Prodrug activation by Cryptosporidium thymidine kinase

Article abstract of DOI:10.1074/jbc.M110.101543

Cryptosporidium spp. cause acute gastrointestinal disease that can be fatal for immunocompromised individuals. These protozoan parasites are resistant to conventional antiparasitic chemotherapies and the currently available drugs to treat these infections are largely ineffective. Genomic studies suggest that, unlike other protozoan parasites, Cryptosporidium is incapable of de novo pyrimidine biosynthesis. Curiously, these parasites possess redundant pathways to produce dTMP, one involving thymidine kinase (TK) and the second via thymidylate synthase-dihydrofolate reductase. Here we report the expression and characterization of TK from C. parvum. Unlike other TKs, CpTK is a stable trimer in the presence and absence of substrates and the activator dCTP. Whereas the values of k_cat= 0.28 s^-1 and K_m,ATP = 140 μM are similar to those of human TK1, the value of K_m(thymidine) = 48 μM is 100-fold greater, reflecting the abundance of thymidine in the gastrointestinal tract. Surprisingly, the antiparasitic nucleosides AraT, AraC, and IDC are not substrates for CpTK, indicating that Cryptosporidium possesses another deoxynucleoside kinase. Trifluoromethyl thymidine and 5-fluorodeoxyuridine are good substrates for CpTK, and both compounds inhibit parasite growth in an in vitro model of C. parvum infection. Trifluorothymidine is also effective in a mouse model of acute disease. These observations suggest that CpTK-activated pro-drugs may be an effective strategy for treating cryptosporidiosis.

Full text of DOI:10.1074/jbc.M110.101543

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 21, pp. 15916–15922, May 21, 2010
Printed in the U.S.A.
□
S
Prodrug Activation by Cryptosporidium Thymidine Kinase*
Received for publication, January 6, 2010, and in revised form, March 13, 2010 Published, JBC Papers in Press, March 15, 2010, DOI 10.1074/jbc.M110.101543
Xin E. Sun‡1, Lisa Sharling§, Mani Muthalagi§, Devaraja G. Mudeppa¶, Krzysztof W. Pankiewiczʈ, Krzysztof Felczakʈ,
Pradipsinh K. Rathod¶, Jan Mead**, Boris Striepen§, and Lizbeth Hedstrom‡‡2
From the ‡Graduate Program in Biochemistry and ‡‡Departments of Biology and Chemistry, Brandeis University, Waltham,
Massachusetts 02454, the §Center for Tropical and Emerging Global Diseases and Department of Cellular Biology, University of
Georgia, Athens, Georgia 30602, the ¶Department of Chemistry, University of Washington, Seattle, Washington 98195, the ʈCenter
for Drug Design, University of Minnesota, Minneapolis, Minnesota 55455, and the **Atlanta Veterans Affairs Medical Center and
Department of Pediatrics, Emory University School of Medicine, Atlanta, Georgia 30322
Cryptosporidium spp. cause acute gastrointestinal disease
that can be fatal for immunocompromised individuals. These
protozoan parasites are resistant to conventional antipara-
sitic chemotherapies and the currently available drugs to treat
these infections are largely ineffective. Genomic studies suggest
that, unlike other protozoan parasites, Cryptosporidium is inca-
pable of de novo pyrimidine biosynthesis. Curiously, these par-
asites possess redundant pathways to produce dTMP, one
involving thymidine kinase (TK) and the second via thymidylate
synthase-dihydrofolate reductase. Here we report the expres-
sion and characterization of TK from C. parvum. Unlike other
TKs, CpTK is a stable trimer in the presence and absence of
to standard water treatment. Cryptosporidium hominis, which
is specific for humans, and Cryptosporidium parvum, which
infects a wide range of hosts, are responsible for most human
disease. The prevalence of C. parvum infections in calves raises
serious concerns that C. parvum oocysts could be easily
obtained and used as a bioterrorism agent (3).
No effective treatment exists for cryptosporidiosis (4). Cryp-
tosporidium is resistant to conventional antiparasitic chemo-
therapies such as antifolates; several drug targets are either
absent or highly divergent in the parasite (5). In addition, Cryp-
tosporidium contains many putative drug efflux transporters,
which may also protect the parasite (6). Drug development is
further impeded by the inability to continuously culture Cryp-
tosporidium in vitro.
substrates and the activator dCTP. Whereas the values of kcat
؍
؊1
0.28 s and Km,ATP ؍ 140 ␮M are similar to those of human
TK1, the value of Km(thymidine) ؍ 48 ␮M is 100-fold greater,
reflecting the abundance of thymidine in the gastrointestinal
tract. Surprisingly, the antiparasitic nucleosides AraT, AraC,
and IDC are not substrates for CpTK, indicating that Cryptospo-
ridium possesses another deoxynucleoside kinase. Trifluoro-
methyl thymidine and 5-fluorodeoxyuridine are good substrates
for CpTK, and both compounds inhibit parasite growth in an in
vitro model of C. parvum infection. Trifluorothymidine is also
effective in a mouse model of acute disease. These observations
suggest that CpTK-activated pro-drugs may be an effective
strategy for treating cryptosporidiosis.
Nucleotide metabolism in general, and dTMP biosynthesis in
particular, provides a rich source of drug targets for many diseases.
Genomic analysis suggests that, unlike most protozoan parasites,
Cryptosporidiumlacksdenovopyrimidinenucleotidebiosynthetic
pathways and instead salvages pyrimidines from the host, produc-
ing dTMP via thymidine kinase (TK)3 (E.C. number 2.7.1.21) and
thymidylate synthase-dihydrofolate reductase (TS-DHFR) (Fig.
1). Although several laboratories are developing inhibitors of
Cryptosporidium TS-DHFR (7–9), the presence of these redun-
dant pathways calls to question whether blocking dTMP bio-
synthesis is a viable strategy for anti-cryptosporidial chemo-
therapy. Indeed, the intestinal parasites Giardia lamblia (10)
and Entamoeba histolytica (11) lack TS and appear to obtain
dTMP entirely via the phosphorylation of thymidine. Intrigu-
ingly, Cryptosporidium is the only Apicomplexan that pos-
sesses a TK (12), and it appears to have obtained its TK gene
from bacteria via horizontal gene transfer. Together, these
observations suggest that Cryptosporidium may have adapted
its metabolism to exploit a unique abundance of thymidine in
the gastrointestinal environment (13).
Cryptosporidium spp. are intracellular parasitic protozoa
that cause cryptosporidiosis, an acute gastrointestinal disease
characterized by severe diarrhea. Cryptosporidium is a major
cause of malnutrition in the developing world (1). The disease is
typically short term and self-limiting in healthy individuals;
however, the infection can be chronic and life-threatening in
children and immunocompromised patients. Cryptosporidium
infection is transmitted by oocysts found in contaminated
drinking and recreational water (2). These oocysts are resistant
TK plays a critical role in the activation of deoxynucleoside
prodrugs used in antiviral and anticancer chemotherapy (14).
* Thisworkwassupported, inwholeorinpart, byNationalInstitutesofHealth 3 The abbreviations used are: TK, thymidine kinase; CpTK, Cryptosporidium
Grants RO1 AI055268 (to B. S.), U01AI75466 (to L. H.), and AI082617 (to
P. K. R.), and the Veterans Affairs and the Atlanta Research and Education
Foundation (to J. M.).
S
parvum thymidine kinase; EcTK, E. coli thymidine kinase; TS, thymidylate
synthase; DHFR, dihydrofolate reductase; TFT, trifluoromethylthymidine;
AraT, thymine 1-␤-D-arabinofuranoside; IUdR, 5-iodo-2Ј-deoxyuridine;
AraC, 1-␤-D-arabinofuranosylcytosine (cytarabine); AZT, 3Ј-azido-2Ј,3Ј-
dideoxythymidine; dT, thymidine; dU, deoxyuridine; dG, deoxyguanosine;
dC, deoxycytidine; UK/UPRT, uridine kinase/uridine phosphoribosyl trans-
ferase; FUdR, 5-fluoro-2Ј-deoxyuridine; ClUdR, 5-chloro-2Ј-deoxyuridine;
D4T, 2Ј,3Ј-didehydro-2Ј,3Ј-dideoxythymidine; IDC, 5-iodo-2Ј-deoxycyti-
dine; IL, interleukin; TK1, thymidine kinase 1; MP, monophosphate.
□
The on-line version of this article (available at http://www.jbc.org) contains
supplemental Figs. S1–S3.
1 Supported by National Institutes of Health Training Grant 2T32GM007596.
2 To whom correspondence should be addressed: MS009, 415 South St., Wal-
tham, MA 02454-9110. Fax: 781-736-2349; E-mail: hedstrom@brandeis.
edu.
15916 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 21•MAY 21, 2010

Cryptosporidium TK
(forward) and TCAGGTCGACTTAGAAATTGTATTCTTC-
ACAATTAATT (reverse) and subsequently subcloned into
pMAL-c2X (New England Biolabs). The resulting construct
will be referred to as pMAL-CpTK.
Additionally, the coding sequence of CpTK was PCR am-
plified from pMAL-CpTK using the following primers: TGGT-
GCCTCGTGGTAGCCATGCAAAATTATACTTTTACT-
ATTCAGCAGCAAAATTATACTTTTACTATTCAGCA
(forward) and CTCAGCTTCCTTTCGGGCTTTGTTATTA-
GAAATTGTATTCTTCACAATTAATTATATGA (reverse)
and subsequently cloned into pET28a. The resulting construct
will be referred to as pET-CpTK.
Cell-free Translation—Untagged CpTK was expressed using
a wheat germ cell-free transcription-translation system as pre-
viously described (18). The coding sequence of CpTK was
amplified from pMAL-CpTK vector by PCR using the following
primers: CAGGACTCGAGATGGCAAAATTATACTTTTA-
CTATTCAGCA (forward) and CATGGTCCCGGGTTAGA-
AATTGTATTCTTCACAATTAATTAT (reverse) and subse-
quently cloned into a cell-free vector that carries SP6 RNA
polymerase promoter and ⍀ sequence for the wheat germ ribo-
some binding site. Transcription and translation were carried
out as described (18). Wheat germ lysate with CpTK was kept at
Ϫ80 °C until purification.
FIGURE 1. C. parvum pyrimidine nucleotide salvage pathways. Enzymes
that appear to have been obtained via horizontal gene transfer are shown in
red (bacteria) and green (plant). T, nucleoside transporter.
These compounds are converted to the mono-, di-, and triphos-
phates and then incorporated into DNA and RNA. TFT, AraT,
IUdR, IDC, and AraC, but not AZT and acyclovir, have been
reported to have anticryptosporidial activity in a cell culture
model of infection (15). All of these nucleosides are potential
substrates for CpTK, suggesting that CpTK may have very
broad specificity like a viral TK. Importantly, the antiparasitic
effects are observed at concentrations that do not affect the
host cells, which is surprising because the host cells also contain
these same deoxynucleoside salvage enzymes. Perhaps this
selective antiparasitic activity derives from the catalytic prop-
erties of CpTK.
Bacterial Expression—Alternatively, His6-tagged CpTK was
expressed in bacteria. Briefly, pET-CpTK was transformed into
chemically competent BL21(DE3) cells and grown in LB me-
dium at 30 °C until A600 ϳ1.0. Cultures were induced with iso-
propyl 1-thio-␤-D-galactopyranoside to a final concentration of
0.5 mM and allowed to grow overnight at 16 °C. Cells were har-
vested and cell pellets were stored at Ϫ80 °C until purification.
Purification of CpTK—Untagged CpTK was purified by affin-
ity chromatography on 3Ј-aminothymidine-Sepharose resin.
3Ј-Aminothymidine-Sepharose resin was synthesized as previ-
ously described (19, 20). Wheat germ lysate was loaded onto
the thymidine column and purification was carried out as pre-
viously described (19, 20). Elution fractions were assayed for
enzyme activity and fractions with activity were pooled and
concentrated and stored at 4 °C. Protein concentration was
determined using the Bio-Rad protein assay dye reagent
according to the manufacturer’s instructions. Prior to assaying,
CpTK was passed through a Centri-Sep desalting column (Prin-
ceton Separations) to remove thymidine from the enzyme
We have expressed and characterized CpTK as part of a pro-
gram to identify potential drug targets in the nucleotide salvage
pathways of C. parvum. FUdR, TFT, and AZT are good sub-
strates for CpTK. In contrast, AraT, AraC, and IDC are not
substrates for CpTK, suggesting that Cryptosporidium possess
another deoxynucleoside kinase. Importantly TFT inhibits C.
parvum growth in a mouse model of C. parvum infection, sug-
gesting that the pyridimidine deoxynucleoside salvage path-
ways can be subverted for chemotherapy.
EXPERIMENTAL PROCEDURES
Materials—3Ј-Amino-3Ј-deoxythymidine was purchased from sample.
Toronto Research Chemicals (Ontario, Canada). Activated
Alternatively, His6-tagged CpTK was purified by affinity chro-
CH-Sepharose 4B beads were purchased from Amersham Bio- matography using a HisTrap column (Amersham Biosciences) on
sciences. [methyl-3H]Thymidine (2 Ci/mmol) was purchased an AKTA Purifier (GE Healthcare). Briefly, cells were resus-
¨
from PerkinElmer Life Sciences. DEAE paper discs were pur- pended in Binding Buffer (20 mM Na2HPO4, pH 7.8, 500 mM
chased from Whatman (Piscataway, NJ). ␤-L-Thymidine was NaCl, 20 mM imidazole) and lysed by sonication. Cell lysate was
purchased from Carbosynth (Berkshire, UK). All other reagents loaded onto the HisTrap column and His6-tagged CpTK was
were purchased from Sigma.
eluted using a gradient to 500 mM imidazole. Purified enzyme
Synthesis of Nucleoside Analogs—The syntheses of KP296-8 was used immediately.
were reviewed previously (16). KP1308 and KP1309 were syn-
Enzyme Assays—CpTK activity was measured using a radio-
thesized as previously described (17). The syntheses of KP330, metric assay as previously described (21, 22). Reactions were
KP332-4, and KP1283 are described in Ref. 17.
carried out in a final volume of 100 ␮l at 25 °C. Conversion of
Cloning—The coding sequence of CpTK was PCR amplified thymidine to dTMP was measured by the DEAE disc method as
from plasmid MTT1-CpTK-GFP using the following primers: described (21, 22). Additionally, a coupled spectrophotometric
ATTCGGATCCATGGCAAAATTATACTTTTACTATTC assay was used where the production of ADP was coupled to the
MAY 21, 2010•VOLUME 285•NUMBER 21
JOURNAL OF BIOLOGICAL CHEMISTRY 15917

Cryptosporidium TK
TABLE 1
Kinetic parameters for CpTK
All reactions were 100 ␮M dCTP unless otherwise noted. Reactions characterizing
phosphate acceptors were carried out with 5 mM ATP and reactions characterizing
phosphate donors were carried out with 250 ␮M dT.
production of NADH via pyruvate kinase/lactate dehydrogen-
ase reactions and monitored at 340 nm (23). Reactions were
carried out in a final volume of 500 ␮l and the decrease in
absorbance at 340 nm was measured on a Hitachi U-2000 spec-
trophotometer. Kinetic parameters were determined using the
SigmaPlot Enzyme Kinetics Module by fitting to the Michaelis-
Menten equation.
Substrate
Km
␮M
kcat
s
k
cat/Km
Ϫ1
Ϫ1
M
Ϫ1s
Thymidinea
48 Ϯ 3
89 Ϯ 6
0.28 Ϯ 0.05
0.28 Ϯ 0.007
0.3 Ϯ 0.1
(4.8 Ϯ 0.5) ϫ 103
(3.2 Ϯ 0.1) ϫ 103
(6.7 Ϯ 2) ϫ 103
Thymidineb
Thymidinec
Thymidine (ϪdCTP)d
ATPd
Determination of Oligomeric State—The oligomeric state of
CpTK was determined by size-exclusion chromatography
using a Sephacryl S-200 HR column (Amersham Biosciences).
CpTK oligomerization was determined in the absence and
presence of substrates (thymidine and ATP) and an allosteric
effector (dCTP). The CpTK elution profile was created by as-
saying fractions for enzyme activity. The molecular mass of
the CpTK oligomer was estimated from a calibration curve
obtained from standard proteins in the Bio-Rad Gel Filtration
Standard kit: bovine ␥-globulin (158 kDa), chicken ovalbumin
(44 kDa), equine myoglobin (17 kDa), and vitamin B12 (1.35
kDa). Blue dextran was used to determine the void volume of
the column.
40 Ϯ 2
45 Ϯ 15
140 Ϯ 30
110 Ϯ 50
118 Ϯ 1
22 Ϯ 3
0.04 Ϯ 0.004
0.28 Ϯ 0.05
0.04 Ϯ 0.004
0.53 Ϯ 0.06
0.36 Ϯ 0.01
0.24 Ϯ 0.02
0.17 Ϯ 0.02
(8.8 Ϯ 0.8) ϫ 102
(2.3 Ϯ 0.1) ϫ 103
(3.5 Ϯ 0.3) ϫ 102
(4.5 Ϯ 0.5) ϫ 103
(6.4 Ϯ 0.2) ϫ 103
(5.8 Ϯ 0.8) ϫ 103
(5.0 Ϯ 0.5) ϫ 103
ATP (ϪdCTPd)
dURc
TFTc
FUdRc
40 Ϯ 2
AZTc
32 Ϯ 4
␤-L-Thymidinec
D4Tc
290 Ϯ 30 0.007 Ϯ 0.0002 (2.4 Ϯ 0.6) ϫ 10
50 Ϯ 10
0.03 Ϯ 0.002
(6.4 Ϯ 0.2) ϫ 102
a Radioactive assay with untagged CpTK.
b Radioactive assay with His-tagged CpTK.
c Spectrophotometric assay with His-tagged CpTK.
d Spectrophotometric assay with untagged CpTK. Values are the average and stand-
ard deviations of two to three independent experiments.
Statistical Analysis—Flow cytometry data were evaluated by
analysis of variance (Microsoft Excel; Microsoft Corp., Red-
mond, WA).
Cell Culture Model of C. parvum Infection—Human ileocecal
adenocarcinoma epithelial cell line HCT-8 was infected with C.
parvum oocysts (24). Parasite growth was measured using a
real-time PCR assay as previously described (25) or a high con-
tent imaging assay.4 The values of EC50 were calculated using
RESULTS
Expression and Purification of Recombinant CpTK—CpTK
the Hill-Slope model (Equation 1) using Prism version 5 was initially expressed using a cell-free wheat germ transcrip-
(GraphPad Software Inc., La Jolla, CA),
% Growth ϭ ͑max Ϫ min͒/͑1 ϩ ͑EC50/͓I͔ ͒
tion/translation system. The enzyme was purified using thymi-
dine affinity chromatography (supplemental Fig. S1). One mil-
liliter of wheat germ lysate yielded 520 ␮g of ϳ90% pure CpTK.
Alternatively, His6-tagged CpTK was expressed in bacteria
using the pET system. One liter of culture yielded ϳ10 mg of
ϳ90% pure enzyme (supplemental Fig. S1).
n
(Eq. 1)
where n is the Hill coefficient. The host cell cytotoxicity was
determined using the LIVE/DEAD assay (Molecular Probes,
Carlsbad, CA).
Kinetic Characterization—The CpTK reaction exhibited
classic Michaelis-Menten kinetics (supplemental Fig. S2).
Wheat germ lysate CpTK has a Km of 48 ␮M for dT and kcat ϭ
0.28 sϪ1 when the production of dTMP was monitored at sat-
urating concentrations of ATP. Similar values are obtained for
His-tagged CpTK, indicating that the His tag has no effect on
enzyme function (Table 1). In addition, similar values are
obtained when the production of ADP was monitored (Table
1), indicating that the enzyme preparation does not contain
a contaminating ATPase. A Km value of 140 Ϯ 30 ␮M was
observed for ATP at saturating concentrations of dT (Table 1).
Allosteric Regulation—CpTK was activated by dCTP and
dCDP by 7- and 2.5-fold, respectively. dCTP is not a phosphate
donor, but instead activates CpTK by increasing kcat; it does not
change the values of Km of either dT or ATP (Table 1). Unlike
Escherichia coli TK, CpTK was not activated by dATP or dGTP.
Like other TKs, CpTK is inhibited by dTTP (data not shown).
Oligomeric State—The oligomeric state of CpTK was deter-
mined using size-exclusion chromatography. CpTK eluted at a
size of 70 Ϯ 10 kDa (Fig. 2), which is most consistent with a
trimer (monomeric molecular mass of 23.3 kDa). Importantly,
the presence of the activator dCTP or substrates dT and ATP
did not change the oligomeric state of CpTK.
Mouse Model of C. parvum Infection—The anticryptospo-
ridial activity of TFT was assessed in the interleukin (IL)-12
knock-out mouse model that resembles the acute human dis-
ease (26, 27). Mice were inoculated with 1,000 oocysts and
treated with phosphate-buffered saline, 200 mg/kg of TFT, or
2000 mg/kg of paromomycin starting 4 h postinfection. Com-
pounds were given for 7 days and mice were sacrificed on day 8
(peak infection). Mice (10 per group) were treated by gavage
given in a split dose. Parasite load was quantified by fluores-
cence-activated cell sorter assays for the presence of the oocysts
in feces at days 0, 4, and 7. Fecal pellets from the mice were
routinely collected daily and homogenized in adjusted volumes
of 2.5% potassium dichromate. Aliquots (200 ␮l) of vortexed
samples were processed over microscale sucrose gradients
essentially as previously described (28). The oocyst-containing
fraction was collected and washed. Purified oocysts were incu-
bated with a fluorescein-labeled oocyst-specific monoclonal
antibody (OW5O-fluorescein isothiocyanate) for 20 min. Sam-
ples were adjusted to 600 ␮l and assayed with a 102-s sampling
interval (100 ␮l) using logical gating of forward/side scatter and
a OW5O-fluorescein isothiocyanate fluorescence signal on a
BD Biosciences FACScan flow cytometer (29).
Activation of Naturally Occurring Nucleosides—CpTK effi-
ciently phosphorylates both dT and dU with similar values of
4 L. Sharling, X. Liu, D. R. Gollapalli, S. K. Maurya, L. Hedstrom, and B. Striepen,
manuscript in preparation.
k
cat/Km (Table 1). dG and dC are poor substrates, and no phos-
15918 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 21•MAY 21, 2010

Cryptosporidium TK
TABLE 3
CpTK activation of antimetabolites
Conditions used were 100 ␮M phosphoacceptor, 5 mM ATP. Activity is relative to
dT.
Compound
% Activity
TFT
130
5-I-dU
89
5-Cl-dU
5-Bromodeoxyuridine
AZT
110
84
60
FudR
120
12
D4T
␤-L-Thymidine
Acyclovir
AraC
Ͻ5
Ͻ1
Ͻ1
Ͻ1
Ͻ1
AraT
IDC
TABLE 4
CpTK activation of synthetic thymidine and cytidine analogs
Conditions used were 100 ␮M phosphoacceptor, 5 mM ATP. Activity is relative to
FIGURE 2. Determination of the CpTK oligomeric state using gel filtration
chromatography. Untagged CpTK elutes at a molecular mass of ϳ70 kDa,
consistent with being a trimer under the three conditions tested: enzyme
alone (diamonds), CpTK ϩ 100 ␮M dCTP (triangles), and CpTK ϩ 100 ␮M Thd ϩ
1mM ATP(squares). The elution volumes of the standards are as follow: blue
dextran, 96 ml; bovine ␥-globulin, 158 kDa, 107 ml; chicken ovalbumin, 44
kDa, 142 ml; equine myoglobin, 17 kDa, 180 ml; and vitamin B12, 1.35 kDa,
303 ml.
dT. na, not applicable.
TABLE 2
Substrate specificity of CpTK
Untagged CpTK was used for all assays.
Substrate (100 ␮M)
% Activity
Phosphate acceptorsa
dT
dU
dA
dG
dC
G
100
69
Ͻ1
Ͻ1
7
1
U
Ͻ1
Ͻ1
Ͻ1
Ͻ1
A
C
dTMP
Phosphate donorsb
ATP
dGTP
GTP
UTP
CTP
PPi
100
99
42
17
Ͻ1
Ͻ1
a For phosphate acceptors: spectrophotometric assay; all reactions contained 5 mM
ATP; activity is relative to 100 ␮M dT.
␤-L-Thymidine is a poor substrate; the value of kcat/Km for ␤-L-
b For phosphate donors: radioactive assay; all reactions contained 250 ␮M dT; activ-
ity is relative to 5 mM ATP.
thymidine is less than that of dT by a factor of 200, which
derives primarily from a decrease in the value of kcat
.
phorylation was observed for the other naturally occurring
Although AraC, AraT, and IDC are reported to display anti-
nucleosides or for dTMP (Table 2). CpTK utilizes a wide range cryptosporidial activity (15), none of these compounds are sub-
of NTPs as the phosphate donor, with the exception of CTP. strates for CpTK, nor do they inhibit the phosphorylation of dT.
The preference for phosphate donors is: ATP ϭ dGTP Ͼ Acyclovir also was not phosphorylated by CpTK, which can
GTP Ͼ UTP (Table 2). PPi cannot serve as the phosphate explain the resistance of C. parvum to this compound.
donor.
We screened a collection of pyrimidine nucleoside analogs to
Activation of Prodrugs and Other Nucleoside Analogs—The more thoroughly probe the specificity requirements of CpTK
specificity of CpTK was further evaluated by testing the ability (Table 4). In general, only modest substitutions of similar or
of antiviral and anticancer drugs to serve as substrates (Table 3). smaller size are tolerated in both the sugar and base compo-
TFT, FUdR, AZT, IUdR, ClUdR, and bromodeoxyuridine, all nents. A 2Ј-deoxy sugar is strongly preferred: the 2Ј position
close analogs of dT, are efficiently phosphorylated by CpTK cannot tolerate OH or F in ara configuration (AraT, KP296-8)
(Table 3). The Michaelis-Menten parameters for TFT, FUdR, and the 3Ј position can be N3 but not acetyl (KP1280). Few
and AZT are equivalent to those of dT (Table 1). D4T is a substitutions are allowed on the base. The 5 positions can tol-
moderately good substrate; the value of Km for D4T is equiva- erate hydrogen, fluorine, bromine, chlorine, iodine, and CF3, all
lent to that of dT, but the value of kcat is lower by a factor of 10. of which are of similar or smaller size compared with the CH3 of
MAY 21, 2010•VOLUME 285•NUMBER 21
JOURNAL OF BIOLOGICAL CHEMISTRY 15919

Cryptosporidium TK
requirements suggest that the
CpTK active site is very restrictive
and discriminating of phosphate
acceptors.
Effect of Prodrugs on C. parvum
Growth in the Cell Culture Model
of Infection—The antiparasitic
activities of AZT, TFT, and FUdR
were tested by infecting monolay-
ers of HCT-8 cells with C. parvum
oocysts. AZT is a poor inhibitor of
C. parvum growth with EC50 Ͼ 370
␮M, consistent with a previous
report (15) (supplemental Fig. S1).
Both TFT and FUdR showed potent
antiparasitic activity (Fig. 3, A and
B). TFT has an EC50 ϭ 410 nM,
somewhat better than a previous
report (EC50 ϭ 900 nM (15)). No
cytotoxicity was observed at 6.8 ␮M
TFT (Fig. 3C), similar to other stud-
ies (15, 30). FUdR has an EC50 ϭ 28
nM, and no cytotoxicity was
observed at 0.8 ␮M (Fig. 3D). In pre-
vious reports, FUdR inhibited the
proliferation of colon cancer cell
FIGURE 3. Effect of TFT and FUdR on parasite and host cell growth in a cell culture model of C. parvum
infection. A and B, C. parvum growth was assayed by high-content imaging. A, TFT; B, FUdR. C and D, host cell
cytotoxicity was assessed using the LIVE/DEADꢀ assay (Invitrogen). Data are representative of two indepen-
dent experiments. C, TFT; D, FUdR.
lines with values of EC50 ranging from 10 to 209 ␮M (30). These
observations suggest that sufficient therapeutic windows may
exist for both TFT and FUdR.
Effect of TFT on C. parvum Growth in a Mouse Model—To
determine whether thymidine analogs can compete effectively
with thymidine for uptake into C. parvum in the gastrointesti-
nal tract, TFT was tested in the IL-2 knock-out mouse model of
acute infection (26, 27). Paromomycin treatment (2000 mg/kg)
causes a Ͼ99% reduction in the oocysts recovered from feces in
this model system (p Ͻ 0.0001, Fig. 4). Similarly, TFT treatment
(200 mg/kg) caused a 95% reduction after 4 days of treatment
(p Ͻ 0.0006, Fig. 4). A significant decrease of parasite load (76%
inhibition, p Ͻ 0.02) was still observed with continued treat-
ment through day 7 (Fig. 4).
DISCUSSION
The anti-cryptosporidial activity of TFT, AraT, IUdR, IDC,
and AraC suggested that that CpTK might have the broad
specificity of a viral TK (15). However, the above experi-
ments demonstrate that CpTK has narrow substrate speci-
ficity for dT and dU and does not phosphorylate AraT, AraC,
and IDC. These observations suggest that Cryptosporidium
must possess another deoxynucleoside kinase. Two other
nucleoside kinases have been identified in the genome: adeno-
sine kinase and uridine kinase/uracil phosphoribosyl transfer-
FIGURE 4. Treatment with TFT in a IL-12 mouse model of C. parvum infec-
tion. Number of parasite oocysts in mouse feces 4 and 7 days postinfection
with treatment with phosphate-buffered saline (Mock), 200 mg/kg of TFT,
and 2000 mg/kg of paromomycin (Pm) is shown. ***, p Ͻ 0.0006; *, p Ͻ 0.02.
The bars denote the averages and S.E.
dT. At the 4 position replacement of the carbonyl group by ase (UK/UPRT). Although Cryptosporidium-adenosine kinase
N4-OH (KP1308, KP1309) removes activity. Surprisingly, and phosphorylates AraA (13), it appears to have strict specificity for
in contrast to dU, 2Ј-deoxypseudouridine (KP320) is not a sub- purine nucleosides (31). Curiously, CpUK/UPRT appears to
strate, but addition of a 1-methyl to give KP332 (an analog of have been obtained from a plant or algae (13). Little is known
dT) produces a good substrate, with kcat comparable with that about the substrate preferences of plant UK/UPRTs (32); per-
for dT and a 3-fold higher Km. Addition of CH3 to the 3 position haps CpUK/UPRT is responsible for the activation of these
of 2-deoxypseudouridine (KP333) abrogates activity. These prodrugs.
15920 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 21•MAY 21, 2010

Cryptosporidium TK
Surprisingly, AZT does not exhibit antiparasitic activity and thymidine phosphorylases (44), so it is possible that more
despite being an excellent substrate for CpTK. The phosphor- effective anticryptosporidial activity could be obtained with dif-
ylation of AZT-MP is rate-limiting in human cells (33); this ferent dosing. Alternatively, a thymidine phosphorylase inhib-
step may also be difficult in C. parvum. Failure to be converted itor could be used to increase drug stability (44–46). Impor-
to the triphosphate could account for the poor parasitic activity tantly, TAS-102, a combination of TFT and thymidine
of AZT. Intriguingly, D4T-MP is a good substrate for dTMP phosphorylase inhibitor, is currently in clinical trials for colon
kinase, suggesting that antiviral D4T (stavudine) may be an cancer (46).
effective anti-parasitic agent even though it is a relatively poor
The mechanistic basis for the parasite selectivity of TFT and
FUdR is unclear. Viral TKs, such as herpes simplex virus type 1
substrate for CpTK.
The presence of CpTK, together with the observation that TK, often have broader specificity than human TK1 and TK2
other gastrointestinal parasites do not require TS, raises impor- (14), which explains the antiviral properties of compounds such
tant questions about the effectiveness of targeting CpTS-DHFR as acyclovir. However, the specificity of CpTK is very similar to
for anticryptosporidial chemotherapy. Indeed, the abundance human TK1, and both TFT and FUdR are also good substrates
of thymidine in the gastrointestinal tract is reflected in the high for the human enzymes. Perhaps the salvage pathways are sim-
value of Km for dT for both the C. parvum and E. coli enzymes ply more efficient in the parasite than the host. The cytotoxicity
(Km ϭ 48 and 17 ␮M for CpTK and EcTK, respectively (21)), of both TFT and FUdR is attributed to the incorporation of the
suggesting that dT is abundant in the gastrointestinal tract. In corresponding triphosphates into DNA (47, 48). Therefore rap-
contrast, the value of Km ϭ 0.5 ␮M for human TK1 (34, 35) idly dividing cells are more sensitive to these compounds, so
reflects the low concentrations of dT in plasma (36).
antiparasitic activity could also reflect faster proliferation of the
Deoxynucleoside kinases form two superfamilies: the thymi- parasite.
dine kinase 1 (TK1)-like family and the thymidine kinase 2
TFT-MP and FUdR-MP have an additional mode of action:
(TK2)-like family, so named for their homology to human cyto- both inhibit TS (49, 50), which could further decrease the dTTP
solic TK1 (hTK1) and mitochondrial TK2 (hTK2), respectively pool, facilitating the incorporation of TFT-TP and FUdR-TP
(37). CpTK is a member of the TK1 family and is 62% identical into DNA. Intriguingly, Cryptosporidium TS-DHFR is more
to E. coli TK (EcTK) and 23% identical to hTK1. Narrow spec- active than human TS (51), suggesting that CpTS-DHFR could
ificity for phosphate acceptors, broad specificity for phosphate also be more sensitive to TFT-MP and FUdR-MP.
donors, and allosteric regulation by dCTP and dTTP observed
Cryptosporidium contains a plethora of transporters, many
for CpTK are typical of TK1s in general and most similar to of which are associated with drug resistance (6, 52). Although
EcTK, reflecting the bacterial origins of the parasite enzyme. the role of these transporters in drug action has yet to be eluci-
CpTK is notably different from hTK1 in two respects. First, dated, their mere presence suggests that drug accumulation
CpTK is allosterically regulated by dCTP and dCDP in addi- may be a significant obstacle in the development of chemother-
tion to dTTP. Similar allosteric regulation is observed in apy for cryptosporidiosis. Nucleoside prodrugs offer an appeal-
EcTK, which is regulated by a number of nucleoside di- and ing strategy to circumvent this problem. Because the parasite
triphosphates (21, 38). Second, CpTK is a trimer regardless relies on salvage pathways, Cryptosporidium must have effi-
of the presence of substrates or allosteric activator, whereas cient uptake systems for thymidine that will also uptake pro-
both hTK1 and EcTK are regulated via changes in oligomer- drugs such as TFT. The efficacy of TFT in the IL-2 knock-out
ization (39, 40). In this respect, CpTK is similar to Caenorh- mouse model demonstrates that the pyrimidine salvage path-
abditis elegans TK, another member of the TK1 family (41). ways can be subverted for treatment. Therefore nucleoside pro-
Importantly, CpTK displays very different functional prop- drugs offer a promising route to new anticryptosporidial drugs.
erties than hTK2, which has broad specificity for phosphate
acceptor and narrow specificity for phosphate donors char-
acteristic of the TK2 family (37, 42). These observations sug-
gest that it might be possible to develop selective inhibitors
of CpTK, although redundancy of the pyrimidine salvage
pathways argues against this strategy.
Acknowledgment—We acknowledge Nina McNair for technical
assistance.
REFERENCES
Although CpTK is not likely to be a drug target per se, our
results suggest that TK-activated prodrugs may provide an
effective strategy to treat cryptosporidiosis. Both TFT and
FUdR display selective antiparasitic effects in vitro; C. parvum
is at least 20-fold more sensitive to TFT and 400-fold more
sensitive to FUdR than host cells, which is comparable or better
than the therapeutic index of ribavirin (TI ϭ 2–30 (43)), so a
sufficient therapeutic window may exist for these compounds
despite their well known cytotoxicity. Moreover, TFT causes a
dramatic reduction in oocyst load in the IL-2 knock-out mouse
model of infection, demonstrating that the prodrug can com-
pete effectively in a thymidine-rich environment. TFT is rapidly
metabolized in both mice and humans by the action of uridine
1. Huang, D. B., and White, A. C. (2006) Gastroenterol. Clin. North Am. 35,
291–314, viii
2. Carey, C. M., Lee, H., and Trevors, J. T. (2004) Water Res. 38, 818–862
3. DuPont, H. L., Chappell, C. L., Sterling, C. R., Okhuysen, P. C., Rose, J. B.,
and Jakubowski, W. (1995) N. Engl. J. Med. 332, 855–859
4. Mead, J. R. (2002) Drug Resist. Updat. 5, 47–57
5. Abrahamsen, M. S., Templeton, T. J., Enomoto, S., Abrahante, J. E., Zhu,
G., Lancto, C. A., Deng, M., Liu, C., Widmer, G., Tzipori, S., Buck, G. A.,
Xu, P., Bankier, A. T., Dear, P. H., Konfortov, B. A., Spriggs, H. F., Iyer, L.,
Anantharaman, V., Aravind, L., and Kapur, V. (2004) Science 304,
441–445
6. Sauvage, V., Aubert, D., Escotte-Binet, S., and Villena, I. (2009) Mol. Bio-
chem. Parasitol. 167, 81–94
7. Martucci, W. E., Udier-Blagovic, M., Atreya, C., Babatunde, O., Vargo,
M. A., Jorgensen, W. L., and Anderson, K. S. (2009) Bioorg. Med. Chem.
MAY 21, 2010•VOLUME 285•NUMBER 21
JOURNAL OF BIOLOGICAL CHEMISTRY 15921

Cryptosporidium TK
Lett. 19, 418–423
26. Campbell, L. D., Stewart, J. N., and Mead, J. R. (2002) J. Parasitol. 88,
1014–1016
27. Ehigiator, H. N., Romagnoli, P., Borgelt, K., Fernandez, M., McNair, N.,
Secor, W. E., and Mead, J. R. (2005) Parasite Immunol. 27, 17–28
28. Arrowood, M. J., and Donaldson, K. (1996) J. Eukaryot. Microbiol. 43, 89S
29. Arrowood, M. J., Hurd, M. R., and Mead, J. R. (1995) J. Parasitol. 81,
404–409
30. de Bruin, M., van Capel, T., Van der Born, K., Kruyt, F. A., Fukushima, M.,
Hoekman, K., Pinedo, H. M., and Peters, G. J. (2003) Br. J. Cancer 88,
957–964
31. Galazka, J., Striepen, B., and Ullman, B. (2006) Mol. Biochem. Parasitol.
149, 223–230
8. Pelphrey, P. M., Popov, V. M., Joska, T. M., Beierlein, J. M., Bolstad, E. S.,
Fillingham, Y. A., Wright, D. L., and Anderson, A. C. (2007) J. Med. Chem.
50, 940–950
9. Va´squez, J. R., Gooze´, L., Kim, K., Gut, J., Petersen, C., and Nelson, R. G.
(1996) Mol. Biochem. Parasitol. 79, 153–165
10. Morrison, H. G., McArthur, A. G., Gillin, F. D., Aley, S. B., Adam, R. D.,
Olsen, G. J., Best, A. A., Cande, W. Z., Chen, F., Cipriano, M. J., Davids,
B. J., Dawson, S. C., Elmendorf, H. G., Hehl, A. B., Holder, M. E., Huse,
S. M., Kim, U. U., Lasek-Nesselquist, E., Manning, G., Nigam, A., Nixon,
J. E., Palm, D., Passamaneck, N. E., Prabhu, A., Reich, C. I., Reiner, D. S.,
Samuelson, J., Svard, S. G., and Sogin, M. L. (2007) Science 317, 1921–1926
11. Loftus, B., Anderson, I., Davies, R., Alsmark, U. C., Samuelson, J., Amedeo,
P., Roncaglia, P., Berriman, M., Hirt, R. P., Mann, B. J., Nozaki, T., Suh, B.,
Pop, M., Duchene, M., Ackers, J., Tannich, E., Leippe, M., Hofer, M.,
Bruchhaus, I., Willhoeft, U., Bhattacharya, A., Chillingworth, T.,
Churcher, C., Hance, Z., Harris, B., Harris, D., Jagels, K., Moule, S., Mun-
gall, K., Ormond, D., Squares, R., Whitehead, S., Quail, M. A., Rabbinow-
itsch, E., Norbertczak, H., Price, C., Wang, Z., Guille´n, N., Gilchrist, C.,
Stroup, S. E., Bhattacharya, S., Lohia, A., Foster, P. G., Sicheritz-Ponten, T.,
Weber, C., Singh, U., Mukherjee, C., El-Sayed, N. M., Petri, W. A., Jr.,
Clark, C. G., Embley, T. M., Barrell, B., Fraser, C. M., and Hall, N. (2005)
Nature 433, 865–868
32. Islam, M. R., Kim, H., Kang, S. W., Kim, J. S., Jeong, Y. M., Hwang, H. J.,
Lee, S. Y., Woo, J. C., and Kim, S. G. (2007) Plant Mol. Biol. 63, 465–477
33. Lavie, A., and Konrad, M. (2004) Mini. Rev. Med. Chem. 4, 351–359
34. Munch-Petersen, B., Cloos, L., Jensen, H. K., and Tyrsted, G. (1995) Adv.
Enzyme Regul. 35, 69–89
35. Birringer, M. S., Perozzo, R., Kut, E., Stillhart, C., Surber, W., Scapozza, L.,
and Folkers, G. (2006) Protein Expr. Purif. 47, 506–515
36. Shields, A. F., Coonrod, D. V., Quackenbush, R. C., and Crowley, J. J.
(1987) J. Nucl. Med. 28, 1435–1440
37. Arne´r, E. S., and Eriksson, S. (1995) Pharmacol. Ther. 67, 155–186
38. Okazaki, R., and Kornberg, A. (1964) J. Biol. Chem. 239, 275–284
39. Munch-Petersen, B., Tyrsted, G., and Cloos, L. (1993) J. Biol. Chem. 268,
15621–15625
12. Zhu, G. (2008) in Cryptosporidium and Cryptosporidiosis (Fayer, R., and
Xiao, L., eds) pp. 57–77, Second Ed., CRC Press, Boca Raton, FL
13. Striepen, B., Pruijssers, A. J., Huang, J., Li, C., Gubbels, M. J., Umejiego,
N. N., Hedstrom, L., and Kissinger, J. C. (2004) Proc. Natl. Acad. Sci. U.S.A.
101, 3154–3159
40. Iwatsuki, N., and Okazaki, R. (1967) J. Mol. Biol. 29, 139–154
41. Skovgaard, T., and Munch-Petersen, B. (2006) Nucleosides Nucleotides
Nucleic Acids 25, 1165–1169
14. Al-Madhoun, A. S., Tjarks, W., and Eriksson, S. (2004) Mini. Rev. Med.
Chem. 4, 341–350
42. Pe´rez-Pe´rez, M. J., Priego, E. M., Herna´ndez, A. I., Familiar, O., Camarasa,
M. J., Negri, A., Gago, F., and Balzarini, J. (2008) Med. Res. Rev. 28,
797–820
15. Woods, K. M., and Upton, S. J. (1998) FEMS Microbiol. Lett. 168, 59–63
16. Pankiewicz, K. W. (2000) Carbohydr. Res. 327, 87–105
17. Felczak, K., Miazga, A., Poznan´ski, J., Bretner, M., Kulikowski, T., Dzik,
J. M., Gołos, B., Zielin´ski, Z., Cies´la, J., and Rode, W. (2000) J. Med. Chem.
43, 4647–4656
43. Markland, W., McQuaid, T. J., Jain, J., and Kwong, A. D. (2000) Antimi-
crob. Agents Chemother. 44, 859–866
44. Fukushima, M., Suzuki, N., Emura, T., Yano, S., Kazuno, H., Tada, Y.,
Yamada, Y., and Asao, T. (2000) Biochem. Pharmacol. 59, 1227–1236
45. Emura, T., Suzuki, N., Fujioka, A., Ohshimo, H., and Fukushima, M. (2005)
Int. J. Oncol. 27, 449–455
18. Mudeppa, D. G., Pang, C. K., Tsuboi, T., Endo, Y., Buckner, F. S., Varani,
G., and Rathod, P. K. (2007) Mol. Biochem. Parasitol. 151, 216–219
19. Kokoris, M. S., and Black, M. E. (2002) Protein Sci. 11, 2267–2272
20. Tung, P. P., Respass, J., and Summers, W. C. (1996) Yale J. Biol. Med. 69,
495–503
46. Temmink, O. H., Emura, T., de Bruin, M., Fukushima, M., and Peters, G. J.
(2007) Cancer Sci. 98, 779–789
47. Emura, T., Nakagawa, F., Fujioka, A., Ohshimo, H., Yokogawa, T., Okabe,
H., and Kitazato, K. (2004) Int. J. Mol. Med. 13, 249–255
48. Yin, M. B., and Rustum, Y. M. (1991) Cancer Commun. 3, 45–51
49. Danenberg, P. V., and Lockshin, A. (1981) Pharmacol. Ther. 13, 69–90
50. Eckstein, J. W., Foster, P. G., Finer-Moore, J., Wataya, Y., and Santi, D. V.
(1994) Biochemistry 33, 15086–15094
21. Chen, M. S., and Prusoff, W. H. (1978) Methods Enzymol. 51, 354–360
22. Furlong, N. B. (1963) Anal. Biochem. 5, 515–522
23. Schelling, P., Folkers, G., and Scapozza, L. (2001) Anal. Biochem. 295,
82–87
24. Umejiego, N. N., Gollapalli, D., Sharling, L., Volftsun, A., Lu, J., Benjamin,
N. N., Stroupe, A. H., Riera, T. V., Striepen, B., and Hedstrom, L. (2008)
Chem. Biol. 15, 70–77
51. Atreya, C. E., and Anderson, K. S. (2004) J. Biol. Chem. 279, 18314–18322
52. Benitez, A. J., McNair, N., and Mead, J. (2007) Parasitol. Res. 101,
1611–1616
25. Cai, X., Woods, K. M., Upton, S. J., and Zhu, G. (2005) Antimicrob. Agents
Chemother. 49, 4437–4442
15922 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 21•MAY 21, 2010

Enzymology:
Prodrug Activation by Cryptosporidium
Thymidine Kinase
Xin E. Sun, Lisa Sharling, Mani Muthalagi,
Devaraja G. Mudeppa, Krzysztof W.
Pankiewicz, Krzysztof Felczak, Pradipsinh K.
Rathod, Jan Mead, Boris Striepen and Lizbeth
Hedstrom
J. Biol. Chem. 2010, 285:15916-15922.
doi: 10.1074/jbc.M110.101543 originally published online March 15, 2010
Access the most updated version of this article at doi: 10.1074/jbc.M110.101543
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
Supplemental material:
http://www.jbc.org/content/suppl/2010/03/15/M110.101543.DC1.html
This article cites 51 references, 10 of which can be accessed free at
http://www.jbc.org/content/285/21/15916.full.html#ref-list-1