Enzymatic incorporation and fluorescent labelling of cyclooctyne-modified deoxyuridine triphosphates in DNA

Article abstract of DOI:10.1016/j.bmc.2014.05.050

The amino group of 5-aminopropargyl-2′-deoxyuridine-5′- triphosphate was labelled with dibenzocyclooctyne (DIBO) and two derivatives of bicyclo [6.1.0] non-4-yne (BCN) with short and long linkers to produce three different cycloalkyne-modified deoxyuridine triphosphates. BCN was successfully incorporated into DNA at multiple sites by enzyme-mediated primer extension and the polymerase chain reaction (PCR). Efficient fluorescent labelling of the BCN-DNA and DIBO-DNA with Cy3-azide was demonstrated.

Full text of DOI:10.1016/j.bmc.2014.05.050

Accepted Manuscript
Enzymatic Incorporation and Fluorescent Labelling of Cyclooctyne-Modified
Deoxyuridine Triphosphates in DNA
Xiaomei Ren, Marta Gerowska, Afaf H. El-Sagheer, Tom Brown
PII:
S0968-0896(14)00409-X
http://dx.doi.org/10.1016/j.bmc.2014.05.050
BMC 11611
DOI:
Reference:
To appear in:
Bioorganic & Medicinal Chemistry
Received Date:
Revised Date:
Accepted Date:
8 March 2014
16 May 2014
22 May 2014
Please cite this article as: Ren, X., Gerowska, M., El-Sagheer, A.H., Brown, T., Enzymatic Incorporation and
Fluorescent Labelling of Cyclooctyne-Modified Deoxyuridine Triphosphates in DNA, Bioorganic & Medicinal
Chemistry (2014), doi: http://dx.doi.org/10.1016/j.bmc.2014.05.050
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Graphical Abstract
Enzymatic Incorporation and Fluorescent
Labelling of Cyclooctyne-Modified
Deoxyuridine Triphosphates in DNA
a
b
a,c
a
Xiaomei Ren , Marta Gerowska , Afaf H. El-Sagheer and Tom Brown *
a
Department of Chemistry, University of Oxford, Chemistry Research Laboratory, Oxford, OX1 3TA, UK
School of Chemistry, University of Southampton, Highfield, Southampton, SO17 1BJ, UK
b
c
Chemistry Branch, Department of Science and Mathematics, Faculty of Petroleum and Mining Engineering,
Suez University, Suez, 43721, Egypt
BCN and DIBO modified deoxyuridine triphosphates were successfully incorporated into DNA at
multiple sites by enzyme-mediated primer extension and the polymerase chain reaction (PCR).
Efficient fluorescent labelling of the BCN-DNA and DIBO-DNA with Cy3-azide was demonstrated.

Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com
Enzymatic Incorporation and Fluorescent Labelling of Cyclooctyne-Modified
Deoxyuridine Triphosphates in DNA
a
b
a,c
a
Xiaomei Ren , Marta Gerowska , Afaf H. El-Sagheer and Tom Brown *
a
Department of Chemistry, University of Oxford, Chemistry Research Laboratory, Oxford, OX1 3TA, UK
School of Chemistry, University of Southampton, Highfield, Southampton, SO17 1BJ, UK
b
c
Chemistry Branch, Department of Science and Mathematics, Faculty of Petroleum and Mining Engineering, Suez University, Suez, 43721, Egypt
*
To whom correspondence should be sent: Tel: +44(0)0865 275413, E-mail: tom.brown@chem.ox.ac.uk
ARTICLE INFO
ABSTRACT
Article history:
Received
Received in revised form
Accepted
The amino group of 5-aminopropargyl-2'-deoxyuridine-5'-triphosphate was labelled with
dibenzocyclooctyne (DIBO) and two derivatives of bicyclo [6.1.0] non-4-yne (BCN) with short
and long linkers to produce three different cycloalkyne-modified deoxyuridine triphosphates.
BCN was successfully incorporated into DNA at multiple sites by enzyme-mediated primer
extension and the polymerase chain reaction (PCR). Efficient fluorescent labelling of the BCN-
DNA and DIBO-DNA with Cy3-azide was demonstrated.
Available online
Keywords:
Keyword_1 copper free click
Keyword_2 DNA fluorescent labelling
Keyword_3 cyclooctyne deoxyuridine triphosphates
Keyword_4 BCN
2
014 Elsevier Ltd. All rights reserved.
Keyword_5 DIBO
1
. Introduction
creating chemically modified PCR templates.[8, 25, 26]
Chemically modified DNA is used extensively in biology,
However, despite the spectacular success of the CuAAC
reaction in the nucleic acid field, Cu has one particular
I
diagnostics, and nanotechnology. Recently the field of nucleic
acid chemistry underwent a revolution when click chemistry [1]
limitation. It is cytotoxic, and is therefore not compatible with in
vivo applications of nucleic acids, or for use in experiments that
involve living cells.[27-30] Unfortunately the uncatalyzed
copper-free DNA-templated AAC Huisgen reaction is very
slow[31] unless highly activated terminal alkynes are used, but
these are unstable in aqueous media so they cannot be used in
biology. For carbohydrates and other biomolecules the issue of
biocompatibility has been elegantly solved by the development of
the ring strain-promoted azide-alkyne [3+2] cycloaddition
reaction (SPAAC) (Figure 1.A).[32-35] This involves the
uncatalyzed reaction between an azide and a strained alkyne,
normally a cyclooctyne derivative, and is promoted by distortion
I
and in particular the Cu catalyzed [3+2] azide-alkyne
cycloaddition reaction (CuAAC reaction)[2, 3] was discovered.
This reaction has the considerable advantage in the context of
nucleic acids that the reacting alkyne and azide groups are stable
in aqueous buffer and do not cross-react with other functional
groups. The CuAAC reaction has been utilized extensively[4] as
a method of joining together single strands of DNA,[5] cross-
linking complementary strands,[6] cyclizing single and double
strands,[5, 7] labelling oligonucleotides with reporter groups,[8-
1
0] immobilizing DNA on surfaces,[11] constructing nanowires
from DNA templates,[12] building DNA nanostructures,[13]
producing analogues of DNA with modified nucleobases[14, 15]
and backbones,[16-21] synthesizing chemically modified RNA
constructs,[22, 23] monitoring DNA synthesis in vivo[24] and
2
of the sp-orbitals of the alkyne. Reaction to form a triazole (sp
hybridisation) allows release of energy accompanied by the
formation of a stable product. Analogues of cyclooctyne have
been synthesized which are modified to increase reactivity.[32,
3
3], and the SPAAC reaction using these has recently been
adopted for nucleic acids, both in oligonucleotide labelling[36,
7] and copper-free DNA strand ligation.[38] Phosphoramidite
3
monomers have been synthesized for internal[38] and terminal
labelling[39] of DNA with cyclooctynes such as DIBO
(dibenzocyclooctyne, Figure 1.B).[39, 40] For applications in
Figure 1. A: Oligonucleotide ligation and labelling by the ring-strain
promoted alkyne-azide cycloaddition reaction (SPAAC). B: DIBO, C:
BCN.
which diastereoisomers of the product of the SPAAC reaction
might be undesirable, achiral bicycle [6.1.0] nonyne (BCN,

Figure 1.C)[41, 42] has been employed.[43, 44] Due to its
symmetry, BCN produces only enantiomeric products.
triphosphate by the Yoshikawa procedure.[56] Phosphorus
oxychloride (POCl ) in trimethylphosphate was employed to
3
generate the 5'-dichlorophosphate, and the reaction mixture was
treated with a tetrabutylammonium salt of pyrophosphate to
produce the required triphosphate. In order to minimize the
production of 3', 5'-diphosphate by-products, the reaction was
conducted at –15 ºС. 5-Aminopropargyl-dUTP was then labelled
with the active esters of DIBO, BCN-I and BCN-II to yield three
activated cyclooctyne-modified triphosphates (dMTPs) (Scheme
Enzymatic incorporation of terminal alkyne and azide
modifications into DNA by polymerase enzymes is an efficient
and widely employed method of DNA labelling.[10, 25, 45-48]
Clearly it would be desirable if this methodology could be used
to incorporate reactive cyclooctyne derivatives for applications
such as the synthesis of fluorescent probes. Here we report the
synthesis of three new DIBO and BCN-modified deoxyuridine
triphosphates. We describe their incorporation into DNA by
enzymatic primer extension and polymerase chain reactions, and
demonstrate efficient fluorescent labelling of the BCN and
DIBO-modified DNA with Cy3 hexylazide via the SPAAC
reaction (Figure 2).
1
).
Scheme 1. Labelling of aminopropargyl-dUTP with DIBO, BCN-I and BCN-II
Figure 2. Enzyme-mediated primer extension reaction using DIBO and
active esters to produce 5-cyclooctyne-modified dUTPs. Reagents: DMF and
BCN-modified triphosphates followed by labelling with Cy3-azide.
°
triethylammonium bicarbonate buffer, 4 h, 55 C.
2
.2. Primer extension reactions and PCR
2
. Results and discussion
Table 1. Oligonucleotide sequences used in primer extension, reverse
2
.1. Preparation of cycloalkyne modified deoxyuridine
transcription and PCR.
triphosphates
Code
T1
Sequences(5'-3')
Mass Mass
Calc. Found
Deoxyuridine triphosphate is the simplest of the natural
dNTPs to modify chemically. The C5-position of uracil is remote
from the H-bonding residues that are involved in Watson-Crick
base-pairing, and functional groups attached at this site protrude
into space in the major groove of the DNA duplex, without
disruption of the normal B-conformation. Hence 5-modified
dUTPs (dMTPs) are likely to be compatible with enzymatic
incorporation by DNA polymerases, provided that the
modification does not inhibit polymerase binding.[49-51] The
aminopropargyl linkage is a particularly useful functionality
because the ethynyl moiety is known to be compatible with DNA
polymerases, and the primary amine is a suitable attachment
point for carboxylic acid derivatives of reporter groups, thereby
enabling the synthesis of various functionalized dMTPs from a
common intermediate.[49, 52, 53] In fact aminopropargyl dUTP
is an interesting dMTP in its own right, as it has a short linker in
the position normally occupied by the methyl group of dTTP, so
it is likely to be a good substrate for various DNA polymerase
enzymes.[54] We chose to synthesize three different cyclooctyne
dUTP derivatives; a DIBO derivative which has a short linker
between the cyclooctyne and the uracil base, and two different
BCN dUTP derivatives with short and long linkers (BCN-I and
BCN-II, Scheme 1). We expected that the presence of the bulky
DIBO ring might lead to less efficient incorporation by DNA
polymerases than BCN, and that placing the BCN ring further
from the uracil base and away from the enzyme active site would
lead to more efficient enzymatic incorporation. In order to
synthesize these cyclooctyne deoxyuridine triphosphates we first
required the common intermediate, aminopropargyl dUTP. The
Sonogashira reaction was used to attach aminoprop-2-yne to 5-
iododeoxyuridine[53, 55] which was then converted to its 5'-
CAGTCACTGTACTGCCGACACACATAA
CC (DNA template)
CAGTCACAAAACTGCCGACACACATAA
CC (DNA template)
FAM-GGTTATGTGTGTCGGCAG (primer )
CAGUCACUGUACUGCCGACACACAUAA
CC (RNA template)
GCATTCGAGCAACGTAAG (PCR primer)
GGTTATGTGTGTCGGCAG (PCR primer)
FAM-
8776
8775
T2
8778
8777
P3
T4
6138
9169
6138
9169
P5
P6
T7
6548
7040
6548
7040
GGTTATGTGTGTCGGCAGTATTGTCAG
TGTGAATTCCAGAGTGTGAGATTGTGT
GCTGGCGATCTTACGTTGCTCGAATGC
(PCR template)
FAM is 6-carboxyfluorescein. The RNA template has the equivalent
sequence to the DNA template T1. The bold A (A/T for PCR) shows the site
to incorporate the modified triphosphates.
Primer extension is a biochemical approach to the synthesis of
chemically modified DNA of defined sequence and substitution
pattern. Primer extension reactions utilizing amino, DIBO, BCN-
I and BCN-II dMTPs were carried out with family A (Klenow
large fragment) and family B polymerases (Therminator II, Gotaq
and KOD). The sequences of primers and templates are shown in
Table 1. The 5'-end of the primer was labelled with 6-
carboxyfluorescein (FAM) for ease of visualization on analytical
polyacrylamide gels. Two templates were used with different
numbers and arrangements of adenine bases after the starting
point of linear copying. Template (T1) begins with one A, and
contains just three adenines for replication while the “highly
demanding” template (T2) starts with four consecutive adenines
(A) and contains six adenine bases to be replicated. In each case

the primer must be extended by 11 bases for complete replication
to give a 29-mer product. Alternatively the primer can be
extended using only the modified triphosphate to give shorter
products, a 19-mer with template T1 and a 22-mer with template
T2. The four natural dNTPs (dATP, dCTP, dGTP, dTTP) were
used in control experiments.
with any of the polymerases used (see SI). It is noteworthy that
the most suitable cyclooctyne dUTP in this study is the one with
the smallest mass attached to the 5-position of the uracil base
(BCN-I), even though this has a much shorter linker than BCN-
II.
Polyacrylamide gel electrophoresis (PAGE) and mass
spectrometry confirmed that KOD, Therminator II, Gotaq and
Klenow large fragment polymerases successfully incorporated all
four dMTPs into the template T1 (Figures 3 and SI). All the
copies of the templates containing dMTPs (Figure 3.A, lanes 1,
2
) exhibited lower electrophoretic mobility compared to the
natural counterparts (Figure 3.A, lane 4, 5). This is due to the
extra bulk of the modified uracil bases, particularly in the case of
BCN-II dMTP with a long linker which showed a large
difference in mobility compared to the natural counterparts. The
polymerases incorporated one or two additional nucleotides at the
3
'-end of the linear copy of the template when using only dTTP
or dMTPs (Figure 3, lane 4 and SI). When modified dNTPs are
incorporated into DNA enzymatically the modified dNTP is
usually doped with its natural counterpart to avoid premature
termination of replication. We therefore explored the effect of
mixing the individual dMTPs with dTTP (Figure 3.A, lane 3) and
found that the modified triphosphates were all able to compete
effectively, producing fully extended primers with a mixture of
dTTP and dMTP opposite to the dA sites in the template. This is
evident from the multiple or broader bands of the fully extended
mixed products of dMTP with dTTP, dATP, dCTP, dGTP
Figure 4. Primer extension reactions with P3 (66 pmol), T2 (132 pmol), BCN-
I dMTP (3.2 nmol for each triphosphate). A: Lane 1, BCN-I dMTP using
Klenow polymerase (2 units); lane 2, dMTP + dATP + dCTP + dGTP using
Klenow polymerase (2 units); lane 3, dMTP + dATP + dCTP + dGTP using
Therminator II polymerase (1 unit). (20 % PAGE gel) B: Reactions using
2
KOD polymerase (2 units, 0.4 mM MgCl ). Lane 1, BCN-I dMTP; lane 2,
BCN-I dMTP +dATP + dCTP + dGTP. (20 % PAGE gel) C: Mass spectrum
of fully extended primer (BCN-I Full) from B-lane 2 (calc. mass 10845, found
10844).
(
Figure 3.A, lane 3) compared to the control dNTP (lane 5).
Figure 3. Primer extension reactions using Klenow polymerase (1 unit) with
P3 (66 pmol) and T1 (132 pmol). 3.2 nmol of dMTPs or dNTPs for each
triphosphate were used unless otherwise stated. A: Lane N, P3 + T1 without
triphosphates; lane 1, dMTP; lane 2, dMTP + dATP + dCTP + dGTP; lane 3,
dMTP (2.1 nmol) + dTTP (1.1 nmol) + dATP + dCTP + dGTP; lane 4, dTTP;
lane 5, dTTP + dATP + dCTP + dGTP (20% PAGE gel). B: Mass spectra of
fully extended primers: BCN-I Full is produced from BCN-I dMTP + dATP
Figure 5. Cy3-azide labelling of primer extension products from P3, T1 and
dMTPs using Gotaq polymerase (1 unit). Lane P, P3; lane 1, BCN-I dMTP
(non-labelled); lane 2, BCN-I dMTP labelled with Cy3-azide; lane 3, DIBO
dMTP (non-labelled); lane 4, DIBO dMTP labelled with Cy3-azide. (20 %
PAGE gel) A: Picture was taken using transilluminator light and UV filter. B:
Picture was taken using normal digital camera. C: Fluorescent spectra of lane 2
+
dCTP + dGTP (calc. 10202, found 10202); BCN-II Full is produced from
BCN-II dMTP + dATP + dCTP + dGTP (calc. 10934, found 10934); DIBO
Full is produced from DIBO dMTP + dATP + dCTP + dGTP (calc. mass
(BCN-I labelled) and lane 4 (DIBO labelled) products (Excited at 540 nm on
1
0412, found 10412).
PE LS50B fluorimeter). D: Mass spectra of one base extended primers, non-
labelled product (NL) and Cy3-azide labelled product (L). BCN-I NL (lane 1
in PAGE): calc.6657 [M], found 6661[M] and 6683 [M+Na]; BCN-I L (lane 2
in PAGE): calc. 7125, found 7130; DIBO NL (lane 3 in PAGE), calc. 6727
Next template T2 with four consecutive adenines was used to
evaluate the incorporation of the various dMTPs in a highly
demanding case. Encouragingly dMTP containing short chain
BCN-I was successfully incorporated by KOD, Therminator II
and Klenow polymerases (Figure 4). The dMTP containing long
chain BCN-II gave fully and partially extended products, whereas
the more bulky DIBO did not produce a fully extended product
[M], found 6732 [M] and 6754 [M+Na]; DIBO L (lane 4 in PAGE), calc.7195,
found 7200.
2.3. Fluorescent labelling

template T7. The modified triphosphate was successfully
incorporated when it was mixed with the four natural
triphosphates, using a 1:3 ratio of dMTP to dTTP. Labelling of
the PCR product created from this mixture with Cy3 hexylazide
gave a fluorescent band (Figure 7.B, lane 6). As expected,
subsequent staining with ethidium bromide revealed slower
migration of this band compared with the unlabeled amplicon
(
Figure 7.A, lane 5 and 6).
2
.4. Reverse transcription
Reverse transcriptase (RT) enzymes can be used to copy DNA
and RNA templates in order to prepare chemically modified
complementary DNA (cDNA). This methodology can efficiently
produce functionalized complementary DNA (cDNA) from RNA
that has been isolated from natural sources. In the current work
we chose to evaluate the cyclooctyne-modified dMTPs with
Moloney Murine Leukemia Virus reverse transcriptase (M-
Figure 6. Cy3-azide labelling of primer extension products from P3, T2
and BCN-I dMTP + dATP + dCTP + dGTP using KOD polymerase (1
2
unit, 1.0 mM MgCl ). A: Lane P, P3 + T2; lane 1, dTTP; lane 2, lane 1
with Cy3 azide; lane 3, dATP + dCTP + dGTP + dTTP; lane 4, lane 3 with
Cy3-azide. B: Lane 1, BCN-I dMTP + dATP + dCTP + dGTP(non-
labelled); lane 2, lane 1 labelled with Cy3-azide. Pictures were taken using
transilluminator light and UV filter. C: Picture of gel B was taken using a
digital camera. (20 % PAGE gel)
-
MuLV RT, RNase H ) which conveniently lacks the catalytic
activity necessary to cleave RNA strands. RNA template T4 of
the equivalent sequence to the previously used DNA template
with dispersed adenines was employed. BCN-II dMTP was
incorporated efficiently within 1 h while BCN-I dMTP needed 4
h. Even with this extended period the DIBO reaction was
incomplete (Figure 8, lanes 1). The above reverse transcription
reactions would clearly benefit from further optimization of the
reaction conditions.
Cy3 is commonly used in the synthesis of fluorescent DNA
probes.[57] In this context it has a number of favorable properties
which make it suitable for the multiple labelling of DNA strands.
It is very bright, sterically undemanding and not excessively
hydrophobic. After primer extension with template T1 and
ethanol precipitation to remove unincorporated triphosphates, the
BCN-I and DIBO-functionalized linear extension products were
labelled efficiently with Cy3 hexylazide via the SPAAC reaction
(
Figure 5 and 6) (see SI for the structure and synthesis of the Cy3
hexylazide). Natural dTTP and dNTP were used as negative
controls. The labelled products exhibited high fluorescence and
much lower electrophoretic mobility than the unlabeled controls.
This confirms that the BCN and DIBO moieties are stable to the
conditions of their incorporation and labelling.
Figure 8. Reverse transcription reactions with P3 (66 pmol), RNA template
T4 (132 pmol), dMTPs or dNTPs (3.2 nmol for each triphosphate unless
-
otherwise stated) using M-MuLV (RNase H ) reverse transcriptase (100
units). A: The reaction time was 4 h. Lane P, P3 + T4 without triphosphate;
lane N, dATP + dCTP + dGTP; lane 1, dMTP; lane 2, dMTP + dATP +
dCTP + dGTP; lane 3, dMTP (1.6 nmol) + dTTP (1.6 nmol) + dATP + dCTP
+
dGTP; lane 4, dTTP; lane 5, dATP + dCTP + dGTP + dTTP. B: The
reaction time was 1 h. Lane 1, dMTP; lane 2, dMTP + dATP + dCTP +
dGTP; lane 3, dMTP (2.1 nmol) + dTTP (1.1 nmol) + dATP + dCTP +
dGTP. (20 % PAGE gel)
Figure 7. Cy3-azide labelling of polymerase chain reaction product from
P5, P6, T7 and BCN-I dMTP with dTTP + dATP + dGTP + dCTP using
KOD polymerase (0.5 unit, 1.0 mM MgCl
of each triphosphate was used. Lane L, 50 bp ladder; lane 1, dTTP + dATP
dGTP + dCTP (non-labelled); lane 2, lane 1 with Cy3 azide; lane 3, BCN-
2
). Unless otherwise stated 4 nmol
3
. Conclusions
+
The strain-promoted alkyne-azide cycloaddition reaction is a
valuable tool for DNA labelling, and in this context the efficient
incorporation of reactive cyclooctyne derivatives into DNA by
enzymatic methods is an important objective. To this end we
have synthesized one DIBO and two BCN dUTP analogues from
a common aminopropargyl dUTP intermediate and incorporated
them into DNA by linear extension using two different templates
and a variety of DNA polymerases. All three cyclooctynes
I dMTP (2 nmol) + dTTP (2 nmol) + dATP + dGTP + dCTP (non-labelled);
lane 4, lane 3 labelled with Cy3-azide; lane 5, BCN-I dMTP (1 nmol) +
dTTP (3 nmol) + dATP + dGTP + dCTP (non-labelled); lane 6, lane 5
labelled with Cy3-azide. A: Gel after staining with ethidium bromide. B:
Gel before staining. (2% agarose gel)
Efficient incorporation of cyclooctynes into DNA during PCR
amplification and subsequent fluorescence labelling by the
SPAAC reaction would enable the synthesis of long fluorescent
probes in practical quantities. To this end PCR was carried out
with BCN-I dMTP using KOD polymerase and 81-mer DNA
(DIBO, BCN-I and BCN-II) were incorporated successfully
against template with dispersed adenine bases, whereas BCN was
the most successful dMTP when using a template with four

consecutive adenines. Labelling of the modified extension
products with Cy3 hexylazide via the copper-free SPAAC click
reaction demonstrated the efficient incorporation and stability of
these modified triphosphates to the enzymatic reaction
Healthcare). For HPLC purification of RNA, triethylammonium
bicarbonate buffer was used (buffer A: 0.1 M triethylammonium
bicarbonate, pH 7.5, buffer B: 0.1 M triethylammonium
bicarbonate, pH 7.5, with 50 % acetonitrile). The fractions from
HPLC were evaporated without need for additional desalting.
conditions.
The
acceptance
of
cyclooctyne-modified
triphosphates as substrates for various DNA polymerases in
linear extension and PCR is encouraging in the context of future
in vitro and in vivo applications.
All oligonucleotides were characterized by negative-mode
electrospray HPLC-mass spectrometry, using
a
Brueker
Daltronics micro-TOF mass spectrometer and an Acquity UPLC
system with a BEH C18 1.7 μm column (Waters). A gradient of
acetonitrile in triethylammonium acetate (TEAA) and
hexafluoroisopropanol (HFIP) was employed, increasing from 5
4
. Experimental section
4
.1. General method for oligonucleotide synthesis and
purification
%
to 40 % buffer B over 14 min, with a flow rate of 0.1 mL/min
(
buffer A: 10 mM TEAA, 100 mM HFIP in H O; buffer B: 20
2
Standard DNA phosphoramidites, solid supports, and
mM TEAA in CH CN). Raw data were processed and
3
additional reagents were purchased from Link Technologies and
Applied Biosystems Ltd. All oligonucleotides were synthesized
on an Applied Biosystems 394 automated DNA/RNA synthesizer
using a standard 1.0 μmol scale phosphoramidite cycle of acid-
catalyzed detritylation, coupling, capping, and iodine oxidation.
Stepwise coupling efficiencies and overall yields were
determined by the automated trityl cation conductivity
monitoring facility and in all cases were >98.0 %. All -
cyanoethyl phosphoramidite monomers were dissolved in
anhydrous acetonitrile to a concentration of 0.1 M immediately
prior to use. The coupling time for normal A, G, C, and T
monomers was 40 s. Cleavage of oligonucleotides from the solid
support and deprotection was achieved by exposure to
concentrated aqueous ammonia solution for 60 min at room
temperature followed by heating in a sealed tube for 5 h at 55 °C.
deconvoluted using the Data Analysis function of the Bruker
Daltronics Compass 1.3 software package.
TM
4.2. Primer extension experiments
In a 20 µL reaction, 66 pmol of FAM labelled DNA primer
(
P3), 132 pmol of template (T1 or T2) and 3.2 nmol of each
dMTP or dNTP were mixed with the polymerase enzyme (1 or
units, see figure legends) and 1X buffer (supplied with the
2
enzymes). In the case of KOD polymerase, 0.4 or 1 mM MgCl2
was added separately to the reaction buffer. The reaction
mixtures were heated for 1 or 1.5 h (KOD, Therminator II and
GoTaq were at 72 °C while Klenow was at 37 °C) and 20 µL
formamide was added before analysis by 20 % denaturing
polyacrylamide gel electrophoresis under a constant 20 W. For
the mass spectrometry analysis, 40 µL reactions were carried out,
desalted on a NAP-10 column and concentrated by freeze-drying.
KOD was purchased from Merck Millipore, Therminator II and
Klenow large fragment from New England Bio and Gotaq from
Promega.
The building blocks for the RNA analogues were prepared
using 2'-TBS protected RNA phosphoramidite monomers with t-
butylphenoxyacetyl protection of the A, G and C nucleobases and
unprotected
U
(Sigma-Aldrich).
A
solution of 0.3
M
benzylthiotetrazole in acetonitrile (Link Technologies) was used
as the coupling agent, t-butylphenoxyacetic anhydride was
employed as the capping agent and 0.1 M iodine as the oxidizing
agent (Sigma-Aldrich). All RNA phosphoramidite monomers
were dissolved in anhydrous acetonitrile to a concentration of 0.1
M immediately prior to use, and the coupling time for all
monomers was 10 min. Stepwise coupling efficiencies were
determined by automated trityl cation conductivity monitoring
and in all cases were >96 %. Cleavage of oligonucleotides from
the solid support and deprotection were achieved by exposure to
concentrated aqueous ammonia/ethanol (3/1 v/v) for 2 h at room
temperature followed by heating in a sealed tube for 45 min at 55
4
.3. Polymerase chain reaction
Samples containing 10 pmol of two primers (P5, P6), 50 pg of
template (T7) and 4 nmol dMTP or dNTP in total were added
followed by polymerase, 10X KOD polymerase buffer (pH = 8)
and 25 mM MgCl . The final reaction volume was 20 µL with
2
1
X reaction buffer and 1 mM MgCl . Amplification was
2
performed using the following procedure: an initial denaturing at
9
1
for 30 s, then further extension at 72 ºC for 5 min. The samples
were analyzed by 2 % agarose gel electrophoresis in 1X TBE
buffer (126 V).
5 ºC for 1 min, followed by 25 cycles of denaturing at 95 ºC for
5 s, primer annealing at 54 ºC for 20 s, and extension at 72 ºC
°
C. After cleavage from the solid support and deprotection of the
nucleobases and phosphotriesters, RNA oligonucleotides were
concentrated to a small volume in vacuo, transferred to 15 mL
plastic tubes and freeze dried. The residues were dissolved in
DMSO (300 L) and triethylamine trihydrofluoride (300 L) was
added after which the reaction mixtures were kept at 65 C for
4.4. Reverse transcription
Samples containing 66 pmol of FAM labelled DNA primer
(P3), 132 pmol of RNA template (T4) and 3.2 nmol dMTP or
-
dNTP were mixed with M-MuLV (RNase H ) reverse
transcriptase (100 units), 5X buffer and 1X dithiothretitol (DTT,
supplied with the enzyme). The final reaction volume was 20 µL.
The reaction mixtures were heated at 42 ºС for 1 h or 4 h, 20 µL
of formamide was added and samples were analyzed by 20 %
denaturing polyacrylamide gel electrophoresis under constant 20
W.
2
.5 h. Sodium acetate (3 M, 50 L) and butanol (3 mL) were
added with vortexing and the samples were kept at -80 C for 30
min then centrifuged at 4 C at 13,000 rpm for 10 min. The
supernatant was decanted and the precipitate was washed twice
with ethanol (0.75 mL) then dried under vacuum.
The fully deprotected oligonucleotides (DNA or RNA) were
purified by reversed-phase HPLC on a Gilson system using a
Luna 10 C8 100Å pore Phenomenex 10x250 mm column with a
gradient of acetonitrile in ammonium acetate, in case of DNA, (0
4
.5. Fluorescent labelling
Primer extension reactions or PCR (2 X 20 µL + 10 µL water)
%
to 50 % buffer B over 20 min, flow rate 4 mL/min), (buffer A:
were prepared as explained above in section 4.2 or 4.3 using
BCN-1 dMTP, DIBO dMTP or dNTP negative control. DNA
was precipitated by mixing with 5 µl 3M sodium acetate (pH 5.3)
followed by 150 µl ethanol and was then left on dry ice for 10
min and at -20 °C for 20 min. This was followed by
0
.1 M ammonium acetate, pH 7.0, buffer B: 0.1 M ammonium
acetate, pH 7.0, with 50 % acetonitrile). Elution was monitored
by UV absorption at 295 nm. After HPLC purification,
oligonucleotides were desalted using NAP-10 columns (GE

centrifugation at 4 °C for 30 min (13,000 rpm). The precipitate
was re-dissolved in 40 µl 1X Gotaq Green buffer and 20 µl was
reacted with 1.6 µl Cy3 hexylazide (10 mM DMSO solution) for
Acknowledgments
TB and AHE-S are grateful to the UK BBSRC for funding via
the sLOLA grant BB/J001694/1: "Extending the Boundaries of
Nucleic Acid Chemistry."
1
h. for primer extensions, 20 µl of formamide was added to the
labeled DNA and the unlabeled primer extension reactions (20
µl) followed by analysis on a 20 % PAGE gel at 20 W. for PCR,
after the labelling reactions, a second ethanol precipitation was
carried out using 2 µL of 3M sodium acetate (pH 5.3) and 60 µL
of ethanol. The samples were analyzed by 2 % agarose gel
electrophoresis in 1X TBE buffer (126 V) For mass spectrometry
and fluorescent spectra analysis, 40 µL of non-labelled and
labelled reactions were carried out as above followed by
desalting on NAP-10 columns.
Supplementary data
Supplementary data associated with this article includes
chemical synthesis, primer extension experiments and fluorescent
labelling reactions. This can be found in the online version.
functionalization by the alkyne - azide 'click' reaction, Helv. Chim.
Acta, 91 (2008) 1181-1200.
References
[
5
15] P. Kocalka, N.K. Andersen, F. Jensen, P. Nielsen, Synthesis of
-(1,2,3-triazol-4-yl)-2'deoxyuridines by a click chemistry approach:
[
1] H.C. Kolb, M.G. Finn, K.B. Sharpless, Click chemistry: Diverse
chemical function from a few good reactions, Angew. Chem. Int.
Edit., 40 (2001) 2004-2021.
Stacking of triazoles in the major groove gives increased nucleic acid
duplex stability, Chembiochem, 8 (2007) 2106-2116.
[
2] C.W. Tornoe, C. Christensen, M. Meldal, Peptidotriazoles on
solid phase: [1,2,3]-triazoles by regiospecific copper(I)-catalyzed
,3-dipolar cycloadditions of terminal alkynes to azides, J. Org.
Chem., 67 (2002) 3057-3064.
3] V.V. Rostovtsev, L.G. Green, V.V. Fokin, K.B. Sharpless, A
[16] T. Fujino, N. Yamazaki, H. Isobe, Convergent synthesis of
oligomers of triazole-linked DNA analogue ((TL)DNA) in solution
phase, Tetrahedron Lett., 50 (2009) 4101-4103.
1
[17] H. Isobe, T. Fujino, N. Yamazaki, M. Guillot-Nieckowski, E.
[
Nakamura, Triazole-linked analogue of deoxyribonucleic acid
TL
stepwise Huisgen cycloaddition process: Copper(I)-catalyzed
regioselective "ligation" of azides and terminal alkynes, Angew.
Chem. Int. Edit., 41 (2002) 2596-2599.
(
DNA): Design, synthesis, and double-strand formation with
natural DNA, Org. Lett., 10 (2008) 3729-3732.
18] A. Nuzzi, A. Massi, A. Dondoni, Model studies toward the
synthesis of thymidine oligonucleotides with triazole
[
[
4] A.H. El-Sagheer, T. Brown, Click chemistry with DNA, Chem.
Soc. Rev., 39 (2010) 1388-1405.
5] R. Kumar, A.H. El-Sagheer, J. Tumpane, P. Lincoln, L.M.
internucleosidic linkages via iterative Cu(I)-promoted azide-alkyne
ligation chemistry, Qsar & Combinatorial Sci., 26 (2007) 1191-1199.
[
Wilhelmsson, T. Brown, Template-directed oligonucleotide strand
ligation, covalent intramolecular DNA circularization and catenation
using click chemistry, J. Am. Chem. Soc., 129 (2007) 6859-6864.
[19] R. Lucas, P.H. Elchinger, P.A. Faugeras, R. Zerrouki,
Pyrimidine-purine and pyrimidine heterodinucleosides synthesis
containing a triazole linkage, Nucleoside, Nucleotide & Nucleic
Acid, 29 (2010) 168-177.
[6] P. Kocalka, A.H. El-Sagheer, T. Brown, Rapid and efficient
DNA strand cross-linking by click chemistry, Chembiochem, 9
[20] R. Lucas, R. Zerrouki, R. Granet, P. Krausz, Y. Champavier, A
(2008) 1280-1285.
rapid efficient microwave-assisted synthesis of 3',5'-
pentathymidine by copper(I)-catalyzed [3 + 2] cycloaddition,
Tetrahedron, 64 (2008) 5467-5471.
a
[7] A.H. El-Sagheer, R. Kumar, S. Findlow, J.M. Werner, A.N.
Lane, T. Brown, A very stable cyclic DNA miniduplex with just two
base pairs, Chembiochem, 9 (2008) 50-52.
[21] J. Vergnaud, P.-. Faugeras, V. Chaleix, Y. Champavier, R.
[8] J. Gierlich, G.A. Burley, P.M.E. Gramlich, D.M. Hammond, T.
Zerrouki, Design of a new oligotriazole peptide nucleic acid
analogue (oT-PNA), Tetrahedron Lett., 52 (2011) 6185-6189.
Carell, Click chemistry as a reliable method for the high-density
postsynthetic functionalization of alkyne-modified DNA, Org. Lett.,
8
[22] A.H. El-Sagheer, T. Brown, New strategy for the synthesis of
(2006) 3639-3642.
chemically modified RNA constructs exemplified by hairpin and
hammerhead ribozymes, Proc. Natl. Acad. Sci. U. S. A., 107 (2010)
[9] E.A. Motea, I. Lee, A.J. Berdis, Development of a 'clickable'
non-natural nucleotide to visualize the replication of non-
instructional DNA lesions, Nucleic Acids Res. , 40 (2012) 2357-
2
1
[
5329-15334.
23] E. Paredes, S.R. Das, Click chemistry for rapid labeling and
ligation of RNA, ChemBioChem 12 (2011) 125-131.
24] A. Salic, T.J. Mitchison, A chemical method for fast and
367.
[10] U. Wenge, T. Ehrenschwender, H.-A. Wagenknecht, Synthesis
[
of 2'-O-propargyl nucleoside triphosphates for enzymatic
oligonucleotide preparation and "click" modification of DNA with
nile red as fluorescent probe, Bioconjugate Chem. , 24 (2013) 301-
sensitive detection of DNA synthesis in vivo, Proc. Natl. Acad. Sci.
U. S. A., 105 (2008) 2415-2420.
[25] J. Gierlich, K. Gutsmiedl, P.M.E. Gramlich, A. Schmidt, G.A.
3
[
04.
11] D.I. Rozkiewicz, J. Gierlich, G.A. Burley, K. Gutsmiedl, T.
Carell, B.J. Ravoo, D.N. Reinhoudt, Transfer printing of DNA by
click" chemistry, Chembiochem, 8 (2007) 1997-2002.
12] M. Fischler, U. Simon, H. Nir, Y. Eichen, G.A. Burley, J.
Burley, T. Carell, Synthesis of highly modified DNA by a
combination of PCR with alkyne-bearing triphosphates and click
chemistry, Chem. Eur. J., 13 (2007) 9486-9494.
"
[
[
26] A.H. El-Sagheer, A.P. Sanzone, R. Gao, A. Tavassoli, T.
Brown, Biocompatible artificial DNA linker that is read through by
DNA polymerases and is functional in Escherichia coli, Proc. Nat.
Acad. Sci. U.S.A., 108 (2011) 11338-11343.
Gierlich, P.M.E. Gramlich, T. Carell, Formation of bimetallic Ag-Au
nanowires by metallization of artificial DNA duplexes, Small, 3
(2007) 1049-1055.
[27] S.H. Chiou, DNA-Scission and protein-scission activities of
[13] E.P. Lundberg, A.H. El-Sagheer, P. Kocalka, L.M.
ascorbate in the presence of copper-ion and a copper-peptide
complex, J. Biochem. , 94 (1983) 1259-1267.
Wilhelmsson, T. Brown, B. Norden, A new fixation strategy for
addressable nano-network building blocks, Chem. Commun., 46
[28] R. Stoewe, W.A. Prutz, Copper-catalyzed DNA damage by
(2010) 3714-3716.
ascorbate and hydrogen-peroxide - kinetics and yield, Free Radical
Biol. Med. , 3 (1987) 97-105.
[14] F. Seela, X. Ming, Oligonucleotides containing 7-deaza-2'-
deoxyinosine as universal nucleoside: Synthesis of 7-halogenated
and 7-alkynylated derivatives, ambiguous base pairing, and dye

[
29] S. Kobayashi, K. Ueda, J. Morita, H. Sakai, T. Komano, DNA
[49] S. Jager, G. Rasched, H. Kornreich-Leshem, M. Engeser, O.
Thum, M. Famulok, A versatile toolbox for variable DNA
functionalization at high density, J. Am. Chem. Soc. , 127 (2005)
15071-15082.
damage induced by ascorbate in the presence of Cu-2+, BBA 949
(1988) 143-147.
[30] D.E. Won, C.S. Lee, Y.K. Shin, K.S. Lee, DNA degradation by
mitomycin c in the presence of copper and epinephrine, Chung-Ang
Journal of Medicine, 14 (1989) 59-74.
[50] J. Sagi, A. Szemzo, K. Ebinger, A. Szabolcs, G. Sagi, E. Ruff,
L. Otvos, Base-modified oligodeoxynucleotides .1. Effect of 5-alkyl,
5-(1-alkenyl) and 5-(1-alkynyl) substitution of the pyrimidines on
duplex stability and hydrophobicity, Tetrahedron Lett. , 34 (1993)
2191-2194.
[31] A.H. El-Sagheer, T. Brown, Factors influencing hairpin
oligonucleotide cyclization by the uncatalyzed alkyne-azide
cycloaddition (AAC) reaction, Pure & Applied Chem, 82 (2010)
1
599-1607.
[51] B.M. Znosko, T.W. Barnes, T.R. Krugh, D.H. Turner, NMR
studies of DNA single strands and DNA : RNA hybrids with and
without 1-propynylation at C5 of oligopyrimidines, J. Am. Chem.
Soc. , 125 (2003) 6090-6097.
[32] J.C. Jewett, E.M. Sletten, C.R. Bertozzi, Rapid Cu-free click
chemistry with readily synthesized biarylazacyclooctynones, J. Am.
Chem. Soc., 132 (2010) 3688-3690.
[
33] P.V. Chang, J.A. Prescher, E.M. Sletten, J.M. Baskin, I.A.
[52] G. Giller, T. Tasara, B. Angerer, K. Muhlegger, M. Amacker,
H. Winter, Incorporation of reporter molecule-labeled nucleotides by
DNA polymerases. I. Chemical synthesis of various reporter group-
labeled 2'-deoxyribonucleoside-5'-triphosphates, Nucleic Acids Res.,
31 (2003) 2630-2635.
Miller, N.J. Agard, A. Lo, C.R. Bertozzi, Copper-free click
chemistry in living animals, Proc. Nat. Acad. Sci. U.S.A. , 107
(2010) 1821-1826.
[34] J.C. Jewett, C.R. Bertozzi, Cu-free click cycloaddition reactions
in chemical biology, Chem. Soc. Rev. , 39 (2010) 1272-1279.
35] E.M. Sletten, C.R. Bertozzi, A hydrophilic azacyclooctyne for
Cu-free click chemistry, Org. Lett., 10 (2008) 3097-3099.
36] P. van Delft, N.J. Meeuwenoord, S. Hoogendoorn, J. Dinkelaar,
H.S. Overkleeft, G.A. van der Marel, D.V. Filippov, Synthesis of
oligoribonucleic acid conjugates using cyclooctyne
phosphoramidite, Org. Lett., 12 (2010) 5486-5489.
37] K.N. Jayaprakash, C.G. Peng, D. Butler, J.P. Varghese, M.A.
[53] V. Borsenberger, M. Kukwikila, S. Howorka, Synthesis and
enzymatic incorporation of modified deoxyuridine triphosphates,
Org. Biomol. Chem. , 7 (2009) 3826-3835.
[54] S.E. Lee, A. Sidorov, T. Gourlain, N. Mignet, S.J. Thorpe, J.A.
Brazier, M.J. Dickman, D.P. Hornby, J.A. Grasby, D.M. Williams,
Enhancing the catalytic repertoire of nucleic acids: a systematic
study of linker length and rigidity, Nucleic Acids Res. , 29 (2001)
1565-1573.
[
[
a
[
Maier, K.G. Rajeev, M. Manoharan, Non-nucleoside building blocks
for copper-assisted and copper-free click chemistry for the efficient
synthesis of RNA conjugates, Org. Lett., 12 (2010) 5410-5413.
[55] F.W. Hobbs, Palladium-catalyzed synthesis of alkynylamino
nucleosides - a universal linker for nucleic-acids, J. Org. Chem. , 54
(1989) 3420-3422.
[
38] M. Shelbourne, X. Chen, T. Brown, A.H. El-Sagheer, Fast
[56] M. Yoshikawa, T. Kato, T. Takenishi, A novel method for
phosphorylation of nucleosides to 5-nucleotigei, Tetrahedron Lett. ,
50 (1967) 5065-5068.
copper-free click DNA ligation by the ring-strain promoted alkyne-
azide cycloaddition reaction, Chem. Commun., 47 (2011) 6257-
6
259.
[57] L.M. Hall, M. Gerowska, T. Brown, A highly fluorescent DNA
toolkit: synthesis and properties of oligonucleotides containing new
Cy3, Cy5 and Cy3B monomers, Nucleic Acids Res. , 40 (2012).
[39] M. Shelbourne, T. Brown, A.H. El-Sagheer, T. Brown, Fast and
efficient DNA crosslinking and multiple orthogonal labelling by
copper-free click chemistry, Chem. Commun., 48 (2012) 11184-
1
1186.
[40] I.S. Marks, J.S. Kang, B.T. Jones, K.J. Landmark, A.J. Cleland,
T.A. Taton, Strain-promoted "click" chemistry for terminal labeling
of DNA, Bioconjugate Chem., 22 (2011) 1259-1263.
[41] M.F. Debets, S.S. Van Berkel, J. Dommerholt, A.J. Dirks, F.
Rutjes, F.L. Van Delft, Bioconjugation with strained alkenes and
alkynes, Accounts Chem. Res., 44 (2011) 805-815.
[42] A. Borrmann, S. Milles, T. Plass, J. Dommerholt, J.M.M.
Verkade, M. Wiessler, C. Schultz, J.C.M. van Hest, F.L. van Delft,
E.A. Lemke, Genetic encoding of a bicyclo 6.1.0 nonyne-charged
amino acid enables fast cellular protein imaging by metal-free
ligation, ChemBioChem, 13 (2012) 2094-2099.
[43] J. Dommerholt, S. Schmidt, R. Temming, L.J.A. Hendriks, F.
Rutjes, J.C.M. van Hest, D.J. Lefeber, P. Friedl, F.L. van Delft,
Readily accessible bicyclononynes for bioorthogonal labeling and
three-dimensional imaging of living cells, Angew. Chem. Int. Edit.,
4
9 (2010) 9422-9425.
[44] A.M. Jawalekar, S. Malik, J.M.M. Verkade, B. Gibson, N.S.
Barta, J.C. Hodges, A. Rowan, F.L.v. Delft, Oligonucleotide tagging
for copper-free click conjugation, Molecules, 18 (2013) 7346-7363.
[45] K. Gutsmiedl, D. Fazio, T. Carell, High-Density DNA
Functionalization by a Combination of Cu-Catalyzed and Cu-Free
Click Chemistry, Chem. Eur. J., 16 (2010) 6877-6883.
[46] S.H. Weisbrod, A. Marx, A nucleoside triphosphate for site-
specific labelling of DNA by the Staudinger ligation, Chem.
Commun. , (2007) 1828-1830.
[47] H. Rao, A.A. Sawant, A.A. Tanpure, S.G. Srivatsan,
Posttranscriptional chemical functionalization of azide-modified
oligoribonucleotides by bioorthogonal click and Staudinger
reactions, Chem. Commun. , 48 (2012) 498-500.
[
48] H. Rao, A.A. Tanpure, A.A. Sawant, S.G. Srivatsan, Enzymatic
incorporation of an azide-modified UTP analog into
oligoribonucleotides for post-transcriptional chemical
functionalization, Nat. Protoc. , 7 (2012) 1097-1112.