Synthesis and evaluation of [18F]FETLOs and [18F]AMBF3LOS as novel 18F-labelled losartan derivatives for molecular imaging of angiotensin II type 1 receptors

Article abstract of DOI:10.3390/molecules25081872

Losartan is widely used in clinics to treat cardiovascular related diseases by selectively blocking the angiotensin II type 1 receptors (AT₁Rs), which regulate the renin-angiotensin system (RAS). Therefore, monitoring the physiological and pathological biodistribution of AT₁R using positron emission tomography (PET) might be a valuable tool to assess the functionality of RAS. Herein, we describe the synthesis and characterization of two novel losartan derivatives PET tracers, [¹⁸F]fluoroethyl-losartan ([¹⁸F]FEtLos) and [¹⁸F]ammoniomethyltrifluoroborate-losartan ([¹⁸F]AMBF₃Los). [¹⁸F]FEtLos was radiolabeled by ¹⁸F-fluoroalkylation of losartan potassium using the prosthetic group 2-[¹⁸F]fluoroethyl tosylate; whereas [¹⁸F]AMBF₃Los was prepared following an one-step ¹⁸F-¹⁹F isotopic exchange reaction, in an overall yield of 2.7 ± 0.9% and 11 ± 4%, respectively, with high radiochemical purity (>95%). Binding competition assays in AT₁R-expressing membranes showed that AMBF₃Los presented an almost equivalent binding affinity (K_i 7.9 nM) as the cold reference Losartan (K_i 1.5 nM), unlike FEtLos (K_i 2000 nM). In vitro and in vivo assays showed that [¹⁸F]AMBF₃Los displayed a good binding affinity for AT₁R-overexpressing CHO cells and was able to specifically bind to renal AT₁R. Hence, our data demonstrate [¹⁸F]AMBF₃Los as a new tool for PET imaging of AT₁R with possible applications for the diagnosis of cardiovascular, inflammatory and cancer diseases.

Full text of DOI:10.3390/molecules25081872

molecules
Article
Synthesis and Evaluation of [18F]FEtLos and
[18F]AMBF3Los as Novel 18F-Labelled Losartan
Derivatives for Molecular Imaging of Angiotensin II
Type 1 Receptors
Martha Sahylí Ortega Pijeira 1, Paulo Sérgio Gonçalves Nunes 2, Sofia Nascimento dos Santos 1,
Zhengxing Zhang 3, Arian Pérez Nario 1, Efrain Araujo Perini 1, Walter Miguel Turato 4,
Zalua Rodríguez Riera 5, Roger Chammas 6 , Philip H. Elsinga 7, Kuo-Shyan Lin 3
,
Ivone Carvalho 2 and Emerson Soares Bernardes 1,
*
1
Radiopharmacy Center, Nuclear and Energy Research Institute (IPEN/CNEN-SP),
CEP 05508-000 São Paulo, Brazil; msopijeira2015@usp.br (M.S.O.P.); snsantos@usp.br (S.N.d.S.);
apereznario@usp.br (A.P.N.); eaperini@ipen.br (E.A.P.)
School of Pharmaceutical Sciences of Ribeirão Preto, University of São Paulo (FCFRP–USP),
CEP 14040-903 Ribeirão Preto, Brazil; paulosgn@fcfrp.usp.br (P.S.G.N.); carronal@usp.br (I.C.)
Department of Molecular Oncology, BC Cancer Research Centre, Vancouver, BC V5Z 1L3, Canada;
zzhang@bccrc.ca (Z.Z.); klin@bccrc.ca (K.-S.L.)
School of Pharmaceutical Sciences–University of São Paulo-USP, CEP 05508-000 São Paulo, Brazil;
turato@usp.br
Departamento de Radioquímica, Instituto Superior de Tecnologías y Ciencias Aplicadas (InSTEC),
Universidad de La Habana, CP 10400 La Habana, Cuba; zalua@instec.cu
Department of Radiology and Oncology, Faculty of Medicine, University of São Paulo,
CEP 01246903 São Paulo, Brazil; rchammas@usp.br
2
3
4
5
6
7
Department of Nuclear Medicine and Molecular Imaging, University Medical Center Groningen,
University of Groningen, EB79, PO box 30.001, 9700 RB Groningen, The Netherlands; p.h.elsinga@umcg.nl
Correspondence: ebernardes@ipen.br; Tel.: +55-11-3133-9546
*
ꢀꢁꢂꢀꢃꢄꢅꢆꢇ
ꢀꢁꢂꢃꢄꢅꢆ
Received: 16 December 2019; Accepted: 23 January 2020; Published: 18 April 2020
Abstract: Losartan is widely used in clinics to treat cardiovascular related diseases by selectively
blocking the angiotensin II type 1 receptors (AT1Rs), which regulate the renin-angiotensin system
(RAS). Therefore, monitoring the physiological and pathological biodistribution of AT1R using
positron emission tomography (PET) might be a valuable tool to assess the functionality of RAS.
Herein, we describe the synthesis and characterization of two novel losartan derivatives PET
tracers, [18F]fluoroethyl-losartan ([18F]FEtLos) and [18F]ammoniomethyltrifluoroborate-losartan
([18F]AMBF3Los). [18F]FEtLos was radiolabeled by 18F-fluoroalkylation of losartan potassium using
the prosthetic group 2-[18F]fluoroethyl tosylate; whereas [18F]AMBF3Los was prepared following an
one-step 18F-19F isotopic exchange reaction, in an overall yield of 2.7
±
0.9% and 11
±
4%, respectively,
with high radiochemical purity (>95%). Binding competition assays in AT1R-expressing membranes
showed that AMBF3Los presented an almost equivalent binding affinity (Ki 7.9 nM) as the cold
reference Losartan (Ki 1.5 nM), unlike FEtLos (Ki 2000 nM). In vitro and in vivo assays showed that
[18F]AMBF3Los displayed a good binding affinity for AT1R-overexpressing CHO cells and was able
to specifically bind to renal AT1R. Hence, our data demonstrate [18F]AMBF3Los as a new tool for PET
imaging of AT1R with possible applications for the diagnosis of cardiovascular, inflammatory and
cancer diseases.
Molecules 2020, 25, 1872; doi:10.3390/molecules25081872
www.mdpi.com/journal/molecules

Molecules 2020, 25, 1872
2 of 21
Keywords: fluoroethyl-losartan; [18F]FEtLos; ammoniomethyltrifluoroborate-losartan; [18F]AMBF3Los;
angiotensin II type 1 receptors; [18F]Fluoroethylation; 18F-19F isotopic exchange approach; in vitro assays;
µPET imaging; renal autoradiography
1. Introduction
Angiotensin II (ANG II) is the effector peptide that exerts most of the physiological functions of
the renin-angiotensin system (RAS), and binds with high affinity to two G-protein coupled receptors:
angiotensin II type 1 (AT1) and angiotensin II type 2 (AT2) receptors. The RAS is well-known as a
key regulator of blood pressure and fluid homeostasis [1]. Nevertheless, the deregulation of RAS
is responsible for several pathologies such as cardiovascular [2–4], renal [5–7], brain [8–11] and
cancer [12–14] disorders via ANG II/AT1R signaling.
Positron emission tomography (PET) is a highly sensitive and non-invasive imaging modality
widely used in nuclear medicine for the diagnosis and clinical monitoring of several diseases. PET
imaging uses radiopharmaceuticals labelled with positron-emitting radioisotopes such as carbon-11
(11C) and fluorine-18 (18F). Several AT1R radioligands have been designed, synthesized and evaluated
for molecular imaging of AT1 receptors [15–24]. Most of these AT1R radioligands (Figure 1), mostly
derivatives from commercial angiotensin receptor blockers (ARBs), were labeled with 11C which is a
drawback in the clinic practice due to the very short half-life of 20.4 min [25]. The use of the 11C-labelled
radiopharmaceuticals demands an on-site cyclotron at the clinical PET center for their production in
contrast to 18F-labelled radiopharmaceuticals. Compared to 11C, 18F has a lower maximum energy
of the emitted positron of 635 keV, which favors the spatial resolution of PET images [25–27], and a
higher half-life of 110 min [25] allowing the performance of PET studies without the need of an on-site
cyclotron. Losartan is the most used selective AT1R blocker in the clinic among the ARBs, being the first
choice for stroke, heart failure, diabetic nephropathy, hyperuricemia and erectile dysfunction, and also
exerts potentially beneficial effects for cardiovascular prevention, atrial fibrillation, diabetes mellitus
and cognitive decline [28]. However, to the best of our knowledge, just one 18F-labelled losartan-based
AT1R radioligand ([18F]FPyKYNE-losartan; Figure 1) was developed so far. [18F]FPyKYNE-losartan
was labeled with 18F using a time-consuming synthesis and presented a hydrophobic motif that
induced a non-specific liver uptake when injected in vivo [21]. This prompted us to develop a novel
18F-labelled losartan derivative, more hydrophilic and easy to synthesize which could decrease in vivo
non-specific uptake.
Therefore, here we described the synthesis and 18F-labeling of two novel losartan derivatives
using less hydrophobic motifs such as: 2-fluoroethoxy and ammoniomethyltrifluoroborate (AMBF3),
[18F]FEtLos and [18F]AMBF3Los, respectively (Figure 2).
The 2-[18F]fluoroethyl tosylate is a 18F-fluoroalkylating agent usually used to prepare PET tracers since
it is easy to prepare with low volatility, high chemical stability and reactivity, and chemoselectivity [29,30].
Besides, the [18F]fluoroethyl group is considered as a surrogate for a [11C]methyl group because
it can be coupled to the same functional groups [30]. Therefore, we designed the novel analog
[18F]fluoroethyl-losartan ([18F]FEtLos; Figure 2) following a similar reaction scheme to the one reported
for [11C]methyl-losartan (Figure 1).

Molecules 2020, 25, 1872
3 of 21
Figure 1. Reported AT1R positron emission tomography (PET) radioligands [15–24].
Figure 2. Losartan and the new 18F-labelled derivatives proposed in this work, [18F]FEtLos and
18F]AMBF3Los.
[
On the other hand, the copper (I)-catalyzed Huisgen alkyne-azide 1,3-dipolar cycloaddition (CuAAC)
is the most commonly used reaction for click chemistry, which has become a very attractive strategy in
the design of PET tracers. This type of reaction shows an outstanding efficiency, regiospecificity and fast
formation of the 1,4-disubstituted 1,2,3-triazoles [31] which are metabolically stable under physiological
conditions [32,33]. In particular, the N-propargyl-N,N-dimethyl-ammoniomethyl-trifluoroborate is a
hydrophilic linker that afford AMBF3-conjugated biomolecules using a CuAAC reaction. The AMBF3
motif allows an easy one-step 18F-labeling by 18F-19F isotope exchange reaction in acidic aqueous media
using only nanomole amounts of the precursor. AMBF3 labeled products are usually very stable in vivo
,
present high molar activity and radiochemical purity, and do not depend on High Pressure Liquid
Chromatography (HPLC) for purification [34–
36]. Therefore, [18F]ammoniomethyltrifluoroborate-losartan
([18F]AMBF3Los; Figure 2) was also synthesized and characterized in the present work following the
AMBF3 approach.
In addition, we studied the AT1R binding affinity of the newly synthetized derivatives both in vitro
,
ex-vivo and in vivo to evaluate its usefulness and pharmacokinetics as PET tracers for the noninvasive

Molecules 2020, 25, 1872
4 of 21
imaging of AT1R. We found that [18F]AMBF3Los presented the most suitable characteristics as an AT1R
PET tracers: (1) its kit-like 18F-labeling approach was very fast and efficient, and (2) 18F-19F isotope
exchange allowed the use of smaller amounts of the precursor than conventional radiolabeling methods.
2. Results
2.1. Chemistry
The compounds 2-butyl-4-chloro-5-(2-fluoroethoxy)methyl-1-[(20-(1H-tetrazol-5-yl)biphenyl-4-yl)
methyl]-1H-imidazole(FEtLos)and2-butyl-4-chloro-5-[((1H-1,2,3-triazol-4-yl)-(N,N-dimethyl-ammoniomethyl
-trifluoroborate)methyl)methyl]-1-[(20-(1H-tetrazol-5yl)biphenyl-4-yl)methyl]-1H-imidazole (AMBF3Los)
were synthesized as new derivatives of 2-butyl-4-chloro-5-hydroxymethyl-1-[(20-(1H-tetrazol-5yl)biphenyl-
4yl)methyl]-1H-imidazole (1) (losartan) with substitution at the imidazole C-5 position (Schemes 1
and 2).
Scheme 1. Synthesis of FEtLos ([19F]fluoroethyl-losartan, cold derivative) by O-alkylation of
commercially available losartan potassium ( ) using two strategies, ( ) direct nucleophilic substitution
of with 2-fluoroethyl tosylate ( ) or ( ) a three steps procedure through protection of the N-tetrazol
1
A
1
2
B
moiety of 1, followed by O-alkylation and deprotection.
Scheme 2. Synthesis of AMBF3Los ([19F]ammoniomethyltrifluoroborate-losartan) by click chemistry
using a copper (I)-catalyzed azide-alkyne cycloaddition reaction.
The synthesis of the cold derivative FEtLos was carried out through an O-alkylation of the
hydroxymethylene group at the C-5 position of losartan (1) with 2-fluoroethyl-tosylate (2) (Scheme 1A),
readily prepared from the tosylation of 2-fluoroethanol using tosyl chloride diluted in pyridine [37].

Molecules 2020, 25, 1872
5 of 21
Following the bimolecular nucleophilic substitution reaction (SN2), FEtLos was obtained with a yield
of 26% while the sub-product
3 was obtained with a yield of 7% (FEtLos/3 ratio = 3.7). Structural
characterization of FEtLos was achieved by 13C NMR, 1H NMR, 19F NMR, (1H, 13C)-HMBC and HRMS
analyses. In particular, the structure of FEtLos was confirmed based on the heteronuclear correlation
over three bonds between the fluoroethyl methylene hydrogens (4.70 ppm) and the oxymethylene
carbon (52.7 ppm) at the imidazole C-5 position (Figure S2). The compound
characterized (Figure S3).
3 was also structurally
In order to improve the yield of FEtLos, we pursued an alternative synthetic route in which the
N-tetrazole moiety of losartan was protected with a trityl group [20] to give 2-butyl-4-chloro-5-(hydrox
ymethyl)-1-[(20-(1H-(1-(triphenylmethyl))tetrazol-5-yl)biphenyl-4-yl) methyl]-1H-imidazole intermediate
(
4
) with a good yield◦(83%) (Scheme 1B). Then, the same O-alkylation reaction conditions of
losartan (1) (NaH, 80 C, 2 h) was applied for functionalization of 4, originating the 2-butyl-4-
chloro-5-(2-fluoroethoxy) methyl-1-[(20-(1H-tetrazol-5-yl)biphenyl-4-yl) methyl]-1H-imidazole (
single product with an overall yield of 33%. The O-alkylation reaction was also conducted at room
temperature for 24 h, but compound was not totally consumed, and the yield of compound did not
improve even with an excess of 2-fluoroethyl tosylate ( ). Finally, acidic removal of the trityl protecting
group of compound in 1:40 trifluoroacetic acid (TFA)/N,N-dimethylformamide (DMF) solution at
80 ◦C for 15 min led to the formation of FEtLos with a low yield (15%) and several by-products due
to the decomposition of , mostly formed under prolonged reaction conditions. Therefore, the direct
5) as a
4
5
2
5
5
fluoroethylation of losartan (26% yield, Scheme 1A) without N-tetrazole protection was found to be a
superior strategy to obtain FEtLos than the three-step synthetic route (4% overall yield, Scheme 1B).
For the preparation of AMBF3Los, a CuAAC reaction was chosen to introduce the N,N-
dimethyl-ammonium methyl-trifluoroborate at the C-5 position of losartan through a triazole bridge to
produce both the standard reference and the precursor of [18F]AMBF3Los by an 18F-19F isotopic exchange
approach. Firstly, the trityl-protected compound
(DPPA) to displace the primary hydroxyl group by azide and give 2-butyl-4-chloro-5-(azidomethyl)-1-
[(20-(1H-(1-(triphenylmethyl))tetrazol-5-yl)biphenyl-4-yl) methyl]-1H-imidazole (
) [21], with good a
yield (77%). Before proceeding to the click reaction, the trityl group was removed in order to avoid
hydrolysis of the final AMBF3Los trifluoroborate group (Scheme 2). Therefore, the intermediate ( ) was
4 was treated with diphenyl phosphoryl azide
6
7
obtained by acidic removal of trityl protecting group at room temperature for 24 h with an excellent
yield (96%) using 1 M HCl in methanol and 1,4-dioxane. Finally, the coupling between losartan-derived
azide
7
with the N-propargyl-N,N-dimethyl-ammoniomethyl-trifluoroborate (
8), bearing the terminal
acetylene group, by CuAAC reaction [34
,
36
,
38] under copper (I) catalyst at 45 ◦C for 2 h gave exclusively
the 1,4-disubstituted regioisomer AMBF3Los in moderate yield (52%). Although the copper (I) catalyst
was formed in situ by reduction of copper sulfate (II) in the presence of sodium ascorbate, ammonium
hydroxide solution (NH4OH, 5%) was immediately added to this mixture to avoid copper (I) complex
precipitation due to its poor water solubility [36]. The structural characterization of AMBF3Los was
achieved by 13C-NMR, 1H-NMR, 19F-NMR, (1H, 13C)-HMQC, (1H, 13C)-HMBC and HRMS analyses.
In particular, direct heteronuclear correlations H–C for the ammoniomethyltrifluoroborate group were
showed: methylene hydrogens (4.30 ppm)-methylene carbon (58.9 ppm) linked to triazole and, methyl
hydrogens (2.83 ppm)-methyl carbon (52.0 ppm) from de dimethylamine group, as well the direct
heteronuclear correlations H–C for the triazole moiety (7.98 ppm, 126.7 ppm) and methylene group at
imidazole C-5 position (5.25 ppm, 46.3 ppm) (Figure S5). Furthermore, the structure of AMBF3Los was
confirmed based on the heteronuclear correlation over three bonds between the methylene hydrogens
(5.24 ppm) at imidazole C-5 position and the tertiary carbon (125.3 ppm) from the triazole moiety
(Figure S5).
2.2. Radiochemistry
Schemes 3 and 4 show the synthetic route used for the preparation of the radiolabeled compounds
[18F]FEtLos and [18F]AMBF3Los, respectively.

Molecules 2020, 25, 1872
6 of 21
Scheme 3. Radiosynthesis of [18F]FEtLos ([18F]fluoroethyl-losartan) by direct nucleophilic substitution
of commercially available losartan potassium (1
) with 2-[18F]fluoroethyl tosylate (2*), and formation of
the isomer N-[18F]fluoroethyl-losartan (3*) as side-product.
Scheme 4. Radiosynthesis of [18F]AMBF3Los ([18F]ammoniomethyltrifluoroborate-losartan) by 18F-19
F
isotopic exchange (IE) reaction.
[18F]FEtLos was prepared by a 18F-fluoroalkylation of losartan using the prosthetic group
2-[18F]fluoroethyl tosylate (2*) (Scheme 3). Thus, 2* was manually prepared with a radiochemical
yield of 30
±
8% (decay-corrected from dried [18F]F−) and >99% chemical and radiochemical
purity after HPLC-purification. The synthesis duration of 2* was of approximately 50 min. After
18F-fluoroalkylation of losartan potassium, [18F]FEtLos was purified by HPLC with a chemical and
radiochemical purity >99% and its chemical identity was confirmed by HPLC co-injection of the cold
compound (FEtLos) (Figure S6). [18F]FEtLos was prepared using a small amount of 2* and obtained
with a radiochemical yield of 12
±
5% (decay-corrected from 2*, approximately 100 min) and 1.4
±
1.2 GBq (38 33 mCi)/ mol molar activity (n = 10). The overall radiochemical yield was 2.7
±
µ
±
0.9%
(decay-corrected from dried [18F]F−) with a total synthesis time of approximately three hours. The
distribution coefficient of [18F]FEtLos at pH 7.4 (log D7.4) was 0.21
±
0.09 (n = 3). The 18F-labeled
side-product 3* was also formed by N-18F-fluoroalkylation of the losartan tetrazole moiety, confirmed
by HPLC analyses of the crude reaction mixtures and compared with the HPLC profile of the cold
compound 3.
On the other hand, [18F]AMBF3Los was easily synthetized (35–55 min) by an 18F-19F isotopic
exchange in an acidic aqueous medium, using only nanomole amounts of the AMBF3Los precursor and
purified using a single Sep-Pak cartridge (Scheme 4). The manual radiosynthesis of [18F]AMBF3Los,
using 25 nmol of precursor and low activities of [18F]F−, was achieved with a radiochemical yield of
11
±
4%, a molar activity of 2.4
±
0.5 GBq (0.06
±
0.01 Ci)/µmol, and a radiochemical purity >97%

Molecules 2020, 25, 1872
7 of 21
(n = 20). When the radiosynthesis of [18F]AMBF3Los was done using 100-fold higher activities of
[18F]F− and 4-fold higher mass of the precursor (100 nmol), a radiochemical yield of 10
1% with a
radiochemical purity >97% and molar activity of 108 29 GBq (2.9 0.8 Ci)/ mol was achieved. The
±
±
±
µ
chemical identity of [18F]AMBF3Los was also confirmed by a single peak in the analytical HPLC profile
after co-injection of the final formulation and the cold AMBF3Los, previously prepared (Figure S6).
[18F]AMBF3Los displayed a log D7.4 of −0.43 ± 0.02 (n = 3).
2.3. In Vitro Binding Assays
The AT1R receptor affinities for Losartan, AMBF3Los and FEtLos were evaluated using the human
AT1R membrane preparations and [125I]-(Sar1,Ile8)-Angiotensin II as the radioligand. The Ki values of
Losartan potassium, AMBF3Los and FEtLos were 1.5
±
0.3 nM (n = 3), 7.9
±
0.4 nM (n = 3) and 2.2
±
0.2 µM (n = 3) (Figure 3A). Since AMBF3Los showed the strongest AT1R receptor binding affinity, we
further evaluated [18F]AMBF3Los.
Figure 3. In vitro receptor binding assay. (
Angiotensin II by losartan potassium, FEtLos and AMBF3Los respectively. (
A
) A representative displacement curve of [125I]-(Sar1,Ile8)-
) AT1 mRNA receptor
abundance (n = 3) determined by RT-PCR in Chinese hamster ovary cells (CHO-AT1R, CHO); relative
quantification was done using the ∆∆Ct method normalizing to -actin gene expression. ( In vitro
18F]AMBF3Los uptake in CHO-AT1R or CHO cells seeded in 6-well plates after the tracer incubation
for 60 min at 4 ◦C in the presence (white bars, n = 3) or absence (black bars, n = 3) of the AT1R
blocker losartan potassium (100 M/well). Graphs show the mean standard deviation (SD) of
B
β
C)
[
µ
±
three independent experiments (n = 3). Data were analyzed by one unpaired t-test (multiple t tests);
** p < 0.01 (Holm-Sidak method).
We next evaluated the in vitro cellular uptake of [18F]AMBF3Los in CHO-AT1R cells, which
overexpress the human AT1R (Figure 3B), and CHO cells (control). As observed in Figure 3C,
CHO-AT1R cells presented a higher uptake of [18F]AMBF3Los in comparison to CHO cells. Incubation
of 100 µM of losartan potassium blocked the CHO-AT1R uptake, indicating that the binding of

Molecules 2020, 25, 1872
8 of 21
[18F]AMBF3Los was receptor-specific (p < 0.01). [18F]FEtLos, on the other hand, did not show any
specific AT1R binding for CHO-AT1R cells, which is in agreement with the low Ki value (Figure S7).
2.4. In Vivo Assays
A dynamic
µ
PET study for healthy NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ mice were next performed
PET dynamic scan at baseline showed a high [18F]AMBF3Los
with [18F]AMBF3Los (Figure 4A,B). The
µ
uptake in the mouse renal cortex at early time points (10, 15 and 20 min) that was reduced when
losartan potassium (AT1R blocker) was co-injected with [18F]AMBF3Los (Figure 4A). To confirm this
finding, a volume of interest (VOI) analysis was performed on the reconstructed images to generate the
time-activity curves (TAC) for [18F]AMBF3Los (Figure 4B), which showed renal tracer uptake within
the first few minutes, and the activity was slowly washed out. In contrast, the presence of losartan
potassium (AT1R blocker) reduced renal uptake during the first 10 min.
Figure 4. In vivo biodistribution of [18F]AMBF3Los. (
the dynamic PET imaging (coronal view, 0–10% ID/g) in healthy NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ mice
of the baseline and AT1R blocked groups (co-injection with losartan, 18 mg/kg). ( ) The time-activity
curves obtained from the dynamic PET data at baseline (n = 3) and AT1R blocked (n = 3) groups.
) Representative autoradiography images of kidneys from healthy mice at baseline and AT1R blocked
groups after the 60 min dynamic PET scans.
A) Representative frames (10, 15 and 20 min) of
B
(C
To validate the µ
PET imaging studies, a biodistribution study of [18F]AMBF3Los was performed
at 60 min post injection (p.i.) as summarized in Table 1. No significant differences were observed
compared to the µPET imaging quantification for the renal uptake. The high [18F]AMBF3Los activity
uptake in intestines suggests it may also be cleared through the hepatobiliary system.

Molecules 2020, 25, 1872
9 of 21
Table 1. Biodistribution of [18F]AMBF3Los in healthy NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ mice.
Tissues
Baseline
AT1R Blocking
Blood
Fat
Testis
Intestines
Stomach
Spleen
0.05 ± 0.03
0.011 ± 0.004
0.03 ± 0.01
63 ± 9
0.08 ± 0.08
0.008 ± 0.002
0.029 ± 0.008
62 ± 3
0.06 ± 0.05
0.2 ± 0.1
2 ± 2
0.08 ± 0.03
0.6 ± 0.3
Liver
0.5 ± 0.5
Pancreas
Adrenal glands
Kidneys
Lungs
0.05 ± 0.03
0.1 ± 0.1
0.07 ± 0.06
0.11 ± 0.06
1.9 ± 1.3
3.5 ± 1.2
0.06 ± 0.03
0.03 ± 0.01
0.02 ± 0.01
0.11 ± 0.06
0.006 ± 0.005
0.08 ± 0.04
0.04 ± 0.03
0.05 ± 0.04
0.11 ± 0.03
0.005 ± 0.004
Heart
Muscle
Bone
Brain
Uptake data are presented as mean (% ID/g of tissues) ± SD of three independent experiments (n = 3).
Autoradiographies of the mouse kidneys were also taken after the 60-min dynamic
µPET scan
with [18F]AMBF3Los showing that [18F]AMBF3Los was mainly captured in the kidney cortex, and
this uptake was blocked by the co-injection of losartan potassium (Figure 4C). Indeed, the renal
cortex activity was approximately 5-times smaller in the kidney of the mouse previously blocked with
losartan potassium in comparison to the unblocked one. Thus, these data suggest that [18F]AMBF3Los
specifically binds to renal AT1R.
The renal AT1R binding specificity of [18F]FEtLos was also evaluated by an ex vivo
µPET/CT
imaging of Balb/c Nude mice kidneys 10 min post injection (p.i.) of the tracer. As shown in Figure
S8, [18F]FEtLos showed a high uptake in the kidneys (baseline), which was blocked when losartan
potassium (AT1R blocker) was co-injected with [18F]FEtLos, despite the low affinity of the radiotracer.
These positive results of the ex vivo renal AT1R binding of [18F]FEtLos might be possible due to the
high AT1R density in the kidneys, that allows visualizing specific uptake in spite of the low AT1R
binding affinity of [18F]FEtLos.
3. Discussion
The renin-angiotensin system (RAS) plays a fundamental role in the control of the cardiovascular
and renal systems. Recent evidences suggest that AT1R has been implicated in a few brain disorders
and has been associated with cancer progression and prognosis. Therefore, the in vivo imaging of
AT1R could provide a diagnostic and prognostic information for the management of several diseases.
Although a few PET AT1R radioligands have been evaluated for cardiovascular [39
,40],
renal [22 24 41 44] and brain [18
–
,
–
,
45] AT1R imaging, most of them were labeled with 11C, which
brings some disadvantages over 18F in the clinical practice, such as the presence of an in-site cyclotron.
Recently, it was reported the synthesis of [18F]FPyKYNE-losartan (Figure 1), a losartan-derivative
containing a hydrophobic motif that could favor a non-specific liver uptake [21]. Therefore, here we
described the design, synthesis and characterization of two new AT1R radiotracers: [19/18F]FEtLos and
[
19/18F]AMBF3Los using less hydrophobic motifs.
Both compounds were designed via the substitution of the hydroxyl group by fluoro ligands
at the imidazole 5-position of losartan. Several substituents with different length such as a
small methyl group [20] and a bulky side chain [46] have been introduced into the losartan
pharmacophore at the same position. For instance, a few losartan derivatives were synthesized
by adding nitric oxide (NO)-donor side chains to losartan at the imidazole 5-position (Figure S9),
displaying antagonist potency values similar to losartan [47]. Besides, the chelate-coupled
losartan-Leucine-Diglycoloyl-Tetraethyleneglycol-Tetraamine (Figure S10) showed superior AT1R

Molecules 2020, 25, 1872
10 of 21
affinity compared to parental losartan; radiolabeling of this compound with 99mTc displayed an
acceptable biodistribution profile in mouse model of post-myocardial infarction heart failure [46].
The increase for AT1R affinity of this losartan analog may be probably due to the higher possibility
to form hydrogen bonds, which may increase their affinity to the receptor. In addition, the
[18F]FPyKYNE-losartan derivative also showed a high affinity to kidney AT1R in rats and pigs [44].
[18F]FEtLos and the cold FEtLos were synthetized by both [18/19F]fluoroethylation of losartan
potassium and tetrazole-protected losartan through a SN2 reaction. Many PET tracers have been
synthesized using a two-step radiosynthesis because the direct [18F]fluorination is not feasible most of
the time. Direct fluorination usually requires high temperatures and non-physiological pH that can
harsh the precursors [27]. Hence, 18F-labeling using prosthetic groups, such as the 2-[18F]fluoroethyl
tosylate (2*) for 18F-fluoroalkylation reactions [30], is commonly used in spite of the longer time of
synthesis. Moreover, although the insertion of fluoroethylene group in the NH-tetrazole group is
interesting, we decided to maintain the negatively-charged tetrazole moiety intact because of its crucial
role for AT1R binding through hydrogen bridge interactions with basic amino acid residues of the
receptor [48–50], its prolonged half-life and enhanced metabolic stability [51]. In addition, the tetrazolic
ion is more stable than the alkoxide ion due to the spatial delocalization of the negative charge of the
former, favoring reactive alkoxide formation and alkylation to produce FEtLos with a ratio of 3.7 with
the corresponding NH-tetrazole isomer (3).
On the other hand, the cold AMBF3Los was synthetized via a copper (I)—catalyzed Huisgen
alkyne—azide 1,3-dipolar cycloaddition, the most used click reaction; while the 18F-labelled compound
was obtained from an aqueous 18F-19F isotopic exchange reaction. The cold AMBF3Los was afforded
in similar yield to other compounds using the same approach [38,
52]. The one step 18F-19F isotopic
exchange approach using organotrifluoroborates resembles a ‘kit like” 18F-labeling method and
requires much lower amount of precursor (nanomoles) that the conventional radiolabeling methods
(micromoles of precursor). This approach was previously used for radiolabeling peptides using
high activities of [18F]F− and very low amounts of precursor (75–100 nmol), within 30 min with
a radiochemical purity >99%, a high molar activity (68–148 GBq/
20–28%, with HPLC-free purification [34 38
53]. Small [18F]AMBF3-conjugated molecules were also
synthesized with a radiochemical yield of 14.8 0.4% with a molar activity of 24.5 5.2 GBq/ mol and
µmol), a radiochemical yield of
,
,
±
±
µ
radiochemical purity >99% [54]. Taking into account that the reaction medium is acid, a significant
amount of [18F]F− is lost by volatilization as [18F]hydrogen fluoride during the labeling reaction under
vacuum and heating. According to the literature, reaction pH is the crucial step of this radiolabeling
approach, and pH 2–2.5 generally gives lower by-product (boronic acid) levels and better radiochemical
yield [36]. The carrier [19F]fluoride was used during the radiolabeling because it increases the [18F]BF3
formation while still providing a molar activity of 37 GBq/µmol [55].
Results of the in vitro receptor binding assays showed that only the derivative AMBF3Los
displayed a good binding affinity to human AT1R compared to FEtLos. Therefore, the substitution
of hydroxyl group by the 2-fluoroethoxy motif decreased the AT1R binding affinity due to the lack
of hydrogen bonding or other intermolecular forces. The 1,2,3-triazole is a polar moiety and a good
hydrogen-bond acceptor that may keep the receptor binding affinity of AMBF3Los, as reported for
the [18F]FPyKYNE-losartan derivative, which also contains a 1,2,3-triazole at the imidazole 5-position
and displays high affinity for AT1R (dissociation constant, KD 49.4 nM) to rat kidney AT1R [44].
The structure-activity relationship at the imidazole 5-position revealed that it generally prefers small
hydrogen-bonding substituents such as alcohols or carboxylic acids but will also tolerate a wide range
of groups [48]. Hence, our results suggested that hydrogen-bonding substituents at the imidazole
5-position play an important role to AT1R binding affinity besides the tetrazole moiety.
Next, both in vitro and in vivo assays showed that [18F]AMBF3Los specifically binds to the AT1
receptors. Therefore, [18F]AMBF3Los could be further evaluated as a specific PET radioligand to image
the AT1 receptors in disease, for instance, in cancer; whereas, the low binding affinity of [18F]FEtLos
limits its use as a AT1R PET tracer. In addition, the log D7.4 measurements of [18F]AMBF3Los (
0.4)
−

Molecules 2020, 25, 1872
11 of 21
showed that this new derivative is more hydrophilic than the parental losartan with a log D7.4 of
1.7 [56]. As such, we could observe that [18F]AMBF3Los displayed a smaller liver uptake (% ID/g = 0.5
than the previously reported derivative [18F]FPyKYNE-losartan (% ID/g = 66.7) in vivo at the same
time-point (60 min) [44]. Therefore, [18F]AMBF3Los exhibited a significant less non-specific liver
uptake compared to the reported [18F]FPyKYNE-losartan.
)
In particular, the PET imaging of AT1R in cancer has not been explored so far despite the
upregulation of AT1R protein levels in human cells and tumor tissues of breast, prostate, gastric, bladder,
ovarian and endometrial-derived cancers compared to non-cancerous tissues [57–62]. Accordingly,
losartan has been shown to inhibit breast [63], gastric [62] and ovarian [64] cancer development and
progression suggesting that AT1R could be a potential therapeutic target to complement current cancer
treatment. Hence, [18F]AMBF3Los as AT1R radioligand for PET imaging can be a very useful tool for
assessing AT1R-positive tumors.
4. Materials and Methods
4.1. General Methods
All the chemicals and solvents were purchased with analytical grade from commercial sources
and used without further purification. All the cold compounds were characterized by high resolution
mass spectrometry (HRMS, Billerica, MA, USA) and nuclear magnetic resonance (NMR) experiments,
recorded on a Bruker Daltonics micrOTOF-Q II ESI-Qq-TOF spectrometer and Bruker Avance DRX 300,
DPX 400, DPX 500 equipments (Billerica, MA, USA). Chemical shifts (δ) were reported in parts per
million (ppm) relative to an internal tetramethylsilane (TMS) standard. Coupling constants (J) were
reported in Hertz (Hz). No carrier-added [18F]F− was produced by the 18O(p,n)18F reaction using
enriched water (H218O) target in a 18-MeV cyclotron (IBA, Belgium) using H218O target. Sep-Pak Light
QMA cartridges were pre-conditioned with 10 mL of potassium carbonate 0.5 M (K2CO3), followed
by 20 mL of Milli-Q water and purged with 20 mL air. µ-QMA cartridges were reused, and always
flushed with 3 mL brine and 6 mL Milli-Q water before [18F]F− trapping. Sep-Pak C18 Plus cartridges
were preconditioned with 5 mL ethanol and 10 mL of Milli-Q water. Sep-Pak C18 Light cartridges were
preconditioned with 3 mL ethanol and 3 mL of Milli-Q water. Radioactivity of [18F]F− was measured
using a Capintec radioisotope dose calibrator (CRC-15R, Ramsey, NJ, USA). HPLC system from Agilent
Technologies (Santa Clara, CA, USA) was used to purifications and quality control of the [18F]FEtLos
and [18F]AMBF3Los.
4.2. Chemistry
4.2.1. Synthesis of 2-Butyl-4-chloro-5-(2-fluoroethoxy)methyl-1-[(20-(1H-(1-(triphenylmethyl))
tetrazol-5-yl) biphenyl-4-yl)methyl]-1H-imidazole (5)
The compounds 2-fluoroetyl tosylate (
according to the literature. The compound
ice-cooled solution of (50 mg, 0.11 mmol) and NaH (3.6 mg, 0.15 mmol) in anhydrous DMF (400
2
) [37] and tetrazole-protected losartan
(28 L, 37 mg, 0.17 mmol), was dropwise added to an
L)
4 [20], were synthetized
2
µ
4
µ
under stirring and argon atmosphere. The reaction was set at 0 ◦C for 30 min, and then, at 80 ◦C for 2 h
(yellow in color), and monitored by TLC (silica gel, toluene/ethyl acetate, 90:10, Rf = 0.5). Afterwards, the
reaction was quenched by dripping deionized water, and the crude product was extracted by ethyl acetate
(3 times) using brine as aqueous phase. The organic layers were pool together, dried over magnesium
sulphate (MgSO4), filtered, and the solvent was evaporated. Residue was purified by flash column
chromatography (silica gel, toluene/ethyl acetate, 90:10, Rf = 0.5) to afford 17.8 mg (33%) of
5
as a yellow
1
oil. H NMR (300 MHz, CDCl3) δH 7.93 (dd, J = 7.5 Hz, 1.5 Hz, 1H), 7.53–7.41 (m, 2H), 7.38–7.32 (m, 4H),
7.29–7.22 (m, 6H), 7.11 (d, J = 8.2 Hz, 2H), 6.95–6.90 (m, 6H), 6.75 (d, J = 8.3 Hz, 2H), 5.07 (s, 2H), 4.53–4.44
(m, 1H), 4.39–4.33 (m, 1H), 4.23 (s, 2H), 3.62–3.54 (m, 1H), 3.52–3.45 (m, 1H), 2.57–2.47 (m, 2H), 1.77–1.56
(m, 2H), 1.36–1.20 (m, 2H), 0.86 (t, J = 7.3 Hz, 3H). 13C NMR (75 MHz, CDCl3) δC 164.1, 149.0, 141.4, 141.0,
134.6, 130.9, 130.4, 130.3, 130.1, 130.0, 129.3, 129.2, 128.5, 128.1, 127.9, 127.8, 126.4, 125.4, 121.7, 83.6, 83.0,

Molecules 2020, 25, 1872
12 of 21
82.0, 68.60, 68.4, 61.1, 47.3, 29.9, 26.9, 22.5, 13.9. 19F NMR (282 MHz, CDCl3) δF −223.16 (referred to the TFA
reference standard). HRMS (ES+): m/z [M+H]+ calculated for C43H41ClFN6O: 711.3014; found: 711.3018.
4.2.2. Synthesis of 2-Butyl-4-chloro-5-(2-fluoroethoxy)methyl-1-[(20-(1H-tetrazol-
5-yl)biphenyl-4-yl)methyl]-1H-imidazole (FEtLos)
Method A: A solution of losartan potassium
was added to an ice-cooled mixture of NaH (6 mg, 0.22 mmol) and anhydrous DMF (500
stirring and argon atmosphere. Then, a solution of 2-fluoroethyl tosylate ( ) [37] (40.4 L, 0.24 mmol)
1
(100 mg, 0.22 mmol) in anhydrous DMF (500
µL)
µL) under
2
µ
in anhydrous DMF (400
µ
L) was dropwise added into the solution previ◦ously prepared. The reaction
mixture was stirred at room temperature for 30 min, and then, at 80 C for two hours (orange in
color). The progress of the reaction was monitored by TLC (silica gel, hexane/ethyl acetate, 50:50 and
30:70, Rf = 0.31 and 0.68 respectively). The reaction was quenched and the solvent was evaporated
using a rotary evaporator with vertical dry-ice condenser. The residue was purified by flash column
chromatography (silica gel, hexane/ethyl acetate, 50:50–30:70) to afford 26 mg of FEtLos (26%, light
yellow oil) (Scheme 1A).
Method B: A solution of DMF-TFA 40:1 (64 µL) was added to the solution of 5 (8 mg, 11.3 µmol) in
anhydrous DMF. After heating at 80 ◦C for 15 min, the reaction was monitored and the crude product
was purified by semi-preparative HPLC (Shimadzu Corporation, Kyoto, Japan) with the conditions:
Macherey-Nagel Nucleodur® C18 column (250
B: MeCN; 0–40 min, 10–100% A; 3 mL/min; 254 nm to afford 1.2 mg (15%) of compound FEtLos
(Scheme 1B).
×
10 mm, 10 µm), solvent A: 0.1% TFA water; solvent
1H NMR (500 MHz, CDCl3) δH 7.88 (dd, J = 7.5 Hz and 0.8 Hz, 1H), 7.57–7.40 (m, 3H), 7.14 (d,
J = 8.1 Hz, 2H), 6.94 (d, J = 8.0 Hz, 2H), 5.28 (s, 1H), 5.19 (s, 2H), 4.80 (s, 2H), 4.76–4.74 (m, 1H), 4.71–4.69
(m, 1H), 4.47 (s, 2H), 2.60–2.57 (m, 2H), 1.70–1.64 (m, 2H), 1.35 (h, J = 7.3 Hz, 2H), 0.88 (t, J = 7.3 Hz, 3H).
1H NMR (500 MHz, DMSO-d6) δH 7.77 (d, J = 7.1 Hz, 1H), 7.63 (t, J = 7.1 Hz, 1H), 7.55 (t, J = 7.1 Hz,
1H), 7.47 (d, J = 7.4 Hz, 1H), 7.09 (d, J = 8.0 Hz, 2H), 6.99 (d, J = 8.0 Hz, 2H), 5.75 (s, 1H), 5.25 (s, 2H),
4.97 (t, J = 4.8 and 23.1 Hz, 1H), 4.91 (t, J = 4.8 and 23.1 Hz, 1H), 4.80 (t, J = 4.8 and 46.8 Hz, 1H), 4.71 (t,
J = 4.8 and 46.8 Hz, 1H), 4.33 (s, 2H), 2.50–2.47 (m, 2H), 1.48 (q, J = 7.5 Hz, 2H), 1.25 (h, J = 7.2 Hz,
2H), 0.81 (t, J = 7.3 Hz, 3H).13C NMR (75 MHz, CDCl3) δC 165.6, 148.7, 141.3, 140.8, 135.0, 130.8, 130.5,
130.4, 130.0, 128.0, 127.7, 126.1, 125.8, 124.9, 81.3, 79.0, 53.3, 53.0, 47.5, 29.9, 26.9, 22.6, 13.9. 19F NMR
(282 MHz, CDCl3) δF −224.05 (referred to the TFA reference standard). HRMS (ES+): m/z [M + H]+
calculated for C24H27ClFN6O: 469.1919, found: 469.1923.
4.2.3. Synthesis of 2-Butyl-4-chloro-5-(azidomethyl)-1-[(20-(1H-tetrazol-5-yl)biphenyl-4yl)methyl]-1H-
imidazole (7)
The compound tetrazole-protected azido-losartan 6 was synthetized according to the literature [21].
Following a described procedure for deprotection of tetrazole-protected losartan [20], a solution of 1M
HCl in methanol (1.7 mL) was added to a solution of 6 (15.7 mg, 22.8
After stirring at room temperature (22 ◦C) for 24 h, reaction was completed and monitored by HPLC
(Phenomenex Luna C18 semi-preparative column (5 , 250 10 mm), 0–10 min, 60:40, 0.1% TFA
µmol) in 1,4-dioxane (1.4 mL).
µ
×
water/MeCN, 11–15 min, 40–100% MeCN, 15–25 min, 100% MeCN, 4 mL/min, 254 nm; retention time
of 16 min). The reaction was quenched, extracted with ethyl acetate and brine, dried over MgSO4,
filtered and the solvent was evaporated. The residue was dissolved in MeCN and purified by HPLC
(Phenomenex Luna C18 semi-preparative column (5
water/MeCN, 11–15 min, 40–100% MeCN, 15–25 min, 100% MeCN, 4 mL/min, 254 nm; retention time
of 16 min). The product was also purified by flash column chromatography (silica gel, hexane/ethyl
µ
, 250
×
10 mm), 0–10 min, 60:40, 0.1% TFA
acetate, 95:5–30:70). The collected fractions were pooled together, concentrated and the product was
1
freeze-dried to get 9.8 mg (96%) of
7
. H NMR (300 MHz, CDCl3) δH 7.95 (dd, J = 7.5 Hz, 1.4 Hz, 1H),
7.66–7.51 (m, 2H), 7.42 (dd, J = 7.2 Hz, 1.5 Hz, 1H), 7.15 (d, J = 8.2 Hz, 2H), 6.85 (d, J = 8.1 Hz, 2H),
5.14 (s, 2H), 4.12 (s, 2H), 2.43 (t, 2H), 1.59 (p, J = 7.6 Hz, 2H), 1.32 (h, J = 7.4 Hz, 2H), 0.88 (t, J = 7.3

Molecules 2020, 25, 1872
13 of 21
Hz, 3H). 13C NMR (75 MHz, CDCl3) δC 149.3, 140.6, 139.9, 135.1, 131.4, 131.1, 130.7, 130.0, 128.6, 120.3,
77.2, 47.3, 42.9, 30.0, 26.8, 22.5, 13.9. HRMS (ES+): m/z [M + H]+ calculated for C22H23ClN9: 448.1765;
found: 448.1758.
4.2.4. Synthesis of 2-Butyl-4-chloro-5-[((1H-1,2,3-triazol-4-yl)-(N,N-dimethyl-ammoniomethyl-
trifluoroborate)methyl)methyl]-1-[(20-(1H-tetrazol-5-yl)biphenyl-4-yl)methyl]-1H-imidazole
(AMBF3Los)
AMBF3-alkynyl (
Na asc (1M, 40 L), NH4OH 5% (vol/vol) (1:1 MeCN/H2O, 150
300 L MeCN/H2O 1:1), and compound (4.8 mg, 10.7 mol, 700
to a 5 mL tube. After stirring at 45 ◦C for 2 h, the product was purified by HPLC (Phenomenex Luna
C18 semi-preparative column (5 , 250 10 mm), 0–10 min, 80:20, Milli-Q water/MeCN, 11–25 min,
8
) was synthetized according to the literature [34
L), compound
L of MeCN), were sequentially added
,
36]. Then, CuSO4 (1M, 15
µ
L),
µ
µ
8
(6.6 mg, 40
µ
mol,
µ
7
µ
µ
µ
×
60:40 Milli-Q water/MeCN, 4 mL/min, 254 nm; retention time of 15.2 min). The collected fractions were
frozen, and the product was freeze-dried to get 3.4 mg (52%) of AMBF3Los (Scheme 2). Then, the pure
AMBF3Los was diluted in acetone and stored in aliquots of ~25 or 100 nmol for further radiolabeling;
the solvent was blow-dried. 1H NMR (500 MHz, CD3CN) δH 7.96 (s, 1H), 7.80 (d, J = 7.4 Hz, 1H),
7.65 (t, J = 7.4 Hz, 1H), 7.56 (t, J = 7.4 Hz, 1H), 7.47 (d, J = 7.6 Hz, 1H), 6.96 (d, J = 8.1 Hz, 2H), 6.68
(d, J = 7.9 Hz, 2H), 5.49 (s, 2H), 5.45 (s, 1H), 5.24 (s, 2H), 4.28 (s, 2H), 3.27 (s, 1H), 2.83 (s, 6H), 2.58
(t, J = 7.6 Hz, 2H), 1.60 (q, J = 7.7 Hz, 2H), 1.33 (h, 2H), 0.87 (t, J = 7.3 Hz, 3H). 13C NMR (75 MHz,
CD3CN) δC 149.7, 136.7, 131.3, 131.0, 130.7, 129.3, 128.0, 127.5, 125.6, 59.7, 52.5, 47.0, 42.5, 29.3, 26.3, 21.9,
13.0. 19F NMR (470 MHz, CD3CN) δF −137.25–
−
137.75 (m). HRMS (ES+): m/z [M + H]+ calculated for
C28H34BClF3N10: 613.2702; found: 613.2693.
4.3. Radiochemistry
4.3.1. Concentration and [18F]F− Drying
The irradiated water containing the [18F]F− was loaded onto a pre-conditioned QMA cartridge
(Waters, Brazil) (130 mg, quaternary ammonium, carbonate form), and [18F]F− was eluted off with
1 mL of K2CO3 (2 mg, 14
µmol)/Kryptofix 2.2.2 (K222, 11 mg, 29 µmol) mixture in 2:8 Milli-Q
water/MeCN [29]. [K+/K222]/[18F]F−/CO3 complex was dried by azeotropic distillation at 100 ◦C and
2−
nitrogen atmosphere with sequential addition of MeCN (1 mL, 3 times).
4.3.2. Radiosynthesis of 2-[18F]Fluoroethyl Tosylate (2*)
The solution of ethylene glycol bistosylate precursor (8 mg, 21.6
(1 mL) was added into the sealed conical reaction vial containing the dried [K+/K222]/[18F]F−/CO3
complex (1.6 0.6 GBq = 44
16 mCi). The reaction was set at 100 ◦C for one minute. Next, the crude
mixture was injected onto a semi-prep HPLC system to purify the product (Phenomenex nucleosil
C18 semi-preparative column (5 m, 10 250 mm), 50:50, 0.1% TFA water/MeCN, 3 mL/min, 254 nm;
µmol) in anhydrous MeCN
2−
±
±
µ
×
retention time of 14 min). The collected fraction of 2* was diluted and loaded onto a Sep-Pak C18
Plus cartridge (Waters, Brazil). The loaded cartridge was washed with Milli-Q water (10 mL), and
heated at 50 ◦C for 10 min while flushing with nitrogen [29]. Then, 2* was eluted off with DMF (1 mL).
An aliquot of the final formulation was analyzed by HPLC (Agilent Zorbax Eclipse Plus C18 analytical
column (5
µ
m, 4.6
×
250 mm), 0–15 min, 55:45, 0.1% TFA water/MeCN, 15–20 min, 45–100% MeCN,
20–30 min, 100% MeCN, 1 mL/min, 254 nm; retention time of 8.6 min) to confirm the identity of the
labelled compound by a single peak on radiochromatogram compared to its cold compound on 254 nm
UV profile, and evaluate the chemical and radiochemical purity.
4.3.3. Radiosynthesis of [18F]FEtLos
A solution of 2* (0.20
containing losartan potassium (1 mg, 2.2
±
0.07 GBq = 5
±
2 mCi) in DMF (800
mol) and NaH (8 eq.) in DMF (30
µ
L) was dropwise added to the vial
µ
µL) at room temperature.

Molecules 2020, 25, 1872
14 of 21
The reaction vial was heated at 80 ◦C for 20 min under stirring and nitrogen atmosphere (Scheme 3).
The labeling reaction was monitored by analytical HPLC (Agilent Zorbax Eclipse Plus C18 analytical
column (5
µ
m, 4.6
×
250 mm), 0–15 min, 55:45, 0.1% TFA water/MeCN, 15–20 min, 45–100% MeCN,
20–30 min, 100% MeCN, 1 mL/min, 254 nm; retention time of 7.9 min). The crude mixture was diluted
with 5:5 MeCN/water mixture, and injected onto a semi-prep HPLC system (Phenomenex Nucleosil
C18 semi-preparative column (5
µ
m, 10
×
250 mm), 55:45, 0.1% TFA water/MeCN, 3 mL/min, 254 nm;
retention time of 21 min) to purify the [18F]FEtLos. The collected fraction was diluted with Milli-Q
water and loaded onto a Sep-Pak C18 Plus cartridge (Waters, Brazil). Finally, [18F]FEtLos was eluted off
with MeCN (1 mL), the solvent was evaporated at 100 ◦C, and the product was reformulated in saline
for biological studies. An aliquot of the final formulation was analyzed by HPLC (Agilent Zorbax
Eclipse Plus C18 analytical column (5
15–20 min, 45–100% MeCN, 20–30 min, 100% MeCN, 1 mL/min, 254 nm; retention time of 7.9 min).
µ
m, 4.6
×
250 mm), 0–15 min, 55:45, 0.1% TFA water/MeCN,
4.3.4. Radiosynthesis of [18F]AMBF3Los
[18F]AMBF3Los was manually synthesized using both low (0.7
±
0.2 GBq) or high (61
±
23 GBq)
activities of [18F]F−. Telemanipulators were used to handle the high activities of [18F]F−; whereas, low
[18F]F− activities were performed manually (without telemanipulators). Sodium fluoride was added
as the source of carrier [19F]fluoride.
Radiosynthesis Using Low Activities (0.7 ± 0.2 GBq) of [18F]F−
AMBF3Los (25 nmol) was resuspended in a mixture of DMF (15
buffer (1.0 M, pH 2.0–2.5, 15 L), and an aqueous solution of sodium fluoride (15 mM, 1
carrier-added [18F]F− (0.7
0.2 GBq; 0.019 0.005 Ci), was trapped on the -QMA cartridge (ORTG
Inc., Oakdale, TN, USA) (9 mg, quaternary ammonium, chloride form). The [18F]F− was eluted with
100- L of isotonic saline into a polypropylene tube (reaction vial) containing the precursor (AMBF3Los).
µL), aqueous pyridazine-HCl
µ
µL). No
±
±
µ
µ
The 18F-labeling reaction was allowed to react at 80 ◦C for 20 min under vacuum and quenched with
NH4OH (5% in water, 2 mL). The reaction mixture was then loaded onto a Sep-Pak C18 light cartridge
(Waters, Brazil), washed with 2-mL of Milli-Q water, and [18F]AMBF3Los (Scheme 4) was eluted with
0.5-mL of 1:1 ethanol/saline solution. The solvent was evaporated at 45 ◦C under a slow nitrogen flow,
and the radiotracer was resuspended in saline for biological studies. An aliquot of the final formulation
was analyzed by HPLC (Agilent analytical Zorbax Eclipse Plus C18 column (5
solvent A: 0.1% TFA water, solvent B: MeCN, 0–30 min, 0–100% B, 1 mL/min, 254 nm; retention time of
µ
m, 4.6
×
250 mm),
17.6 min).
Radiosynthesis Using High Activities (61 ± 23 GBq) of [18F]F−
AMBF3Los (100 nmol) was resuspended in a mixture of DMF (15
buffer (1.0 M, pH 2.0–2.5, 15 L), and an aqueous solution of sodium fluoride (15 mM, 1
carrier-added [18F]F− (61
23 GBq; 1.6 0.6 Ci), was trapped on the -QMA cartridge (ORTG Inc.,
Oakdale, TN, USA) (9 mg, quaternary ammonium, chloride form). The [18F]F− was eluted with 100-
µL), aqueous pyridazine-HCl
µ
µL). No
±
±
µ
µL
of an isotonic saline into a polypropylene tube (reaction vial) containing the precursor (AMBF3Los).
The 18F-labeling reaction was allowed to react at 80 ◦C for 20 min under vacuum and quenched with
NH4OH (5% in water, 2 mL). The reaction mixture was then loaded onto a Sep-Pak C18 light cartridge
(Waters, Brazil), washed with 2-mL Milli-Q water, and [18F]AMBF3Los (Scheme 4) was eluted with
0.5-mL of 1:1 ethanol/saline solution. The tracer was then reformulated in saline (maximum of 10%
ethanol solution) for biological studies. An aliquot of the final formulation was analyzed by HPLC
(Agilent analytical Zorbax Eclipse Plus C18 column (5
solvent B: MeCN, 0–30 min, 0–100% B, 1 mL/min, 254 nm; retention time of 17.6 min).
µ
m, 4.6
×
250 mm), solvent A: 0.1% TFA water,

Molecules 2020, 25, 1872
15 of 21
4.3.5. Quality Control
The chemical identity of [18F]FEtLos and [18F]AMBF3Los was determined by co-injection with
their respective cold compounds onto HPLC using the analytical conditions previously described
in each method of radiosynthesis. The radiochemical purity and molar activity of [18F]FEtLos and
[18F]AMBF3Los were determined and the radiochemical yields were decay-corrected. The molar
activity was always calculated at the end of each radiosynthesis using a calibration curve (nmol of
the cold compound vs. area under the curve recorded from the HPLC analytical profile) (Figures S11
and S12).
Log D7.4 Measurements
The log D7.4 values were determined according to the literature [65]. Aliquots (2
and [18F]AMBF3Los were added to polypropylene tubes containing 3 mL of octanol and 3 mL of PBS
(phosphate-buffered saline). The samples were vortexed for 20 s (2 times) and centrifuged at 600 g for
µ
L) of [18F]FEtLos
×
15 min. Aliquots (0.1 mL) of each layer were counted in a gamma counter to determine the log D7.4 as
log (counts in octanol layer/counts in PBS layer).
4.4. In Vitro Assays
4.4.1. Competition Binding Assays in Membranes Containing Human AT1R
The assays were performed using membranes expressing the human angiotensin II type 1 receptor
from CHO-K1 cells, purchased from Perkin Elmer (Waltham, MA, USA). A serial dilution ranging from
10−4 to 10−12 M of Losartan potassium, FEtLos and AMBF3Los were used as cold ligands to displace the
hot [125I]-(Sar1,Ile8)-Angiotensin II (0.3 nM taking into account the activity of 125I decay-corrected at
the day of the assay and the specific activity of the hot compound (81.4 TBq (2200 Ci)/mmol)). The hot
ligand [125I]-(Sar1,Ile8)-Angiotensin II (81.4 TBq/mmol) was also purchased from Perkin Elmer (USA).
The Multiscreen MSFCN6B50 96-well plates were used for this assay. The procedure was based on the
recommended assay conditions from Perkin Elmer (Waltham, MA, USA) and procedures previously
described for other AT1R ligands [22
with 200 L of 0.5% BSA (Bovine Serum Albumin) followed by washing (3 times) with an assay buffer.
Next, 150 L of the membranes, diluted (1:150) in the buffer assay (50 mM Tris-HCl pH 7.4, 5 mM
MgCl2) to a final concentration of 0.6 g/well, were added to the wells followed by the addition of
cold (25 L) and hot ligand (25
L). The plate was incubated for 60 min at 27 ◦C under stirring and at
,
23]. Briefly, the 96-well plate was preincubated for 1–2 h at 4 ◦C
µ
µ
µ
µ
µ
the end of the experiment all wells were washed (9 times) with ice-cold wash buffer (50 mM Tris-HCl
pH 7.4) using vacuum. Afterwards, membranes were punched out and counted in a Perkin Elmer
(Waltham, MA, USA) Wizard2 2480 automatic gamma counter. The Ki values were calculated by a
non-linear curve fitting using GraphPad Prism 7.01 Software (San Diego, CA, USA). The experiment
was done in triplicate.
4.4.2. Cell Culture
Chinese hamster ovary cells CHO and CHO-AT1R (a gift of Professor Dr. Claudio Costa-Neto
from the Department of Biochemistry and Immunology, at the School of Medicine of Ribeir
ão Preto,
University of S o Paulo, Ribeir o Preto, Brazil), were cultured in high glucose Dulbecco’s modification
ã
ã
of Eagle medium (DMEM) (Gibco, Life technologies, MD, USA), supplemented with 10% of fetal
bovine serum (FBS) (Gibco, Life technologies, MD, USA), penicillin (100 U/mL) and streptomycin
(100 µg/mL) (Sigma-Aldrich, St. Louis, MO, USA), and kept at 37 ◦C and 5% CO2.
4.4.3. Real-Time Polymerase Chain Reaction (RT-PCR)
The AT1R mRNA abundance was measured in CHO-AT1R and CHO cells by RT-PCR. Total RNA
from cells was isolated with 1 mL of Tri-Reagent (Sigma-Aldrich, St. Louis, MO, USA) according

Molecules 2020, 25, 1872
16 of 21
to the manufacturer’s instructions. Complementary DNA was synthesized using the High capacity
cDNA RT kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s protocols.
Quantitative PCR analysis was performed in triplicate using the Power SYBR® Green PCR Master
Mix (Applied Biosystems). Relative quantification was done using the ∆∆Ct method normalizing to
β
-actin gene expression. Primer human AT1R: forward 50–30, GCGTCAGTTTCAACCTC; reverse 50–30,
TCCGGGACTCGTAATG. Primer hamster β
-actin: Forward 50–30, GGCAGGCAAAGGTTACTCTG;
reverse 50–30, TGGTGACAGGTGGACAAGAT.
4.4.4. Cell Binding Assays
The cell binding assays were performed based on previous reports [66] with modifications.
CHO-AT1R and CHO cells (2
hour at 4 ◦C with 10 Ci (370 kBq) of [18F]AMBF3Los per well, in presence or absence of the AT1R
blocker (losartan potassium (100 M/well) in PBS). To saturate the AT1R, the cells of the blocking
×
105) were plated in a 6-well plate overnight and then incubated for one
µ
µ
group were treated with losartan 30 min before adding the radiolabelled compound. At the end of the
incubation period, the supernatant was aspirated and cells were washed six times with ice-cold PBS,
and further removed with cell scraper and transferred to a gamma counter tube. The cellular activity
was counted in a Cobra II gamma counter (Packard).
4.5. In Vivo Assays
4.5.1. Animals
Experiments involving animals were approved by the Animal Ethics Committee of the University
of British Columbia (Protocol number: A16-0128). Immunodeficient NOD.Cg-PrkdcscidII2rgtm1Wjl/SzJ
(NSG) mice were obtained from an in-house breeding colony at the Animal Resource Centre at BC
Cancer Research Facility. Mice were always divided into baseline and AT1R blocked groups to assess
the AT1R binding specificity of [18F]AMBF3Los with the co-injection of the AT1R blocker losartan
(18 mg/kg, dissolved in PBS).
4.5.2. Imaging and Biodistribution Studies
The in vivo AT1R binding specificity of [18F]AMBF3Los was evaluated in healthy mice by a
dynamic PET scan. Healthy NSG mice were injected in the tail vein with 6
±
1 MBq (170
±
38 µCi)
of [18F]AMBF3Los and a sixty-minute dynamic PET scans was carried out on a
µPET/CT scanner
(Inveon, Siemens) following procedures reported previously [67]. Alternatively, [18F]AMBF3Los was
concomitantly injected with the AT1R blocker losartan (18 mg/kg) before the dynamic acquisition.
Before and during the acquisition, mice were sedated with a continuous flow of isoflurane anesthesia
(2% isoflurane in oxygen). The µPET/CT images were analyzed with PMOD v3.3 software (PMOD
Technologies, Zürich, Switzerland). An elliptical volume-of-interest that enclosed the entire kidney
was positioned manually on the PET images for the determination of the kidney volume. Then,
3-dimensional isocontours were drawn automatically. For each VOI, the percentage of the injected dose
in the region of interest, divided by the injected dose per animal weight (% ID/g) could be calculated
directly using the output parameters from the µPET.
After the sixty-minute dynamic PET scans, anesthetized mice were euthanized by carbon dioxide
asphyxiation and blood, fat, testis, intestines, stomach, spleen, liver, pancreas, adrenal glands, kidneys,
lungs, heart, muscle, bone and brain were harvested, rinsed in PBS, weighted and counted in a Perkin
Elmer (Waltham, MA, USA) Wizard2 2480 automatic gamma counter to quantify the percent of injected
dose per gram of tissue (% ID/g).
4.5.3. Autoradiography
Kidneys harvested from healthy NSG mice (after the biodistribution studies), were rinsed in
PBS and frozen in isopentane/dry-ice bath. Ten µm-thick slides of the kidneys were obtained using

Molecules 2020, 25, 1872
17 of 21
a cryostat (Leica, Wetzlar, Germany), and thaw-mounted onto Superfrost Plus microscope slides
(Fischerbrand from Thermo Fisher Scientific, Toronto, ON, Canada), following general procedures of
the lab [67]. Afterwards, kidney slides were exposed to a phosphor screen overnight and imaged on a
Typhoon FLA 9500 scanner (GE Healthcare, Chicago, IL, USA).
4.5.4. Statistical Analysis
Data was expressed as the mean
±
standard deviation (SD). The statistical analysis was performed
using GraphPad Prism 7.01 Software (San Diego, CA, USA). Data was analyzed by one unpaired
t-test (multiple t tests). The outliers were removed before analyzing the data. A p-value < 0.05 was
considered statistically significant.
5. Conclusions
Both FEtLos and AMBF3Los were successfully synthesized as novel derivatives of losartan.
The radiolabelled derivative [18F]FEtLos was synthetized high radiochemical purity and low molar
activity due to the small amount of 18F used, and resulted in a less lipophilic compound than losartan.
Still, [18F]FEtLos exhibited a low AT1R binding affinity. On the other hand, [18F]AMBF3Los was
synthetized with a high radiochemical purity and molar activity. Moreover, [18F]AMBF3Los was
slightly hydrophilic, and showed a high AT1R binding affinity and specificity. Our data suggests
that [18F]AMBF3Los might be a valuable PET imaging tracer for monitoring AT1R expression in
several diseases.
Supplementary Materials: The following are available online. Figure S1: 1H-NMR, 13C-NMR, 19F-NMR, and
HRMS (ES+) spectra of compound . Figure S2: 1H-NMR, 13C-NMR, 19F-NMR, HMBC and HRMS (ES+)
5
spectra of compound FEtLos. Figure S3: 1H-NMR, 13C-NMR, 13F-NMR, HMBC and HRMS (ES+) spectra of
compound 3 7
. Figure S4: 1H-NMR, 13C-NMR and HRMS (ES+) spectra of compound . Figure S5: 1H NMR,
13C-NMR, 19F-NMR, HMBC, HMBC and HRMS (ES+) spectra of compound AMBF3Los. Figure S6: Quality
control of the 18F-labeled compounds. Figure S7: In vitro assays with [18F]FEtLos. Figure S8. Ex vivo assays with
[
18F]FEtLos. Figure S9: Structure of NO-releasing derivatives of losartan. Figure S10: Structure of chelate-coupled
losartan-Leucine-Diglycoloyl-Tetraethyleneglycol–Tetraamine. Figure S11: Calibration curve for determining the
molar activity of [18F]AMBF3Los. Figure S12: Calibration curve for determining the molar activity of [18F]FEtLos.
Supplemental material and methods.
Author Contributions: M.S.O.P. performed the experiments involving the cold and hot synthesis, conducted
the biological assays, analyzed the data, reviewed the literature and wrote the manuscript; P.S.G.N. contributed
to the cold synthesis of the compound FEtLos and analysis of the spectroscopic data; S.N.d.S. carried out the
biological assays; Z.Z. performed the radiosynthesis of [18F]AMBF3Los using high activities of 18F; A.P.N. and
W.M.T. contributed to the experiments; E.A.P., Z.R.R., R.C., P.H.E., K.-S.L., I.C. and E.S.B. supervised the results.
E.S.B. conceived the study and was in charge of the overall direction and planning. All authors have read and
agreed to the published version of the manuscript.
Funding: This research was funded by the Young Investigator Grant from São Paulo Research Foundation—FAPESP,
Brazil (grant number 2012/06875-6), CAPES—Brazilian Federal Agency for Support and Evaluation of Graduate
Education within the Ministry of Education of Brazil—Finance Code 001 and by a scholarship provided with the
support of the Government of Canada (Emerging Leaders in the Americas Program—ELAP 2016–2017).
Acknowledgments: We strongly thank to François Bénard, Jutta Zeisler, Julie Rousseau, Chengcheng Zhang,
Hsiou-Ting Kuo, Iulia Dude and Joseph Lau from the Department of Molecular Oncology at BC Cancer Research
Centre, Vancouver, British Columbia, Canada. And to Angelica Bueno Barbezan, Yasniel Araujo Babi and staff
of the Radiopharmacy and Cyclotron Accelerator Centers of the Nuclear and Energy Research Institute IPEN,
São Paulo, Brazil.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Crowley, S.D.; Coffman, T.M. Recent advances involving the renin-angiotensin system. Exp. Cell Res. 2012
,
318, 1049–1056. [CrossRef] [PubMed]
2.
Unger, T. The role of the renin-angiotensin system in the development of cardiovascular disease. Am. J.
Cardiol. 2002, 89, 3A–9A, discussion 10A. [CrossRef]

Molecules 2020, 25, 1872
18 of 21
3.
4.
5.
Xu, F.; Mao, C.; Hu, Y.; Rui, C.; Xu, Z.; Zhang, L. Cardiovascular effects of losartan and its relevant clinical
application. Curr. Med. Chem. 2009, 16, 3841–3857. [PubMed]
Husain, K.; Hernandez, W.; Ansari, R.A.; Ferder, L. Inflammation, oxidative stress and renin angiotensin
system in atherosclerosis. World J. Biol. Chem. 2015, 6, 209–217. [CrossRef] [PubMed]
Brenner, B.M.; Cooper, M.E.; de Zeeuw, D.; Keane, W.F.; Mitch, W.E.; Parving, H.H.; Remuzzi, G.; Snapinn, S.M.;
Zhang, Z.; Shahinfar, S.; et al. Effects of losartan on renal and cardiovascular outcomes in patients with type
2 diabetes and nephropathy. N. Engl. J. Med. 2001, 345, 861–869. [CrossRef] [PubMed]
6.
7.
8.
9.
Vaziri, N.D.; Bai, Y.; Ni, Z.; Quiroz, Y.; Pandian, R.; Rodriguez-Iturbe, B. Intra-renal angiotensin II/AT1
receptor, oxidative stress, inflammation, and progressive injury in renal mass reduction. J. Pharmacol.
Exp. Ther. 2007, 323, 85–93. [CrossRef] [PubMed]
Zheng, C.M.; Wang, J.Y.; Chen, T.T.; Wu, Y.C.; Wu, Y.L.; Lin, H.T.; Chang, T.J.; Chu, N.F.; Su, S.L.; Chen, J.S.;
et al. Angiotensin-converting enzyme inhibitors or angiotensin receptor blocker monotherapy retard
deterioration of renal function in Taiwanese chronic kidney disease population. Sci. Rep. 2019, 9, 2694.
Joglar, B.; Rodriguez-Pallares, J.; Rodriguez-Perez, A.I.; Rey, P.; Guerra, M.J.; Labandeira-Garcia, J.L.
The inflammatory response in the MPTP model of Parkinson’s disease is mediated by brain angiotensin:
relevance to progression of the disease. J. Neurochem. 2009, 109, 656–669.
Li, N.C.; Lee, A.; Whitmer, R.A.; Kivipelto, M.; Lawler, E.; Kazis, L.E.; Wolozin, B. Use of angiotensin receptor
blockers and risk of dementia in a predominantly male population: Prospective cohort analysis. BMJ 2010
340, b5465. [CrossRef]
,
10. Labandeira-Garcia, J.L.; Rodríguez-Perez, A.I.; Garrido-Gil, P.; Rodriguez-Pallares, J.; Lanciego, J.L.;
Guerra, M.J. Brain Renin-Angiotensin System and Microglial Polarization: Implications for Aging and
Neurodegeneration. Front. Aging Neurosci. 2017, 9, 129. [CrossRef]
11. Jackson, L.; Eldahshan, W.; Fagan, S.C.; Ergul, A. Within the Brain: The Renin Angiotensin System. Int. J.
Mol. Sci. 2018, 19, 876. [CrossRef] [PubMed]
12. George, A.J.; Thomas, W.G.; Hannan, R.D. The renin-angiotensin system and cancer: old dog, new tricks.
Nat. Rev. Cancer 2010, 10, 745–759. [CrossRef] [PubMed]
13. Wegman-Ostrosky, T.; Soto-Reyes, E.; Vidal-Millán, S.; Sánchez-Corona, J. The renin-angiotensin system
meets the hallmarks of cancer. J. Renin Angiotensin Aldosterone Syst. 2015, 16, 227–233. [CrossRef] [PubMed]
14. Munro, M.J.; Wickremesekera, A.C.; Davis, P.F.; Marsh, R.; Tan, S.T.; Itinteang, T. Renin-angiotensin system
and cancer: a review. Integr. Cancer Sci. Ther. 2017, 4, 1–6.
15. Mathews, W.B.; Burns, H.D.; Dannals, R.F.; Ravert, H.T.; Naylor, E.M. Carbon-11 Labeling of a Potent,
Nonpeptide, AT1-Selective Angiotensin-I1 Receptor Antagonist: MK-996. J. Label Compd. Radiopharm. 1995
36, 729–737. [CrossRef]
,
16. Hamill, T.G.; Burns, H.D.; Dannals, R.F.; Mathews, W.B.; Musachio, J.L.; Ravert, H.T.; Naylor, E.M.
Development of [11C] L-159,884: a radiolabelled, nonpeptide angiotensin II antagonist that is useful for
angiotensin II, AT1 receptor imaging. Appl. Radiat. Isot. 1996, 47, 211–218. [CrossRef]
17. Mathews, W.B.; Yoo, S.E.; Lee, S.H.; Scheffel, U.; Rauseo, P.A.; Zober, T.G.; Gocco, G.; Sandberg, K.; Ravert, H.T.;
Dannals, R.F.; et al. A novel radioligand for imaging the AT1 angiotensin receptor with PET. Nucl. Med. Biol.
2004, 31, 571–574. [CrossRef]
18. Hadizad, T.; Kirkpatrick, S.A.; Mason, S.; Burns, K.; Beanlands, R.S.; DaSilva, J.N. Novel O-[11C]methylated
derivatives of candesartan as angiotensin II AT1 receptor imaging ligands: Radiosynthesis and ex vivo
evaluation in rats. Bioorg. Med. Chem. 2009, 17, 7971–7977. [CrossRef]
19. Iimori, H.; Hashizume, Y.; Sasaki, M.; Kajiwara, Y.; Sugimoto, Y.; Sugiyama, Y.; Watanabe, Y.; Senda, M. First
automatic radiosynthesis of 11C labeled Telmisartan using a multipurpose synthesizer for clinical research
use. Ann. Nucl. Med. 2011, 25, 333–337. [CrossRef]
20. Hadizad, T.; Collins, J.; E Antoun, R.; S Beanlands, R.; N DaSilva, J. [11C] Methyl-losartan as a potential ligand
for PET imaging angiotensin II AT1 receptors. J. Label Compd. Radiopharm. 2011, 54, 754–757. [CrossRef]
21. Arksey, N.; Hadizad, T.; Ismail, B.; Hachem, M.; Valdivia, A.C.; Beanlands, R.S.; deKemp, R.A.; DaSilva, J.N.
Synthesis and evaluation of the novel 2-[18F]fluoro-3-propoxy-triazole-pyridine-substituted losartan for
imaging AT1 receptors. Bioorg. Med. Chem. 2014, 22, 3931–3937. [CrossRef] [PubMed]
22. Chen, X.; Hirano, M.; Werner, R.A.; Decker, M.; Higuchi, T. Novel 18 F-Labeled PET Imaging Agent FV45
Targeting the Renin - Angiotensin System. ACS Omega 2018, 3, 10460–10470. [CrossRef] [PubMed]

Molecules 2020, 25, 1872
19 of 21
23. Hoffmann, M.; Chen, X.; Hirano, M.; Arimitsu, K.; Kimura, H.; Higuchi, T.; Decker, M. F-Labeled Derivatives
of Irbesartan for Angiotensin II Receptor PET Imaging. ChemMedChem 2018, 13, 2546–2557. [CrossRef]
[PubMed]
24. Ismail, B.; Hadizad, T.; Antoun, R.; Lortie, M.; deKemp, R.A.; Beanlands, R.S.; DaSilva, J.N. Evaluation of
[(11)C]methyl-losartan and [(11)C]methyl-EXP3174 for PET imaging of renal AT1receptor in rats. Nucl. Med.
Biol. 2015, 42, 850–857. [CrossRef]
25. Conti, M.; Eriksson, L. Physics of pure and non-pure positron emitters for PET: A review and a discussion.
EJNMMI Phys. 2016, 3, 8. [CrossRef]
26. Cole, E.L.; Stewart, M.N.; Littich, R.; Hoareau, R.; Scott, P.J. Radiosyntheses using fluorine-18: The art and
science of late stage fluorination. Curr. Top Med. Chem. 2014, 14, 875–900. [CrossRef]
27. Jacobson, O.; Kiesewetter, D.O.; Chen, X. Fluorine-18 radiochemistry, labeling strategies and synthetic routes.
Bioconjug. Chem. 2015, 26, 1–18. [CrossRef]
28.
D
é
zsi, C.A. The different therapeutic choices with ARBs. Which one to give? When? Why? Am. J.
Cardiovasc. Drugs 2016, 16, 255–266. [CrossRef]
29. Schoultz, B.W.; Reed, B.J.; Marton, J.; Willoch, F.; Henriksen, G. A fully automated radiosynthesis of
[18F]fluoroethyl-diprenorphine on a single module by use of SPE cartridges for preparation of high quality
2-[18F]fluoroethyl tosylate. Molecules 2013, 18, 7271–7278. [CrossRef]
30. Kniess, T.; Laube, M.; Brust, P.; Steinbach, J. 2-[18 F] Fluoroethyl tosylate–a versatile tool for building 18
F-based radiotracers for positron emission tomography. MedChemComm 2015, 6, 1714–1754. [CrossRef]
31. Kettenbach, K.; Schieferstein, H.; Ross, T.L. 18F-labeling using click cycloadditions. Biomed. Res. Int. 2014
2014, 361329. [CrossRef] [PubMed]
,
32. Glaser, M.; Robins, E.G. “Click labeling” in PET radiochemistry. J. Label Compd. Radiopharm. 2009, 52, 407–414.
[CrossRef]
33. Pretze, M.; Pietzsch, D.; Mamat, C. Recent trends in bioorthogonal click-radiolabeling reactions using
fluorine-18. Molecules 2013, 18, 8618–8665. [CrossRef] [PubMed]
34. Liu, Z.; Pourghiasian, M.; Radtke, M.A.; Lau, J.; Pan, J.; Dias, G.M.; Yapp, D.; Lin, K.S.; Bénard, F.; Perrin, D.M.
An organotrifluoroborate for broadly applicable one-step 18F-labeling. Angew. Chem. Int. Ed. Engl. 2014, 53,
11876–11880. [CrossRef]
35. Liu, Z.; Radtke, M.A.; Wong, M.Q.; Lin, K.S.; Yapp, D.T.; Perrin, D.M. Dual mode fluorescent (18)F-PET
tracers: efficient modular synthesis of rhodamine-[cRGD]2-[(18)F]-organotrifluoroborate, rapid, and high
yielding one-step (18)F-labeling at high specific activity, and correlated in vivo PET imaging and ex vivo
fluorescence. Bioconjug. Chem. 2014, 25, 1951–1962. [CrossRef]
36. Liu, Z.; Lin, K.S.; Bénard, F.; Pourghiasian, M.; Kiesewetter, D.O.; Perrin, D.M.; Chen, X. One-step (18)F
labeling of biomolecules using organotrifluoroborates. Nat. Protoc. 2015, 10, 1423–1432. [CrossRef]
37. Bernard-Gauthier, V.; Aliaga, A.; Boudjemeline, M.; Hopewell, R.; Kostikov, A.; Rosa-Neto, P.; Thiel, A.;
Schirrmacher, R. Syntheses and evaluation of carbon-11- and fluorine-18-radiolabeled pan-tropomyosin
receptor kinase (Trk) inhibitors: exploration of the 4-aza-2-oxindole scaffold as Trk PET imaging agents. ACS
Chem. Neurosci. 2015, 6, 260–276. [CrossRef]
38. Pourghiasian, M.; Liu, Z.; Pan, J.; Zhang, Z.; Colpo, N.; Lin, K.S.; Perrin, D.M.; Bénard, F. (18)F-AmBF3-MJ9:
a novel radiofluorinated bombesin derivative for prostate cancer imaging. Bioorg. Med. Chem. 2015, 23,
1500–1506. [CrossRef]
39. Fukushima, K.; Bravo, P.E.; Higuchi, T.; Schuleri, K.H.; Lin, X.; Abraham, M.R.; Xia, J.; Mathews, W.B.;
Dannals, R.F.; Lardo, A.C.; et al. Molecular hybrid positron emission tomography/computed tomography
imaging of cardiac angiotensin II type 1 receptors. J. Am. Coll. Cardiol. 2012, 60, 2527–2534. [CrossRef]
40. Valenta, I.; Szabo, Z.; Mathews, W.; Dannals, R.; Pomper, M.; Abraham, T.; Schindler, T. Abnormal regional
increase of myocardial angiotensin II type 1 receptors in hypertrophic obstructive cardiomyopathy patients
as determined with 11C-KR31173 and PET/CT. J. Nucl. Med. 2017, 58, 439.
41. Szabo, Z.; Speth, R.C.; Brown, P.R.; Kerenyi, L.; Kao, P.F.; Mathews, W.B.; Ravert, H.T.; Hilton, J.; Rauseo, P.;
Dannals, R.F.; et al. Use of positron emission tomography to study AT1 receptor regulation in vivo. J. Am.
Soc. Nephrol. 2001, 12, 1350–1358. [PubMed]
42. Zober, T.G.; Fabucci, M.E.; Zheng, W.; Brown, P.R.; Seckin, E.; Mathews, W.B.; Sandberg, K.; Szabo, Z. Chronic
ACE inhibitor treatment increases angiotensin type 1 receptor binding in vivo in the dog kidney. Eur. J. Nucl.
Med. Mol. Imaging 2008, 35, 1109–1116. [CrossRef] [PubMed]

Molecules 2020, 25, 1872
20 of 21
43. Lortie, M.; DaSilva, J.N.; Kirkpatrick, S.A.; Hadizad, T.; Ismail, B.A.; Beanlands, R.S.; deKemp, R.A. Analysis
of [11C]methyl-candesartan kinetics in the rat kidney for the assessment of angiotensin II type 1 receptor
density in vivo with PET. Nucl. Med. Biol. 2013, 40, 252–261. [CrossRef] [PubMed]
44. Hachem, M.; Tiberi, M.; Ismail, B.; Hunter, C.R.; Arksey, N.; Hadizad, T.; Beanlands, R.S.; deKemp, R.A.;
DaSilva, J.N. Characterization of 18F-FPyKYNE-Losartan for Imaging AT1 Receptors. J. Nucl. Med. 2016, 57,
1612–1617. [CrossRef] [PubMed]
45. Noda, A.; Fushiki, H.; Murakami, Y.; Sasaki, H.; Miyoshi, S.; Kakuta, H.; Nishimura, S. Brain penetration of
telmisartan, a unique centrally acting angiotensin II type 1 receptor blocker, studied by PET in conscious
rhesus macaques. Nucl. Med. Biol. 2012, 39, 1232–1235. [CrossRef] [PubMed]
46. Verjans, J.W.; Lovhaug, D.; Narula, N.; Petrov, A.D.; Indrevoll, B.; Bjurgert, E.; Krasieva, T.B.; Petersen, L.B.;
Kindberg, G.M.; Solbakken, M.; et al. Noninvasive imaging of angiotensin receptors after myocardial
infarction. JACC Cardiovasc. Imaging 2008, 1, 354–362. [CrossRef]
47. Breschi, M.C.; Calderone, V.; Digiacomo, M.; Martelli, A.; Martinotti, E.; Minutolo, F.; Rapposelli, S.;
Balsamo, A. NO-sartans: A new class of pharmacodynamic hybrids as cardiovascular drugs. J. Med. Chem.
2004, 47, 5597–5600. [CrossRef]
48. Carini, D.J.; Duncia, J.J.V.; Aldrich, P.E.; Chiu, A.T.; Johnson, A.L.; Pierce, M.E.; Price, W.A.; Santella, J.B.;
Wells, G.J.; Wexler, R.R.; et al. Nonpeptide angiotensin II receptor antagonists: the discovery of a series
of N-(biphenylylmethyl) imidazoles as potent, orally active antihypertensives. J. Med. Chem. 1991, 34,
2525–2547. [CrossRef]
49. Vauquelin, G.; Fierens, F.L.; Gáborik, Z.; Le Minh, T.; De Backer, J.P.; Hunyady, L.; Vanderheyden, P.M. Role
of basic amino acids of the human angiotensin type 1 receptor in the binding of the non-peptide antagonist
candesartan. J. Renin Angiotensin Aldosterone Syst. 2001, 2, S32–S36. [CrossRef]
50. Zhang, H.; Unal, H.; Gati, C.; Han, G.W.; Liu, W.; Zatsepin, N.A.; James, D.; Wang, D.; Nelson, G.;
Weierstall, U.; et al. Structure of the Angiotensin receptor revealed by serial femtosecond crystallography.
Cell 2015, 161, 833–844. [CrossRef]
51. Neochoritis, C.G.; Zhao, T.; Dömling, A. Tetrazoles via Multicomponent Reactions. Chem. Rev. 2019, 119,
1970–2042. [CrossRef] [PubMed]
52. Lau, J.; Liu, Z.; Lin, K.S.; Pan, J.; Zhang, Z.; Vullo, D.; Supuran, C.T.; Perrin, D.M.; Bénard, F. Trimeric
Radiofluorinated Sulfonamide Derivatives to Achieve In Vivo Selectivity for Carbonic Anhydrase IX-Targeted
PET Imaging. J. Nucl. Med. 2015, 56, 1434–1440. [CrossRef] [PubMed]
53. Liu, Z.; Pourghiasian, M.; Bénard, F.; Pan, J.; Lin, K.S.; Perrin, D.M. Preclinical evaluation of a high-affinity
18F-trifluoroborate octreotate derivative for somatostatin receptor imaging. J. Nucl. Med. 2014, 55, 1499–1505.
[CrossRef]
54. Gonçalves Nunes, P.S.; Zhang, Z.; Kuo, H.T.; Zhang, C.; Rousseau, J.R.; Rousseau, E.; Lau, J.; Kwon, D.;
Carvalho, I.; Bénard, F.; et al. Synthesis and evaluation of an 18F-labeled trifluoroborate derivative of
2-nitroimidazole for imaging tumor hypoxia with positron emission tomography. J. Label Compd. Radiopharm.
2018, 61, 370–379. [CrossRef] [PubMed]
55. Lin, K.-S.; Benard, F.; Perrin, D.M. Organoboronates: Captors of 18F-fluoride for one-step radiofluorination
of biomolecules. In Fluorine in Life Sciences: Pharmaceuticals, Medicinal Diagnostics, and Agrochemicals; Inc., E.,
Haufe, G., Leroux, F.R., Eds.; Academic Press: London, UK, 2019; pp. 519–549.
56. Kalgutkar, A.S.; Daniels, J.S. Carboxylic acids and their bioisosteres. In Metabolism, Pharmacokinetics and
Toxicity of Functional Groups: Impact of Chemical Buildins Blocks on ADMET; Smith, D.A., Ed.; Royal Society of
Chemistry: Cambridge, UK, 2010; pp. 99–167.
57. Watanabe, Y.; Shibata, K.; Kikkawa, F.; Kajiyama, H.; Ino, K.; Hattori, A.; Tsujimoto, M.; Mizutani, S.
Adipocyte-derived leucine aminopeptidase suppresses angiogenesis in human endometrial carcinoma via
renin-angiotensin system. Clin. Cancer Res. 2003, 9, 6497–6503.
58. Suganuma, T.; Ino, K.; Shibata, K.; Kajiyama, H.; Nagasaka, T.; Mizutani, S.; Kikkawa, F. Functional expression
of the angiotensin II type1 receptor in human ovarian carcinoma cells and its blockade therapy resulting
in suppression of tumor invasion, angiogenesis, and peritoneal dissemination. Clin. Cancer Res. 2005, 11,
2686–2694. [CrossRef]
59. Uemura, H.; Hasumi, H.; Ishiguro, H.; Teranishi, J.; Miyoshi, Y.; Kubota, Y. Renin-angiotensin system is an
important factor in hormone refractory prostate cancer. Prostate 2006, 66, 822–830. [CrossRef]

Molecules 2020, 25, 1872
21 of 21
60. Tanaka,N.; Miyajima,A.; Kosaka,T.; Shirotake,S.; Hasegawa,M.; Kikuchi,E.; Oya,M.Cis-dichlorodiammineplatinum
upregulatesangiotensinIItype1receptorsthroughreactiveoxygenspeciesgenerationandenhancesVEGFproduction
in bladder cancer. Mol. Cancer Ther. 2010, 9, 2982–2992. [CrossRef]
61. Du, N.; Feng, J.; Hu, L.J.; Sun, X.; Sun, H.B.; Zhao, Y.; Yang, Y.P.; Ren, H. Angiotensin II receptor type 1
blockers suppress the cell proliferation effects of angiotensin II in breast cancer cells by inhibiting AT1R
signaling. Oncol. Rep. 2012, 27, 1893–1903.
62. Huang, M.M.; Guo, A.B.; Sun, J.F.; Chen, X.L.; Yin, Z.Y. Angiotensin II promotes the progression of human
gastric cancer. Mol. Med. Rep. 2014, 9, 1056–1060. [CrossRef]
63. Coulson, R.; Liew, S.H.; Connelly, A.A.; Yee, N.S.; Deb, S.; Kumar, B.; Vargas, A.C.; O’Toole, S.A.; Parslow, A.C.;
Poh, A.; et al. The angiotensin receptor blocker, Losartan, inhibits mammary tumor development and
progression to invasive carcinoma. Oncotarget 2017, 8, 18640–18656. [CrossRef] [PubMed]
64. Zhao, Y.; Cao, J.; Melamed, A.; Worley, M.; Gockley, A.; Jones, D.; Nia, H.T.; Zhang, Y.; Stylianopoulos, T.;
Kumar, A.S.; et al. Losartan treatment enhances chemotherapy efficacy and reduces ascites in ovarian cancer
models by normalizing the tumor stroma. Proc. Natl. Acad. Sci. USA 2019, 116, 2210–2219. [CrossRef]
[PubMed]
65. Lin, K.S.; Pan, J.; Amouroux, G.; Turashvili, G.; Mesak, F.; Hundal-Jabal, N.; Pourghiasian, M.; Lau, J.;
Jenni, S.; Aparicio, S.; et al. In vivo radioimaging of bradykinin receptor b1, a widely overexpressed molecule
in human cancer. Cancer Res. 2015, 75, 387–393. [CrossRef] [PubMed]
66. Oroujeni, M.; Abouzayed, A.; Lundmark, F.; Mitran, B.; Orlova, A.; Tolmachev, V.; Rosenström, U.
Evaluation of Tumor-Targeting Properties of an Antagonistic Bombesin Analogue RM26 Conjugated with a
Non-Residualizing Radioiodine Label Comparison with a Radiometal-Labelled Counterpart. Pharmaceutics
2019, 11, 380. [CrossRef] [PubMed]
67. Zhang, C.; Zhang, Z.; Lin, K.-S.; Pan, J.; Dude, I.; Hundal-Jabal, N.; Colpo, N.; Bénard, F. Preclinical melanoma
imaging with 68Ga-labeled -melanocyte-stimulating hormone derivatives using PET. Theranostics 2017, 7,
α
805–8013. [CrossRef] [PubMed]
Sample Availability: Samples of the compounds FEtLos and AMBF3Los are available from the authors.
©
2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).