry, Journal of Chromatography B, 990 (2015) 185-197.
[
30] R. Singh, J. Panduri, D. Kumar, D. Kumar, H. Chandsana, R. Ramakrishna, R.S. Bhatta, Evaluation
of memory enhancing clinically available standardized extract of Bacopa monniera on P-glycoprotein
and cytochrome P450 3A in Sprague-Dawley rats, PloS one, 8 (2013) e72517.
[
31] O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall, Protein measurement with the Folin phenol
reagent, J biol Chem, 193 (1951) 265-275.
32] J. Yan, X. He, S. Feng, Y. Zhai, Y. Ma, S. Liang, C. Jin, Up-regulation on cytochromes P450 in rat
[
mediated by total alkaloid extract from Corydalis yanhusuo, BMC complementary and alternative
medicine, 14 (2014) 306.
[
33] C.Z. Qin, X. Ren, Z.R. Tan, Y. Chen, J.Y. Yin, J. Yu, J. Qu, H.H. Zhou, Z.Q. Liu, A high‐throughput
inhibition screening of major human cytochrome P450 enzymes using an in vitro cocktail and liquid
chromatography–tandem mass spectrometry, Biomedical Chromatography, 28 (2014) 197-203.
[
34] R. Yuan, S. Madani, X.-X. Wei, K. Reynolds, S.-M. Huang, Evaluation of cytochrome P450 probe
substrates commonly used by the pharmaceutical industry to study in vitro drug interactions, Drug
metabolism and disposition, 30 (2002) 1311-1319.
[
35] B. Wang, S. Yang, J. Hu, Y. Li, Multifaceted interaction of the traditional Chinese medicinal herb
Schisandra chinensis with cytochrome P450-mediated drug metabolism in rats, Journal of
ethnopharmacology, 155 (2014) 1473-1482.
[
36] L. DFV, Cytochrome P450Substrate specificity and metabolism. Cytochromes P450: structure,
function, and mechanism, Bristol: Taylor & Francis1996.
37] Food, D. Administration, Drug Interaction Studies-Study Design, Data Analysis, and Implications
for Dosing and Labeling, Guidance for industry (draft), (2006).
[
2
3

[
38] M. Yao, M. Zhu, M.W. Sinz, H. Zhang, W.G. Humphreys, A.D. Rodrigues, R. Dai, Development
and full validation of six inhibition assays for five major cytochrome P450 enzymes in human liver
microsomes using an automated 96-well microplate incubation format and LC–MS/MS analysis,
Journal of pharmaceutical and biomedical analysis, 44 (2007) 211-223.
[
39] H. Tang, G. Min, B. Ge, Y. Li, X. Liu, S. Jiang, Evaluation of protective effects of Chi-Zhi-Huang
decoction on Phase I drug metabolism of liver injured rats by cocktail probe drugs, Journal of
ethnopharmacology, 117 (2008) 420-426.
[
40] H.-R. Fan, F. He, Q.-S. Li, Y.-R. Huang, G.-L. Wei, S.-H. Xiao, C.-X. Liu, Study on influence of
ginsenoside Re on cytochrome P450 isoforms by cocktail approach using probe drugs, caffeine,
chlorzoxazone, omeprazole and dapsone in rats, Asian Journal of Drug Metabolic and
Pharmacokinetics, 4 (2004) 91-98.
[
41] M. Turpeinen, U. Jouko, J. Jorma, P. Olavi, Multiple P450 substrates in a single run: rapid and
comprehensive in vitro interaction assay, European journal of pharmaceutical sciences, 24 (2005)
23-132.
42] T.D. Bjornsson, J.T. Callaghan, H.J. Einolf, V. Fischer, L. Gan, S. Grimm, J. Kao, S.P. King, G. Miwa,
1
[
L. Ni, The conduct of in vitro and in vivo drug-drug interaction studies: a Pharmaceutical Research
and Manufacturers of America (PhRMA) perspective, Drug metabolism and disposition, 31 (2003)
8
15-832.
[
43] E.A. Dierks, K.R. Stams, H.-K. Lim, G. Cornelius, H. Zhang, S.E. Ball, A method for the
simultaneous evaluation of the activities of seven major human drug-metabolizing cytochrome
P450s using an in vitro cocktail of probe substrates and fast gradient liquid chromatography tandem
mass spectrometry, Drug metabolism and disposition, 29 (2001) 23-29.
[
44] K. Sharma, H. Sangraula, B. Das, D. Badyal, A. Dadhich, Cytochrome P450 and drug interactions,
Indian journal of pharmacology, 34 (2002) 289.
45] R. Singh, J. Panduri, D. Kumar, D. Kumar, H. Chandsana, R. Ramakrishna, R.S. Bhatta, Evaluation
[
of memory enhancing clinically available standardized extract of Bacopa monniera on P-glycoprotein
and cytochrome P450 3A in Sprague-Dawley rats, PloS one, 8 (2013) e72517.
[
46] J.H. Lin, A.Y. Lu, Inhibition and induction of cytochrome P450 and the clinical implications,
Clinical pharmacokinetics, 35 (1998) 361-390.
[
(
[
47] A.A. Izzo, E. Ernst, Interactions between herbal medicines and prescribed drugs, Drugs, 69
2009) 1777-1798.
48] O. Pelkonen, M. Turpeinen, J. Hakkola, P. Honkakoski, J. Hukkanen, H. Raunio, Inhibition and
induction of human cytochrome P450 enzymes: current status, Archives of toxicology, 82 (2008)
6
67-715.
2
4

Fig. 1.: Chemical structure of 16-dehydropregnenolone
Fig. 2.: Mean plasma concentration-time profiles of caffeine (a); tolbutamide (b);
dextromethorphan (c); chlorzoxazone (d); dapsone (e) in SD rats. VCG: vehicle control
group; L-1W: low dose (36 mg/kg) given for 1 week; H-1W: high dose (72 mg/kg) given for
1
week; L-2W: low dose (36 mg/kg) given for 2 weeks; H-2W: high dose (72 mg/kg) given
for 2 weeks. Error bars represent SEM (n=5).
2
5

Fig. 3.: Changes in liver microsomal CYP activities in rats administered with DHP. VCG:
vehicle control group; L-1W: low dose (36 mg/kg) given for 1 week; H-1W: high dose (72
mg/kg) given for 1 week; L-2W: low dose (36 mg/kg) given for 2 weeks; H-2W: high dose
(72 mg/kg) given for 2 weeks. Phenacetin O-deethylation (CYP1A2) (a); diclofenac 4-
hydroxylation (CYP2C11) (b); dextromethorphan O-demethylation (CYP2D2) (c);
chlorzoxazone 6-hydroxylation (CYP2E1) (d); midazolam 1-hydroxylation (CYP3A1) (e).
*
**
Results are expressed in mean ± SEM (n=5). Significantly different from VCG, P < 0.05;
significantly different from VCG, P < 0.01 and *** significantly different from VCG, P <
0
.001.
2
6

Fig.4.: Changes in mRNA expression of hepatic CYP1A2 (a); CYP2C11 (b); CYP2D2 (c);
CYP2E1 (d); and CYP3A1 (e) in rats administered with DHP. VCG: vehicle control group;
L-1W: low dose (36 mg/kg) given for 1 week; H-1W: high dose (72 mg/kg) given for 1
week; L-2W: low dose (36 mg/kg) given for 2 weeks; H-2W: high dose (72 mg/kg) given for
*
2
0
weeks. Results are expressed in mean ± SEM (n=5). Significantly different from VCG, P <
.05; ** significantly different from VCG, P < 0.01 and *** significantly different from VCG,
P < 0.001.
2
7

Tables
Table 1: Optimized MS/MS parameters of CYP probe substrates and metabolites.
Compound
MRM Transition
Polarity
DP
CE (eV)
(eV)
DHP
315.1→137.5
195.1→138.0
271.0→91.0
272.2→171.0
167.6→132.0
249.0→156.0
+
+
+
-
55
56
36
53
-52
53
37
19
50
54
-30
16
Caffeine
Tolbutamide
Dextromethorphan
Chlorzoxazone
Dapsone
+
+
Paracetamol
’-hydroxydiclofenac
Dextrorphan
-hydroxychlorzoxazone
’-hydroxymidazolam
152.1→110.0
312.1→230.1
258.2→157.1
183.8→120.0
342.1→324.0
482.1→258.2
336.9→146.0
45
41
61
-35
56
63
21
42
50
-28
26
25
4
+
+
-
+
+
-
6
1
Rosuvastatin (IS1)
Chlorthalidone (IS2)
-58
-32
MRM: multiple reaction monitoring; DP: declustering potential;
CE: collision energy.
2
8

Table 2: Oligonucleotide primers used for real-time RT-PCR.
CYP
Gene accession
no
Forward primer sequence
Reverse primer sequence
1
2
2
A2
C11
D2
NM_012541.3
U33173.1
NM_012730.1
CTACAACTCTGCCAGTCTCCAG
GGAGGAACTGAGGAAGAGCA
GAAGGAGAGCTTTGGAGAGGA
CCTCTCAACACCCAGAACACT
AATGGAGCATATCACATTGCAG
AGAATTGGGATTGCGTTCAG
2
E1
AF061442.1
U09742.1
M17701.1
CTGACTGTCTCCTCATAGAGATGG
ACCCGTCTGGATTCTAAGCA
AGCTGGTCATCAATGGGAAA
TCACAGAAACATTTTCCATTGTGT
TGGAATTATTATGAGCGTTCAGC
ATTTGATGTTAGCGGGATCG
3
A1
GAPDH
2
9