Enhancing fructooligosaccharides production by genetic improvement of the industrial fungus Aspergillus niger ATCC 20611

Article abstract of DOI:10.1016/j.jbiotec.2017.03.021

Aspergillus niger ATCC20611 is one of the most potent filamentous fungi used commercially for production of fructooligosaccharides (FOS), which are prospective components of functional food by stimulating probiotic bacteria in the human gut. However, current strategies for improving FOS yield still rely on production process development. The genetic engineering approach hasn't been applied in industrial strains to increase FOS production level. Here, an optimized polyethylene glycol (PEG)-mediated protoplast transformation system was established in A. niger ATCC 20611 and used for further strain improvement. The pyrithiamine resistance gene (ptrA) was selected as a dominant marker and protoplasts were prepared with high concentration (up to 10⁸?g^?1 wet weight mycelium) by using mixed cell wall-lysing enzymes. The transformation frequency with ptrA can reach 30–50 transformants per μg of DNA. In addition, the efficiency of co-transformation with the EGFP reporter gene (egfp) was high (approx. 82%). Furthermore, an activity-improved variant of β-fructofuranosidase, FopA(A178P), was successfully overexpressed in A. niger ATCC 20611 by using the transformation system. The transformant, CM6, exhibited a 58% increase in specific β-fructofuranosidase activity (up to 507?U/g), compared to the parental strain (320?U/g), and effectively reduced the time needed for completion of FOS synthesis. These results illustrate the feasibility of strain improvement through genetic engineering for further enhancement of FOS production level.

Full text of DOI:10.1016/j.jbiotec.2017.03.021

Accepted Manuscript
Title: Enhancing fructooligosaccharides production by genetic
improvement of the industrial fungus Aspergillus niger ATCC
20611
Authors: Jing Zhang, Caixia Liu, Yijia Xie, Ning Li, Zhanguo
Ning, Na Du, Xirong Huang, Yaohua Zhong
PII:
S0168-1656(17)30126-8
DOI:
Reference:
http://dx.doi.org/doi:10.1016/j.jbiotec.2017.03.021
BIOTEC 7829
To appear in:
Journal of Biotechnology
Received date:
Revised date:
Accepted date:
1-12-2016
21-3-2017
21-3-2017
Please cite this article as: Zhang, Jing, Liu, Caixia, Xie, Yijia, Li, Ning, Ning, Zhanguo,
Du, Na, Huang, Xirong, Zhong, Yaohua, Enhancing fructooligosaccharides production
by genetic improvement of the industrial fungus Aspergillus niger ATCC 20611.Journal
of Biotechnology http://dx.doi.org/10.1016/j.jbiotec.2017.03.021
This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof
before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that
apply to the journal pertain.

Enhancing fructooligosaccharides production by genetic
improvement of the industrial fungus Aspergillus niger ATCC
20611
Jing Zhang1, Caixia Liu2, Yijia Xie1, Ning Li3, Zhanguo Ning3, Na Du4, Xirong
Huang4, Yaohua Zhong1*
1 State Key Laboratory of Microbial Technology, School of Life Sciences, Shandong
University, Jinan 250100, P. R. China
2 Shandong Xingguang Sugar Group Co., Ltd., Laoling, Dezhou, 253600, P. R. China
2 Shandong Academy of Pharmaceutical Sciences, Jinan 250101, P. R. China
d Key Laboratory of Colloid and Interface Chemistry of the Education Ministry of
China, Shandong University, Jinan 250100, P. R. China
*Corresponding author
E-mail address: zhongyaohua@sdu.edu.cn (Y. Zhong).
Tel: +86-531-88366118; Fax: +86-531-88565610.
1

Highlights




An efficient PEG-mediated protoplast transformation system with ptrA as the selectable
marker was developed in Aspergillus niger ATCC 20611.
The EGFP reporter gene (egfp) was co-transformed with ptrA and the efficiency reached
approx. 82%.
The activity-improved variant of β-fructofuranosidase, FopA(A178P), was successfully
overexpressed in A. niger ATCC 20611.
The genetically engineered strain, CM6, exhibited a 58% increase in β-
fructofuranosidase activity and achieved a 40% reduction in the time required for
completion of FOS synthesis.
Abstract Aspergillus niger ATCC20611 is one of the most potent filamentous
fungi used commercially for production of fructooligosaccharides (FOS), which are
prospective components of functional food by stimulating probiotic bacteria in the
human gut. However, current strategies for improving FOS yield still rely on
production process development. The genetic engineering approach hasn’t been
applied in industrial strains to increase FOS production level. Here, an optimized
polyethylene glycol (PEG)-mediated protoplast transformation system was
established in A. niger ATCC 20611 and used for further strain improvement. The
pyrithiamine resistance gene (ptrA) was selected as a dominant marker and
protoplasts were prepared with high concentration (up to 108 g-1 wet weight
mycelium) by using mixed cell wall-lysing enzymes. The transformation frequency
with ptrA can reach 30~50 transformants per μg of DNA. In addition, the efficiency
of co-transformation with the EGFP reporter gene (egfp) was high (approx. 82%).
Furthermore, an activity-improved variant of β-fructofuranosidase, FopA(A178P),
was successfully overexpressed in A. niger ATCC 20611 by using the transformation
system. The transformant, CM6, exhibited a 58% increase in specific β-
2

fructofuranosidase activity (up to 507 U/g), compared to the parental strain (320 U/g),
and effectively reduced the time needed for completion of FOS synthesis. These
results illustrate the feasibility of strain improvement through genetic engineering for
further enhancement of FOS production level.
Keywords Fructooligosaccharide; Aspergillus niger; Transformation system; Genetic
engineering
3

1. Introduction
Prebiotics are nondigestible food ingredients that selectively stimulate the
growth and/or activity of beneficial bacterial species already resident in the host
intestine (Sangeetha et al., 2005; Simmering and Blaut, 2001). Among the commonly
used prebiotics, fructooligosaccharides (FOS) have been regarded as important food
ingredients due to their excellent nutrition- and health-relevant properties, such as
possessing low calorie, reduction of total serum cholesterol level, as well as
enhancement of calcium absorption (Maiorano et al., 2008; Dominguez et al., 2014).
FOS generally refer to a series of homologous oligosaccharides that are mainly
composed of 1-kestose (GF2), nystose (GF3) and 1F-β-fructofuranosyl nystose (GF4),
in which two, three, and four fructosyl units are bound at the β-2,1 position of
glucose, respectively (Mutanda et al., 2014). Naturally, FOS are found in plants such
as onion, banana, jerusalem artichoke and some grasses (Maiorano et al., 2008).
However, the FOS production yield derived from these natural plant hosts is low and
also quite limited by seasonal conditions (Yun, 1996). Commercially, the production
of FOS is primarily carried out from sucrose by the transfructosylation activity of β-
fructofuranosidases (Ffase，EC 3.2.1.26) (Hirayama et al., 1989; Ghazi et al., 2007;
Kurakake et al., 2010).
β-fructofuranosidases belong to the family 32 glycoside hydrolase (GH32)
enzymes that act on sucrose and related β-D-fructo-furanosides (Cantarel et al., 2009;
Trollope et al., 2015). They intrinsically have both hydrolysis (Uh) and fructosyl
transfer (Ut) activities, but the ratio (Ut/Uh) of each enzyme varies depending on the
4

specific source organism (Yanai et al., 2001). The enzymes that are potential for
industrial production generally come from several fungi including Aspergillus niger,
A. japonicus, and Aureobasidium pullulans (Hidaka et al., 1988; Kurakake et al.,
2010; Ghazi et al., 2007). In particular, A. niger ATCC 20611 showed high
productivity of β-fructofuranosidase (namely FopA), and FopA demonstrated much
higher transfructosylation activity than hydrolysis activity (Hidaka et al., 1988).
Therefore, A. niger ATCC 20611 is considered as one of the most suitable strains for
FOS production (Yanai et al., 2001; Trollope et al., 2015).
The FOS synthesis catalysed by the FopA enzyme from A. niger ATCC 20611
has been scaled up in industry for more than 20 years (Hidaka et al., 1988; Nishizawa
et al., 2001). So far, optimization of nutritional and culture parameters of fermentation
processes is still the main approach to increase enzyme yield and productivity
(Sangeetha et al., 2005; Mutanda et al., 2014). Dorta et al. (2006) found that the
inexpensive cane molasses and yeast powder were as good as sucrose and peptone in
the enzyme and FOS production, thus reducing the cost of carbon and nitrogen
sources. Moreover, response surface methodology (RSM) was applied to optimization
of medium composition and a high productivity of β-fructofuranosidase was obtained
by using a slowly metabolized nitrogen source and limiting the carbon content
conditions (Dinarvand et al., 2013). These traditional approaches typically rely on
optimization of the fermentation conditions and there is an upper limit to the degree of
enzyme production that can be increased. Recently, the A. japonicus FopA was
semirationally engineered using a combined crystal structure- and evolutionary-
5

guided approach and 15 single-amino-acid-substitution variants displayed improved
catalytic activities, with the FopA(A178P) identified as the most improved variant
(Trollope et al., 2015). However, these improved FopA variants were all expressed in
yeast system and not tested in the industrial Aspergillus strains. It is known that
improvement of the production strain could offer the greatest opportunity for cost
reduction without significant capital outlay (Chiang, 2004). Genetic engineering is a
powerful approach for filamentous fungi in order to increase productivity, which can
help to transfer desired phenotypic trait more quickly and accurately than
conventional breeding (Meyer, 2008). However, before genetic manipulation can
become available, the establishment of a suitable transformation system is an essential
prerequisite. Although genetic transformation of Aspergillus niger strains was
developed over the years, most of the strains used in the literature are non-industrial
ones (Kelly and Hynes, 1985; Sureka et al. 2014). To date, no available
transformation descriptions have been reported for the industrial strain A. niger ATCC
20611, which limits strain improvement in the FOS industry.
In the present study, an efficient PEG-mediated protoplast transformation system
with ptrA as the selectable marker was developed in A. niger ATCC 20611. High
efficiency of co-transformation with the EGFP reporter gene (egfp) was demonstrated.
Then construction of genetically engineered strains, for the first time, with increased
FOS production by overexpressing activity-improved β-fructofuranosidase was
achieved.
2. Materials and methods
6

2.1 Strains, plasmids and growth conditions
A. niger ATCC 20611, a commercial strain for FOS production, was used as
transformation host and routinely maintained on potato-dextrose agar (PDA,
containing 20.0 g/L D-glucose and 20.0 g/L agar). Minimal medium (MM, as
described by Penttilä et al. (1987)), supplemented with 2 μg/ml pyrithiamine, was
applied for fungal growth during genetic transformation. For β-fructofuranosidase
production, A. niger ATCC 20611 and transformants were cultured in fermentation
medium (FM) at 30℃, 200 rpm. The FM medium contained sucrose 20 g/L, yeast
extract 15 g/L, KCl 0.5 g/L, MgSO4.7H2O 0.5 g/L, K2HPO4 5 g/L, NaNO3 2 g/L. The
initial pH of FM was adjusted to 5.5 using 0.1 M HCl. After incubation for 48 h, the
cultures were centrifuged and cells were separated for enzyme assays.
Plasmid pME2892 (Krappmann et al., 2005), which contains the ptrA selectable
marker gene, was adopted for genetic transformation. Plasmid pIG1783 (Pöggeler et
al., 2003), which carries the enhanced green fluorescent protein-encoding gene (egfp)
as a reporter, was used for detection and analysis of heterologous gene expression in
A. niger. The pMD19-T cloning vector (Takara, Otsu, Japan) was employed for TA
cloning. Escherichia coli DH5α was the host for cloning of constructs and cultured in
LB broth supplemented with appropriate antibiotics at 37℃.
2.2 Protoplast preparation and transformation of A. niger ATCC 20611
Protoplast preparation was carried out as previously described with modification
(Penttilä et al., 1987; Liu and Friesen, 2012). A. niger spores were inoculated in liquid
7

modified MM (with substitution of glucose for sucrose as the carbon source) and
cultured for 30 h at 28℃,200 rpm. The mycelia were harvested by centrifugation at
13,000 rpm for 10 min and about 1 g (wet weight ) of mycelia was added into 20 ml
of Solution I (1.2 M sorbitol-0.1 M KH2PO4, pH 5.6), in which cell wall-digesting
enzymes, including lysing enzymes from Trichoderma harzianum (Sigma Corp., St
Louis, MO), snailase (Dingguo Corp., Beijing, China) and lysozyme (Genview,
Houston, TX), were dissolved at appropriate concentrations and sorbitol was used as
the osmotic stabilizer. Incubation was performed at 28℃ with gentle shaking for 2 h.
Then the mixtures were filtered aseptically through 4 layers of glass wool to remove
hyphae and other debris, and the protoplasts were centrifuged at 2500 rpm and finally
resuspended in 200-1000 μl of Solution II (1 M Sorbitol-10 mM CaCl2-10 mM Tris-
HCl, pH 7.5). The formation of protoplasts was monitored by microscopic
observation.
Protoplasts were transformed with pME2892 or cotransformed with pME2892
and pIG1783. The transformation procedure was a modification of that of Yelton et
al. (1984). Specifically, 200 μl of protoplasts suspension, 2~5 μg of plasmid DNA and
50 μl of PEG/CaCl2 solution (25% PEG 6000, 50 mM CaCl2) were mixed and
incubated on ice for 20 min, followed by addition of 500 μl of the same PEG/CaCl2
solution and incubation for 5 min at room temperature. The protoplasts were then
plated on selective regeneration medium (MM medium containing 1 M sorbitol, with
2 μg/ml of pyrithiamin) and incubated at 30℃ for 3-4 days. Finally, well-growing
8

transformants were selected and purified to uninuclear clones by plating single spores
on selective medium.
2.3 PCR and Southern blot analysis
Chromosomal DNA was isolated from fungal transformants and analyzed by
PCR using primer pair ptrA-F/ptrA-R for amplification of a 853-bp ptrA fragment,
and egfp-F/egfp-R for amplification of a 720-bp egfp fragment, respectively. Southern
hybridization and detection was carried out with the DIG Easy Hyb kit (Roche
Diagnostics, Germany) according to the manufacture’s instruction. The A. niger
chromosomal DNA was digested with Hind III, size-fractioned by gel-electrophoresis
and transferred to a Hybond N+ nylon membrane (Amersham Biosciences,
Piscataway, NJ). The probe was prepared by PCR amplification of a 853-bp ptrA
fragment from plasmid pME2892 using primer pair ptrA-F/ ptrA-R.
2.4 Enzyme determination and TLC detection
To determine the β-fructofuranosidase activity, the reaction mixture consisted of
25% (W/V) sucrose (2 ml) as the substrate, 0.1 M citrate buffer (pH 5.0, 3 ml) and
adequate amount of the collected cells. The enzymatic reaction was carried out at 50
℃ for 2 h with moderate shaking and terminated by heating the mixture in boiling
water for 10 min. The β-fructofuranosidase activity was determined by measuring the
amount of glucose released from sucrose using the 3, 5-dinitrosalicylic acid (DNS)
method as described previously (Ghazi et al., 2007). One unit of activity (U) was
defined as the amount of enzyme required to produce 1 μmol of glucose per min.
9

Qualitative identification of FOS production and composition was conducted using
the thin layer chromatography (TLC). TLC was done by using the silica gel 60 F254
plates (Millipore). Aliquots (1-2 μl) of the reaction solutions were spotted 10 mm
from the bottom of the plates with 2.5 μl micro syringe pipettes. Then plates were run
using a mixture of solvents (butanol, isopropanol, acetic acid, and water in volume
(ml) at proportions of 7:5:2:4, respectively). After development was complete, the
plates were dried and the sugars were visualized using a spray of diphenylamine–
aniline–phosphoric acid (DPA) reagent (Buchan and Savage, 1952).
2.5 Fluorescence and light microscopy
For visualization of EGFP expression, spores of the fungal strains, transformed
with pIG1783, were cultured in liquid MM medium and grown for 10 h at 30℃.
Mycelia were collected and used directly for microscopic observation by using
fluorescence and light microscopy (Nikon Eclipse 80i fluorescence microscope).
2.6 Construction of FopA(A178P)-overexpression A. niger strains
The FopA(A178P)-overexpression cassette, which carries the mfopA gene
encoding the activity-improved β-fructofuranosidase variant FopA(A178P) (Trollope
et al., 2015), was constructed as follows. Firstly, the 5’- and 3’-regions of the mfopA
gene from the A. niger ATCC 20611 genome were amplified using primer pairs fopA-
F/mfopA-542R and mfopA-525F/fopA-R, respectively and fused together to form the
full-length mfopA gene using the primer pair fopA-F/fopA-R. At the same time, the
fragments of gpdA promoter and trpC terminator were amplified from plasmid pAN7-
10

1 (Punt and Hondel, 1992) with prime pairs gpdA-F/gpdA-R and trpC-F/trpC-R,
respectively. Then, the full-length mfopA gene, the gpdA promoter and the trpC
terminator were mixed and ligated together to amplify the FopA(A178P)-
overexpression cassette with primer pair gpdA-F/trpC-R by using Double-joint PCR
method (Yu et al., 2004). Finally, the overexpression cassette was cloned into
pMD19-T plasmid (Takara, Japan) to generate the final donor vector, named pGF-
mfopA. Primers used in this study are listed in Table 1. All of the PCR experiments
were carried out using standard methodology and the PCR fragments were purified
with Gel Extraction Kit (Omega, USA).
The plasmid pGF-mfopA was co-transformed with pME2892, which consists of
the ptrA selectable marker gene, into A. niger ATCC 20611 protoplasts to get the
FopA(A178P)-overexpression strains. Transformants were selected on MM medium
with 2 μg/ml pyrithiamine.
2.7 Fructooligosaccharides synthesis and HPLC analysis
A mixture containing 50% (W/V) sucrose and cells (6 units of enzyme per g
sucrose) of A. niger strains in 50 mM citrate phosphate buffer (pH 5.5) was stirred at
50℃. After 5 h, the reaction was stopped by treatment in boiling water for 5 min.
Then the mixture was centrifuged at 1,600 g for 10 min and the supernatant was
collected. Quantitative analysis of the FOS product was performed using HPLC (LC-
6A, Shimadzu, Japan) with a Agilent Zorbax NH2 column (5 μm, 4.6 mm×250 mm)
(Agilent Technologies, Santa Clara, CA) coupled with a refractive index detector
11

(2414, Waters, USA). The mobile phase was acetonitrile: water (70:30, v/v) at a flow
rate of 1.0 ml/min. The identification and quantification of each FOS was carried out
by a calibration curve built with authentic standards of 1-kestose, nystose and 1F-β-
fructofuranosyl nystose (Sigma Corp., St Louis, MO).
3. Results
3.1 Sensitivity of A. niger ATCC 20611 to antibiotics
As previously reported, filamentous fungi are relatively resistant to many
antibiotics (Penttilä et al., 1987; Meyer, 2008). In this study, three generally used
antibiotics for fungal species, including hygromycin B, pyrithiamine and sulfonylurea,
were selected to test the sensitivity of the A. niger ATCC 20611. The diluted spore
suspensions were plated on MM solid medium containing 0-300 μg/ml hygromycin B
or 0-6 μg/ml of pyrithiamine and sulfonylurea, and then cultivated at 30℃ for 3 d.
The sensitivity of this fungus to the antibiotics is shown in Table 2. A. niger ATCC
20611 displayed resistance to high concentrations of sulfonylurea and hygromycin B,
and still grew in the presence of 300 μg/ml hygromycin B or 6 μg/ml sulfonylurea.
However, it was highly sensitive to pyrithiamine at concentrations as low as 2 μg/ml,
indicating that the pyrithiamine resistance gene (ptrA) could be used as a dominant
selectable marker for genetic transformation of A. niger ATCC 20611.
3.2 Protoplast preparation from mycelium of A. niger ATCC 20611
PEG-mediated protoplast transformation system is the most commonly used
method in filamentous fungi and preparation of high-yield and high-activity
12

protoplasts is the key to successful application of this technology (Liu and Friesen,
2012). Protoplast preparation is often affected by many factors, such as the types and
concentrations of cell-wall-digesting enzymes, the age and morphology of mycelium,
and the molarity of osmotic stabilizer (Collings et al., 1988). To our knowledge, there
are no protocols and descriptions available for protoplast generation from A. niger
ATCC 20611. Here, three types of cell wall-digesting enzymes, including lysing
enzymes from T. harzianum, snailase and lysozyme, were adopted individually or
combinely for preparing protoplasts. It was found that any individual enzyme in
different concentrations could not crack mycelium easily and quickly and only few
protoplasts were released (data not shown). When these enzymes were combined
together, protoplasts could be prepared much more efficiently. And the optimal
enzyme mixture, consisting of 60% lysing enzymes from T. harzianum, 30% snailase
and 10% lysozyme, was confirmed to produce viable protoplasts from A. niger ATCC
20611 mycelium (Fig. 1A, B). The concentration of protoplasts prepared in this
situation could reach 9×106 /g wet weight mycelium and the regeneration frequency
was 57% (Fig. 1C, D).
Just as mentioned above, the morphology of fungal mycelium is another
important factor for preparation protoplasts. In the present study, different carbon
sources were also used for cultivation of A. niger ATCC 20611. It was found that the
mycelium was stubby and formed compact pellets when sucrose or glucose was used
as carbon source, while the mycelium grew rapidly and formed loose mycelium
pellets when cane molasses was used as carbon source (Fig. S1). These mycelia were
13

then applied for protoplast preparation, and cane molasses-cultivated mycelium could
produce high yield of viable protoplasts, with the concentration of up to 1×108 /g wet
weight mycelium and the regeneration frequency of 59% (Fig. 1C, D), demonstrating
that the looser mycelium could be more beneficial to protoplast preparation.
Therefore, a high concentration of A. niger ATCC 20611 protoplasts was successfully
prepared and could be used for further genetic transformation.
3.3 PEG-mediated protoplast transformation of A. niger ATCC 20611 with the ptrA
gene as a dominant selectable marker
To confirm if the ptrA gene is available as a selectable marker for the FOS-
producing industrial strain A. niger ATCC 20611, the frequency of PEG-mediated
protoplast transformation was examined using a plasmid pME2892, which contained
the ptrA gene expression cassette. In the presence of 2 μg/ml pyrithiamine,
approximately 100 resistant transformants were obtained per μg DNA, while no
colonies were regenerated in the control experiments with no plasmid (Fig. 2A). The
putative transformants were purified on MM medium containing pyrithiamine to
assess the mitotic stability. Six transformants, which had been proved to retain their
mitotic stability, were randomly selected for further analysis. PCR was carried out to
confirm the integration of ptrA into the genomes of transformants. Reactions with
ptrA-specific primers yielded the expected amplification products in each of the six
transformants respectively, but not in the parental strain (Fig. 2B). In order to
determine the copy number of ptrA in the fungal genomes, Southern blot analysis was
performed for the transformants. As shown in Fig. 2C, all the transformants appeared
14

to have two to three copies of ptrA integration into the genomes, indicating that the
ptrA gene is a suitable selectable marker for genetic transformation of A. niger ATCC
20611.
To investigate whether the ptrA integration affects the fopA expression, the
transformants were cultured and determined for the β-fructofuranosidase activity.
There were no significant difference in the enzyme activity between the transformants
and parental strain (Fig. 2D). The typical TCL profiles of FOS products prepared
using β-fructofuranosidases from the fungal strains were all roughly of equal size
(Fig. 2E). These results suggested that the ptrA integration randomly located in the
genomes and did not influence the ability of the fungal strains to synthesize FOS.
3.4 Co-expression of enhanced green fluorescent protein (EGFP) with the ptrA
gene
EGFP was chosen as the reporter to verify the practicability of the established
genetic transformation system in A. niger ATCC 20611 with the ptrA selectable
marker. The plasmid pIG1783, carrying the EGFP expression cassette, was co-
transformed with pME2892 into the protoplasts of A. niger ATCC 20611. 45
pyrithiamine-resistant transformants were obtained. Among these, the 720-bp
fragment of the egfp gene could be amplified from 42 transformants, indicating that
the co-transformation rate of ptrA and egfp reached up to 82%. Fig. 3A showed the
PCR result of seven randomly selected transformants, in which five transformants
15

contained both ptrA and egfp. The EGFP expression was further analyzed by
fluorescence microscopy (Fig. 3B). The mycelium showed intense fluorescence
emission, demonstrating successful expression of the egfp gene co-integrated into the
genome. This result exhibited the validity and efficiency of the transformation system
for genetic manipulation in the industrial stain A. niger ATCC 20611.
3.5 Overexpression of an activity-improved FopA variant for improving FOS
production
The β-fructofuranosidase is the key enzyme catalyzing the biotransformation of
sucrose to FOS (Yanai et al., 2001). Because of its key role in the FOS biosynthesis,
the FopA from A. niger ATCC 20611 has recently been engineered to generate
activity-increased variants, including the most improved single-amino-acid-
substitution variant FopA(A178P), using a semirational directed evolution strategy
(Trollope et al., 2015). However, these FopA variants were only expressed in yeast
host and have not been applied in an industrial Aspergillus strain to increase the
ability of FOS biosynthesis. Here, the β-fructofuranosidase variant FopA(A178P) was
selected for strain improvement by genetic engineering. The FopA(A178P) expression
cassette containing the gpdA promoter and the trpC terminator was constructed and
cloned into pMD19-T to generate the expression vector, pGF-mfopA (Fig. 4A). The
resultant vector was then co-transformed with pME2892 into the protoplasts of A.
niger ATCC 20611. Purified transformants were grown in FM medium and screened
for production of β-fructofuranosidase. The best three transformants, CM2, CM6 and
CM9 were selected and each of them produced over 40% higher β-fructofuranosidase
16

activity than the parental strain (Fig. 4B). Especially, CM6 could produce specific β-
fructofuranosidase with activity of up to 507 U/g, which was 1.58 times of the
parental strain (320 U/g).
Furthermore, production of FOS by A. niger ATCC 20611 and the
FopA(A178P)-overexpression strains was investigated. Equal amounts of mycelium
cells were used to produce FOS under conditions according to the method described
in 2.7. Results of FOS formation detected by HPLC were summarized in Table 3.
During the initial reaction up to 1 h, markedly higher GF2 levels for the
overexpression transformants (31.1% for CM2, 32.9% for CM6 and 31.3% for CM9)
than the parental strain (25.5%) highlighted the enhancements in catalytic activities,
as GF2 is the initial FOS species produced from sucrose. As the reaction progressed,
larger amounts of GF3 and GF4 also accumulated for the transformants, further
confirming the effectiveness of overexpression of FopA(A178P) in the industrial
strain A. niger ATCC 20611. Generally, the endpoint for a typical FOS synthesis
reaction was regarded as the time when the content of total FOS was approx. 60%
(Hidaka et al., 1988; Nishizawa et al., 2001). All the transformants reached over 59%
FOS in 3 h while it took the parent 5 h to produce similar amount of FOS, indicating
that overexpression of FopA(A178P) achieved a 40% reduction in the time required to
complete the reaction. These results displayed an enhanced effectiveness for FOS
production by strain improvement via genetic engineering, suggesting the industrial
relevance of the engineered strains to improve process economics.
4. Discussion
17

For more than decades, genetic engineering has been used as a fruitful strategy
for strain improvement in filamentous fungi, as it substantially circumvents the
shortage of conventional breeding (Yelton et al., 1984; Chiang, 2004). Before
designing a genetic engineering strategy, development of an efficient transformation
system is essential to a specific filamentous fungus. Many fungal species have been
transformed and a variety of protocols now exist, including the widely used PEG-
mediated protoplast transformation (Meyer, 2008). However, no common rule could
be applicable to predicting the availability of a particular protocol for the fungus of
interest. Individual species, especially the industrial strains, have to be considered
independently and the most appropriate method for each fungus need to be identified
and optimized. In this study, a PEG-mediated protoplast transformation system was
established in A. niger ATCC 20611 by determination of the dominant selectable
marker and optimization of protoplast preparing conditions, and furthermore applied
to strain improvement for FOS production.
Filamentous fungi generally display a considerable metabolic diversity, which
confer them relatively resistant to many antibiotics. Selection of an appropriate
selectable marker is an important prerequisite for stable genetic transformation of
certain fungus species (Punt and Hondel, 1992; Zhong et al., 2007). There have been
several commonly used markers conferring resistance to antibiotics for selection of
fungal transformants, such as the hygromycin B resistance gene (hph), the
sulfonylurea resistance gene (sur) and the pyrithiamine resistance gene (ptrA). The
hph gene encodes a phosphotransferase that could phosphorylate and inactivate
18

hygromycin B, an aminoglycoside antibiotic that interrupts the translocation step of
protein synthesis (Punt and Hondel, 1992). Although hph has been widely used as an
effective marker for transformation selection in many fungi, some species display
high resistance to this robust antibiotic, including the filamentous ascomycetes
Colletotrichum acutatum and Beauveria bassiana (Sureka et al., 2014). The sur gene
from Magnaporthe grisea encodes acetolactate synthase (ALS) required for
valine/isoleucine biosynthesis, and overexpression of sur in a fungus could eliminate
the inhibition of ALS by sulfonylurea, thus resulting in sulfonylurea resistance
(Chung et al., 2002). The two mentioned-above fungi C. acutatum and B. bassiana
were reported to be successfully transformed by using sur as the dominant selectable
marker (Chung et al., 2002; Zhang et al., 2010). Pyrithiamine, a potent antagonist of
thiamine, could inhibit the fungal growth and the ptrA gene would confer high
resistance to pyrithiamine (Kubodera et al., 2000). More recently, ptrA has been
proven to be particularly useful for transformation of different Aspergillus sp.,
including A. oryzae and A. aculeatus that are insensitive to various drugs (Kubodera
et al., 2002; Kanamasa et al., 2003). In this study, the sensitivity of A. niger ATCC
20611 to hygromycin B, sulfonylurea and pyrithiamine were examined and found that
pyrithiamine inhibited its growth effectively, even in the concentration as low as 2
μg/mL (Table 2). Consequently, the ptrA gene was selected as the dominant selectable
marker for genetic transformation of A. niger ATCC 20611. Furthermore, protoplast
preparation is another important element to consider with the choice of the resistance
to antibiotic for fungal transformation (Liu and Friesen, 2012; Zhang et al., 2016).
19

Two crucial parameters, i.e., cell wall-lysing enzymes and fungal cultures, necessary
to be considered for proper generation of protoplasts were examined. Our results
confirmed that lysing enzymes from T. harzianum, snailase and lysozyme were more
effective when used as mixtures rather than individually. And high yield of
protoplasts were obtained using the molasses-cultured fungal mycelia with
concentrations of 1×108 /g wet weight mycelium (Fig. 1C). Finally, the protoplasts of
A. niger ATCC 20611 were successfully transformed using ptrA as the dominant
selectable marker. This is the first report on the genetic transformation of the FOS-
producing industrial strain and the efficiency of transformation reaches 30~50
transformants per μg of DNA.
FOS is now produced commercially from sucrose using the enzymes with high
transfructosylating activity (Maiorano et al., 2008). Such enzymes can be derived
from plants, bacteria or fungi, with the latter affording the greatest yields (Dominguez
et al., 2014). Different FOS-producing fungi have been identified and characterized
for their potential application to FOS production. A. niger ATCC 20611 was the first
fungus reported to achieve a high yield of FOS production with the maximum FOS
conversion from sucrose reaching 55-60% (w/w) of total sugar (Hidaka et al., 1988).
An A. japonicus, TIT-KJ1, was isolated from air and found to produce a significantly
high transfructosylating activity (Duan et al., 1993). Another promising fungus
Aureobasidium pullulans for FOS production was investigated and gave rise to
industrial process as well described by Yun et al. (1992). Other candidate fungi,
including A. oryzae, A. aculeatus, Penicillium citrinum, P. expansum and Calviceps
20

purpurea, have also received particular attention (Sangeetha et al., 2005; Yun, 1996;
Mutanda et al., 2014). So far, most investigations with the aim to obtain higher FOS
yields and productivities are mainly based on the development of more efficient
production processes (Dominguez et al., 2014). Chen and Liu (1996) firstly examined
the effect of various carbon and nitrogen sources in cultivation of A. japonicus for
FOS production and found that sucrose and yeast extract were the best ones,
respectively. The effect of the medium pH in fungal growth has also been evaluated.
pH of 5.5 was found to be the best initial value for A. oryzae, A. japonicus, and P.
purpurogenum (Dominguez et al., 2014). In addition, several agricultural by-products
like cereal bran, corn products and sugarcane bagasse were used as the low-cost
substrates for the growth of the FOS-producing strain A. oryzae CFR 202 (Sangeetha
et al., 2004). Moreover, immobilized enzymes or cells have been employed for the
continuous production of FOS. Calcium alginate, synthetic polymer
polymethacrylamide as well as gluten have been adopted as the matrix for entrapping
fungal mycelia to achieve the high-level production of FOS (Chien et al., 2001;
Sangeetha et al., 2005). However, there are few reports concerning strain
improvement and genetic manipulation. Genetic engineering can be a powerful
strategy for filamentous fungi in order to increase productivity and thereby to
maximize the capacity of a particular metabolic process (Meyer, 2008). In the present
study, an efficient genetic transformation system was developed in A. niger ATCC
20611 and, furthermore, the reporter protein EGFP was successfully expressed based
on this system (Fig. 3). These results indicated the potential feasibility of strain
21

improvement of A. niger ATCC 20611 for higher FOS productivity by genetic
manipulation.
Principal FOS such as 1-kestose, nystose and 1F-β-fructofuranosyl nystose are
synthesized by the fructosyltransferase activity of β-fructofuranosidase (also
designated as β-fructosyltransferase). Fructosyltransferases derived from fungi
provide high yields of FOSs and their mass production is not complicated (Madlová et
al., 2000). For example, A. niger ATCC 20611 produces a unique β-
fructofuranosidase, which has a high transfructosyating activity and a high
regiospecificity for fructosyl transfer to the 1-OH group of terminal fructofuransides
(Hirayama et al., 1989). The fructosyltransferase from Aureobasidium pullulans also
showed high activity and regiospecificity in the fructosyl transfer reaction (Hayashi et
al., 1990). An important property of these enzymes is that they catalyze almost
exclusively transfructosylation reaction at rather high concentration of sucrose
solution (over 500 g/L) to produce a mixture of FOS and glucose (Nishizawa et al.,
2001). And the typical values of recommended conditions for the production of FOS
are the pH of about 5-5.5 and temperature of 55-60℃ (Madlová et al., 2000).
Therefore, industrial sucrose-to-FOS biotransformation is generally conducted in 50
to 60% (w/v) sucrose solution with the reaction proceeding at 50 to 60℃ for up to 20
h (Madlová et al., 2000; Trollope et al., 2015). However, operating at large volumes
of substrate loading and long-term high temperatures, the enzyme activity is prone to
be impaired by thermal instability. To address these limitations, Trollope et al. (2015)
used a combined crystal structure- and evolutionary-guided approach for the directed
22

evolution of the A. japonicus β-fructofuranosidase and acquired a library of
functionally enriched variants displaying improved thermostability and increased
specific activities. Here, the most improved single-amino-acid-substitution variant
FopA(A178P) was overexpressed in A. niger ATCC 20611 through the genetic
transformation system. The FopA(A178P)-encoding gene mfopA under the control of
the strong promoter, PgpdA, was successfully transformed into the protoplasts of A.
niger ATCC 20611 (Fig. 4A). All the transformants showed improved β-
fructofuranosidase activity and the transformant, CM6, exhibited the highest activity
(507 U/g) (Fig. 4B). When used for FOS synthesis, the transformants displayed an
increased catalytic effectiveness by reducing the time to complete the reaction. Thus,
when applying the genetic engineered strains for commercial FOS production, the
required enzyme loading could be reduced to improve industrial process economics.
In conclusion, this study developed an efficient PEG-mediated protoplast
transformation system for the industrial strain A. niger ATCC 20611, which is based
on the use of ptrA as the selectable marker. Further strain improvement for FOS
production was achieved by overexpression of FopA(A178P) in A. niger ATCC
20611. The high efficiency of genetic manipulation achieved using this
transformation system will further facilitate new developments in genetic engineering
of A. niger ATCC 20611, thus strengthening the role of this strain as an important
microorganism in functional food industry.
Acknowledgment
23

This work was supported by the grants from the National Natural Science
Foundation of China (No. 31370135), the Fundamental Research Funds of Shandong
University (No. 2015JC005) and the Agricultural Science and Technology
Achievement Transformation Fund of Shandong Province (2014No.45).
References
Buchan, J., Savage, R., 1952. Paper chromatography of some starch conversion products.
Analyst. 77, 401–406.
Cantarel, B.L., Coutinho, P.M., Rancurel, C., Bernard, T., Lombard, V., Henrissat, B., 2009.
The Carbohydrate-Active EnZymes database (CAZy): an expert resource for
glycogenomics. Nucleic Acids Res. 37, D233–D238.
Chen, W.C., Liu, C.H., 1996. Production of β-fructofuranosidase by Aspergillus japonicus.
Enzyme Microb. Technol. 18, 153-160.
Chiang, S.J., 2004. Strain improvement for fermentation and biocatalysis processes by genetic
engineering technology. J. Ind. Microbiol. Biotechnol. 31, 99-108.
Chien, C.S., Lee, W.C., Lin, T.J., 2001. Immobilization of Aspergillus japonicus by
entrapping cells in gluten for production of fructooligosaccharides. Enzyme Microb.
Technol. 29, 252-257.
Chung, K.R., Shilts, T., Li, W., Timmer, L.W., 2002. Engineering a genetic transformation
system for Colletotrichum acutatum, the causal fungus of lime anthracnose and
postbloom fruit drop of citrus. FEMS Microbiol. Lett. 213 (1), 33-39.
Collings, A., Davis, B., Mills, J., 1988. Factors affecting protoplast release from some
mesophilic, thermophilic and thermotolerant species of filamentous fungi using
Novozym 234. Microbios. 53, 197-210.
Dinarvand, M., Rezaee, M., Masomian, M., Jazayeri, S.D., Zareian, M., Abbasi, S., Ariff,
A.B., 2013. Effect of C/N ratio and media optimization through response surface
methodology on simultaneous productions of intra-and extracellular inulinase and
invertase from Aspergillus niger ATCC 20611. Biomed Res. Int. 2013, 508968.
Dominguez, A.L., Rodrigues, L.R., Lima, N.M., Teixeira, J.A., 2014. An overview of the
recent developments on fructooligosaccharide production and applications. Food
Bioproc. Tech. 7, 324-337.
24

Dorta, C., Cruz, R., Oliva-Neto, P.D., Moura, D.J.C., 2006. Sugarcane molasses and yeast
powder used in the fructooligosaccharides production by Aspergillus japonicus -FCL
119T and Aspergillus niger ATCC 20611. J. Ind. Microbiol. Biotechnol. 33, 1003-1009.
Duan, K.J., Sheu, D.C., Chen, J.S., 1993. Purification and characterization of β-
fructofuranosidase from Aspergillus japonicus TIT-KJ1. Biosci. Biotechnol. Biochem.
57, 1811-1815.
Ghazi, I., Fernandez-Arrojo, L., Garcia-Arellano, H., Plou, F.J., Ballesteros, A., 2007.
Purification and kinetic characterization of a fructosyltransferase from Aspergillus
aculeatus. J. Biotechnol. 128, 204-211.
Hayashi, S., Nonokuchi, M., Imada, K., and Ueno, H., 1990. Production of fructosyl-
transferring enzyme by Aureobasidium sp. ATCC 20524. Ind. Microbial. 5, 395-400.
Hidaka, H., Hirayama, M., Sumi, N., 1988. A fructooligosaccharide-producing enzyme from
Aspergillus niger ATCC 20611. Agric. Biol. Chem. 52, 1181-1187.
Hirayama, M., Sumi, N., Hidaka, H., 1989. Purification and properties of a
fructooligosaccharide-producing β-fructofuranosidase from Aspergillus niger ATCC
20611. Agric. Biol. Chem. 53 (3), 667-673.
Kanamasa, S., Yamaoka, K., Kawaguchi, T., Sumitani, J.I., Arai, M., 2003. Transformation of
Aspergillus aculeatus using the drug resistance gene of Aspergillus oryzae and the pyrG
gene of Aspergillus nidulans. Biosci. Biotechnol. Biochem. 67 (12), 2661-2663.
Kelly, J. M., Hynes, M. J., 1985. Transformation of Aspergillus niger by the amdS gene of
Aspergillus nidulans. The EMBO J. 4(2), 475-9.
Krappmann, S., Bayram, O., Braus, G.H., 2005. Deletion and allelic exchange of the
Aspergillus fumigatus veA locus via a novel recyclable marker module. Eukaryot. Cell 4,
1298–1307.
Kubodera, T., Yamashita, N., Nishimura, A., 2000. Pyrithiamine resistance gene (ptrA) of
Aspergillus oryzae: cloning, characterization and application as a dominant selectable
marker for transformation. Biosci. Biotechnol. Biochem. 64 (7), 1416-1421.
Kubodera, T., Yamashita, N., Nishimura, A., 2002. Transformation of Aspergillus sp. and
Trichoderma reesei using the pyrithiamine resistance gene (ptrA) of Aspergillus oryzae.
Biosci. Biotechnol. Biochem. 66 (2), 404-406.
Kurakake, M., Masumoto, R., Maguma, K., Kamata, A., Saito, E., 2010. Production of
fructooligosaccharides by β-fructofuranosidases from Aspergillus oryzae KB. J. Agric.
Food Chem. 58 (1), 488-492.
Liu, Z., Friesen, T.L., 2012. Polyethylene glycol (PEG)-mediated transformation in
filamentous fungal pathogens. Methods Mol. Biol. 835, 365-375.
25

Madlová, A., Antosová, M., Baráthová, M., Polakovic, M., Stefuca, V., Báles, V., 2000.
Screening of microorganisms for transfructosylating activity and optimization of
biotransformation of sucrose to fructooligosaccharides. Chem. Papers 53 (6), 366-369.
Maiorano, A.E., Piccoli, R.M., da Silva, E.S., de Andrade Rodrigues, M.F., 2008. Microbial
production of fructosyltransferases for synthesis of pre-biotics. Biotechnol. Lett. 30 (11),
1867-1877.
Meyer, V., 2008. Genetic engineering of filamentous fungi — Progress, obstacles and future
trends. Biotechnol. Adv. 26 (2), 177–185.
Mutanda, T., Mokoena, M.P., Olaniran, A.O., Wilhelmi, B.S., Whiteley, C.G., 2014.
Microbial enzymatic production and applications of short-chain fructooligosaccharides
and inulooligosaccharides: recent advances and current perspectives. J. Ind. Microbiol.
Biotechnol. 41 (6), 893-906.
Nishizawa, K., Nakajima, M., Nabetani, H., 2001. Kinetic study on transfructosylation by β-
fructofuranosidase from Aspergillus niger ATCC 20611 and availability of a membrane
reactor for fructooligosaccharides. Food Sci. Technol. Res. 7 (1), 39-44.
Penttilä, M., Nevalainen, H., Rättö, M., Salminen, E., Knowles, J., 1987. A versatile
transformation system for the cellulolytic filamentous fungus Trichoderma reesei. Gene
61 (2), 155-164.
Pöggeler, S., Masloff, S., Hoff, B., Mayrhofer, S., Kück, U., 2003. Versatile EGFP reporter
plasmids for cellular localization of recombinant gene products in filamentous fungi.
Curr. Genet. 43, 54–61.
Punt, P.J., van den Hondel, C.A., 1992. Transformation of filamentous fungi based on
hygromycin B and phleomycin resistance markers. Methods Enzymol. 216, 447-457.
Sangeetha, P.T., Ramesh, M.N., Prapulla, S.G., 2004. Production of fructosyl transferase by
Aspergillus oryzae CFR 202 in solid-state fermentation using agricultural by-products.
Appl. Microbiol. Biotechnol. 65 (5), 530-537.
Sangeetha, P.T., Ramesh, M.N., Prapulla, S.G., 2005. Recent trends in the microbial
production, analysis and application of fructooligosaccharides. Trends Food Sci.
Technol. 16, 442–457.
Simmering, R., Blaut, M., 2001. Pro- and prebiotics--the tasty guardian angels? Appl
Microbiol Biotechnol. 55(1):19-28.
Sureka, S., Chakravorty, A., Holmes, E.C., Spassibojko, O., Bhatt, N., Wu, D., Turgeon,
B.G., 2014. Standardization of functional reporter and antibiotic resistance cassettes to
facilitate the genetic engineering of filamentous fungi. ACS Syn. Biol. 3 (12), 960-962.
26

Trollope, K.M.，Görgens, J.F.，Volschenk, H., 2015. Semirational directed evolution of
loop regions in Aspergillus japonicus β-fructofuranosidase for improved
fructooligosaccharide production. Appl. Environ. Microb. 81 (20), 7319-7329.
Yanai, K., Nakane, A., Kawate, A., Hirayama, M., 2001. Molecular cloning and
characterization of the fructooligosaccharide-producing beta-fructofuranosidase gene
from Aspergillus niger ATCC 20611. Biosci. Biotechnol. Biochem. 65 (4), 766-773.
Yelton, M.M., Hamer, J.E., Timberlake, W.E., 1984. Transformation of Aspergillus nidulans
by using a trpC plasmid. Proc. Natl. Acad. Sci. U. S. A. 81, 1470–1474.
Yu, J.H., Hamari, Z., Han, K.H., Seo, J.A., Reyes-Domínguez, Y., 2004. Double-joint PCR: a
PCR-based molecular tool for gene manipulations in filamentous fungi. Fung. Genet.
Biol. 41 (11), 973-981.
Yun, J.W., 1996. Fructooligosaccharides—occurrence, preparation, and application. Enzyme
Microb. Technol. 19, 107-117.
Yun, J.W., Jung, K.H., Jeon, Y.J., Lee, J.H., 1992. Continuous production of fructo-
oligosaccharides by immobilized cells of Aureobasidium pullulans. J. Microb. Biotech. 2
(2), 98-101.
Zhang, S., Fan, Y., Xia, Y.X., Keyhani, N.O., 2010. Sulfonylurea resistance as a new
selectable marker for the entomopathogenic fungus Beauveria bassiana. Appl.
Microbiol. Biotechnol. 87 (3), 1151-1156.
Zhang, Y.J, Xie, M., Zhang, X.L., Peng, D.L., Yu, W.B., 2016. Establishment of
polyethylene-glycolmediated protoplast transformation for Lecanicillium lecanii and
development of virulence-enhanced strains against Aphis gossypii. Pest Manag. Sci. 72
(10), 1951-1958.
Zhong, Y.H., Wang, X.L., Wang, T.H., Jiang, Q., 2007. Agrobacterium-mediated
transformation (AMT) of Trichoderma reesei as an efficient tool for random insertional
mutagenesis. Appl. Microbiol. Biotechnol. 73(6):1348-54.
Tables
Table 1
Primers used in this study.
Primers
ptrA-F
Sequences (5’-3’)
Targeted gene
AGGGTAAGGTCGTGGTTT
ptrA
ptrA-R
egfp-F
egfp-R
gpdA-F
CGATTATCAAGCCCTTAGTA
ATGGTGAGCAAGGGCGAG
TTACTTGTACAGCTCGTCCATG
AGACCTAATACAGCCCCTAC
ptrA
egfp
egfp
Promoter of gpdA
27

gpdA-R
GGGTGGTAGTGGTGAGCTTCATTGTCTGCTCAAGC
GGGGTAG
Promoter of gpdA
fopA-F
fopA-R
ATGAAGCTCACCACTACCACCC
TTTGATGATTTCAGTAACGTTAAGTTCAATTTCTCT
CCGGCCAG
fopA
fopA
mfopA-542R
mfopA-525F
trpC-F
GGGTGGTCGGGGATGACG
CGTCATCCCCGACCACCC
ACTTAACGTTACTGAAATCATCAAA
GAGTGGAGATGTGGAGTGGG
mfopA
mfopA
Terminator of trpC
Terminator of trpC
trpC-R
28

Table 2
Antibiotic resistance of A. niger ATCC 20611a
Hygromycin B (μg/ml)
Sulfonylurea (μg/ml)
Pyrithiamine (μg/ml)
2.0 4.0 6.0
+++ --- --- ---
0
100
200
++-
300
+--
0
2.0
4.0
++-
6.0
+--
0
ATCC 20611
+++
+++
+++
+++
a 100 μl diluted spores suspensions (105/ml, 106/ml and 107/ml) are spread on solidified
minimal medium plates containing various concentrations of the antibiotic: +++, significant
growth; ++ -, growth; + - -, sparse growth; ---, no growth.
29