Biosci. Biotechnol. Biochem., 75 (9), 1758–1762, 2011
Comparison of Acyl-CoA Synthetic Activities and Enantioselectivity
toward 2-Arylpropanoic Acids in Firefly Luciferases
y
Dai-ichiro KATO, Keisuke YOKOYAMA, Yoshihiro HIRAISHI, Masahiro TAKEO, and Seiji NEGORO
Department of Materials Science and Chemistry, Graduate School of Engineering, University of Hyogo,
2
167 Shosha, Himeji, Hyogo 671-2280, Japan
Measurement of thioesterification activities for
whether other firefly luciferases can catalyze the
enantioselective thioesterification reaction. Here we
report the enantioselectivity of the acyl-CoA synthesis
of ketoprofen in other five firefly luciferases, from
Pyrocoelia miyako (PmL), Photinus pyralis (PpL),
Luciola cruciata (LcL), Hotaria parvura (HpL), and
Luciola mingrelica (LmL). In addition, we report on the
effect of pH on enzymatic activity and kinetic param-
eters determined using PmL.
dodecanoic acid (C12) and ketoprofen was done using
five firefly luciferases, from Pyrocoelia miyako (PmL),
Photinus pyralis (PpL), Luciola cruciata (LcL), Hotaria
parvura (HpL), and Luciola mingrelica (LmL). Among
these, PmL, PpL, and LcL showed the expected
thioesterification activities toward both substrates. All
the enzymes exhibited (R)-enantioselectivity toward
ketoprofen, which had same tendency as firefly lucifer-
ase from Luciola lateralis (LUC-H). HpL and LmL,
however, did not accept ketoprofen, although they had
thioesterification activity toward C12. These results
indicate that the substrate acceptance of luciferases for
the thioesterification reaction varies dramatically rely-
ing on the origin of firefly. Hence we focused primarily
on PmL and investigated the effect of pH on enzymatic
activity. In addition, by determining the kinetic param-
eters at various pH values, we verified that the kcat
parameter contributed to the preferential enantioselec-
tivity of this enzyme.
Materials and Methods
The pTrc-PmL and the pTrc-HpL plasmids, which code the cDNA
of PmL and HpL, were kindly provided by Professor Yoshihiro
Ohmiya of the National Institute of Advanced Industrial Science and
Technology (AIST).11) LmL and PpL were purchased from Sigma-
Aldrich (USA). LcL was from Wako Pure Chemicals (Japan). (R)-
12)
Ketoprofen was prepared according to a previously reported method.
Other chemicals were purchased from reputable vendors and were used
without further purification, unless otherwise noted. Protein concen-
trations were measured by Bradford Assay with bovine serum albumin
as standard.13)
Key words: firefly luciferase; enantioselective thioester-
ification; 2-arylpropanoic acid; kinetic res-
olution; Pyrocoelia miyako
Plasmid construction and expression of PmL and HpL. The
expression vectors for PmL and HpL were designed to produce N-
terminal His-Tag fused proteins (MNHKVHHHHHHIGGRH). The
PmL gene was amplified from pTrc-PmL by PCR using forward
(TTTGACATATGGAAGATGATAGTAAACATATTATGC) and re-
verse (GTTAGTCTAGAGTAAACCGAAGAAATTACA) primers. The
cDNA of the HpL gene was also amplified using forward (TTTGA-
CATATGGAAATGGAAAAGGAGGA) and reverse (TAGCATCTA-
GACCGATTTACATCTTG) primers. These primers were designed to
contain artificially introduced Nde I and Xba I cleavage sites (italic
Firefly luciferase is a bioluminescence enzyme that
catalyzes the oxidation of D-luciferin using molecular
oxygen in the presence of ATP and Mg2
þ
1–3)
.
Its amino
acid sequence exhibits high similarity to that of long-
chain acyl-CoA synthetase (LACS), and the firefly
luciferase reaction mechanism shares some features in
0
0
form) in the 5 and 3 ends of the PmL and the HpL gene respectively.
The underlined ATG represents the start codon. The amplified 1.7-kbp
fragment was subcloned into TA vector, which was prepared from
pXCmkn12 digested with Xcm I (National Institute of Genetics, Japan).
First the subcloned vectors were digested with Nde I and Xba I. Then
they were purified and inserted into a pCold I expression vector
4
)
common with the LACS mechanism. Based on this
similarity, Oba et al. have suggested that firefly
luciferases from Luciola cruciata (LcL) and Photinus
pyralis (PpL) have the same catalytic ability as for acyl-
CoA synthesis toward long-chain fatty acids such as
(Takara, Japan). The resulting plasmids, pColdI-PmL and pColdI-HpL,
were used to express the recombinant proteins.
5
)
dodecanoic acid (C12), and this has been verified. On
the other hand, LACS is also known to be involved in a
deracemization reaction and to catalyze the enantiose-
lective thioesterification reaction toward 2-arylpropanoic
E. coli BL21 (DE3) cells were transformed with pColdI-PmL or
pColdI-HpL, cultivated, and treated to express proteins following the
manufacturer’s instructions. After production of the recombinant
enzymes, the cells were collected, lysed by sonication (20 kHz, 30 s ꢀ
acids.6,7)
In this way, we found that Japanese firefly
luciferases from Luciola lateralis (LUC-H) had (R)-
1
0 times) in 5 mL of 50 mM potassium phosphate buffer (PPB)
(
pH 7.0) containing 300 mM NaCl, and centrifuged (14;500 ꢀ g for
enantioselective thioesterification ability when the sub-
8
ꢁ
1
0 min, 4 C). The enzymes were purified from the supernatant using a
,9)
strates were a series of 2-arylpropanoic acids (Fig. 1).
In nature, there are many kinds of firefly lucifer-
ases.10) Hence we were interested in determining
TALON Metal Affinity Resin (2 mL) (Clontech) following the
manufacturer’s instructions. Following purification, the enzymes were
identified by SDS–PAGE, and protein bands were visualized by
y
Abbreviations: C12, dodecanoic acid; CoASH, coenzyme A; HpL, firefly luciferase from Hotaria parvula; LcL, firefly luciferase from Luciola
cruciata; LmL, firefly luciferase from Luciola mingrelica; LUC-H, firefly luciferase from Luciola lateralis; PPB, potassium phosphate buffer; PmL,
firefly luciferase from pyrocoelia miyako; PpL, firefly luciferase from Photinus pyralis