Modification on ursodeoxycholic acid (UDCA) scaffold. Discovery of bile acid derivatives as selective agonists of cell-surface G-protein coupled bile acid receptor 1 (GP-BAR1)

Article abstract of DOI:10.1021/jm500889f

Bile acids are signaling molecules interacting with the nuclear receptor FXR and the G-protein coupled receptor 1 (GP-BAR1/TGR5). GP-BAR1 is a promising pharmacological target for the treatment of steatohepatitis, type 2 diabetes, and obesity. Endogenous bile acids and currently available semisynthetic bile acids are poorly selective toward GP-BAR1 and FXR. Thus, in the present study we have investigated around the structure of UDCA, a clinically used bile acid devoid of FXR agonist activity, to develop a large family of side chain modified 3,7 dihydroxyl cholanoids that selectively activate GP-BAR1. In vivo and in vitro pharmacological evaluation demonstrated that administration of compound 16 selectively increases the expression of pro-glucagon 1, a GP-BAR1 target, in the small intestine, while it had no effect on FXR target genes in the liver. Further, compound 16 results in a significant reshaping of bile acid pool in a rodent model of cholestasis. These data demonstrate that UDCA is a useful scaffold to generate novel and selective steroidal ligands for GP-BAR1.

Full text of DOI:10.1021/jm500889f

Article
pubs.acs.org/jmc
Modification on Ursodeoxycholic Acid (UDCA) Scaffold. Discovery of
Bile Acid Derivatives As Selective Agonists of Cell-Surface G‑Protein
Coupled Bile Acid Receptor 1 (GP-BAR1)
Valentina Sepe,† Barbara Renga,‡ Carmen Festa,† Claudio D’Amore,‡ Dario Masullo,† Sabrina Cipriani,‡
Francesco Saverio Di Leva,† Maria Chiara Monti,§ Ettore Novellino,† Vittorio Limongelli,†
Angela Zampella,*,† and Stefano Fiorucci‡
†Department of Pharmacy, University of Naples “Federico II”, Via D. Montesano, 49, 80131 Napoli, Italy
‡Department of Clinical and Experimental Medicine, Nuova Facolta
̀
di Medicina, Via Gambuli 1 06132 Perugia, Italy
§Department of Pharmacy, University of Salerno, Via Giovanni Paolo II, 132, 84084, Fisciano (Salerno), Italy
S
* Supporting Information
ABSTRACT: Bile acids are signaling molecules interacting
with the nuclear receptor FXR and the G-protein coupled
receptor 1 (GP-BAR1/TGR5). GP-BAR1 is a promising
pharmacological target for the treatment of steatohepatitis,
type 2 diabetes, and obesity. Endogenous bile acids and
currently available semisynthetic bile acids are poorly selective
toward GP-BAR1 and FXR. Thus, in the present study we have
investigated around the structure of UDCA, a clinically used
bile acid devoid of FXR agonist activity, to develop a large
family of side chain modified 3α,7β-dihydroxyl cholanoids that
selectively activate GP-BAR1. In vivo and in vitro pharmaco-
logical evaluation demonstrated that administration of
compound 16 selectively increases the expression of pro-
glucagon 1, a GP-BAR1 target, in the small intestine, while it
had no effect on FXR target genes in the liver. Further, compound 16 results in a significant reshaping of bile acid pool in a
rodent model of cholestasis. These data demonstrate that UDCA is a useful scaffold to generate novel and selective steroidal
ligands for GP-BAR1.
Cell-surface G-protein coupled bile acid receptor 1 (GP-
BAR1, TGR5, M-BAR1) belongs to the rhodopsin-like
superfamily of G protein coupled receptors (GPCRs). GP-
BAR1 activation results in the elevation of intracellular cAMP
levels, which in turn activates specific intracellular signaling
cascades. Similarly to FXR, GP-BAR1 is highly expressed in the
liver and in the intestine, but differently from FXR it is also
located in tissues and cells not participating in the enter-
ohepatic circulation such as muscle, brain, adipose tissue,
macrophages, and endothelial cells. In muscle and brown
adipose tissue, GP-BAR1 activation increases energy expendi-
ture and oxygen consumption,12 while in entero-endocrine L
cells, it stimulates the secretion of glucagon-like peptide (GLP)-
1, an incretin that improves insulin release from pancreas, thus
regulating glucose blood levels, gastrointestinal motility, and
appetite.13
INTRODUCTION
■
Bile acids (BAs) are signaling molecules interacting with two
types of dedicated cellular receptors, intracellular nuclear
receptors, and cell-surface receptors. Nuclear receptors include
farnesoid X receptor (FXR),1,2 pregnane X receptor (PXR),3
vitamin D3 receptor (VDR),4 and constitutive androstane
receptor (CAR),5 with FXR identified as the endogenous bile
acid sensor.
Highly expressed in enterohepatic tissues (liver and
intestine), FXR regulates bile acid homeostasis, preventing
their accumulation and associated toxicity through the
induction of gene expression for conjugating enzymes and
export pumps with the final aim to provide bile acid elimination
from the body. Apart from this pivotal role, FXR controls
further important metabolic pathways6 regulating also lipid7
and glucose homeostasis.8 Additionally, FXR agonists were
proved to exert anti-inflammatory9 and antifibrotic effects,10
making this nuclear receptor an appealing pharmacological
target in the treatment of common human diseases ranging
from metabolic syndrome to cancer.11
All these data underlay the role of GP-BAR1 agonists in
preventing obesity, atherosclerosis, and hepatic steatosis in
Received: June 11, 2014
Published: August 27, 2014
© 2014 American Chemical Society
7687
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701

Journal of Medicinal Chemistry
Article
mice on a high-fat diet, thus pointing toward GP-BAR1 as a
promising target in the pharmacotherapy of enterohepatic and
metabolic disorders.14−16
Thus, today, several efforts are focused toward the discovery
and development of potent and selective GP-BAR1 small
molecule agonists belonging to bile acid or nonbile acid classes
as promising therapeutic strategy in lipid and glucose diseases
such as in the treatment of nonalcoholic steatohepatitis,
hypercholesterolaemia, hypertriglyceridaemia, and type 2
diabetes mellitus (T2DM).14−16
In this context, the identification of potent GP-BAR1 small
molecule agonists with improved selectivity over FXR remains
the aim of the medicinal chemists.
From a chemical point of view, BAs are truncated cholesterol
side chain derivatives (Figure 1). Their molecular repertoire is
about 3% of total bile acids, UDCA has been shown effective in
biliary and liver diseases and is now considered as the first-line
treatment for primary biliary cirrhosis (PBC), primary
sclerosing cholangitis (PSC), intrahepatic cholestasis of
pregnancy (ICP), and several less common adult and pediatric
cholestatic conditions.17 UDCA is a molecule with a good
safety profile and a clinical history with minimal side effects,
also when used in large doses. Additionally, UDCA is endowed
with several beneficial effects such as neuroprotective and
antiapoptotic actions, chemopreventative effects in colon cancer
with attenuation of carcinogenic signaling cascades induced by
toxic bile acids.18−20
UDCA is the 7β-hydroxy epimer of CDCA and, despite its
pharmacological profile resembling a modulation of FXR,
UDCA is not a FXR agonist and its mechanism of action
remains unclear and still subjected to intense scientific debates.
In this context we have decided to manipulate UDCA
chemical scaffold to obtain selective GP-BAR1 agonists. Thus, a
series of side chain modified 3α,7β-dihydroxyl cholanoids
(Figure 2) has been prepared and screened in their ability to
modulate FXR/GP-BAR1. This research work resulted in the
identification of several UDCA analogues endowed with GP-
BAR1 selective agonistic profile. Computational studies have
been performed to elucidate their binding mechanism to GP-
BAR1 and the pharmacological activity of derivative 16, the
most potent compound generated in this study, has been
characterized through a series of in vitro and in vivo
experiments.
Figure 1. Endogenus bile acids.
generated first in the liver with the production of primary bile
acids, cholic acid (CA), and chenodeoxycholic acid (CDCA),
successively subjected to microbial transformation in the gut,
affording secondary bile acids, deoxycholic acid (DCA), and
lithocholic acid (LCA) and their glycine and taurine conjugates.
Interestingly, the activity toward the two BAs receptors is
structure dependent, with CDCA and its conjugated forms the
most potent endogenous FXR activators and LCA and tauro-
lithocholic acid (TLCA) the strongest natural agonists of GP-
BAR1.
RESULTS
■
The steroidal nucleus of both CA and CDCA adopts a bent
shape due to the A/B cis ring juncture that forces ring A to lie
outside of the plane of the BCD ring system. As a result, two
well distinct faces are generated: (i) the hydrophobic area (β-
site) of the cholanoic acid nucleus and (ii) the α-hydrophilic
region defined by the two hydroxyl groups at C3 and C7. These
structural features allow primary BAs (CDCA and CA) to bind
the FXR ligand binding domain (FXR-LBD) and activate this
nuclear receptor.21 If compared with CDCA, the reduced FXR
Among BAs, ursodeoxycholic acid (UDCA) represents a
puzzling molecule. Present in human bile at low concentrations,
Figure 2. Ursodeoxycholane derivatives generated in this study.
7688
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701

Journal of Medicinal Chemistry
Article
a
Scheme 1. nor-Ursodeoxycholane Derivatives
a
Reagents and conditions: (a) HCOOH, HClO4, 96%; (b) TFA, trifluoroacetic anhydride, NaNO2, 96%; (c) KOH 30% in MeOH/H2O 1:1 v/v,
97%; (d) p-TsOH, MeOH dry, 97%; (e) DMT-MM, Et3N, taurine, DMF dry, 28%; (f) LiBH4, MeOH dry, THF, 0 °C, quantitative yield; (g) Et3N·
SO3, DMF, 95 °C.
a
Scheme 2. Ursodeoxycholane and Bis-homo Derivatives
a
Reagents and conditions: (a) LiBH4, MeOH dry, THF, 0 °C, 93%; (b) 2,6-lutidine, t-butyldimethylsilyl trifluoromethanesulfonate, CH2Cl2, 0 °C;
(c) LiBH4, MeOH dry, THF, 0 °C, quantitative yield over two steps; (d) DMSO, oxalyl chloride, TEA dry, CH2Cl2, −78 °C, then
methyl(triphenylphosphoranylidene)acetate, 76%; (e) HCl 37%, MeOH, quantitative yield; (f) NaOH 5% in MeOH/H2O 1:1 v/v, 93%; (g) DMT-
MM, Et3N, taurine, DMF dry, 26%; (h) H2, Pd(OH)2/C Degussa type, THF/MeOH 1:1, then HCl 37%, MeOH, quantitative yield; (i) NaOH 5%
in MeOH/H2O 1:1 v/v, 60%; (j) DMT-MM, Et3N, taurine, DMF dry, 45%; (k) LiBH4, MeOH dry, THF, 0 °C, 77%.
activation of UDCA can be explained by the lower hydro-
phobicity of the β-site due to the presence of the β-oriented
hydroxyl group at C7. This stresses the pharmacophoric role of
the configuration at C7 hydroxyl methine carbon in bile acid
derivatives to achieve FXR agonism. On the other hand,
according to structural studies, the BAs alkyl side chain points
toward a rather large and polar cavity both in FXR and GP-
BAR1.21,22 Consequently, this part of the BAs can be
functionalized by producing derivatives endowed with different
pharmacological profiles, ranging from full potent dual
agonism22 to selective FXR or GP-BAR1 modulation.23,24
To get more insights into the structural requisites ruling the
activity of bile acid derivatives on GP-BAR1 and FXR, we have
developed a library of compounds introducing on the UDCA
scaffold: (i) side chains of different length (C23, C24, and C26)
and flexibility, (ii) side chains functionalized with a number of
diverse polar functional groups such as carboxylic, alcoholic,
and sulfate moieties. In fact, we have recently identified a
7689
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701

Journal of Medicinal Chemistry
Article
a
Scheme 3. Bis-homo Chenodeoxycholane Derivatives
a
Reagents and conditions: (a) LiBH4, MeOH dry, THF, 0 °C; (b) 2,6-lutidine, t-butyldimethylsilyl trifluoromethanesulfonate, CH2Cl2, 0 °C; (c)
LiBH4, MeOH dry, THF, 0 °C; (d) DMSO, oxalyl chloride, TEA dry, CH2Cl2, −78 °C; (e) LiOH, TEPA, THF dry, reflux; (e) HCl 37%, MeOH,
60% yield over five steps; (f) NaOH 5% in MeOH/H2O 1:1 v/v, 78% yield; (g) LiBH4, MeOH dry, THF, 0 °C, 73% yield.
potent GP-BAR1 agonist showing the CDCA scaffold with a
sulfate group on the side chain.22 Thus, it is worth investigating
the effect of this substituent on the GP-BAR1 activity of UDCA
derivatives.
nor-Ursodeoxycholane Derivatives. A key step in the
synthetic protocol toward nor-ursodeoxycholane derivatives was
Beckmann one-carbon degradation at C24 on the UDCA
perfomate derivative 21, generated through UDCA Fisher’s
esterification with formic acid and acetic anhydride,25 by
treatment with sodium nitrite in a mixture of trifluoroacetic
anhydride and trifluoroacetic acid (Scheme 1).26,27
purification allowed us to obtain the corresponding tauro
conjugated derivative 20.
Double bond hydrogenation on 24 gave methyl ester 15,
which was used as starting material in the preparation of
carboxyl acid 16 and its corresponding alcohol 14, through
treatment with LiOH and LiBH4, respectively. Finally, 16 was
easily transformed in the corresponding tauro-conjugated
(taurine, DMT-MM, 45% yield) derivative 17.
In this study, several derivatives were proved selective GP-
BAR1 agonists (see below in In Vitro Pharmacological
Evaluation), e.g., compounds 4, 14, and 16. These results
represent an interesting evidence of the hierarchical role played
by the length and the functionalization of the side chain rather
than the configuration at C7 in BA recognition of their
receptors. To give further support to this hypothesis, also bis-
homoCDCA (26) and corresponding alcohol 27 were prepared
(Scheme 3) starting from CDCA methyl ester and following
the synthetic protocol already described for the corresponding
bis-homo ursodeoxycholane derivatives (Scheme 2).
In Vitro Pharmacological Evaluation. Ursodeoxycholane
derivatives (3−20, Figure 2) and chenodeoxycholane analogues
26 and 27 were tested in the luciferase reporter assays on
HepG2 and HEK-293T cells transfected with FXR and GP-
BAR1, respectively. Our pharmacological data suggest that the
stereochemistry at C7 is a determinant factor for the activity on
FXR and not on GP-BAR1. In fact, as shown in Figures 3 and 4,
all the newly synthesized UDCA derivatives, which have the 7β-
OH group, are inactive on FXR, while compounds like CDCA,
which presents a 7α-OH group, activates this receptor. At
variance with FXR, in GP-BAR1 the presence of the 7α-OH as
in CDCA, the 7β-OH as in 16 and even the absence of the
hydroxyl group at C7 as in TLCA are tolerated.
Alkaline hydrolysis of the resulting C23-nitrile (22) furnished
11 in 97% chemical yield, which in a small aliquot was
subjected to the reaction of amidation with taurine in the
presence of the versatile coupling agent, 4-(4,6-dimethoxy-
1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMT-
MM),28 giving the amide derivative as ammonium sulfate salt.
Purification on RP-18 column followed by HPLC furnished 12
in pure form and as sodium salt (28% chemical yield).
Methanol/p-toluenesulfonic acid treatment on 11 afforded
C23 methyl ester 13 that in turn was transformed in the
corresponding C23 alcohol 4 by treatment with lithium
borohydride (88% chemical yield over two steps). Sulfation
(Et3N·SO3 10 equiv) afforded a crude reaction product
(Scheme 1) containing trisulfate derivative 10, the mixture of
disulfate derivatives 8−9, and the mixture of monosulfate
derivatives 5−7. RP-18 column separation with a gradient
eluting system from water to methanol followed by HPLC of
the enriched fractions furnished pure derivatives 5−10, differing
in the sulfation pattern on nor-ursodeoxycholane scaffold.
Ursodeoxycholane and Bis-homo-ursodeoxycholane
Derivatives. First, treatment of ursodeoxycholic methyl ester
with LiBH4 afforded triol 3 in high chemical yield (Scheme 2).
A four-step reaction sequence on UDCA methyl ester,
including protection of alcoholic functions at C3 and C7 (2,6-
lutidine, t-butyldimethylsilyl trifluoromethanesulfonate,
CH2Cl2), reduction of the side chain methyl ester (LiBH4,
MeOH/THF), and subsequent one-pot Swern oxidation/
Wittig C2 homologation gave the protected conjugated methyl
ester 24 in a total 76% chemical yield. Silyl deprotection
furnished pure Δ24,25 ester 18 that was subjected to methyl
ester hydrolysis to give the corresponding bis-homo conjugated
acid 19. Finally, amidation with taurine and RP18/HPLC
Additionally as previously demonstrated,29 side chain
elongation on CDCA scaffold produce positive effects toward
FXR when an hydroxyl function is placed as end-terminus (27),
whereas the corresponding carboxyl acid derivative 26 was
almost inactive when tested at 10 μM (Figure 3A). Moreover,
when compound 26 was tested at 50 μM in the presence of
CDCA (Figure 3B), the ratio RLU/RRU was higher than that
of CDCA, indicating that 26 might be an FXR modulator.
Indeed, 26 was demonstrated cytotoxic on HEK-293T cells
(Figure 4B) at 50 μM, thus ruling out the pharmacological
potential of this compound.
7690
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701

Journal of Medicinal Chemistry
Article
Figure 3. Transactivation assays on FXR. (A) HepG2 cells were transfected with pSG5-FXR, pSG5-RXR, pCMV-βgal, and p(hsp27)TKLUC
vectors. Cells were stimulated with compounds 3−20, 26, and 27 (10 μM). CDCA (1, 10 μM) was used as a positive control, UDCA (2, 10 μM) as
negative control. Results are expressed as mean standard error; *p < 0.05 versus not treated cells (NT). (B) HepG2 cells were transfected with
pSG5-FXR, pSG5-RXR, pCMV-βgal, and p(hsp27)TKLUC vectors. Cells were stimulated with CDCA (1) 10 μM in combination with UDCA (2,
50 μM) as negative control and with 3−20, 26, and 27, 50 μM. Results are expressed as mean standard error. *p < 0.05 versus NT; #p < 0.05
versus CDCA; °cytotoxic at 50 μM.
None of the tested compounds turned out to be FXR
antagonist (Figure 3B).
Interestingly, also 16 and the corresponding Δ24,25
conjugated analogue 19 were demonstrated inducers of
cAMP-luciferase reporter gene, with 16 showing a potency
similar to that of TLCA, the most potent endogenous GP-
BAR1 agonist (Figure 4). This result demonstrates that side
chain elongation on the ursodeoxycholane scaffold produce
positive effects toward GP-BAR1 activation also when a
carboxyl function is placed as end-terminus. The above activity
declines in the corresponding tauro-conjugates (compare 16
with 17 and 19 with 20 in Figure 4), thus demonstrating that
further elongation of UDCA side chain is not tolerated by the
Results of transactivations of CREB-responsive elements in
HEK-293T cells transiently transfected with the membrane bile
acid receptor GP-BAR1 (Figure 4) revealed that all
ursodeoxycholane alcohols generated in this study, compounds
3, 4, and 14, transactivate GP-BAR1, thus demonstrating that
the introduction of an hydroxyl group on the side chain of
ursodeoxycholane scaffold produces, independently by side
chain length (C23 in 4, C24 in 3 and C26 in 14), derivatives
endowed with membrane bile acid receptor agonism.
7691
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701

Journal of Medicinal Chemistry
Article
Figure 4. Transactivation assays on GP-BAR1. (A) HEK-293T cells were cotransfected with GP-BAR1 and a reporter gene containing a cAMP
responsive element in front of the luciferase gene. Then 24 h post transfection, cells were stimulated with CDCA (1), UDCA (2), and compounds
3−20, 26, and 27 (10 μM). Luciferase activity served as a measure of the rise in intracellular cAMP following activation of GP-BAR1. TLCA (10
μM) was used as a positive control. Results are expressed as mean
standard error. *p < 0.05 versus NT cells. (B) Antagonistic activity of
compounds 1−27 on transactivation of cAMP responsive element induced by TLCA in HEK-293T cells transfected with GP-BAR1. Experimental
conditions were the same described in (A). None of the compound had an antagonistic activity. Concentrations used were: TLCA 10 μM, while all
the other compounds were tested at the concentration of 50 μM. Results are expressed as mean standard error. *p < 0.05 versus NT cells;
°cytotoxic at 50 μM.
receptor. Of interest is also the behavior of chenodeoxycholane
derivatives 26 and 27, with the alcohol 27 almost inactive and
the carboxylic acid 26 less potent than the corresponding
UDCA derivative 16.
Notably, 3, 4, 14, 16, and 19 are selective GP-BAR1 agonists
devoid of any activity toward FXR (Figure 3). Moreover, none
of tested compounds was able to induce cAMP-luciferase
reporter gene in absence of GP-BAR1 (data not shown), thus
indicating that the observed cAMP induction is GP-BAR1
mediated.
cAMP responsive element in HEK-293T cells transfected with
GP-BAR1 with an EC50 of 24.4 and 17.2 μM, respectively.
Computational Studies. To elucidate the structural
requisites of the activity of the UDCA derivatives on GP-
BAR1, we performed docking simulations on the most active
compounds of the series (3, 4, 14, and 16). In these
calculations, we used the tridimensional structure of GP-
BAR1 that we have very recently reported22 (see Experimental
Section for details). The best-scored docking solution shows
the most potent derivative of the series, compound 16, H-
bonding with the Glu169 and Asn93 side chains through the
3α- and 7β-hydroxyl groups, respectively (Figure 6).
Among all tested compounds, our attention was focused on 4
and 16, both selective GP-BAR1 agonists, but quite different in
their chemical scaffold. As shown in Figure 5, compounds 4 and
16 exerted a concentration-dependent effect on activation of
On the other side of the molecule, the flexible side chain
points toward the transmembrane (TM) helices 1, 2, and 7,
where the ligand carboxylate group engages H-bonds with the
7692
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701

Journal of Medicinal Chemistry
Article
Figure 5. Concentration−response curves on GP-BAR1 activation by compounds 4 and 16. HEK-293T cells were transfected with GP-BAR1 and
stimulated with increasing concentrations of 4 and 16 (0.1, 1, and 10 μM). Results are mean standard error of at least three determination in
duplicate.
Figure 6. Binding mode of 16 (upper left), 14 (upper right), 3 (lower right), and 4 (lower left) in the GP-BAR1 homology model. Ligands are
represented as cyan (16), green (14), orange (3), and yellow (4) sticks. The receptor is shown as gray cartoons and sticks. Extracellular loops and
nonpolar hydrogens are omitted for clarity.
side chains of Ser21 and Ser270. This ligand binding mode is
further stabilized by a series of hydrophobic interactions
engaged by the steroidal scaffold with residues such as Leu71,
Phe83, Leu174, and Trp237. It is interesting to note that the
computed binding mode of 16 is very similar to that of other
potent GP-BAR1 agonists previously reported by our group.22
Furthermore, mutagenesis data showed a reduced activity of
bile acid derivatives in the Asn93Ala, Glu169Ala, and Ser270Ala
GP-BAR1 mutants if compared to the wild-type receptor.30 The
involvement of these residues in the binding mode of 16 is in
line with these experimental observations. The substitution of
the carboxylate group with a hydroxyl one does not
substantially alter the ligand binding mode. In fact, the alcohol
derivative 14 shows a binding mode very similar to that of 16
(Figure 6). In particular, the steroidal scaffold of 14 engages the
same interactions established by 16, while its C26 side chain
points toward the polar region formed by Ser21, Ser267, and
Ser270, where the hydroxyl group H-bonds with the Ser270
side chain.
Our results show that in this pocket the presence of a
negatively charged group, as in compound 16, is desirable but
not necessary, while polar groups, able to form H-bond
interactions, are important for GP-BAR1 activation. Our in
silico predictions explain the pharmacological data, which show
7693
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701

Journal of Medicinal Chemistry
Article
Figure 7. In vivo evaluation on compound 16. In vivo administration of 16 has no effect on expression of FXR target genes in the liver but increases
the expression of pro-glucagon 1, a GP-BAR1 regulated gene. Livers were collected 6 h after administration of 16 or UDCA (2) and 24 h after
administration of 2; *p < 0.05 versus control mice.
Figure 8. Effect of UDCA and 16 in a rodent model of cholestasis. In vivo administration of UDCA (2) and 16 alters the bile acid pool. Cholestasis
was induced by feeding mice with ANIT alone or in combination with 2, 15 mg/kg, or 16, 16 mg/kg, for 7 days. Blood was collected at the end of
experiments and bile acids concentrations measured as described in the Experimental Section. (A) Analysis of body weight loss in control mice, mice
administered ANIT, mice administered ANIT plus 2, and mice administered ANIT plus 16. (B) Blood concentrations of total conjugated bile acids.
(C) Administration of 16 caused a robust increase in tauro-muricholic acid (tMU) and tauro-cholic acid (tCA). *p < 0.05 versus control mice; #p <
0.05 versus ANIT treated mice.
7694
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701

Journal of Medicinal Chemistry
Article
a decreased activity of the hydroxyl compound 14 if compared
with 16, while the more hydrophobic ester derivative 15 shows
an even lower activity.
effect became apparent only 24 h after its administration (p <
0.05 versus control mice).
In contrast, expression of pro-glucagon-1 gene, a GP-BAR1
regulated target, in the intestine was increased by 2-fold in
response to 6 h treatment with compound 16 (Figure 7). In
summary, compound 16 is an effective and selective GP-BAR1
ligand in vivo and in vitro, and its activity is different from
UDCA, its parent compound.
To further confirm the role of compound 16 as a GP-BAR1
agonist, we also performed a cholestatic model by administer-
ing mice with α-naphthylisothiocyanate (ANIT). As shown in
Figure 8, exposure to ANIT caused cholestasis as confirmed by
the analysis of plasma bile acid concentration in ANIT treated
animals which revealed that these animals had an increase in
the total conjugated bile acids in comparison with not treated
animals.
In addition, ANIT treated animals had a significant lost
weight in comparison with not treated animals, while no
significant differences among the groups ANIT and ANIT plus
UDCA was observed in terms of both weight loss and bile acid
concentration. By the contrast, administration of compound 16
significantly increased total amount of plasma bile acids in
comparison with ANIT treated mice (p < 0.05 versus ANIT
treated mice). It is noteworthy that mice administered with
compound 16 had a significant increase in plasma levels of
tauro-muricholic acid (tMU) and tauro-cholic acid (tCA)
compared with ANIT treated mice (p < 0.05 versus ANIT
treated mice).
To provide further structural insights on the binding
mechanism to GP-BAR1 of this series of compounds, we
studied also the binding mode of the alcohol derivatives 3 and
4. These ligands bear a shorter side chain with respect to 14
and 16, specifically 3 and 4 are C24 and C23 derivatives,
respectively. Docking calculations show that these compounds
occupy the binding site similarly to 14 and 16, demonstrating
that shorter side chains are allowed if they present H-bonding
groups which can interact with the neighboring serine residues
through direct or water mediated H-bonds (Figure 6). This
finding is in agreement with the pharmacological data showing
that 3 and 4 are both able to activate GP-BAR1 in
transactivation assays. It is important to stress that our
simulations highlight the high conformational flexibility of the
ligand side chain, which allows the proper binding of the ligand
in the binding pocket and the formation of the interactions with
the receptor. Compounds with a more rigid side chain, such as
the Δ24,25 compound 19 (see Supporting Information, Figure
S1), show indeed a lower activity. A reduced activity was
observed also for the tauro-conjugated compounds 12 and 20,
where the presence of the amide group decreases the
conformational flexibility of the ligand side chain. Finally, the
presence of bulky groups on rings A and B, like sulfate in
compounds 6−10, hampers the proper orientation of the ligand
in the binding site to interact with residues such as Asn93 and
Glu169, causing a drop in the activity.
On the basis of our pharmacological assays, all the UDCA
derivatives are inactive on FXR. These data prompted us to
investigate the binding mechanism of UDCA to FXR in the
attempt to elucidate the structural bases of its inactivity toward
this receptor. Docking calculations on UDCA in the FXR-LBD
indicates that it is able to form a salt-bridge with the Arg328
side chain through its C24 carboxylate group and two hydrogen
bonds with the Tyr358 and His444 side chains through its 3α-
OH (see Supporting Information, Figure S2). Similar
interactions are engaged by the potent FXR agonist 6-
ECDCA,21 however, at variance with 6-ECDCA, UDCA is
not able to form hydrogen bonds with the Tyr366 and Ser329
side chains due to the presence of the β-oriented 7-hydroxyl
group (see Supporting Information, Figure S2). The lack of
these interactions might explain the inactivity of UDCA toward
FXR as also previously reported by Fujino et al.31 This
conclusion is further supported by experimental data, showing
that the interaction with Tyr366 and Ser329 is determinant for
the agonistic activity on FXR. In fact, compounds such as 3-
deoxyCDCA, which interacts with Tyr366 and Ser329 and not
with His444 and Trp466, have an agonist profile in FXR
transactivation assays.21
CONCLUSION
■
In conclusion, in this study we demonstrated that manipulating
UDCA side chain represents a promising strategy to generate
bile acid derivatives as selective GP-BAR1 agonists. Pharmaco-
logical evaluation on 16 demonstrated this compound as a
promising lead for the treatment of diabetes. Administration of
compound 16 selectively increase the expression of pro-
glucagon 1, a GP-BAR1 target, in the small intestine, while it
had no effect on FXR target genes in the liver. Further,
compound 16 results in a significant reshaping of bile acid pool
in a rodent model of cholestasis. This study provides new
opportunities for the treatment of enterohepatic and metabolic
disorders.
EXPERIMENTAL SECTION
■
Chemistry. General. Specific rotations were measured on a Jasco
P-2000 polarimeter. High-resolution ESI-MS spectra were performed
with a Micromass Q-TOF mass spectrometer. NMR spectra were
obtained on Varian Inova 400 and Varian Inova 500 NMR
spectrometers (1H at 400 and 500 MHz, 13C at 100 and 125 MHz)
equipped with Sun hardware and recorded in CDCl3 (δH = 7.26 and
δC = 77.0 ppm) and CD3OD (δH = 3.30 and δC = 49.0 ppm). J are in
hertz, and chemical shifts (δ) are reported in ppm and referred to
CHCl3 and CHD2OD as internal standards. HPLC was performed
using a Waters model 510 pump equipped with Waters Rheodine
injector and a differential refractometer, model 401. Reaction progress
was monitored via thin-layer chromatography (TLC) on Alugram
silica gel G/UV254 plates. Silica gel MN Kieselgel 60 (70−230 mesh)
from Macherey-Nagel Company was used for column chromatog-
raphy. All chemicals were obtained from Sigma-Aldrich, Inc. Solvents
and reagents were used as supplied from commercial sources with the
following exceptions. Tetrahydrofuran, dichloromethane, diisopropyl-
amine, and triethylamine were distilled from calcium hydride
immediately prior to use. Methanol was dried from magnesium
methoxide as follows. Magnesium turnings (5 g) and iodine (0.5 g)
were refluxed in a small (50−100 mL) quantity of methanol until all of
In Vivo Evaluation on Compound 16. Compound 16,
the most potent GP-BAR1 agonist generated in this study, was
further investigated in vivo and its effects on FXR and GP-
BAR1 target genes in the liver and intestine assessed by RT-
PCR. In these experiments CD1, 11 week old male mice were
orally administered with compound 16 (64 mg/kg) or its
parent compound UDCA (60 mg/kg) and liver, intestine, and
blood collected after 3, 6, and 24 h (n = 3).
As illustrated in Figure 7, compound 16 failed to induce the
expression of OST and BSEP mRNA in the liver at 6 and 24 h
(data not shown) after administration. UDCA increased the
expression of these two FXR-target genes although that the
7695
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701

Journal of Medicinal Chemistry
Article
the magnesium had reacted. The mixture was diluted (up to 1 L) with
reagent grade methanol, refluxed for 2−3 h, then distilled under
nitrogen. All reactions were carried out under argon atmosphere using
flame-dried glassware.
The purity of tested compounds was determined to be always
greater than 95% by analytical HPLC analysis using a Nucleodur 100−
5 C18 (5 μm; 4.6 mm i.d. × 250 mm) column eluting with the solvent
system (flow rate 1 mL/min) reported below in the section
corresponding to each individual compound.
mm i.d. × 250 mm) with MeOH/H2O (60:40) as eluent (flow rate 1
D
mL/min) to give 7 mg (28%) of compound 12 (tR = 12.4 min); [α]25
1
= −4.8 (c 0.15, CH3OH). Selected H NMR (400 MHz CD3OD): δ
3.58 (2H, t, J = 6.6 Hz), 3.48 (2H, m), 2.95 (2H, t, J = 6.6 Hz), 0.97
(3H, d, ovl), 0.96 (3H, s), 0.71 (3H, s). HR ESIMS m/z 484.2735 [M
− Na]−, C25H42NO6S requires 484.2732.
Methyl 3α,7β-Dihydroxy-24-nor-5β-cholan-23-oate (13). Com-
pound 11 (100 mg, 0.26 mmol) was dissolved in 30 mL of dry
methanol and treated with p-toluenesulfonic acid (251 mg, 1.3 mmol).
The solution was left to stand at room temperature for 5 h. The
mixture was quenched by addition until neutrality of NaHCO3
saturated solution. Most of the solvent was evaporated, and the
residue was extracted with EtOAc. The combined extract was washed
with brine, dried with Na2SO4, and evaporated to give 13 as
amorphous solid (100 mg, 97% yield). An analytic sample was purified
by HPLC on a Nucleodur 100−5 C18 (5 μm; 4.6 mm i.d. × 250 mm)
with MeOH/H2O (9:1) as eluent (flow rate 1 mL/min) to give
3α,7β-Diformyloxy-5β-cholan-24-oic Acid (21). A solution of
ursodeoxycholic acid 2 (550 mg, 1.3 mmol) in 10 mL of 90% formic
acid containing 25 μL of 70% perchloric acid was stirred at 47−50 °C
for 12 h. The temperature of the heating bath was lowered to 40 °C,
then 5 mL of acetic anhydride was added over 10 min and the mixture
was stirred for 10 min more. The solution was cooled to room
temperature, poured into 50 mL of water, and extracted with diethyl
ether. The organic layers were washed with water to neutrality, dried
over Na2SO4, and evaporated to give 570 mg of 21 (96%). An analytic
sample was obtained by silica gel chromatography eluting with
D
compound 13 (tR = 9.5 min); [α]25 = +19.8 (c 0.22, CHCl3).
1
Selected H NMR (400 MHz CDCl3): δ 3.60 (3H, s), 3.51 (2H, m),
1
0.92 (3H, d, J = 6.3 Hz), 0.88 (3H, s), 0.65 (3H, s). 13C NMR (100
MHz CDCl3): δ 173.8, 71.0, 70.9, 55.7, 54.9, 51.3, 43.6, 43.4, 42.4,
41.3, 39.9, 39.1, 37.1, 37.0, 34.8, 33.9, 33.6, 30.0, 28.6, 26.7, 23.3, 21.0,
19.5, 12.0. HRMS-ESI m/z 393.3009 [M + H]+, C24H41O4 requires
393.3005.
CH2Cl2/MeOH 9:1. Selected H NMR (400 MHz CD3OD): δ 8.03
(1H, s), 7.98 (1H, s), 4.89 (1H, m), 4.80 (1H, m), 0.98 (3H, s), 0.93
(3H, d, J = 6.5 Hz), 0.69 (3H, s). 13C NMR (100 MHz CD3OD): δ
178.1, 163.0, 162.5, 74.9, 74.8, 56.6, 56.4, 44.8, 43.5, 41.3, 41.2, 40.7,
36.6, 35.4 (2C), 35.1, 34.1, 34.0, 32.3, 32.0, 29.5, 27.6, 23.6, 22.3, 18.9,
12.5. HRMS-ESI m/z 449.2907 [M + H]+, C26H41O6 requires
449.2903.
3α,7β-Dihydroxy-24-nor-5β-cholan-23-ol (4). To a solution of 13
(90 mg, 0.23 mmol) in dry THF (5 mL) at 0 °C under argon were
added LiBH4 (0.8 mL, 2 M in THF, 1.6 mmol) and dry methanol (65
μL, 1.6 mmol), and the resulting mixture was stirred for 3 h at 0 °C.
The mixture was quenched by addition of NaOH (1 M, 1.4 mL) and
then allowed to warm to room temperature. Ethyl acetate was added,
and the separated aqueous phase was extracted with ethyl acetate (3 ×
30 mL). The combined organic phases were washed with water, dried
(Na2SO4), and concentrated. Purification by silica gel (CH2Cl2/
MeOH 97:3) gave compound 4 as a colorless oil (85 mg, quantitative
yield). An analytic sample was purified by HPLC on a Nucleodur
100−5 C18 (5 μm; 4.6 mm i.d. × 250 mm) with MeOH/H2O (8:2) as
eluent (flow rate 1 mL/min) to give compound 4 (tR = 17.8 min);
3α,7β-Diformyloxy-24-nor-5β-cholan-23-nitrile (22). Crude 21
(500 mg, 1.1 mmol), 1.7 mL of cold trifluoroacetic acid, and 466
μL (3.3 mmol) of trifluoroacetic anhydride were stirred at 0−5 °C
until dissolution. Sodium nitrite (83 mg, 1.21 mmol) was added in
small portions. After the addition was complete, the reaction mixture
was stirred first at 0−5 °C for 1 h, then at 38−40 °C for 8 h. On
completion, the reaction was neutralized with NaOH 2 N, then the
product was extracted with 50 mL of diethyl ether (3 × 50 mL),
followed by washing with brine and dried over anhydrous Na2SO4.
The ether was removed under reduced pressure to afford 440 mg of 22
(96%) that was subjected to next step without any purification. An
analytic sample was obtained by silica gel chromatography eluting with
n-hexane/ethyl acetate 8:2. Selected 1H NMR (400 MHz CD3OD): δ
8.04 (1H, s), 7.99 (1H, s), 4.87 (1H, m), 4.73 (1H, m), 1.12 (3H, d, J
= 6.5 Hz), 0.98 (3H, s), 0.71 (3H, s). 13C NMR (100 MHz CD3OD):
δ 163.1, 162.6, 120.3, 74.8 (2C), 56.4, 55.5, 44.8, 43.2, 41.2, 40.9, 40.6,
35.4, 35.1, 34.6, 34.1, 34.0, 30.9, 29.3, 27.6, 25.1, 23.6, 22.3, 19.8, 12.5.
HRMS-ESI m/z 416.2807 [M + H]+, C25H38NO4 requires 416.2801.
24-nor-Ursodeoxycholic Acid (11). Crude compound 22 (400 mg,
0.96 mmol) was refluxed in ca. 50 mL of methanol/water 1:1 with 30%
KOH. After stirring for 48 h, the basic aqueous solution was
neutralized with HCl 6 N. Then methanol was evaporated, and the
residue was extracted with AcOEt (3 × 50 mL). The combined
organic layers were washed with brine, dried, and evaporated to
dryness to give white solid residue, which was purified by silica gel
chromatography, eluting with CH2Cl2/MeOH 9:1 (355 mg, 97%). An
analytic sample was purified by HPLC on a Nucleodur 100−5 C18 (5
μm; 4.6 mm i.d. × 250 mm) with MeOH/H2O (70:30) as eluent (flow
rate 1 mL/min), to give compound 11 (tR = 20.7 min); [α]25D = +11.0
D
1
[α]25 = +23.7 (c 0.18, CH3OH). H NMR (400 MHz CD3OD): δ
3.60 (1H, m ovl), 3.51 (1H, m), 3.50 (2H, m), 0.97 (3H, d, ovl), 0.96
(3H, s), 0.72 (3H, s). 13C NMR (100 MHz CD3OD): δ 72.1, 71.9,
60.8, 57.5, 57.1, 44.8, 44.5, 44.0, 41.6, 40.7, 39.9, 38.6, 38.0, 36.1, 35.2,
34.1, 31.0, 29.8, 27.9, 23.9, 22.4, 19.5, 12.6. HRMS-ESI m/z 365.3053
[M + H]+, C23H41O3 requires 365.3056.
3α,7β-Dihydroxy-24-nor-5β-cholan-23-yl-23-sodium Sulfate (5),
7β,23-Dihydroxy-24-nor-5β-cholan-3α-yl-3-sodium Sulfate (6),
3α,23-Dihydroxy-24-nor-5β-cholan-7β-yl-7-sodium Sulfate (7), 7β-
Hydroxy-24-nor-5β-cholan-3α,23-diyl-3,23-sodium Disulfate (8),
3α-Hydroxy-24-nor-5β-cholan-7β,23-diyl-7,23-sodium Disulfate
(9), and 24-nor-5β-Cholan-3α,7β,23-tryl-3,7,23-sodium Trisulfate
(10). The triethylamine−sulfur trioxide complex (253 mg, 1.4 mmol)
was added to a solution of compound 4 (50 mg, 0.14 mmol) in DMF
dry (5 mL) under an argon atmosphere, and the mixture was stirred at
95 °C for 24 h. The solution was then concentrated under vacuum. To
the solid dissolved in methanol (15 mL) was added three drops of HCl
37% v/v, and the mixture was stirred for 3 h at room temperature. At
the end of reaction, silver carbonate was added to precipitate chloride.
Then the reaction mixture was centrifuged, and the supernatant was
concentrated in vacuo. The residue was poured over a RP18 column.
Fraction eluted with H2O/MeOH 99:1 gave a mixture that was
further purified by HPLC on a Nucleodur 100−5 C18 (5 μm; 4.6 mm
i.d. × 250 mm) with MeOH/H2O (35:65) as eluent (flow rate 1 mL/
min) to give 3.7 mg (4%) of compound 10 (tR = 5 min); fraction
eluted with H2O/MeOH 95:5 and with H2O/MeOH 9:1 gave a
mixture that was purified as previously to afford respectively 8.7 mg
(11%) of compound 8 (tR = 15 min) and 7 mg (9%) of compound 9
(tR = 14 min). Fraction eluted with H2O/MeOH 75:25 gave a mixture
that was further purified by HPLC on a Nucleodur 100−5 C18 (5 μm;
4.6 mm i.d. × 250 mm) with MeOH/H2O (65:35) as eluent (flow rate
1 mL/min), to give 15 mg (23%) of compound 7 (tR = 7 min).
Fraction eluted with H2O/MeOH 7:3 gave a mixture that was further
1
(c 0.41, CH3OH). Selected H NMR (400 MHz CD3OD): δ 3.44
(2H, m), 0.98 (3H, d, J = 6.5 Hz), 0.93 (3H, s), 0.71 (3H, s). 13C
NMR (100 MHz CD3OD): δ 177.3, 72.1, 71.9, 57.5, 56.6, 44.8, 44.5,
44.0, 42.5, 41.4, 40.7, 38.6, 38.0, 36.1, 35.2, 34.9, 31.0, 29.7, 27.9, 23.9,
22.4, 20.2, 12.7. HRMS-ESI m/z 379.2844 [M + H]+, C23H39O4
requires 379.2848.
3α,7β-Dihydroxy-24-nor-5β-cholan-23-oyl Taurine Sodium Salt
(12). Carboxylic acid 11 (20 mg, 0.05 mmol) in DMF dry (2 mL) was
treated with DMT-MM (41 mg, 0.15 mmol) and triethylamine (174
μL, 1.25 mmol), and the mixture was stirred at room temperature for
10 min. Then to the mixture was added taurine (37 mg, 0.3 mmol).
After 1 h, the reaction mixture was concentrated under vacuo and
dissolved in water (5 mL). The solution was poured over a C18 silica
gel column. Fraction eluted with H2O/MeOH 99:1 gave a mixture that
was further purified by HPLC on a Nucleodur 100−5 C18 (5 μm; 4.6
7696
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701

Journal of Medicinal Chemistry
Article
purified as previously to give 5 mg (8%) of compound 5 (tR = 8.4 min)
and 4 mg (6%) of compound 6 (tR = 6.4 min).
Methyl 3α,7β-Di(tert-butyldimethylsilyloxy)-25,26-bis-homo-5β-
chol-24-en-26-oate (24). DMSO (2 mL, 28 mmol) was added
dropwise for 15 min to a solution of oxalyl chloride (7 mL, 14 mmol)
in dry dichloromethane (50 mL) at −78 °C under argon atmosphere.
After 30 min, a solution of alcohol 23 (1.2 g, 2 mmol) in dry CH2Cl2
was added via cannula and the mixture was stirred at −78 °C for 30
min. Et3N (2.8 mL, 20 mmol) was added dropwise. After 1 h,
methyl(triphenylphosphoranylidene)acetate (2.1 g, 3 mmol) was
added and the mixture was allowed to warm to room temperature.
NaCl saturated solution was added, and the aqueous phase was
extracted with diethyl ether (3 × 100 mL). The combined organic
phases were washed with water, dried (Na2SO4), and concentrated.
Purification by silica gel (hexane/ethyl acetate 95:5 and 0.5% TEA)
3α,7β-Dihydroxy-24-nor-5β-cholan-23-yl-23-sodium Sulfate (5).
D
1
[α]25 = +35.8 (c 0.69, CH3OH). H NMR (400 MHz CD3OD): δ
4.04 (2H, m), 3.48 (2H, m), 1.00 (3H, d, J = 6.5 Hz), 0.97 (3H, s),
0.72 (3H, s). HR ESIMS m/z 443.2469 [M − Na]−, C23H39O6S
requires 443.2467.
7β,23-Dihydroxy-24-nor-5β-cholan-3α-yl-3-sodium Sulfate (6).
D
1
[α]25 = +11.4 (c 0.04, CH3OH). H NMR (400 MHz CD3OD): δ
4.23 (1H, m), 3.48 (3H, m), 0.98 (3H, d, J = 6.4 Hz), 0.97 (3H, s),
0.72 (3H, s). HR ESIMS m/z 443.2462 [M − Na]−, C23H39O6S
requires 443.2467.
3α,23-Dihydroxy-24-nor-5β-cholan-7β-yl-7-sodium Sulfate (7).
D
D
1
gave compound 24 as a colorless oil (1 g, 76%); [α]25 = +45.0 (c
[α]25 = +7.8 (c 0.19, CH3OH). H NMR (400 MHz CD3OD): δ
4.29 (1H, m), 3.61 (1H, m), 3.51 (2H, m), 0.97 (3H, s), 0.96 (3H, d,
ovl), 0.70 (3H, s). HR ESIMS m/z 443.2465 [M − Na]−, C23H39O6S
requires 443.2467.
0.70, CH3OH). 1H NMR (400 MHz CDCl3): δ 6.94 (1H, dt, J = 7.3,
15.5 Hz), 5.78 (1H, d, J = 15.5 Hz), 3.66 (3H, s), 3.64 (2H, m), 0.92
(3H, d, J = 6.5 Hz), 0.90 (3H, s), 0.86 (18H, s), 0.62 (3H, s), 0.04
(6H, s), 0.03 (6H, s). 13C NMR (100 MHz CDCl3): δ 167.0, 150.0,
120.9, 72.7, 72.5, 55.5, 54.9, 51.3, 43.9, 43.7, 42.8, 39.9, 38.8, 37.9,
37.8, 35.3 (2C), 35.1, 34.3, 34.1, 30.9 (2C), 30.8, 28.9, 27.3, 26.4 (3C),
25.9 (3C), 23.5, 21.2, 18.6, 12.1, −2.8, −3.4, −4.6 (2C). HRMS-ESI
m/z 661.5050 [M + H]+, C39H73O4Si2 requires 661.5047.
7β-Hydroxy-24-nor-5β-cholan-3α,23-diyl-3,23-sodium Disulfate
D
(8). [α]25 = +0.3 (c 0.23, CH3OH). 1H NMR (400 MHz
CD3OD): δ 4.23 (1H, m), 4.04 (2H, m), 3.48 (1H, m), 1.00 (3H,
d, J = 6.6 Hz), 0.97 (3H, s), 0.72 (3H, s). HR ESIMS m/z 545.1859
[M − Na]−, C23H38NaO9S2 requires 545.1855.
3α-Hydroxy-24-nor-5β-cholan-7β,23-diyl-7,23-sodium Disulfate
Methyl 3α,7β-Dihydroxy-25,26-bis-homo-5β-cholan-26-oate
(15). A solution of compound 24 (500 mg, 0.76 mmol) in THF
dry/EtOH dry (5 mL/5 mL, v/v) was hydrogenated in the presence of
Pd(OH)2 5 wt % on activated carbon Degussa type (5 mg). The flask
was evacuated and flushed first with argon and then with hydrogen.
After 12 h, the reaction was complete. The catalyst was filtered
through Celite, and the recovered filtrate was concentrated under
vacuum to give the methyl ester, which was dissolved in methanol (40
mL). At the solution was added 1 mL of HCl 37% v/v. After 1 h, silver
carbonate was added to the solution to precipitate chloride. Then the
reaction mixture was centrifuged, and the supernatant was
concentrated in vacuo to give compound 15 as colorless amorphous
solids (330 mg, quantitative yield). An analytic sample was purified by
HPLC on a Nucleodur 100−5 C18 (5 μm; 4.6 mm i.d. × 250 mm)
with MeOH/H2O (92:8) as eluent (flow rate 1 mL/min) to give
D
(9). [α]25 = +0.5 (c 0.15, CH3OH). 1H NMR (400 MHz
CD3OD): δ 4.29 (1H, m), 4.05 (2H, m), 3.50 (1H, m), 0.99 (3H,
d, J = 6.5 Hz), 0.97 (3H, s), 0.71 (3H, s). HR ESIMS m/z 545.1857
[M − Na]−, C23H38NaO9S2 requires 545.1855.
24-nor-5β-Cholan-3α,7β,23-tryl-3,7,23-sodium Trisulfate (10).
D
1
[α]25 = +13.3 (c 0.03, CH3OH). H NMR (400 MHz CD3OD): δ
4.31 (1H, m), 4.23 (1H, m), 4.04 (2H, m), 1.00 (3H, d, J = 6.4 Hz),
0.98 (3H, s), 0.71 (3H, s). HR ESIMS m/z 647.1247 [M − Na],
C23H37Na2O12S3 requires 647.1243.
3α,7β-Dihydroxy-5β-cholan-24-ol (3). At a solution of methyl
3α,7β-dihydroxy-5β-cholan-24-oate (50 mg, 0.12 mmol) in THF dry
(10 mL) were added at 0 °C dry methanol (51 μL, 1.255 mmol) and
LiBH4 (300 μL, 2 M in THF, 1.25 mmol). After 1 h, the mixture was
quenched by addition of NaOH (1 M, 240 μL) and then allowed to
warm to room temperature. Ethyl acetate was added, and the separated
aqueous phase was extracted with ethyl acetate (3 × 30 mL). The
combined organic phases were washed with water, dried (Na2SO4),
and concentrated. Purification by silica gel (CH2Cl2/methanol 9:1)
gave compound 3 as colorless oil (42 mg, 93%). An analytic sample
was purified by HPLC on a Nucleodur 100−5 C18 (5 μm; 4.6 mm i.d.
× 250 mm) with MeOH/H2O (85:15) as eluent (flow rate 1 mL/
D
compound 15 (tR = 13 min); [α]25 = +41.8 (c 0.15, CH3OH).
1
Selected H NMR (400 MHz CDCl3): δ 3.67 (3H, s), 3.59 (2H, m),
2.30 (2H, dt, J = 2.5, 7.5 Hz), 0.95 (3H, s), 0.91 (3H, d, J = 6.5 Hz),
0.67 (3H, s). 13C NMR (100 MHz CDCl3): 167.1, 71.3 (2C), 55.7,
55.1, 51.4, 43.8, 43.7, 42.4, 40.1, 39.2, 37.3, 36.8, 35.5 (2C), 34.9, 34.2,
34.1, 30.4, 28.7, 26.9, 25.7, 25.4, 23.4, 21.2, 18.7, 12.1. HRMS-ESI m/z
435.3479 [M + H]+, C27H47O4 requires 435.3474.
3α,7β-Dihydroxy-25,26-bis-homo-5β-cholan-26-oic Acid (16). A
portion of compound 15 (200 mg, 0.46 mmol) was hydrolyzed with
NaOH (184 mg, 4.6 mmol) in a solution of MeOH/H2O 1:1 v/v (20
mL). The mixture was stirred for 4 h at reflux. The resulting solution
was then acidified with HCl 6 N and extracted with ethyl acetate (3 ×
50 mL). The collected organic phases were washed with brine, dried
over Na2SO4 anhydrous, and evaporated under reduced pressure to
give compound 16 (115 mg, 60%). An analytic sample was purified by
HPLC on a Nucleodur 100−5 C18 (5 μm; 4.6 mm i.d. × 250 mm)
with MeOH/H2O (95:5) as eluent (flow rate 1 mL/min), to give
compound 16 (tR = 5 min); [α]25D = −9.0 (c 0.04, CH3OH). Selected
1H NMR (500 MHz CD3OD): δ 3.47 (2H, m), 2.27 (2H, dt, J = 3.4,
D
min), to give compound 3 (tR = 5.8 min); [α]25 = +54.7 (c 0.36,
CHCl3). Selected 1H NMR (400 MHz CD3OD): δ 3.51 (4H, m), 0.97
(3H, d, ovl), 0.97 (3H, s), 0.72 (3H, s). 13C NMR (100 MHz
CD3OD): δ 72.1, 71.9, 63.6, 57.6, 56.8, 44.8, 44.5, 44.0, 41.6, 40.7,
38.6, 38.0, 37.0, 36.1, 35.2, 33.3, 31.0, 30.3, 29.7, 27.9, 23.9, 22.4, 19.4,
12.6. HRMS-ESI m/z 379.3215 [M + H]+, C24H43O3 requires
379.3212.
3α,7β-Di(tert-butyldimethylsilyloxy)-5β-cholan-24-ol (23). 2,6-
Lutidine (2.8 mL, 20 mmol) and tert-butyldimethylsilyltrifluorome-
thanesulfonate (1.7 mL, 6 mmol) were added at 0 °C to a solution of
methyl 3α,7β-dihydroxy-5β-cholan-24-oate (800 mg, 2 mmol) in 30
mL of CH2Cl2. After 2 h stirring at 0 °C, the reaction was quenched by
addition of aqueous NaHSO4 (1 M, 100 mL). The layers were
separated, and the aqueous phase was extracted with CH2Cl2 (3 × 100
mL). The combined organic layers were washed with NaHSO4, water,
saturated aqueous NaHCO3, and brine and evaporated in vacuo to
give 1.3 g of methyl 3α,7β-di(tert-butyldimethylsilyloxy)-5β-cholan-24-
oate in the form of colorless needles that was subjected to next step
without any purification. To a solution of methyl ester (1 g, 1.6 mmol)
in dry THF (30 mL), at 0 °C dry methanol (453 μL, 11.2 mmol) and
LiBH4 (5.6 mL, 2 M in THF, 11.2 mmol) were added. The resulting
mixture was stirred for 2 h at 0 °C. The mixture was quenched by
addition of 1 M NaOH (3.2 mL) and then ethyl acetate. The organic
phase was washed with water, dried (Na2SO4), and concentrated.
Purification by silica gel (hexane/ethyl acetate 99:1 and 0.5% TEA)
gave 23 as a white solid (1.2 g, quantitative yield over two steps).
7.4 Hz), 0.96 (3H, s), 0.94 (3H, d, J = 6.5 Hz), 0.70 (3H, s). 13C NMR
(125 MHz CD3OD): δ 178.2, 72.1, 71.9, 57.6, 56.7, 44.8, 44.5, 44.0,
41.6, 40.7, 38.6, 38.0, 36.9, 36.8, 36.1, 35.3, 35.2, 30.9, 29.8, 27.9, 26.7,
26.6, 23.9, 22.4, 19.3, 12.7. HRMS-ESI m/z 421.3315 [M + H]+,
C26H45O4 requires 421.3318.
3α,7β-Dihydroxy-25,26-bis-homo-5β-cholan-26-oyl Taurine So-
dium Salt (17). Carboxylic acid 16 (20 mg, 0.047 mmol) in DMF dry
(5 mL) was treated with DMT-MM (39 mg, 0.14 mmol) and
triethylamine (164 μL, 1.18 mmol), and the mixture was stirred at
room temperature for 10 min. Then to the mixture was added taurine
(35 mg, 0.28 mmol). After 3 h, the reaction mixture was concentrated
under vacuo and dissolved in water (5 mL). The solution was poured
over a C18 silica gel column. Fraction eluted with H2O/MeOH 95:5
gave a mixture that was further purified by HPLC on a Nucleodur
7697
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701

Journal of Medicinal Chemistry
Article
100−5 C18 (5 μm; 4.6 mm i.d. × 250 mm) with MeOH/H2O (45:55)
as eluent (flow rate 1 mL/min) to give 12 mg (45%) of compound 17
(tR = 12.4 min); [α]25D = +108.3 (c 0.06, CH3OH). Selected 1H NMR
(400 MHz CD3OD): δ 3.59 (2H, t, J = 6.5 Hz), 3.47 (2H, m), 2.96
(2H, t, J = 6.5 Hz), 2.18 (2H, t, J = 7.4 Hz), 0.96 (3H, s), 0.94 (3H, d,
J = 6.2 Hz), 0.71 (3H, s). HRMS-ESI m/z 526.3200 [M − Na]−,
C28H48NO6S requires 526.3202.
as eluent (flow rate 1 mL/min), to give 3.5 mg (26%) of compound 20
(tR = 15.8 min); [α]25D = +52.1 (c 0.08, CH3OH). Selected 1H NMR
(400 MHz CD3OD): δ 6.73 (1H, dt, J = 6.5, 14.0 Hz), 5.89 (1H, d, J =
14.0 Hz), 3.65 (2H, t, J = 7.0 Hz), 3.47 (2H, m), 2.98 (2H, t, J = 7.0
Hz), 0.97 (3H, d, ovl), 0.96 (3H, s), 0.71 (3H, s). HRMS-ESI m/z
524.3043 [M − Na]−, C28H46NO6S requires 524.3046.
Ethyl 25,26-Bis-homo-3α,7α-dihydroxy-5β-cholan-26-oate (25).
Compound 25 (67 mg, 60% over five steps) was synthesized, starting
from methyl 3α,7α-dihydroxy-5β-cholan-24-oate (100 mg, 0.25
3α,7β-Dihydroxy-25, 26-bis-homo-5β-cholan-26-ol (14). At a
solution of compound 15 (50 mg, 0.11 mmol) in THF dry (10
mL) were added at 0 °C dry methanol (31 μL, 0.77 mmol) and LiBH4
(382 μL, 2 M in THF, 0.77 mmol). After 1 h, the mixture was
quenched by addition of NaOH (1 M, 220 μL) and then allowed to
warm to room temperature. Ethyl acetate was added, and the separated
aqueous phase was extracted with ethyl acetate (3 × 30 mL). The
combined organic phases were washed with water, dried (Na2SO4),
and concentrated. Purification by silica gel (CH2Cl2/methanol 9:1)
gave compound 14 as a colorless oil (35 mg, 77%). An analytic sample
was purified by HPLC on a Nucleodur 100−5 C18 (5 μm; 4.6 mm i.d.
× 250 mm) with MeOH/H2O (85:15) as eluent (flow rate 1 mL/
mmol), as previously reported;22 [α]25 = +6.72 (c 0.25, CHCl3).
D
Selected 1H NMR (400 MHz CDCl3): δ 4.14 (2H, q, J = 7.0 Hz), 3.80
(1H, br s), 3.38 (1H, m), 2.29 (2H, t, J = 6.7 Hz), 1.24 (3H, t, J = 7.0
Hz), 0.94 (3H, d, J = 6.6 Hz), 0.92 (3H, s), 0.68 (3H, s). 13C NMR
(100 MHz CDCl3): δ 175.4, 72.8, 69.0, 61.4, 57.4, 51.5, 43.6, 43.1,
41.0, 40.7, 40.3, 37.0, 36.7, 36.5, 35.8, 35.2, 34.8, 34.0, 31.3, 29.3, 26.6,
26.5, 24.6, 23.5, 21.8, 19.3, 14.6, 12.3. HRMS-ESI m/z 449.3635 [M +
H]+, C28H49O4 requires 449.3631.
25,26-Bis-homo-3α,7α-dihydroxy-5β-cholan-26-oic Acid (26). A
portion of compound 25 (15 mg, 0.033 mmol) was hydrolyzed with
NaOH (13.2 mg, 0.33 mmol) in a solution of MeOH/H2O 1:1 v/v
(10 mL). The mixture was stirred for 2 h at reflux. The resulting
solution was then acidified with HCl 6 N and extracted with ethyl
acetate (3 × 50 mL). The collected organic phases were washed with
brine, dried over Na2SO4 anhydrous, and evaporated under reduced
pressure to give compound 26 (10.8 mg, 78%); [α]25D = +6.6 (c 0.38,
D
min), to give compound 14 (tR = 9 min); [α]25 = +41.8 (c 0.21,
1
CH3OH). Selected H NMR (400 MHz CD3OD): δ 3.53 (2H, t, J =
6.5 Hz), 3.48 (2H, m), 0.95 (3H, s), 0.94 (3H, d, ovl), 0.70 (3H, s).
13C NMR (100 MHz CD3OD): δ 72.1, 71.9, 63.0, 57.5, 56.7, 44.7,
44.4, 44.0, 41.6, 40.7, 38.5, 37.9, 37.2, 37.0, 36.1, 35.2, 33.7, 30.9, 29.8,
27.9, 27.4, 27.1, 23.9, 22.4, 19.4, 12.7. HRMS-ESI m/z 407.3520 [M +
H]+, C26H47O3 requires 407.3525.
1
CH3OH). Selected H NMR (400 MHz CD3OD): δ 3.79 (1H, br s),
3.40 (1H, m), 2.25 (2H, t, J = 7.5 Hz), 0.94 (3H, d, J = 6.7 Hz), 0.92
(3H, s), 0.68(3H, s). 13C NMR (100 MHz CD3OD): δ 179.6, 72.8,
68.9, 57.5, 51.5, 43.6, 43.1, 41.0, 40.7, 40.4, 37.0, 36.8, 36.6, 36.2, 35.9
(2C), 34.0, 31.3, 29.4, 26.8 (2C), 24.6, 23.5, 21.8, 19.3, 12.3. HRMS-
ESI m/z 421.3315 [M + H]+, C26H45O4 requires 421.3318.
Methyl 3α,7β-Dihydroxy-25,26-bis-homo-5β-chol-24-en-26-oate
(18). To the compound 24 (180 mg, 0.27 mmol) dissolved in
methanol (30 mL) was added 1 mL of HCl 37% v/v, and the mixture
was stirred for 2 h at room temperature. At the end of reaction, silver
carbonate was added to precipitate chloride. Then the reaction mixture
was centrifuged and the supernatant was concentrated in vacuo to give
120 mg (quantitative yield) of the desired compound 18 as colorless
amorphous solids. An analytic sample was purified by HPLC on a
Nucleodur 100−5 C18 (5 μm; 4.6 mm i.d. × 250 mm) with MeOH/
H2O (92:8) as eluent (flow rate 1 mL/min), to give compound 18 (tR
= 14 min); [α]25 = +45.0 (c 0.70, CH3OH). H NMR (400 MHz
CDCl3): δ 6.93 (1H, dt, J = 6.6, 15.7 Hz), 5.79 (1H, d, J = 15.7 Hz),
3.64 (3H, s), 3.58 (2H, m), 0.92 (3H, s), 0.91 (3H, d, J = 6.4 Hz), 0.65
(3H, s). 13C NMR (100 MHz CDCl3): δ 167.2, 150.1, 120.4, 71.1,
71.0, 55.9, 55.1, 51.4, 43.7, 43.6, 42.5, 40.2, 39.3, 37.3, 37.1, 35.4, 34.9,
34.3, 34.0, 30.2, 29.0, 28.7, 26.9, 23.4, 21.2, 18.5, 12.2. HRMS-ESI m/z
433.3323 [M + H]+, C27H45O4 requires 433.3318.
3α,7α-Dihydroxy-25,26-bis-homo-5β-cholan-26-ol (27). Methyl
ester 25 (20 mg, 0.044 mmol) was reduced with LiBH4 (2 M in
THF dry, 156 μL, 0.31 mmol) and MeOH dry (12 μL, 0.31 mmol) in
THF dry at 0 °C for 5 h. The mixture was quenched by addition of 1
M NaOH solution (100 μL), and then ethyl acetate was added. The
separated aqueous phase was extracted with ethyl acetate (3 × 30 mL).
The combined organic phases were washed with water, dried
(Na2SO4), and concentrated. Purification by silica gel (CH2Cl2D/
MeOH 9:1) gave compound 27 as a white solid (13 mg, 73%); [α]25
D
1
1
= +15.0 (c 0.32, CH3OH). Selected H NMR (400 MHz CD3OD): δ
3.82 (1H, br s), 3.61 (2H, t, J = 6.6 Hz), 3.43 (1H, m), 0.89 (3H, d, J =
6.0 Hz), 0.88 (3H, s), 0.64 (3H, s). 13C NMR (100 MHz CDCl3): δ
71.8, 68.4, 62.8, 56.0, 50.4, 42.5, 41.4, 39.6 (2C), 39.4, 35.8, 35.6, 35.2,
35.0, 34.5, 32.8 (2C), 30.5, 28.2, 26.1, 25.8, 23.6, 22.7, 20.5, 18.6, 11.6.
HRMS-ESI m/z 407.3523 [M + H]+, C26H47O4 requires 407.3525.
Animal Studies. All animal experimental procedures were
approved by the Ethics Committee of the University of Perugia and
by the Italian Health Ministry, according to the Italian guideline for
care and use of laboratory animals. The ID for this project is no. 245/
2013-B. The authorization was released to Prof. Stefano Fiorucci, as a
principal investigator, on October 10, 2013. The 6−8 week old CD1
male mice were obtained from Harlan Laboratories Srl (San Pietro al
Natisone, Udine, Italy). Mice were maintained in a temperature
controlled facility with a 12 h light/dark cycle and were given free
access to food and water. Mice (n = 5, 6) were orally administered for
5 days with 30 mg/kg dose of α-naphthylisothiocyanate (ANIT) in
olive oil, a chemical agent that causes specific damage to biliary
epithelial cells leading to bile duct injury and cell proliferation,
ultimately causing intrahepatic cholestasis.32,33 Animals were admin-
istered with UDCA (15 mg/kg) or 16 (16 mg/kg). At the end of the
experiment, serum and liver samples were collected. During the
experiment, mice were daily weight.
3α,7β-Dihydroxy-25,26-bis-homo-5β-chol-24-en-26-oic Acid
(19). A portion of compound 18 (100 mg, 0.23 mmol) was hydrolyzed
with NaOH (93 mg, 2.31 mmol) in a solution of MeOH/H2O 1:1 v/v
(20 mL). The mixture was stirred for 1 h at reflux. The resulting
solution was then acidified with HCl 6 N and extracted with ethyl
acetate (3 × 50 mL). The collected organic phases were washed with
brine, dried over Na2SO4 anhydrous, and evaporated under reduced
pressure to give compound 19 (89 mg, 93% yield). An analytic sample
was purified by HPLC on a Nucleodur 100−5 C18 (5 μm; 4.6 mm i.d.
× 250 mm) with MeOH/H2O (95:5) as eluent (flow rate 1 mL/min)
to give compound 19 (tR = 5 min); [α]25D = +203.0 (c 0.39, CH3OH).
1
Selected H NMR (400 MHz CDCl3): δ 7.07 (1H, dt, J = 7.0, 15.0
Hz), 5.81 (1H, d, J = 15.0 Hz), 3.60 (2H, m), 0.94 (3H, s), 0.94 (3H,
d, ovl), 0.67 (3H, s). 13C NMR (100 MHz CD3OD): δ 170.7, 151.6,
122.7, 72.1, 71.9, 57.5, 56.6, 44.8, 44.5, 44.0, 41.6, 40.7, 38.6, 38.0,
36.8, 36.1, 35.6, 35.2, 31.0, 29.9, 29.7, 27.9, 23.9, 22.4, 19.1, 12.7.
HRMS-ESI m/z 419.3163 [M + H]+, C26H43O4 requires 419.3161.
3α,7β-Dihydroxy-25,26-bis-homo-5β-chol-24-en-26-oyl Taurine
Sodium Salt (20). Carboxylic acid 19 (10 mg, 0.024 mmol) in
DMF dry (2 mL) was treated with DMT-MM (20 mg, 0.075 mmol)
and triethylamine (87 μL, 0.63 mmol), and the mixture was stirred at
room temperature for 10 min. Then to the mixture was added taurine
(18 mg, 0.14 mmol). After 2 h, the reaction mixture was concentrated
under vacuo and dissolved in water (5 mL). The solution was poured
over a C18 silica gel column. Fraction eluted with H2O/MeOH 95:5
gave a mixture that was further purified by HPLC on a Nucleodur
100−5 C18 (5 μm; 4.6 mm i.d. × 250 mm) with MeOH/H2O (45:55)
In another experimental section, mice (n = 3, 4) were treated 6 (or
24) hours with UDCA (60 mg/kg, os) or with 16 (64 mg/kg, os). At
the end of the treatments, mice were sacrificed and liver and ileum
samples were collected to perform real-time PCR analysis.
Transactivation Assay. For FXR mediated transactivation,
HepG2 cells were plated in a 24 well-plate and transfected with 100
ng of pSG5-FXR, 100 ng of pSG5-RXR, 200 ng of the reporter vector
7698
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701

Journal of Medicinal Chemistry
Article
p(hsp27)-TK-LUC containing the FXR response element IR1 cloned
from the promoter of heat shock protein 27 (hsp27), and with 100 ng
of pGL4.70 (Promega), a vector encoding the human Renilla gene.
For GP-BAR1 mediated transactivation, HEK-293T cells were plated
in a 24-well plate and transfected with 200 ng of pGL4.29 (Promega),
a reporter vector containing a cAMP response element (CRE) that
drives the transcription of the luciferase reporter gene luc2P, with 100
ng of pCMVSPORT6-human GP-BAR1 and with 100 ng of pGL4.70.
At 24 h post-transfection, cells were stimulated 18 h with 10 μM
CDCA, TLCA, and compounds 2−20 and 26−27. After treatments,
cells were lysed in 100 μL of lysis buffer (25 mM Tris-phosphate, pH
7.8; 2 mM DTT; 10% glycerol; 1% Triton X-100), and 20 μL of
cellular lysate was assayed for luciferase activity using the luciferase
assay system (Promega). Luminescence was measured using Glomax
20/20 luminometer (Promega).
Real-Time PCR. Real-time PCR was performed as previously
described.32 Briefly, total RNA was isolated using the TRIzol reagent
according to the manufacturer’s specifications (Invitrogen). First, 1 μg
of RNA was purified of the genomic DNA by DNase I treatment
(Invitrogen) and random reverse-transcribed with Superscript II
(Invitrogen) in a 20 μL reaction volume. Then 10 ng of template was
added to the PCR mixture (final volume 25 μL) containing the
following reagents: 0.2 μM of each primer and 12.5 μL of 2× SYBR
FAST Universal ready mix (Invitrogen). All reactions were performed
in triplicate and the thermal cycling conditions were: 2 min at 95 °C,
followed by 40 cycles of 95 °C for 20 s, 60 °C for 30 s in iCycler iQ
instrument (Biorad). The relative mRNA expression was calculated
and expressed as 2−(ΔΔCt). Forward and reverse primer sequences were
the following: mouse GAPDH, ctgagtatgtcgtggagtctac and
gttggtggtgcaggatgcattg; mOSTα, cagtggacatagccctcacc and gaccaaag-
cagcagaacaca; mBSEP, aaatcggatggtttgactgc and tgacagcgagaatcaccaag;
mPro-glucagon, tgaagacaaacgccactcac and caatgttgttccggttcctc.
Bile Acids Determination. Stock solutions of bile acids (tMu,
tCA, tDCA, tCDCA, tHCA) were prepared separately in methanol at
the concentration of 10 mmol/L and stored at −20 °C. The
appropriate amounts of each bile acid stock solution was added into
pooled samples ranging in a five-points calibration curve from 5 nM to
50 μM.
Molecular Docking. The AutoDock4.2 software package36 was
used to perform molecular docking calculations in the three-
dimensional model of hGP-BAR1.22 Ligands tridimensional structures
were generated with the Maestro Build Panel.37 For each ligand, an
extensive ring conformational sampling was performed with the OPLS-
AA force field38 and a 2.0 Å rmsd cutoff using MacroModel (version
9.9)39 as implemented in Maestro 9.3.37 All conformers were then
refined using LigPrep40 as implemented in Maestro 9.3.37 Protonation
states at pH 7.0 were assigned using Epik.41 Protein structure was
prepared through the Protein Preparation Wizard through the
graphical user interface of Maestro 9.3.37 Water molecules were
removed, and hydrogen atoms were added and minimized using the
OPLS-2005 force field.38 Ligands and receptor structures were
converted to AD4 format files using ADT, and the Gesteiger−Marsili
partial charges were then assigned. Grid points of 65 × 80 × 55 with a
0.375 Å spacing were calculated around the ligand binding site of GP-
BAR1 using AutoGrid4.2. Thus, 100 separate docking calculations
were performed for each run. Each docking run consisted of 10 million
energy evaluations using the Lamarckian genetic algorithm local search
(GALS) method, otherwise, default docking parameters were applied.
Docking conformations were clustered on the basis of their rmsd
(tolerance = 2.0 Å) and were ranked based on the AutoDock scoring
function.36
All the residue labels were taken from the wild-type amino acidic
sequence of human GP-BAR1.
Docking calculations of UDCA in the FXR-LBD were performed
using the previously reported protocol.42
All figures were rendered using PyMOL (http://www.pymol.org).
Statistical Analysis. All values are expressed as mean SD of n
values per group. Comparisons of more than two groups were made
with a one-way ANOVA with posthoc Tukey’s test. Comparison of
two groups was made using Student’s t test for unpaired data when
appropriate. Differences were considered statistically significant if p
was <0.05.
ASSOCIATED CONTENT
■
S
* Supporting Information
Tabulated analytical data for compounds 3−20 (HPLC k’s, MS
data) and NMR spectra for all tested compounds. Binding
mode of 19 in the GP-BAR1 homology model, binding mode
of UDCA in the crystal structure of the rFXR-LBD, and
superposition between 2 and 6-ECDCA in the rFXR-LBD.
CSV file. This material is available free of charge via the
Internet at http://pubs.acs.org.
Aliquots of 100 μL of each cell lysate were deproteinized with 1 mL
of cold acetonitrile with 5% of NH4OH vortexing for 1 min.34 After
centrifugation at 16000g for 10 min, the clear supernatant was
transferred to a new vial, snap frozen, and lyophilized. The samples
were then redissolved in methanol−water (2:1, v/v) for tauro-
conjugated bile acids determination. A bile acids extraction yield of
95% was measured using bile acids standards addition in blank samples
before and after deproteinization procedure.
Liquid Chromatography and Mass Spectrometry. For LC-
MS/MS analysis, chromatographic separation was carried out on the
HPLC−MS system LTQ XL ThermoScientific equipped with Accelera
600 pump and Accelera AutoSampler system. The mixture was
separated on a Jupiter 5u C18 column from Phenomenex (150 mm ×
2.00 mm), and the column flow rate was set at 200 μL/min. Tauro-
conjugated bile acids were separated using a methanol−aqueous
ammonium acetate (NH4OAc) gradient.35 Mobile phase A was 5%
methanol in water containing 2 mM ammonium acetate at pH 7,
mobile phase B was methanol, containing ammonium acetate at 2 mM.
The gradient started at 30% B and increased to 100% B in 20 min,
kept at 100% B for 5 min, then decreased to 30% B in 1 min and kept
at 30% B for 10 min. ESI was performed in negative ion mode, and the
ion source temperature was set at 280 °C. The tune page parameters
were automatically optimized by injecting taurocholic acid at 1 μM as
standard. The MS/MS detection was operated in MRM mode using a
collision energy of 20 (arbitrary units), the observed transitions were:
tauromuricholic acid (t-MCA) at 13.5 min MRM of 514.28 Th →
514.28 Th, taurohyocholic acid (t-HCA) at 15.6 min MRM of 498.29
Th → 498.29 Th, taurocholic acid (t-CA) at 16.6 min MRM of 514.28
Th → 514.28 Th, taurochenodeoxycholic acid (t-CDCA) at 18.5 min
MRM of 498.29 Th → 498.29 Th, and taurodeoxycholic acid (t-DCA)
at 18.9 min MRM of 498.29 Th → 498.29 Th.
AUTHOR INFORMATION
■
Corresponding Author
*Phone: (0039) 081-678525. Fax: (0039) 081-678552. E-mail:
angela.zampella@unina.it.
Author Contributions
S. Fiorucci and A. Zampella designed the project, analyzed the
results, organized and wrote the manuscript. V. Sepe, C. Festa,
and D. Masullo performed whole synthetic protocols, structural
characterization of intermediates and final products, and
contributed to the organization of the manuscript. B. Renga,
C. D’Amore and S. Cipriani performed whole pharmacological
experiments, analyzed the results, and contributed to the
organization of the manuscript. M. C. Monti performed bile
acid determination and contributed to the organization of the
manuscript. F. S. Di Leva, E. Novellino, and V. Limongelli
designed, performed and analyzed the computational studies
and wrote the manuscript.
Notes
The authors declare no competing financial interest.
7699
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701

Journal of Medicinal Chemistry
Article
Pellicciari, R.; Auwerx, J.; Schoonjans, K. TGR5-mediated bile acid
sensing controls glucose homeostasis. Cell. Metab. 2009, 10, 167−177.
(14) Fiorucci, S.; Mencarelli, A.; Palladino, G.; Cipriani, S. Bile-acid-
activated receptors: targeting TGR5 and farnesoid-X-receptor in lipid
and glucose disorders. Trends Pharmacol. Sci. 2009, 30, 570−580.
(15) Fiorucci, S.; Cipriani, S.; Baldelli, F.; Mencarelli, A. Bile acid-
activated receptors in the treatment of dyslipidemia and related
disorders. Prog. Lipid Res. 2010, 49, 171−185.
(16) Tiwari, A.; Maiti, P. TGR5: an emerging bile acid G-protein-
coupled receptor target for the potential treatment of metabolic
disorders. Drug Discovery Today 2009, 14, 523−530.
(17) Schaap, F. G.; Trauner, M.; Jansen, P. L. Bile acid receptors as
targets for drug development. Nature Rev. Gastroenterol. Hepatol. 2014,
1, 55−67.
(18) Azzaroli, F.; Mehal, W.; Soroka, C. J.; Wang, L.; Lee, J.; Crispe,
N.; Boyer, J. L. Ursodeoxycholic acid diminishes Fas-ligand-induced
apoptosis in mouse hepatocytes. Hepatology 2002, 36, 49−54.
(19) Keene, C. D.; Rodrigues, C. M.; Eich, T.; Chhabra, M. S.; Steer,
C. J.; Low, W. C. Tauroursodeoxycholic acid, a bile acid, is
neuroprotective in a transgenic animal model of Huntington’s disease.
Proc. Natl. Acad. Sci. U. S. A. 2002, 99, 10671−10676.
(20) Alberts, D. S.; Martinez, M. E.; Hess, L. M.; Einspahr, J. G.;
Green, S. B.; Bhattacharyya, A. K.; Guillen, J.; Krutzsch, M.; Batta, A.
K.; Salen, G.; Fales, L.; Koonce, K.; Parish, D.; Clouser, M.; Roe, D.;
Lance, P. Phase III trial of ursodeoxycholic acid to prevent colorectal
adenoma recurrence. J. Natl. Cancer Inst. 2005, 97, 846−853.
(21) Mi, L.-Z.; Devarakonda, S.; Harp, J. M.; Han, Q.; Pellicciari, R.;
Willson, T. M.; Khorasanizadeh, S.; Rastinejad, F. Structural basis for
bile acid binding and activation of the nuclear receptor FXR. Mol. Cell
2003, 11, 1093−1100.
(22) D’Amore, C.; Di Leva, F. S.; Sepe, V.; Renga, B.; Del Gaudio,
C.; D’Auria, M. V.; Zampella, A.; Fiorucci, S.; Limongelli, V. Design,
synthesis, and biological evaluation of potent dual agonists of nuclear
and membrane bile acid receptors. J. Med. Chem. 2014, 57, 937−954.
(23) Pellicciari, R.; Sato, H.; Gioiello, A.; Costantino, G.;
Macchiarulo, A.; Sadeghpour, B. M.; Giorgi, G.; Schoonjans, K.;
Auwerx, J. Nongenomic actions of bile acids. Synthesis and preliminary
characterization of 23- and 6,23-alkyl-substituted bile acid derivatives
as selective modulators for the G-protein coupled receptor TGR5. J.
Med. Chem. 2007, 50, 4265−4268.
(24) Pellicciari, R.; Costantino, G.; Camaioni, E.; Sadeghpour, B. M.;
Entrena, A.; Willson, T. M.; Fiorucci, S.; Clerici, C.; Gioiello, A. Bile
acid derivatives as ligands of the farnesoid X receptor. Synthesis,
evaluation, and structure−activity relationship of a series of body and
side chain modified analogues of chenodeoxycholic acid. J. Med. Chem.
2004, 47, 4559−4569.
ACKNOWLEDGMENTS
■
This work was supported by grants from PSC Partners (5237
South Kenton Way, Englewood, Colorado 80111 United
States) and grants from BAR Pharmaceuticals, Srl, Italy.
ABBREVIATIONS USED
■
BAs, bile acids; BSEP, bile salt export pump; CDCA,
chenodeoxycholic acid; FXR, farnesoid-X-receptor; GP-BAR-
1, G protein-coupled bile acid receptor 1; HEK-293T, human
embryonic kidney 293 cells; HepG2, human hepatoma cell line;
LBD, ligand binding domain; LCA, lithocholic acid; M-BAR/
TGR5, membrane-type bile acid receptor/Takeda G-protein-
coupled receptor; OSTα, organic solute transporter α; RT-
PCR, real-time polymerase chain reaction; T2DM, type 2
diabetes mellitus; TLCA, tauro-lithocolic acid; UDCA,
ursodeoxycholic acid
REFERENCES
■
(1) Makishima, M.; Okamoto, A. Y.; Repa, J. J.; Tu, H.; Learned, R.
M.; Luk, A.; Hull, M. V.; Lustig, K. D.; Mangelsdorf, D. J.; Shan, B.
Identification of a nuclear receptor for bile acids. Science 1999, 284,
1362−1365.
(2) Parks, D. J.; Blanchard, S. G.; Bledsoe, R. K.; Chandra, G.;
Consler, T. G.; Kliewer, S. A.; Stimmel, J. B.; Willson, T. M.; Zavacki,
A. M.; Moore, D. D.; Lehmann, J. M. Bile acids: natural ligands for an
orphan nuclear receptor. Science 1999, 284, 1365−1368.
(3) Baes, M.; Gulick, T.; Choi, H. S.; Martinoli, M. G.; Simha, D.;
Moore, D. D. A new orphan member of the nuclear hormone receptor
superfamily that interacts with a subset of retinoic acid response
elements. Mol. Cell. Biol. 1994, 14, 1544−1552.
(4) Makishima, M.; Lu, T. T.; Xie, W.; Whitfield, G. K.; Domoto, H.;
Evans, R. M.; Haussler, M. R.; Mangelsdorf, D. J. Vitamin D receptor
as an intestinal bile acid sensor. Science 2002, 296, 1313−1316.
(5) Choi, H. S.; Chung, M.; Tzameli, I.; Simha, D.; Lee, Y. K.; Seol,
W.; Moore, D. D. Differential transactivation by two isoforms of the
orphan nuclear hormone receptor CAR. J. Biol. Chem. 1997, 272,
23565−23571.
(6) Wang, Y. D.; Chen, W. D.; Moore, D. D.; Huang, W. FXR: a
metabolic regulator and cell protector. Cell Res. 2008, 18, 1087−1095.
(7) Zhang, Y.; Lee, F. Y.; Barrera, G.; Lee, H.; Vales, C.; Gonzalez, F.
J.; Willson, T. M.; Edwards, P. A. Activation of the nuclear receptor
FXR improves hyperglycemia and hyperlipidemia in diabetic mice.
Proc. Natl. Acad. Sci. U. S. A. 2006, 103, 1006−1011.
(8) Renga, B.; Mencarelli, A.; D’Amore, C.; Cipriani, S.; Baldelli, F.;
Zampella, A.; Distrutti, E.; Fiorucci, S. Glucocorticoid receptor
mediates the gluconeogenic activity of the farnesoid X receptor in
the fasting condition. FASEB J. 2012, 26, 3021−3031.
(9) Wang, Y. D.; Chen, W. D.; Wang, M.; Yu, D.; Forman, B. M.;
Huang, W. Farnesoid X receptor antagonizes nuclear factor kappaB in
hepatic inflammatory response. Hepatology 2008, 48, 1632−1643.
(10) Fiorucci, S.; Rizzo, G.; Antonelli, E.; Renga, B.; Mencarelli, A.;
Riccardi, L.; Orlandi, S.; Pruzanski, M.; Morelli, A.; Pellicciari, R. A
farnesoid X receptor−small heterodimer partner regulatory cascade
modulates tissue metalloproteinase inhibitor-1 and matrix metal-
loprotease expression in hepatic stellate cells and promotes resolution
of liver fibrosis. J. Pharmacol. Exp. Ther. 2005, 314, 584−595.
(11) Baptissart, M.; Vega, A.; Maqdasy, S.; Caira, F.; Baron, S.;
Lobaccaro, J. M.; Volle, D. H. Bile acids: from digestion to cancers.
Biochimie 2013, 95, 504−517.
(25) Sepe, V.; Ummarino, R.; D’Auria, M. V.; Renga, B.; Fiorucci, S.;
Zampella, A. The first total synthesis of solomonsterol B, a marine
pregnane X receptor agonist. Eur. J. Org. Chem. 2012, 5187−5194.
(26) Schteingart, C. D.; Hofmann, A. F. Synthesis of 24-nor-5 beta-
cholan-23-oic acid derivatives: a convenient and efficient one-carbon
degradation of the side chain of natural bile acids. J. Lipid. Res. 1988,
29, 1387−1395.
(27) Tserng, K. Y.; Klein, P. D. Formylated bile acids: improved
synthesis, properties, and partial deformylation. Steroids 1977, 29,
635−648.
(28) Sepe, V.; Ummarino, R.; D’Auria, M. V.; Lauro, G.; Bifulco, G.;
D’Amore, C.; Renga, B.; Fiorucci, S.; Zampella, A. Modification in the
side chain of solomonsterol A: discovery of cholestan disulfate as a
potent pregnane-X-receptor agonist. Org. Biomol. Chem. 2012, 10,
6350−6362.
(29) Iguchia, Y.; Kihira, K.; Nishimaki-Mogami, T.; Une, M.
Structure−activity relationship of bile alcohols as human farnesoid X
receptor agonist. Steroids 2010, 75, 95−100.
(12) Watanabe, M.; Houten, S. M.; Mataki, C.; Christoffolete, M. A.;
Kim, B. W.; Sato, H.; Messaddeq, N.; Harney, J. W.; Ezaki, O.;
Kodama, T.; Schoonjans, K.; Bianco, A. C.; Auwerx, J. Bile acids
induce energy expenditure by promoting intracellular thyroid hormone
activation. Nature 2006, 439, 484−489.
(30) Macchiarulo, A.; Gioiello, A.; Thomas, C.; Pols, T. W. H.; Nuti,
R.; Ferrari, C.; Giacche, N.; De Franco, F.; Pruzanski, M.; Auwerx, J.;
Schoonjans, K.; Pellicciari, R. Probing the binding site of bile acids in
TGR5. ACS Med. Chem. Lett. 2013, 4, 1158−1162.
(13) Thomas, C.; Gioiello, A.; Noriega, L.; Strehle, A.; Oury, J.;
Rizzo, G.; Macchiarulo, A.; Yamamoto, H.; Mataki, C.; Pruzanski, M.;
7700
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701

Journal of Medicinal Chemistry
Article
(31) Fujino, T.; Une, M.; Imanaka, T.; Inoue, K.; Nishimaki-Mogami,
T. Structure−activity relationship of bile acids and bile acid analogs in
regard to FXR activation. J. Lipid Res. 2004, 45, 132−138.
(32) Renga, B.; Migliorati, M.; Mencarelli, A.; Cipriani, S.; D’Amore,
C.; Distrutti, E.; Fiorucci, S. Farnesoid X receptor suppresses
constitutive androstane receptor activity at the multidrug resistance
protein-4 promoter. Biochim. Biophys. Acta 2011, 1809, 157−165.
(33) Fiorucci, S.; Baldelli, F. Farnesoid X receptor agonists in biliary
tract disease. Curr. Opin. Gastroenterol. 2009, 25, 252−259.
(34) Mencarelli, A.; Renga, B.; D’Amore, C.; Santorelli, C.; Graziosi,
L.; Bruno, A.; Monti, M. C.; Distrutti, E.; Cipriani, S.; Donini, A.;
Fiorucci, S. Dissociation of intestinal and hepatic activities of FXR and
LXRa supports metabolic effects of terminal ileum interposition in
rodents. Diabetes 2013, 62, 3384−3393.
(35) Bobeldijk, I.; Hekman, M.; de Vries-van derWeij, J.; Couliera, L.;
Ramakera, R. Quantitative profiling of bile acids in biofluids and
tissues based on accurate mass high resolution LC-FT-MS: compound
class targeting in a metabolomics workflow. J. Chromatogr., B 2008,
871, 306−313.
(36) Huey, R.; Morris, G. M.; Olson, A. J.; Goodsell, D. S. A
semiempirical free energy force field with charge-based desolvation. J.
Comput. Chem. 2007, 28, 1145−1152.
(37) Maestro, version 9.3; Schrodinger, LLC: New York, 2012.
̈
(38) Jorgensen, W. L.; Maxwell, D. S.; Tirado-Rives, J. Development
and testing of the OPLS all-atom force field on conformational
energetics and properties of organic liquids. J. Am. Chem. Soc. 1996,
118, 11225−11236.
(39) MacroModel, version 9.9; Schrodinger, LLC: New York, 2012.
̈
(40) LigPrep, version 2.5; Schrodinger, LLC: New York, 2012.
̈
(41) Epik, version 2.3; Schrodinger, LLC: New York, 2012.
̈
(42) Di Leva, F. S.; Festa, C.; D’Amore, C.; De Marino, S.; Renga, B.;
D’Auria, M. V.; Novellino, E.; Limongelli, V.; Zampella, A.; Fiorucci, S.
Binding mechanism of the farnesoid X receptor marine antagonist
suvanine reveals a strategy to forestall drug modulation on nuclear
receptors. Design, synthesis, and biological evaluation of novel ligands.
J. Med. Chem. 2013, 56, 4701−4717.
7701
dx.doi.org/10.1021/jm500889f | J. Med. Chem. 2014, 57, 7687−7701