Characterization of a novel marine microbial esterase and its use to make D-methyl lactate

Article abstract of DOI:10.1016/S1872-2067(16)62495-6

A novel marine microbial esterase PHE14 was cloned from the genome of Pseudomonas oryzihabitans HUP022 isolated from the deep sea of the western Pacific Ocean. Esterase PHE14 exhibited very good tolerance to most organic solvents, surfactants and metal ions tested, thus making it a good esterase candidate for organic synthesis that requires an organic solvent, surfactants or metal ions. Esterase PHE14 was utilized as a biocatalyst in the asymmetric synthesis of D-methyl lactate by enzymatic kinetic resolution. D-methyl lactate is a key chiral chemical. Contrary to some previous reports, the addition of an organic solvent and surfactants in the enzymatic reaction did not have a beneficial effect on the kinetic resolution catalyzed by esterase PHE14. Our study is the first report on the preparation of the enantiomerically enriched product D-methyl lactate by enzymatic kinetic resolution. The desired enantiomerically enriched product D-methyl lactate was obtained with a high enantiomeric excess of 99% and yield of 88.7% after process optimization. The deep sea microbial esterase PHE14 is a green biocatalyst with very good potential in asymmetric synthesis in industry and can replace the traditional organic synthesis that causes pollution to the environment.

Full text of DOI:10.1016/S1872-2067(16)62495-6

Chinese Journal of Catalysis 37 (2016) 1396–1402
a v a i l a b l e a t w w w . s c i e n c e d i r e c t . c o m
j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / c h n j c
Article
Characterization of a novel marine microbial esterase and its use to
make D‐methyl lactate
Yilong Wang a,b, Yun Zhang a,c, Aijun Sun a,c, Yunfeng Hu a,c,d,
*
a Key Laboratory of Tropical Marine Bio‐resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou
510301, Guangdong, China
b University of Chinese Academy of Sciences, Beijing 100049, China
c Guangdong Key Laboratory of Marine Materia Medica, South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou 510301,
Guangdong, China
d South China Sea Bio‐Resource Exploitation and Utilization Collaborative Innovation Center, Guangzhou 510275, Guangdong, China
A R T I C L E I N F O
A B S T R A C T
Article history:
A novel marine microbial esterase PHE14 was cloned from the genome of Pseudomonas oryzihabit‐
ans HUP022 isolated from the deep sea of the western Pacific Ocean. Esterase PHE14 exhibited very
good tolerance to most organic solvents, surfactants and metal ions tested, thus making it a good
esterase candidate for organic synthesis that requires an organic solvent, surfactants or metal ions.
Esterase PHE14 was utilized as a biocatalyst in the asymmetric synthesis of D‐methyl lactate by
enzymatic kinetic resolution. D‐methyl lactate is a key chiral chemical. Contrary to some previous
reports, the addition of an organic solvent and surfactants in the enzymatic reaction did not have a
beneficial effect on the kinetic resolution catalyzed by esterase PHE14. Our study is the first report
on the preparation of the enantiomerically enriched product D‐methyl lactate by enzymatic kinetic
resolution. The desired enantiomerically enriched product D‐methyl lactate was obtained with a
high enantiomeric excess of 99% and yield of 88.7% after process optimization. The deep sea mi‐
crobial esterase PHE14 is a green biocatalyst with very good potential in asymmetric synthesis in
industry and can replace the traditional organic synthesis that causes pollution to the environment.
© 2016, Dalian Institute of Chemical Physics, Chinese Academy of Sciences.
Received 25 May 2016
Accepted 22 June 2016
Published 5 August 2016
Keywords:
Esterase
Marine microorganism
Biocatalysis
Kinetic resolution
D‐methyl lactate
Hydrolysis
Published by Elsevier B.V. All rights reserved.
1. Introduction
Chiral α‐hydroxy acids, e.g. chiral lactic acid, are important
building blocks in the synthesis of many drugs, pesticides and
The enantiomers of drugs have dramatically different bio‐
logical activities and toxicities. Chiral drugs are more clinically
acceptable as they reduce the potential toxicity of racemic
drugs. Chiral intermediates are crucial building blocks for the
synthesis of valuable chiral drugs and the synthesis of the chiral
intermediates of drugs is important in the pharmaceutical in‐
dustry [1–3].
polymers [4,5]. The preparation of chiral lactic acid is of great
importance in both the pharmaceutical and material industries.
The synthesis of chiral chemicals like chiral lactic acid is not
easily achieved by traditional organic synthesis due to the low
enantio‐selectivity of traditional metallic organic synthesis [5].
The synthesis of enantiomerically enriched chemicals can
also be achieved by biocatalytic methods using enzymes, which
* Corresponding author. Tel: +86‐20‐89024092; Fax: +86‐20‐84451672; E‐mail: yunfeng.hu@scsio.ac.cn
This work was supported by the Strategic Priority Research Program of the Chinese Academy of Sciences (XDA11030404), the National Natural Sci‐
ence Foundation of China (21302199), Guangzhou Science and Technology Plan Projects (201510010012) and Key Project from the Chinese Acade‐
my of Sciences (KGZD‐EW‐606).
DOI: 10.1016/S1872‐2067(16)62495‐6 | http://www.sciencedirect.com/science/journal/18722067 | Chin. J. Catal., Vol. 37, No. 8, August 2016

Yilong Wang et al. / Chinese Journal of Catalysis 37 (2016) 1396–1402
1397
avoid the harsh working conditions and pollution by metallic
2.3. Expression and purification of PHE14
organic synthesis [6,7]. Due to the existence of one hydroxy
group and one acid group in lactic acid, the synthesis of enan‐
tiomerically enriched lactic acid can be accomplished by the
asymmetric reduction of ketone precursors using dehydrogen‐
ases. However, the biocatalytic method using dehydrogenases
require expensive co‐factors such as NADH and NADPH [8].
Another biocatalytic method is by asymmetric hydrolysis of
racemic esters using esterases or lipases. L‐lactic acid is not
expensive because currently L‐lactic acid can be directly ob‐
tained using large scale fermentation instead of an organic or
enzymatic method [9,10]. D‐lactic acid, which is a chiral chem‐
ical of great demand in industry, cannot be directly obtained
using the inexpensive fermentation method and is thus more
expensive [4]. Biocatalytic methods are the major methods for
the preparation of D‐lactic acid and its ester derivatives with
high enantiomeric excess.
Here, we identified a novel marine microbial esterase,
PHE14, from the deep seas of the western Pacific Ocean and
characterized its functionalities. We also utilized esterase
PHE14 as a biocatalyst for the enzymatic synthesis of D‐methyl
lactate. The desired chiral product D‐methyl lactate was ob‐
tained with high enantiomeric excess and yield after process
optimization.
The E. coli and recombinant E. coli strains were incubated at
37 °C and 200 r/min in Luria‐Bertani medium (recombinant
strains with 50 μg/mL kanamycin). As the cell density reached
a
turbidity of 0.6 at 600 nm, 0.3 mmol/L isopro‐
pyl‐beta‐D‐thiogalactopyranoside (IPTG) was added to the
culture for protein induction. After 18 h induction at 20 °C, the
cells were harvested by centrifugation at 7500 r/min for 10
min, washed with phosphate buffer (50 mmol/L, pH 7.5) two
times and then re‐suspended in the same buffer. The cells were
disrupted by sonication on ice for 10 min and centrifuged
(11500 r/min, 20 min, 4 °C ). The recombinant protein PHE14
was purified and desalted using nickel‐nitrilotriacetic acid
agarose resin (GE Healthcare Life Science, China) and PD‐10
desalting columns (GE Healthcare Life Sciences, China) accord‐
ing to the manufacturer’s instructions. The protein concentra‐
tion was measured by the method of Bradford, with bovine
serum albumin as the standard. Purified PHE14 was examined
by sodium dodecyl sulfate‐polyacrylamide gel electrophoresis
(SDS‐PAGE) under denaturing conditions.
2.4. Enzyme assay
The hydrolytic activity of PHE14 was measured at 405 nm
using the assay procedure described by Deng et al [11]. A
standard reaction system containing 10‐µL substrate (10
mmol/L, dissolved in acetonitrile), 10‐µL (0.8 µg/µL) enzyme,
940‐µL phosphate buffer (50 mmol/L, pH 7.5), and 40‐µL eth‐
anol was incubated at 35 °C for 5 min. The esterase activity was
analyzed by detecting the absorbance of p‐NP at 405 nm. One
unit of enzyme activity was defined as the amount of esterase
that liberated 1 μmol of p‐NP per minute.
2. Experimental
2.1. Microorganisms and reagents
E.coli DH5α and E.coli BL21 (DE3) were used as the host
strains for gene cloning and protein expression, respectively.
Plasmid pET‐28a (+) (Novagen, USA) was used as the expres‐
sion vector of the enzymes. TransStart® FastPfu DNA Poly‐
Merase, ligases and restriction enzymes were all purchased
from TransGen Biotech (Beijing, China). p‐nitrophenyl (p‐NP)
esters were obtained from Sigma (St. Louis, MO, USA). Racemic
methyl lactate and the corresponding chiral enantiomers were
all purchased from Aladdin Industrial Corporation (Shanghai,
China). Other chemicals were analytical grade.
2.5. Biochemical characterization of purified PHE14
The substrate specificity was determined using different
substrates (p‐NP C2‐C10) under standard reaction conditions.
The optimum pH for PHE14 was determined using p‐PN ace‐
tate (C2) as the substrate in different pH ranges: 50 mmol/L
NaAc/HAc (pH 5.0–6.0), 50 mmol/L Na2HPO4/NaH2PO4 (pH
6.5–8.0), 50 mmol/L Tris/HCl (pH 8.5–9.0) and 50 mmol/L
Glycine/NaOH (pH 9.5–10.0). The pH stability was character‐
ized by incubating purified PHE14 at 4 °C for 12 h in the buffer
with different pH values. The optimum temperature was
measured for the temperature range of 20 to 70 °C under the
optimal pH value. The thermo‐stability was measured by incu‐
bating PHE14 at different temperatures (from 20 to 60 °C) for
different times (0–60 min) using p‐PN acetate (C2) as the sub‐
strate under optimal pH value. The effect of metal ions (Li+, Na+,
K+, Mg2+, Ca2+, Fe2+, Ni2+, Mn2+ ) on the activity of PHE14 was
determined by incubating PHE14 in the presence of the metal
ions (1 mmol/L) for 12 h at 4 °C. The effects of different organic
solvents and surfactants were investigated in the presence of
thirteen different organic solvents (10%, v/v)and four different
surfactants (1%) by incubating PHE14 for 12 h at 4 °C. The
effect of salt concentration on PHE14 activity was studied by
2.2. Gene cloning and expression vector construction
The strain Pseudomonas oryzihabitans HUP022 was isolated
from the sediments obtained from the deep sea of the western
Pacific Ocean. The sequencing of the whole genome of Pseudo‐
monas oryzihabitans HUP022 was completed by Genewiz Inc.
The coding DNA sequence of an esterase (named PHE14) was
amplified from the genomic DNA of Pseudomonas oryzihabitans
HUP022 with
CACGAATTCGTGCTGGAATCGCCTAGC‐3′,
a
pair of primers (forward: 5′‐
reverse: 5′‐
CCGCTCGAGTTATTTTTTGCCGAGACGTGCC‐3′). The primer
sequences contained the EcoR I and Xho I (underlined) re‐
striction sites. The PCR products were cloned into the EcoR I
and Xho I sites of the expression vector pET‐28a (+). Recombi‐
nant plasmids were confirmed by sequencing from Majorbio
Ltd. (Shanghai, China) and then transformed into E. coli BL21
(DE3) according to standard protocols.

1398
Yilong Wang et al. / Chinese Journal of Catalysis 37 (2016) 1396–1402
adding NaCl (0.2 to 4 mol/L) into the incubation mixture and
measuring the enzymatic activity after pre‐incubation at 4 °C
for 12 h. Kinetic parameters were determined from a Lin‐
eweaver‐Burk plot under the optimal reaction conditions.
ans HUP022, a marine microorganism identified from the deep
sea of the western Pacific Ocean (the sequence of gene PHE14
has been deposited in GenBank with the accession no.
KX397626). The protein sequence alignment with microbial
esterases revealed that enzyme PHE14 exhibited its maximum
identity with a putative esterase (WP_017639130.1) from
Pseudomonas sp. 313 (96%) and with a putative esterase
(WP_007161882.1) from Pseudomonas psychrotolerans (96%).
The functions of these putative esterases have not been char‐
acterized before. In addition, the protein sequence analysis
showed that PHE14 belonged to the α/β hydrolase family with
the conserved signature (Gly‐X‐Ser‐X‐Gly) in the ORF. The three
dimensional structure of PHE14 consists of five β strands and
five α helices, and revealed that its catalytic triad is formed by
the three residues (Ser110, Asp162, and His193) located at the C
terminal of the main parallel β sheet. This was consistent with
previous esterase sequence information with Ser110 being part
of the characteristic Gly‐X‐Ser‐X‐Gly sequence [12,13]. Thus,
Ser110, Asp162, and His193 are indispensable amino acid residues
in the biochemical characterization of PHE14.
2.6. Optical resolution of racemic methyl lactate by PHE14
A standard 500‐µL hydrolytic reaction system containing
140 μg purified esterase PHE14, 50 mmol/L substrate (racemic
methyl lactate) and 50 mmol/L phosphate buffer (pH 7.5) was
incubated at 37 °C for 1 h. After the completion of the enzymat‐
ic reaction, reaction samples were extracted with an equal
volume of ethyl acetate and the organic phase was further ana‐
lyzed to evaluate the enzymatic resolution of (±)‐methyl lac‐
tate.
2.6.1. Gas chromatography analysis
The enantiomeric excess of the reaction product was ana‐
lyzed by GC (FULI GC‐9700II) equipped with a H2 flame ioniza‐
tion detector and a 112‐6632 CYCLOSIL‐B chiral capillary col‐
umn (30 m × 0.25 mm ID, 0.25 μm df).
3.2. Expression and purification of PHE14
2.6.2. Optimization of the kinetic resolution of (±)‐methyl
lactate by esterase PHE14
PHE14 was purified by Ni‐NTA affinity chromatography.
The nominal molecular weight and pI of PHE14 were calculated
to be 28 kDa and 4.94 by http://web.expasy.org/compute_pi/.
A series of enzymatic reactions were carried out at different
pH ranging from 6 to 11 for 1 h to determine the optimal pH for
the resolution of (±)‐methyl lactate. The effect of temperature
on the resolution of (±)‐methyl lactate was carried out at dif‐
ferent temperatures ranging from 25 to 45 °C for 1 h. Under the
optimum pH value and temperature, eleven different organic
solvents(10%, v/v)and four surfactants (0.01%) were used as
the reaction solvent to investigate the effect of the organic sol‐
vent and surfactant on the enzymatic reaction. Reactions with‐
out adding an organic solvent and surfactant were carried out
as a control. (±)‐Methyl lactate of different concentrations
(from 0.09 to 0.15 mol/L) was employed to determine the ef‐
fect of the substrate concentration on the kinetic resolution of
(±)‐methyl lactate. Purified PHE14 was added to the reaction at
final concentrations ranging from 1.31 × 104 to 6.55 × 104 U/L
to study the effect of enzyme concentration on the kinetic res‐
olution of (±)‐methyl lactate. Under the optimum reaction con‐
ditions, with 0.14 mg purified enzyme and 60 mmol/L sub‐
strate (±)‐methyl lactate in the reaction, the product of the en‐
zymatic reaction was regularly monitored at different times to
study the effect of reaction time on the enantiomeric excess of
the residual methyl lactate. All the products were analyzed by
chiral GC to determine the conversion of (±)‐methyl lactate.
3.3. Biochemical characterization of PHE14
3.3.1. Substrate specificity of PHE14
p‐PN acetate (C2) was the preferred substrate for hydrolysis
and referenced as 100% relative activity. However, PHE14
displayed low activity for C8 and C10 substrates.
3.3.2. Effect of pH on the activity of PHE14
The effect of pH on the PHE14 activity was measured over a
pH range of 6.0–10.0 with p‐PN acetate (C2) as the substrate.
The optimal pH for the hydrolytic activity of esterase PHE14
was 9.0. The stability of PHE14 versus pH was studied after
incubating PHE14 with different pH values ( pH 6.0–10.0 ) for
12 h. Its activity was almost unchanged. The results showed
PHE14 exhibited high activity and stability in a buffer of vari‐
ous pH values.
3.3.3. Effect of temperature on the activity of PHE14
PHE14 exhibited its highest hydrolytic activity at 60 °C. The
thermal stability of PHE14 versus temperature was studied
after incubating PHE14 at different temperatures (20–60 °C)
for different times (0–60 min). PHE14 exhibited its highest
activity and stability at 35 °C. It could retain (85.6±0.7)% of its
maximum activities after incubation at 35 °C for 1 h. The stabil‐
ity of PHE14 decreased rapidly when the temperature was over
40 °C.
3. Results and discussion
3.1. Sequence analysis of PHE14
The sequence analysis showed that the gene PHE14 encod‐
ed a protein composed of 214 amino acids without a signal
peptide. Secretion signal was predicted by the SignalP 4.0 pre‐
diction tool from http://www.cbs.dtu.dk/services/SignalP/.
The gene PHE14 was cloned from the genome of P. oryzihabit‐
3.3.4. Effect of organic solvent and surfactant on the activity of
PHE14
The esterase PHE14 was studied by incubating PHE21 in the

Yilong Wang et al. / Chinese Journal of Catalysis 37 (2016) 1396–1402
1399
presence of different organic solvents(10%, v/v)and different
110
100
90
80
70
60
50
40
30
20
10
0
surfactants (1%) for 12 h at 4 °C. The results showed that al‐
most all the tested organic solvents and surfactants exhibited a
positive effect on the hydrolysis activity of PHE14. Notably, the
presence of dichlormethane and n‐heptane (10%, v/v) greatly
promoted the hydrolysis activity of PHE14 with residual activi‐
ties being (136.2 ± 4.5)% and (137.8 ± 5.8)%, respectively.
ee
Conversion
3.3.5. Effect of metal ions on the activity of PHE14
The effect of various metal ions on the activity of esterase
PHE14 was determined by incubating PHE14 in the presence of
different metal ions (1 mmol/L) for 12 h at 4 °C. The results
indicated that most tested metal ions had no obvious effect on
PHE14 except for Co2+ ((50.9±1.0)%) and Zn2+ ((45.7±2.3)%).
The results indicated that PHE14 was a robust esterase with
strong resistance to metal ions.
15
20
25
30
35
40
45
50
Temperature (oC)
Fig. 2. Effect of temperature on the kinetic resolution of (±)‐methyl
lactate.
The effect of pH and temperature on the kinetic resolution
of (±)‐methyl lactate by esterase PHE14 is shown in Fig. 1 and
Fig. 2. The optimum reaction pH for the highest ees was pH 9.0,
with the ees being 95%. However, the ees and conversion de‐
creased dramatically when the pH values were below or over
9.0. The optimum reaction temperature for the highest ees was
30 °C, with ees and yield being over 96% and 85.2%, respec‐
tively. These results indicated that both the stereo‐selectivity
and catalytic activity were affected by the pH and temperature.
In particular, the state of the active center of the enzyme, state
of the substrate, and stability of the enzymes were all affected
by pH and temperature.
3.3.6. Effect of NaCl concentration on the activity of PHE14
Since the host of PHE14 was isolated from a marine envi‐
ronment, the tolerance of PHE14 to salt was tested by measur‐
ing the residual activity after incubation in solution containing
0.2 to 5 mol/L NaCl for 12 h. The results showed that the addi‐
tion of 0.2 to 1 mol/L NaCl increased the hydrolysis activity of
PHE14. Furthermore, the hydrolysis activity of PHE14 retained
more than 70% of its initial activity in the presence of 4 mol/L
NaCl. The results indicated that PHE14 was a salt‐tolerant es‐
terase.
3.3.7. Kinetic analysis of PHE14
The kinetic analysis of PHE14 was performed using p‐NP
esters (C2–C8) as the substrates. The Km value for p‐NP C2 was
the highest and the Km values for short chain p‐PN esters
(C2–C4) were higher than those of long chain p‐PN esters
(C6–C8). So PHE14 was further confirmed to be an esterase and
not a lipase.
3.4.2. Effect of organic solvent and surfactant on the kinetic
resolution of (±)‐methyl lactate
Almost all the tested organic solvents and surfactants de‐
creased both the ees and conversion, thus inhibiting the kinetic
resolution of (±)‐methyl lactate by esterase PHE14 (Table 1).
Thus, no organic solvent or surfactant was added to the enzy‐
matic reactions for the further optimization of the kinetic reso‐
lution of (±)‐methyl lactate by esterase PHE14.
3.4. Kinetic resolution of racemic methyl lactate by esterase
PHE14
3.4.1. Effect of pH and temperature on the kinetic resolution of
(±)‐methyl lactate
Table 1
Effect of organic solvent and surfactant on the kinetic resolution of
(±)‐methyl lactate.
Organic solvents
Control
n‐Hexane
Cyclohexane
n‐Heptane
n‐Decane
DMF
Acetonitrile
Isooctane
ee (%)
Conversion (%)
110
ee
96 ± 1.2
52 ± 1.6
90 ± 0.9
93 ± 1.7
90 ± 0.8
56 ± 0.5
45 ± 1.2
90 ± 0.5
66 ± 0.8
90 ± 1.7
82 ± 0.8
64 ± 1.2
84 ± 1.2
95 ± 0.4
94 ± 0.8
95 ± 1.2
51.1 ± 1.2
29.1 ± 0.7
47.4 ± 0.6
44.2 ± 0.6
56.1 ± 1.2
28.6 ± 0.3
29.5 ± 0.3
41.9 ± 0.7
45.1 ± 0.8
46.0 ± 0.7
39.2 ± 0.6
37.8 ± 0.9
41.4 ± 1.2
54.7 ± 1.5
58.9 ± 1.2
54.7 ± 1.4
100
90
80
70
Conversion
60
50
40
30
20
10
0
Methylbenzene
DMSO
Methanol
Ethanol
Triton X‐100
Tween‐20
Tween‐80
Sodium Tripolyphosphate
5
6
7
8
9
10
11
12
pH
Fig. 1. Effect of pH on the kinetic resolution of (±)‐methyl lactate.

1400
Yilong Wang et al. / Chinese Journal of Catalysis 37 (2016) 1396–1402
3.5. Discussion
110
100
90
80
70
60
50
40
30
20
10
0
We identified and functionally characterized a novel ester‐
ase, PHE14, from the genome of Pseudomonas oryzihabitans
HUP022 isolated from the deep sea of the western Pacific
Ocean. Under standard assay conditions, PHE14 preferred
short chain p‐NP ester substrates, and gave a Km of 0.24 ± 0.06
mmol/L and a specific activity of 293.07 ± 3.24 U/mg for p‐NP
C2. However, PHE14 displayed low activity for C6 and C8 sub‐
strates. The hydrolytic activity of esterase PHE14 was higher
than some other esterases, such as Ls‐LeuDH (183 U/mg) [14],
EM2L8 (156 U/mg) [15] and Est6 (104.41 U/mg ) [16], but
lower than another esterase DAEEst6 (317 U/mg) [11]. The
optimal pH and temperature for the hydrolysis activity of es‐
terase PHE14 were 9.0 and 60 °C, respectively. PHE14 exhibit‐
ed its highest activity and stability at 35 °C, and retained 85.59
± 0.67% of its maximum activity after incubation at 35 °C for 1
h. Similar results were also observed from an esterase EstIM1
from a metagenomic library of mountain soil with 80% residual
activity after heating at 30 °C for 1 h, but it was inactivated
when heated at 40 °C for 40 min [17]. PHE14 was also quite
stable in the presence of multiple organic solvents, surfactants
and metal ions, thus making it a very good esterase candidate
for organic synthesis that requires an organic solvent, surfac‐
tant or metal ion. Similar behavior was observed with other
microbial esterases [18–21]. PHE14 was also characterized to
be a salt‐tolerant microbial esterase. Some other esterases such
as EstKT4, EstKT7, and EstKT9 from the tidal flat sediments of
Ganghwa Island in South Korea kept 40%, 10% and 40% of
their initial activity in the presence of 4 mol/L NaCl [22–24].
Chiral α‐hydroxyl acids are an important class of chiral drug
in the synthesis of a great variety of drugs, pesticides and pol‐
ymers [4,5,9]. Due to the existence of one hydroxyl group and
one acid group in lactic acid, the synthesis of chiral lactic acid
can be achieved by enzymatic kinetic resolution catalyzed by a
biocatalytic method instead of metallic organic synthesis
[7,25,26]. Before our study, the preparation of chiral D‐lactic
acid and its ester derivatives by enzymatic kinetic resolution
was quite rare, probably because the structural difference of
the two parts on the two sides of the ester bond was too small
ee
Conversion
0
0.025
0.05
0.075
0.1
0.125
0.15
Substrate concentrations (mol/L)
Fig. 3. Effect of substrate concentration on the kinetic resolution of
(±)‐methyl lactate.
3.4.3. Effect of substrate concentration and enzyme
concentration on the kinetic resolution of (±)‐methyl lactate
The amounts of substrate and enzyme used for the kinetic
resolution of (±)‐methyl lactate were another two important
factors that affect the conversion and enantio‐selectivity. Fig. 3
and Fig. 4 show that 0.06 mol/L substrate and 0.14 mg enzyme
were the optimum substrate concentration and enzyme con‐
centration for the kinetic resolution of (±)‐methyl lactate by
esterase PHE14, with an ees over 99% and a yield of 86.1%.
3.4.4. Effect of reaction time on the kinetic resolution of
(±)‐methyl lactate
Under the optimum reaction conditions, different reaction
times (from 20 to 120 min) were used to investigate the opti‐
mal reaction time for the kinetic resolution of (±)‐methyl lac‐
tate by PHE14. The results showed that the ees and the yield
reach over 99% and 88.7%, respectively, when the reaction
time was 60 min. The yield of D‐methyl lactate in the reaction
without added PHE14 was set as 100%. However, when the
reaction time was over 60 min, the conversion was higher than
50% (Fig. 5). So, the optimal reaction time for the kinetic of
(±)‐methyl lactate was 60 min.
110
100
110
100
ee
90
ee
90
80
70
60
80
Yield
70
60
50
40
30
20
10
0
Conversion
50
Conversion
40
30
20
10
0
0
5
10
15
20
0
20
40
60
80
100
120
Enzyme concentration (g/L)
Time (min)
Fig. 4. Effect of enzyme concentration on the kinetic resolution of
(±)‐methyl lactate.
Fig. 5. Effect of reaction time on the kinetic resolution of (±)‐methyl
lactate.

Yilong Wang et al. / Chinese Journal of Catalysis 37 (2016) 1396–1402
1401
[5] R. Datta, M. Henry, J. Chem. Technol. Biotechnol., 2006, 81,
1119–1129.
[6] T. H. T. Vu, T. A. Hang, T. H. T. Nguyen, T. T. T. Nguyen, M. H. Do, N.
Q. Bui, N. Essayem, Catal. Lett., 2013, 143, 950–956.
[7] W. Su, Z. Y. Chang, K. L. Gao, D. Z. Wei, Tetrahedron Asymmetry,
2004, 15, 1275–1277.
to be recognized by esterases. PHE14 is a novel marine micro‐
bial esterase which can recognize the chirality of racemic me‐
thyl lactate and generate valuable chiral D‐methyl lactate with
high enantiomeric excess and yield.
4. Conclusions
[8] J. Y. Liang, Y. Zhang, A. J. Sun, D. Deng, Y. F. Hu, Appl. Biochem. Bio‐
technol., 2016, 178, 558–575.
We identified and functionally characterized a novel ester‐
ase, PHE14, from the genome of Pseudomonas oryzihabitans
HUP022 isolated from the deep sea of the western Pacific
Ocean. Esterase PHE14 exhibited very good tolerance to most
organic solvents, surfactants and metal ions tested. Esterase
PHE14 also exhibited high resistance to high concentration
NaCl. Esterase PHE14 was utilized in the enzymatic prepara‐
tion of D‐methyl lactate by kinetic resolution. The desired
product D‐methyl lactate was obtained with an enantiomeric
excess of 99% and a yield of 88.7% after process optimization.
Thus, PHE14 was characterized to possess very good potential
as a biocatalyst for asymmetric synthesis in industry.
[9] S. D. Zhou, T. B. Causey, A. Hasona, K. T. Shanmugam, L. O. Ingram,
Appl. Environ. Microbiol., 2003, 69, 399–407.
[10] K. D. Ma, T. Maeda, H. You, Y. Shirai, Bioresour. Technol., 2014, 151,
28–35.
[11] D. Deng, Y. Zhang, A. J. Sun, J. Y. Liang, Y. F. Hu, Appl. Biochem. Bio‐
technol., 2016, 179, 75–93.
[12] A. Pesaresi, D. Lamba, Biochim. Biophys. Acta, 2005, 1752,
197–201.
[13] K. K. Kim, H. K. Song, D. H. Shin, K. Y. Hwang, S. Choe, O. J. Yoo, S. W.
Suh, Structure, 1997, 5, 1571–1584.
[14] W. J. Zhu, Y. Li, H. H. Jia, P. Wei, H. Zhou, J. Min, Biotechnol. Lett.,
2016, 38, 1–7.
[15] J. E. Choi, M. A. Kwon, H. Y. Na, D. H. Hahm, J. K. Song, Extremo‐
philes, 2013, 17, 1013–1021.
Acknowledgments
[16] X. W. Jiang, X. W. Xu, Y. Y. Huo, Y. H. Wu, X. F. Zhu, X. Q. Zhang, M.
Wu, Arch. Microbiol., 2012, 194, 207–214.
[17] K. C. Ko, S. O. Rim, Y. Han, B. S. Shin, G. J. Kim, J. H. Choi, J. J. Song, J.
Ind. Microbiol. Biotechnol., 2012, 39, 681–689.
[18] N. Nawani, N. S. Dosanjh, J. Kaur, Biotechnol. Lett., 1998, 20,
997–1000.
[19] Y. M. Mohamed, M. A. Ghazy, A. Sayed, A. Ouf, H. El‐Dorry, R. Siam,
Sci. Rep., 2013, 3, 3358.
[20] H. Shao, L. Xu, Y. J. Yan, Int. J. Mol. Sci., 2014, 15, 16885–16910.
[21] M. Belcastro, T. Marino, N. Russo, M. Toscano, J. Mass Spectrom.,
2005, 40, 300–306.
[22] S. S. Bae, Y. J. Kim, S. H. Yang, J. K. Lim, J. H. Jeon, H. S. Lee, S. G.
Kang, S. J. Kim, J. H. Lee, J. Microbiol. Biotechnol., 2006, 16,
1826–1831.
We thank the research vessel KEXUE of the Chinese Acade‐
my of Sciences for collecting samples and WPOS sample center
for providing samples. Constant help from Professor Jianhua Ju
and Professor Changsheng Zhang is also greatly appreciated.
References
[1] R. N. Patel, Coord. Chem. Rev., 2008, 252, 659–701.
[2] R. N. Patel, Curr. Opin. Drug Discov. Dev., 2006, 9, 741–764.
[3] R. N. Patel, Enzyme Microb. Technol., 2002, 31, 804–826.
[4] C. Gao, J. H. Qiu, J. C. Li, C. Q. Ma, H. Z. Tang, P. Xu, Bioresour. Tech‐
nol., 2009, 100, 1878–1880.
[23] X. W. Jiang, Y. Y. Huo, H. Cheng, X. Q. Zhang, X. F. Zhu, M. Wu, Ex‐
Graphical Abstract
Chin. J. Catal., 2016, 37: 1396–1402 doi: 10.1016/S1872‐2067(16)62495‐6
Characterization of a marine microbial esterase and its use to make D‐methyl lactate
Yilong Wang, Yun Zhang, Aijun Sun, Yunfeng Hu *
South China Sea Institute of Oceanology, Chinese Academy of Sciences; University of Chinese Academy of Sciences;
South China Sea Bio‐Resource Exploitation and Utilization Collaborative Innovation Center
D-methyl lactate
ee > 99%
yield> 88%
A novel marine microbial esterase PHE14 identified from the Western Pacific Ocean was functionally characterized and used as a green
biocatalyst in the enzymatic preparation of D‐methyl lactate, a key chiral chemical, with high enantiomeric excess (ee > 99%) and high
yield (> 88%) through kinetic resolutions.

1402
Yilong Wang et al. / Chinese Journal of Catalysis 37 (2016) 1396–1402
tremophiles, 2012, 16, 427–435.
[24] C. D. Santi, L. Ambrosino, P. Tedesco, L. Zhai, C. Zhou, Y. Xue, Y. Ma,
[25] A. J. R. Lasprilla, G. A. R. Martinez, B. H. Lunelli, A. L. Jardini, R. M.
Filho, Biotechnol. Adv., 2012, 30, 321–328.
D. D. Pascale, Biotechnol. Progr., 2015, 31, 890–899.
[26] K. Sakaki, N. Itoh, Biotechnol. Lett., 2003, 25, 1591–1595.