Design, Synthesis, and Evaluation of 18F-Labeled Monoacylglycerol Lipase Inhibitors as Novel Positron Emission Tomography Probes

Article abstract of DOI:10.1021/acs.jmedchem.9b00936

Dysfunction of monoacylglycerol lipase (MAGL) is associated with several psychopathological disorders, including drug addiction and neurodegenerative diseases. Herein we design, synthesize, and evaluate several irreversible fluorine-containing MAGL inhibitors for positron emission tomography (PET) ligand development. Compound 6 (identified from a therapeutic agent) was advanced for ¹⁸F-labeling via a novel spirocyclic iodonium ylide (SCIDY) strategy, which demonstrated high brain permeability and excellent specific binding. This work supports further development of novel ¹⁸F-labeled MAGL PET probes.

Full text of DOI:10.1021/acs.jmedchem.9b00936

ORIGINAL RESEARCH
published: 27 August 2019
doi: 10.3389/fmicb.2019.02006
Gga-miR-19b-3p Inhibits Newcastle
Disease Virus Replication by
Suppressing Inflammatory Response
via Targeting RNF11 and ZMYND11
Yu Chen1, Wen Liu1, Haixu Xu1, Jingjing Liu1, Yonghuan Deng1, Hao Cheng1,
Tiansong Zhan1, Xiaolong Lu1, Tianxing Liao1, Lili Guo1, Shanshan Zhu1, Yuru Pei1,
Jiao Hu1,2, Zenglei Hu1, Xiaowen Liu1,2, Xiaoquan Wang1, Min Gu1,3, Shunlin Hu1 and
Xiufan Liu1,2,3
*
1 Animal Infectious Disease Laboratory, College of Veterinary Medicine, Yangzhou University, Yangzhou, China, 2 Jiangsu
Co-innovation Center for Prevention and Control of Important Animal Infections Diseases and Zoonoses, Yangzhou
University, Yangzhou, China, 3 Jiangsu Key Laboratory of Zoonosis, Yangzhou University, Yangzhou, China
Newcastle disease (ND), an acute and highly contagious avian disease caused by
virulent Newcastle disease virus (NDV), often results in severe economic losses
worldwide every year. Although it is clear that microRNAs (miRNAs) are implicated in
modulating innate immune response to invading microbial pathogens, their role in host
defense against NDV infection remains largely unknown. Our prior study indicates that
gga-miR-19b-3p is up-regulated in NDV-infected DF-1 cells (a chicken embryo fibroblast
cell line) and functions to suppress NDV replication. Here we report that overexpression
of gga-miR-19b-3p promoted the production of NDV-induced inflammatory cytokines
and suppressed NDV replication, whereas inhibition of endogenous gga-miR-19b-3p
expression had an opposite effect. Dual-luciferase and gene expression array analyses
revealed that gga-miR-19b-3p directly targets the mRNAs of ring finger protein 11
(RNF11) and zinc-finger protein, MYND-type containing 11 (ZMYND11), two negative
regulators of nuclear factor kappa B (NF-κB) signaling, in DF-1 cells. RNF11 and
ZMYND11 silencing by small interfering RNA (siRNA) induced NF-κB activity and
inflammatory cytokine production, and suppressed NDV replication; whereas ectopic
expression of these two proteins exhibited an opposite effect. Our study provides
evidence that gga-miR-19b-3p activates NF-κB signaling by targeting RNF11 and
ZMYND11, and that enhanced inflammatory cytokine production is likely responsible
for the suppression of NDV replication.
Edited by:
Declan C. Schroeder,
University of Minnesota, Twin Cities,
United States
Reviewed by:
Qingmei Xie,
South China Agricultural University,
China
Shijun Zheng,
China Agricultural University (CAU),
China
*Correspondence:
Xiufan Liu
xfliu@yzu.edu.cn
Specialty section:
This article was submitted to
Virology,
a section of the journal
Frontiers in Microbiology
Received: 23 May 2019
Accepted: 15 August 2019
Published: 27 August 2019
Citation:
Chen Y, Liu W, Xu H, Liu J,
Deng Y, Cheng H, Zhan T, Lu X,
Liao T, Guo L, Zhu S, Pei Y, Hu J,
Hu Z, Liu X, Wang X, Gu M, Hu S and
Liu X (2019) Gga-miR-19b-3p Inhibits
Newcastle Disease Virus Replication
by Suppressing Inflammatory
Response via Targeting RNF11
and ZMYND11.
Keywords: NDV, gga-miR-19b-3p, DF-1 cells, RNF11, ZMYND11, inflammatory cytokine, NF-κB signaling
INTRODUCTION
Newcastle disease virus (NDV) was first described in the early 1900s as the contagious agent of the
fatal avian disease known as chicken pest (Dimitrov et al., 2016, 2017). It is classified as an avian
paramyxovirus-1 (APMV-1) in the Avulavirus genus of the family Paramyxoviridae (Cheng et al.,
2016). The viral particles have a negative-sense, single-stranded RNA genome of about 15 kb that
Front. Microbiol. 10:2006.
doi: 10.3389/fmicb.2019.02006
Frontiers in Microbiology | www.frontiersin.org
1
August 2019 | Volume 10 | Article 2006

Chen et al.
Gga-miR-19b-3p Inhibits NDV Replication
contains six genes in the order of 30-NP-P-M-F-HN-L-50,
encoding six proteins: nucleoprotein (NP), phosphor protein
(P), matrix protein (M), fusion protein (F), hemagglutinin-
neuraminidase (HN), and large protein (L), respectively. As one
of the most devastating pathogens for poultry industry, NDV
has a wide host range and can naturally or experimentally
infect more than 250 bird species (Ganar et al., 2014). Although
all NDV isolates belong to a single serotype, they have a
high genetic diversity and evolve rapidly. According to recent
epidemiological investigations, sub-genotype VIId has become
the dominant genotype in many Asian and African countries
since the late 1990s (Qin et al., 2008; Wu et al., 2011;
Munir et al., 2012). Currently, vaccination is the main way
to prevent and control NDV prevalence. However, due to the
wide range of host and high genetic diversity, the failure of
Newcastle disease (ND) vaccine immunization and reduction of
vaccine efficiency often occur in cultivation industry worldwide
(Miller et al., 2009, 2013).
During NDV infection, a variety of the host pattern
recognition receptors (PRRs) are activated such as toll-like
receptor 3 (TLR-3) (Cheng et al., 2014), retinoic-acidinducible
gene I (RIG-I) (Kato et al., 2006; Sun et al., 2013), melanoma
differentiation associated gene 5 (MDA5) (Rue et al., 2011),
and protein kinase R (PKR) (Liao et al., 2016) by recognizing
virus double-stranded RNA. These PRRs subsequently activate
downstream transcription factors such as interferon regulatory
factor 7 (IRF7) (Wang et al., 2014) and NF-κB (Rajmani
et al., 2016), leading to inflammatory cytokine production.
For NF-κB activation, PRRs initiate a signaling cascade
resulting in the IκB kinase (IKK) phosphorylation, which
subsequently phosphorylates and ubiquitinates IκB-α bound
to NF-κB in resting cells, and results in IκB-α proteasomal
degradation, thereby allowing NF-κB nuclear translocation
to transcriptionally activate its gene targets (Woronicz
et al., 1997). However, to maintain cellular homeostasis,
activation of NF-κB signaling pathway is tightly controlled
with multiple tiers of regulation (Ruland, 2011), such as
RNF11 (Shembade et al., 2009; Dalal et al., 2012; Pranski
et al., 2012) and ZMYND11 (Ikeda et al., 2009, 2010). These
two proteins negatively regulate NK-κB activity and greatly
impact the replication of certain viruses such as Hendra
virus (HeV) (Stewart et al., 2013), Japanese encephalitis virus
(JEV) (Ashraf et al., 2016), and Epstein-Barr virus (EBV)
(Ikeda et al., 2009).
(Ingle et al., 2015). In contrast, NDV infection down-regulates
gga-miR-203a expression in chicken embryos, overexpression
of gga-miR-203a effectively increases NDV replication both
in vivo and in vitro via targeting transglutaminase 2 (TGM2)
(Jia et al., 2018). Up-regulated gga-miR-375 in NDV-infected
DF-1 cells suppresses NDV replication via targeting viral
M
gene or cellular embryonic lethal, abnormal vision,
Drosophila-like RNA binding protein (ELAVL4) gene
4
(Wang et al., 2019). These observations collectively suggest that
miRNAs play a critical role in NDV infection and replication.
Identification of host-dysregulated miRNAs and understanding
of their roles in virus replication may shed light on NDV
pathogenesis and provide better strategies for the control
of NDV infection.
Our present study focuses on the effect of gga-miR-19b-3p
on NDV replication and the underlying molecular mechanisms.
Here we report that RNF11 and ZMYND11 are two targets of
gga-miR-19b-3p in DF-1 cells, and that up-regulation of gga-
miR-19b-3p and the subsequent down-regulation of RNF11 and
ZMYND11 expression enhance NDV-induced NF-κB activation,
leading to increased inflammatory cytokine production and
suppression of virus replication. Data presented herein improve
our understanding of the role of host miRNAs in regulating
NDV replication.
MATERIALS AND METHODS
Cells and Viruses
DF-1 cells obtained from ATCC (CRL-12203) were cultured
in Dulbecco’s modified Eagle’s medium (DMEM) (Life
Technologies, United States) supplemented with 10% fetal
bovine serum (FBS) (Life Technologies, United States),
100 U/mL penicillin and 100 µg/mL streptomycin at
37◦C under 5% CO2 atmosphere. Velogenic genotype
VII NDV strain JS5/05 (Accession Number: JN631747)
was propagated in chicken embryos and the biological
characteristics of the virus were determined previously (Hu
et al., 2011). Velogenic genotype IV Herts/33 (Accession
Number: AY741404) was obtained from Dr. D. J. Alexander
(Animal Health and Veterinary Laboratories Agency,
United Kingdom) and avirulent genotype II NDV strain
La Sota (Accession Number: AF077761) was isolated and
maintained in our laboratory.
miRNAs are small non-coding RNAs that are usually
composed of 21–23 nucleotides. miRNAs negatively regulate
the expression of half protein-coding genes involving in cell
growth, proliferation, apoptosis, and signal transduction through
post-transcriptional mechanisms (Bartel, 2004). Accumulating
evidence suggests that virus infection profoundly impacts
miRNA expression, and that altered miRNA expression can
enhance or suppress anti-viral responses (Trobaugh and
Klimstra, 2017). Recent studies have shown that NDV infection
alters the levels of several miRNAs. For example, NDV infection
induces hsa-miR-485 expression in human embryonic kidney
(HEK) 293T cells, which in turn suppresses antiviral response
and enhances NDV replication by targeting RIG-I mRNA
MiRNA Mimic and Inhibitor
Gga-miR-19b-3p mimic was chemically modified double-
stranded oligonucleotides for overexpression of gga-miR-19b-3p
and
gga-miR-19b-3p
inhibitor
was
single-stranded
oligonucleotides for inhibition of gga-miR-19b-3p. All
RNA oligonucleotides were designed and synthesized by
GenePharma, China. For miRNA transfection, DF-1 cells were
transfected with gga-miR-19b-3p mimic and inhibitor and
mimic negative control (mimic-NC) and inhibitor negative
control (inh-NC) at a final concentration of 100 nM using EL
Transfection Reagent (Transgen Biotech, China) following the
manufacturer’s instructions.
Frontiers in Microbiology | www.frontiersin.org
2
August 2019 | Volume 10 | Article 2006

Chen et al.
Gga-miR-19b-3p Inhibits NDV Replication
Mutagenesis System kit (Transgen Biotech, China) according
to manufacturer’s instructions. The coding sequences of RNF11
(Accession No. NM001006540) and ZMYND11 (Accession
No. XM025148320) were amplified and subsequently cloned
into pCMV-blank overexpression vector (Beyotime, China) to
generate pCMV-RNF11 and pCMV-ZMYND11 plasmids. All
the primers for plasmids construction (shown in Table 2) were
synthesized by Sangon Company, China. All the fragments were
amplified by PCR using TransStart Fast Pfu Fly DNA Polymerase
(Transgen Biotech, China).
Knockdown of RNF11 and ZMYND11
siRNAs (double-stranded RNA oligonucleotides) (Genepharma,
China) were used to knockdown the expressions of RNF11 and
ZMYND11 in DF-1 cells and the sequences were shown in
Table 1. siRNA duplexes were transfected into DF-1 cells at a
final concentration of 50 nM using EL Transfection Reagent
(Transgen Biotech, China). The interference efficiency was
detected by qRT-PCR and Western blot as described below.
Determination of Viral Titers
DF-1 cells (2 × 105 cells/mL) were seeded on 12-well plates
and cultured for 24 h before transfection with indicated RNA
oligonucleotides or plasmids. Eighteen hours after transfection,
miRNA Target Prediction and
Dual-Luciferase Reporter Gene Assays
DF-1 cells were infected with JS5/05 strain at a multiplicity Gga-miR-19b-3p targets in host cells were predicted by two
of infection (MOI) of 0.1. The culture supernatants were online softwares: TargetScan1 and miRDB2. GO Ontology
collected and replaced with an equal volume of fresh media (GO) analysis was conducted to screen the genes on the
at different time points (12, 24, 36, 48, and 60 h) after Database for Annotation, Visualization and Integrated
infection. The viral contents in the supernatants were quantified Discovery (DAVID) platform. Luciferase activity was measured
by 50% tissue culture infective doses (TCID50) on DF-1 cells using Dual-GLOꢀR Luciferase Assay System Kits (Promega,
(Reed and Muench, 1938).
United States) following the manufacturer’s instructions. For
targets verification, DF-1 cells were seeded on 24-well plates
with a density of 1 × 105 cells/mL per well. After 24 h, the
cells were co-transfected with indicated plasmids and RNA
oligonucleotides using EL Transfection Reagent. Forty-eight
hours after transfection, luciferase assays were performed with
a Fluorescence/Multi-Detection Microplate Reader (Biotek,
United States). Renilla luciferase activities were normalized
on the basis of firefly luciferase activities. For the detection of
promoter activity, DF-1 cells were transfected with pGL-6 or
pGL-6-miR-19b-3p plasmid using EL Transfection Reagent.
To normalize transfection efficiency, pRL-TK renilla luciferase
reporter plasmid (Promega, United States) was also transfected
into the cells as an internal control. Then the cells were infected
with JS 5/05 at different MOIs at 48h post transfection. Twelve
hours post infection (hpi), the dual-luciferase activity was
detected and firefly luciferase activities were normalized to
Plasmids Construction
DNA sequences of gga-miR-19b-3p promoter were cloned from
genomic DNA of DF-1 cells using specific primers and sub-
cloned into KpnI/XhoI restriction sites in the pGL-6 reporter
vector (Beyotime, China) to generate the pGL-6-miR-19b-3p
reporter vector. Target sequences of gga-miR-19b-3p in RNF11
and ZMYND11 were amplified by polymerase chain reaction
(PCR) using a cDNA template synthesized from total RNA of DF-
1 cells. Subsequently, both PCR products were sub-cloned into
XhoI/NotI restriction sites in the pmiR-RB-reporterTM vector
(Ribobio, China), which can express firefly luciferase and renilla
luciferase in one plasmid, to generate pmiR-RNF11-30UTR-
wild and pmiR-ZMYND11-30UTR-wild plasmids. To generate
gga-miR-19b-3p target-mutated reporter vector, pmiR-RNF11-
30UTR-mut and pmiR-ZMYND11-30UTR-mut were achieved by
changing the gga-miR-19b-3p binding seed sequences using Fast
1http://www.targetscan.org/
2http://www.mirdb.org/
TABLE 1 | siRNA sequences.
siRNAs
Sense (50-30)
Anti-sense (50-30)
TABLE 2 | Primers used for plasmids construction.
SiRNA-
ZMYND
11-1
GCACAUACCUGCGGUUCAUTT AUGAACCGCAGGUAUGUGCTT
GCUAUCCUUGUAUACCUAATT UUAGGUAUACAAGGAUAGCTT
GCUGUUGAUGUUCCUACUATT UAGUAGGAACAUCAACAGCTT
Gene
Forward primers (50-30)
Reverse primer (50-30)
19b-3p
promoter
GGTACCGCCGGGAGG
GTCTGCC
CTCGAGTTCAATTTAAC
AACAAATTGCAAA
SiRNA-
ZMYND
11-2
RNF11-
30UTR-wild
CTCGAGGCCAGGGTTTCTC
CGTGAAC
GCGGCCGCCAAGAGATG
CGGTATCCTTTGC
SiRNA-
ZMYND
11-3
ZMYND11-
30UTR-wild
CTCGAGGAGCCATTCCTCCG
CTAGAACA
GCGGCCGCCTCGGTCTA
AGACCAGCCTCTG
RNF11-
30UTR-mut
ATAGTTTTAAGCTTGTGCAC
GTAGTTCTTTT
ACGTGCACAAGCTTAAAAC
TATTTCTTTGT
SiRNA-
GCCAGAAAUUAGGAAUUAATT
UUAAUUCCUAAUUUCUGGCTT
RNF11-1
ZMYND11-
30UTR-mut
TTCCCATTAAGGTGCAGCCT
TTAAACA
GCACCTTAATGGGAAGC
AAATTCTAAACA
SiRNA-
RNF11-2
CCUACCGAAGGGAGUCUAUTT AUAGACUCCCUUCGGUAGGTT
CCACCUGGACUGUAUAGAUTT AUCUAUACAGUCCAGGUGGTT
RNF11
CDS
ACTAGTATGGGGAACTGCCTC
AAGTCC
GGGCCCTCAGTTAGTCTCG
TATGATGAAAG
SiRNA-
RNF11-3
ZMYND11
CDS
ACTAGTATGGCACGCTTA
ACGAAGAGACG
GGGCCCTCATCTTTTTCTG
CGGCAGGTACG
SiRNA-NC UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
Frontiers in Microbiology | www.frontiersin.org
3
August 2019 | Volume 10 | Article 2006

Chen et al.
Gga-miR-19b-3p Inhibits NDV Replication
TABLE 3 | Primers used for qRT-PCR.
renilla luciferase activities. To measure the activity of NF-κB,
pNF-κB-luc (Beyotime, China) plasmid and indicated siRNAs
or plasmids were transfected into DF-1 cells together with the
internal control plasmid pRL-TK (Promega, United States).
Eighteen hours after transfection, the cells were infected with
JS 5/05 strain at an MOI of 0.1 and dual-luciferase assays were
performed as described above at 18 hpi.
Gene
Forward primers (50-30)
Reverse primer (50-30)
gga-miR-
19b-3p
AGTGTGCAAATCCATGCAA
GGTCCAGTTTTTTTTTTTT
TTTCAGT
IFN-β
TGCACAGCATCCTACTG
CTCTTG
GTTGGCATCCTGGTGACGAA
TNF-α
IL-1β
IL-6
GGACAGCCTATGCCAACAAG
ACCCGCTTCATCTTCTACCG
GGCATTCTCATTTCCTTCT
CCAAGCACACCTCTCTTCCA
ACACGACAGCCAAGTCAACG
TCAGCGCCCACTTAGCTT
CTGGCTGCTGGACATTTT
GCAAGGTAGGACGCTGGTAA
miRNA and Total RNA Extraction and
Quantitative Real-Time PCR (qRT-PCR)
Analysis
IL-8
IκB-α
CTGGACTCCATGAAGGA
GGAGG
TCGTGAATGATCGCCA
AGTGGAG
To measure the dynamic expression pattern of gga-miR-19b-3p
after NDV infection, DF-1 cells seeded in 12-well plates were
infected with JS5/05 strain at different MOIs for 12 h and then
miRNAs were extracted using a miRNA Extraction Kit according
to manufacturer’s instructions. cDNA synthesis was carried out
with a tagged polyT primer according to the protocol of One
Step miRNA cDNA Synthesis Kit. Quantification of gga-miR-
19b-3p was performed by HG miRNA SYBR Green PCR Kit with
a pair of specific primers. Gga-miR-19b-3p expression level was
normalized to 5s rRNA levels using the 2−1 1 Ct model. All kits
used for miRNA extraction, cDNA synthesis and qRT-PCR were
purchased from HaiGene Corporation, China.
For the detection of inflammatory cytokines and IκB-α, DF-
1 cells were transfected with indicated RNA oligonucleotides
for 18 h before infected with JS 5/05 at an MOI of
0.1. Then the total RNAs were extracted from the cells at
18 hpi using TRIzol (TransGen Biotech, China) following the
manufacturer’s instructions. The cDNA synthesis and qRT-PCR
reaction were performed using TransScript Green One-Step qRT-
PCR Super Mix (TransGen Biotech, China) according to the
manufacturer’s instructions. To detect RNF11 and ZMYND11
mRNA expression levels, DF-1 cells were transfected with
indicated RNA oligonucleotides or infected with JS 5/05 or
Herts/33 or La Sota strain at an MOI of 0.1. Eighteen hours
post transfection or infection, qRT-PCR were performed as
described above using RNF11 and ZMYND11 specific primers.
The relative expressions of inflammatory cytokines, IκB-α,
RNF11, and ZMYND11 were all normalized with glyceraldehyde
phosphate dehydrogenase (GAPDH) and calculated using the
2−11CT method. All qRT-PCR experiments were preformed in
LightCycler 480 (Roche, Switzerland) and primers used were
shown in Table 3.
RNF11
GCCTTGACCCACCATTGTCTTT CCTTGACCCAAATGCCAGGAC
ZMYND11 GGCGATCCAACATCTTTGGGC GCCTTTGACCCTTTACACCCCA
5s RNA
AACGCCCGATCTCGTCTGAT
AGTCTCCCATCCAAGTA
CTAACCG
GAPDH
GAGGGTAGTGAAGGCTGCTG
CACAACACGGTTGCTGTATC
For the detection of phosphorylation of IκB-α protein,
DF-1 cells seeded on 12-well plates were transfection with
indicated RNA oligonucleotides or plasmids for 18 h. Then the
cells were infected with JS5/05 strain at an MOI of 0.1 for
18 h. The phosphorylation of IκB-α protein was measured by
ELISA kit (SbjBio, China, cat. no. SBJ-C134) according to the
manufacturer’s instructions.
Western Blot Analysis
To measure the expression levels of RNF11 and ZMYND11
proteins, DF-1 cells were transfected with indicated RNA
oligonucleotides or plasmids or infected with different NDV
strains at an MOI of 0.1. Eighteen hours post transfection,
the cells were lysed and 20 µg protein samples of each group
were used for electrophoresis on 12% sodium dodecylsulfate-
polyacrylamide gel electrophoresis (SDS-PAGE) gels, and
resolved proteins were transferred onto polyvinylidene
difluoride (PVDF) membranes using electro-transfer (Bio-
Rad, United States). After blocking with 5% skimmed milk
for 1 h at room temperature, the membranes were incubated
with the appropriate primary antibodies, including rabbit
polyclonal anti-RNF11 (LSBio, United States), rabbit polyclonal
anti-ZMYND11 (LSBio, United States) and mouse monoclonal
anti-β-actin (Transgene, China) followed by incubation
with goat anti-rabbit and goat anti-mouse HRP-conjugated
secondary antibodies (Beyotime, China). The proteins on the
membranes were detected using an ECLTM detection system
(Bio-Rad, United States).
Enzyme-Linked Immunosorbent Assay
(ELISA)
To measure the translocation of NF-κB from the cytoplasm
DF-1 cells in 6-well plates were transfected with indicated RNA to the nucleus, DF-1 cells transfected with indicated RNA
oligonucleotides or plasmids and were incubated for 18 h and oligonucleotides or plasmids were infected with JS 5/05 at an
then either left uninfected or infected with JS 5/05 at an MOI of MOI of 0.1 for 18 h. Then cytoplasmic and nuclear proteins
0.1 for 18 h. The protein levels of IFN-β, TNF-α, IL-1β, IL-6, and of the cells were prepared using nuclear and cytoplasmic
IL-8 in cell cultures were determined by ELISA kits according to protein extraction kit (Beyotime, China) according to the
the manufacturer’s instructions. The IFN-β (cat. no. CH50022), manufacturer’s instructions. Western blot assays were performed
TNF-α (cat. no. CH50032), IL-1β (cat. no. CH50020), IL-6 (cat. as described above using NF-kB p65 rabbit monoclonal antibody
no. CH50016), and IL-8 ELISA kits (cat. no. CH50027) were (Beyotime, China). Monoclonal rabbit anti-tubulin β and anti-
purchased from Bio-Swamp, China.
histone H3 antibody (Beyotime, China) were used as control
Frontiers in Microbiology | www.frontiersin.org
4
August 2019 | Volume 10 | Article 2006

Chen et al.
Gga-miR-19b-3p Inhibits NDV Replication
of cytoplasmic and nuclear proteins, respectively. The relative
protein quantification was analyzed by Image J software
(Bethesda, United States).
RESULTS
Gga-miR-19b-3p Is Upregulated During
NDV Infection and Inhibits NDV
Replication in DF-1 Cells
Statistical Analysis
We first conducted qRT-PCR to determine if NDV infection
regulated gga-miR-19b-3p expression in DF-1 cells. As shown
in Figure 1A, gga-miR-19b-3p was up-regulated in NDV-
infected DF-1 cells in a dose-dependent manner. Consistently,
NDV infection also increased the gga-miR-19b-3p promoter-
driven luciferase reporter gene expression in a dose-dependent
manner (Figure 1B).
All data are the averages of triplicates and are representative
of results from at least three independent experiments. The
statistical analysis were analyzed using one-way analysis of
variance (ANOVA) following Bonferroni’s multiple comparison
tests for TCID50, miRNA, Western blot and mRNA detections
and two-way ANOVA using a Bonferroni’s multiple comparison
tests for viral growth curve using GraphPad Prism 5 (GraphPad
Software, San Diego, United States). P < 0.05 was considered as a
significant difference.
We next evaluated the effect of gga-miR-19b-3p on NDV
replication. DF-1 cells were transfected with gga-miR-19b-3p
FIGURE 1 | Newcastle disease virus-induced gga-miR-19b-3p inhibits NDV replication in DF-1 cells. (A) DF-1 cells were infected with JS 5/05 strain at indicated
MOIs for 12 h, and then the expression of gga-miR-19b-3p was detected by qRT-PCR. (B) The pGL-6-miR-19b-3p or pGL-6 plasmid was transfected into DF-1
cells together with pRL-TK renilla luciferase reporter plasmid as an internal control. Forty-eight hours post transfection, the cells were infected with JS 5/05 strain at
different MOIs for 12 h, and then the dual-luciferase activity was detected and firefly luciferase activities were normalized to firefly renilla luciferase activities. (C,D)
DF-1 cells were transfected with gga-miR-19b-3p mimic or inhibitor or mimic-NC or inh-NC at a final concentration of 100 nM or left untreated. The gga-miR-19b-3p
expression was measured by qRT-PCR at 18 h post transfection (C). Eighteen hours after transfection, DF-1 cells were infected with JS5/05 strain at an MOI of 0.1.
The viral road in the supernatants collected at different time points were quantified by TCID50 on DF-1 cells (D). Results are representative of three independent
experiments and presented as means ± SD. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
Frontiers in Microbiology | www.frontiersin.org
5
August 2019 | Volume 10 | Article 2006

Chen et al.
Gga-miR-19b-3p Inhibits NDV Replication
FIGURE 2 | Gga-miR-19b-3p promotes NDV-induced expression of inflammatory cytokines. DF-1 cells were transfected with indicated RNA oligonucleotides at a
final concentration of 100 nM for 18 h or left untreated before infected with JS 5/05 at an MOI of 0.1. The expression levels of IFN-β, TNF-α, IL-1β, IL-6, and IL-8
were measured by qRT-PCR (A) and ELISA (B) at 18 hpi. Results are representative of three independent experiments and presented as means ± SD. ∗p < 0.05,
∗∗p < 0.01, ∗∗∗p < 0.001.
FIGURE 3 | Gga-miR-19b-3p directly targets RNF11 and ZMYND11 in DF-1 cells. DF-1 cells were transfected with indicated RNA oligonucleotides at a final
concentration of 100 nM for 18 h. Then the expression of RNF11 and ZMYND11 were detected by Western blot (A,C) and qRT-PCR (B,D) assays. The relative levels
of RNF11 and ZMYND11 proteins were calculated as follows: band density of RNF11 or ZMYND11/band density of β-actin in the same sample and showed in the
below of (A,C). Diagram of the predicted target sites for gga-miR-19b-3p in RNF11 and ZMYND11 were shown in (E). DF-1 cells were co-transfected with indicated
RNA oligonucleotides and wild type (F) or mutant luciferase reporter gene vectors (G) before luciferase reporter gene assay was performed. The relative level of
renilla luciferase activities was calculated normalized on the basis of firefly luciferase activities. Data are representative of three independent experiments and
presented as means ± SD. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
Frontiers in Microbiology | www.frontiersin.org
6
August 2019 | Volume 10 | Article 2006

Chen et al.
Gga-miR-19b-3p Inhibits NDV Replication
mimic or its inhibitor, followed by infection with NDV (JS both mRNA and protein levels of IFN-β, TNF-α, IL-1β, IL-6,
5/05 strain, 0.1 MOI). As shown in Figure 1C, gga-miR-19b- and IL-8 in NDV-infected DF-1 cells. In contrast, gga-miR-19b-
3p mimic increased gga-miR-19b-3p expression about 1000-fold 3p inhibitor significantly decreased the levels of IFN-β, TNF-α,
in DF-1 cells, whereas gga-miR-19b-3p antagonist decreased its IL-1β, IL-6, and IL-8 mRNA and protein.
expression by >70%. Overexpression of gga-miR-19b-3p mimic
significantly suppressed NDV replication, whereas gga-miR-19b-
3p inhibitor increased NDV replication (Figure 1D).
Gga-miR-19b-3p Directly Targets RNF11
and ZMYND11 in DF-1 Cells
We then investigated the targets of gga-miR-19b-3p that might
be involved in regulating NDV-induced inflammatory cytokine
production. A total of 571 and 547 targets were predicted by
TargetScan and miRDB, respectively. Two hundred and twenty-
Gga-miR-19b-3p Positively Regulates
NDV-Induced Expression of
Inflammatory Cytokines
We next determined if gga-miR-19b-3p affected virus replication one common target genes were used to do GO analysis on
by regulating the inflammatory cytokine production. As shown the DAVID platform. After enrichment by GO analysis, we
in Figures 2A,B, gga-miR-19b-3p mimic significantly increased found that two potential target genes RNF11 and ZMYND11were
FIGURE 4 | Newcastle disease virus infection inhibits the expressions of RNF11 and ZMYND11. DF-1 cells were infected with different NDV strains (JS 5/05,
Herts/33, and La Sota) at an MOI of 0.1 for 18 h. The expressions of RNF11 and ZMYND11 were detected by Western blot (A,C) and qRT-PCR (B,D) assays. The
relative levels of RNF11 and ZMYND11 proteins were calculated as described above and showed in the below of (A,C). Data are representative of three independent
experiments and presented as means ± SD. ∗p < 0.05, ∗∗p < 0.01.
Frontiers in Microbiology | www.frontiersin.org
7
August 2019 | Volume 10 | Article 2006

Chen et al.
Gga-miR-19b-3p Inhibits NDV Replication
clustered on immune system process. Moreover, both of them
were reported as negatively regulators of NK-κB activity. Finally,
RNF11 and ZMYND11 were screened for validation given the
GO analysis results and previous study.
NDV Infection Inhibits the Expressions of
RNF11 and ZMYND11
Given that gga-miR-19b-3p directly targeted RNF11 and
ZMYND11 mRNAs, we tested if NDV infection indeed affected
the expression of these two proteins. qRT-PCR and Western
blot revealed that the protein and mRNA levels of RNF11
(Figures 4A,B) and ZMYND11 (Figures 4C,D) were significantly
down-regulated in DF-1 cells infected with three different NDV
strains, including JS 5/05, Herts/33 and La Sota.
To examine whether gga-miR-19b-3p directly targets RNF11
and ZMYND11, We first detected whether gga-miR-19b-
3p regulates the RNF11 and ZMYND11 expression. qRT-
PCR and Western blot revealed that transfection of DF-1
cells with gga-miR-19b-3p mimic led to decreased RNF11
(Figures 3A,B) and ZMYND11 (Figures 3C,D) expression at
both protein and mRNA levels, compared to that transfected
with mimic-NC or inh-NC. We then constructed luciferase
reporter plasmids containing the wild-type or mutant 30-
UTR of the RNF11 and ZMYND11 genes. Predicted target
sequences for gga-miR-19b-3p in the 30-UTR of RNF11 and
ZMYND11 are illustrated in Figure 3E. DF-1 cells were co-
transfected with indicated RNA oligonucleotides plus wild-
type or mutated-type luciferase reporter plasmids. Forty
eight hours after transfection, dual-luciferase reporter assays
were performed. gga-miR-19b-3p mimic significantly decreased
the ratio of Renilla/Firefly in pmiR-RNF11-30UTR-wild and
pmiR-ZMYND11-30UTR-wild transfected DF-1 cells, but not
in pmiR-RNF11-30UTR-mut and pmiR-ZMYND11-30UTR-mut
cells (Figures 3F,G). As expected, inhibition of gga-miR-19b-
3p exhibited a significant promotion of the luciferase radio
in pmiR-RNF11-30UTR-wild and pmiR-ZMYND11-30UTR-wild
DF-1 cells, whereas no changes in pmiR-RNF11-30UTR-
mut and pmiR-ZMYND11-30UTR-mut cells (Figures 3F,G).
Combined with these results, we demonstrated that RNF11
and ZMYND11 are directly targeted by gga-miR-19b-3p in
DF-1 cells.
RNF11 and ZMYND11 Modulate NDV
Replication via Suppressing
NDV-Induced Inflammatory Cytokines
We next determined if RNF11 and ZMYND11 indeed regulated
inflammatory production and virus replication. Firstly, we
detected the interference and overexpression efficiency of
siRNAs and overexpression plasmids by Western blot and
qRT-PCR assays. As shown in Figures 5A–D, the levels of
RNF11 or ZMYND11 were increased by 4.5 or 7-fold in DF-1
cells transfected with pCMV-RNF11 and pCMV-ZMYND11,
respectively. siRNA-RNF11-2 (hereafter called siRNA-RNF11)
and siRNA-ZMYND11-3 (hereafter called siRNA-ZMYND11)
down-regulated the expression of ZMYND and RNF11
by about 70%. RNF11 or ZMYND11 knockdown in DF-1
cells markedly enhanced the expressions of NDV-induced
inflammatory cytokines and suppressed NDV replication,
whereas RNF11 or ZMYND11 overexpression blocked NDV-
induced inflammatory cytokine expression and promoted
NDV replication (Figures 5E–G). Simultaneous knockdown
or overexpression of these two proteins showed synergistic
FIGURE 5 | RNF11 and ZMYND11 inhibit NDV-induced inflammatory cytokines and promote NDV replication in DF-1 cells. DF-1 cells were transfected with
indicated siRNAs or siRNA-NC or overexpression plasmids or pCMV-blank. The efficiencies of interference and overexpression in transfected DF-1 cells were
measured by Western blot (A,C) and qRT-PCR (B,D) at 18 h post transfection. DF-1 cells transfected with indicated siRNAs or siRNA-NC or overexpression
plasmids or pCMV-blank or left untreated were infected with JS 5/05 at an MOI of 0.1 for 18 h. The expression levels of IFN-β, TNF-α, IL-1β, IL-6, and IL-8 were
measured by ELISA assay (E,F). DF-1 cells transfected with indicated siRNAs or siRNA-NC or overexpression plasmids or pCMV-blank were infected with JS 5/05
at an MOI of 0.1. After 36 h, viral titers in infected DF-1 cells were measured by TCID50 as described above (G). Data are representative of three independent
experiments and presented as means ± SD. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
Frontiers in Microbiology | www.frontiersin.org
8
August 2019 | Volume 10 | Article 2006

Chen et al.
Gga-miR-19b-3p Inhibits NDV Replication
effects on viral replication. However, overexpression of NF-κB activity, while overexpression of them had completely
ZMYND11 and knockdown of RNF-11, or overexpression opposite effects (Figure 6A). For further understand the
of RNF-11 and knockdown of ZMYND11 showed no effect on underlying mechanism of the suppression effect on NF-κB
viral replication.
activity by RNF11 and ZMYND11, we then detected the
changes of p-IκB-α, IκB-α, and p65 nuclear translocation in
siRNAs or overexpression plasmids transfected DF-1 cells after
NDV infection. As shown in Figures 6B,C, knockdown of
RNF11 or ZMYND11 in DF-1 cells significantly promoted
RNF11 and ZMYND11 Suppress NF-κB
Activity
Previous studies demonstrated that RNF11 and ZMYND11 p-IκB-α expression and inhibited IκB-α expression, while
negatively regulate the NF-κB signaling pathway in human overexpression of them had completely opposite effects.
cell lines (Ikeda et al., 2010; Dalal et al., 2012). In order to Similarly, simultaneous knockdown or overexpression of these
explore the mechanism by which RNF11 and ZMYND11 two proteins also showed synergistic effects on NF-κB activity,
suppress NDV-induced inflammatory cytokines, we detected p-IκB-α and IκB-α expression. However, overexpression of
NF-κB activity in siRNAs or overexpression plasmids ZMYND11 and knockdown of RNF-11, or overexpression of
transfected DF-1 cells after NDV infection using a pNF- RNF-11 and knockdown of ZMYND11 showed no effect. In
κB-luc plasmid which containing multiple binding motifs expectation, transfection of siRNA-RNF11 or siRNA-ZMYND11
of NF-κB (GGGAATTTCC). We found that knockdown of increased the translocation of p65, an active subunit of NF-
RNF11 or ZMYND11 in DF-1 cells significantly increased κB with transcriptional activity (Vermeulen et al., 2002),
FIGURE 6 | RNF11 and ZMYND11 suppress NF-κB activity. pNF-κB-luc plasmid and indicated siRNAs or siRNA-NC or overexpression plasmids or pCMV-blank
were co-transfected into DF-1 cells together with the internal control plasmid pRL-TK. Eighteen hours after transfection, the cells were infected with JS 5/05 strain at
an MOI of 0.1 or left uninfected, dual-luciferase (A), ELISA (B), and qRT-PCR (C) assays were performed as described above at 18 hpi. NF-κB activities were
indicated by the ratio of firefly luciferase activities to renilla luciferase activities. The relative expression of IκB-α was normalized with GAPDH and calculated using the
2−1 1 CT method. Data are representative of three independent experiments and presented as means ± SD. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001.
Frontiers in Microbiology | www.frontiersin.org
9
August 2019 | Volume 10 | Article 2006

Chen et al.
Gga-miR-19b-3p Inhibits NDV Replication
from the cytoplasm to the nucleus (Figures 7A,D). In NDV replication. We found that NDV infection increased the
contrast, treatment of cells with pCMV-RNF11 or pCMV- expression and promoter activity of gga-miR-19b-3p. miR-19b-
ZMYND11 significantly inhibited the nuclear translocation 3p has been shown to play an important role in regulating
of p65 in NDV-infected DF-1 cells (Figures 7A,D). The the replication of other viruses. For example, up-regulated
relative p65 expression in cytoplasm or nucleus was calculated miR-19b enhances CD8+ T cell function via targeting the
normalized on the basis of tubulin β or histone H3, respectively phosphatase and tensin homolog (PTEN) and inhibits viral
(Figures 7B,C,E,F).
production of human immunodeficiency virus (HIV) in T
cells (Yin et al., 2018). Our study showed that transfection
of gga-miR-19b-3p mimic significantly promoted NDV-induced
inflammatory cytokines and inhibited NDV replication in DF-
1 cells, suggesting that gga-miR-19b-3p might play an anti-viral
role during NDV infection.
DISCUSSION
miRNAs are post-transcriptional regulators that mediate
translational repression and/or mRNA degradation by
complementary binding to the 30 UTRs in target mRNAs.
Mounting evidence suggest that cellular miRNAs can coordinate
host defense against viral infections by direct binding to
virus genome or through virus-mediated changes in the host
transcriptome (Trobaugh and Klimstra, 2017). For some
paramyxoviruses, such as respiratory syncytial virus (RSV)
(Bakre et al., 2012; Thornburg et al., 2012), HeV (Stewart et al.,
2013), and Nipah virus (NiV) (Foo et al., 2016), critical roles of
cellular miRNAs in host defense against virus replication have
already been well characterized. Even so, little is known about
miRNAs roles in NDV replication until now.
Our previous deep sequencing results showed that the
expression of gga-miR-19b-3p is significantly increased in
NDV-infected DF-1 cells. Further study suggests that this up-
regulated miRNAs might function as an anti-viral factor and
play a role in NDV-infected DF-1 cells. Our present study
focuses on the mechanism by which gga-miR-19b-3p inhibits
Like other paramyxoviruses, NDV infection can be sensed
by host innate immune system via PRRs in the cytosol.
Activated PRRs lead to activation of the innate immune
response and the production of inflammatory cytokines that
establishes an antiviral state (Schoggins and Rice, 2011). NF-
κB plays a crucial role in the production of inflammatory
cytokines (i.e., TNF-α, IL-6), apoptotic factors, and oxidative
stress (Deng et al., 2018). A growing body of research
suggests that miRNAs can regulate viral replication via
influencing NF-κB activity. For example, has-miR-215 directly
targets the tripartite motif 22 (TRIM22) to block the NF-
κB signaling pathway, and exerts a positively regulatory role
on (hepatitis C virus) HCV replication (Tian and He, 2018).
Up-regulated miR-221-5p inhibits porcine epidemic diarrhea
virus (PEDV) replication by targeting the 30 UTR of the
viral genome and activating the NF-κB-signaling pathway
(Zheng et al., 2018). In addition, during HIV infection, the
down-regulation of miR-16 results in the activation of the
FIGURE 7 | RNF11 and ZMYND11 inhibit the nucleus translocation of p65. DF-1 cells were transfected with indicated siRNAs or siRNA-NC or overexpression
plasmids or pCMV-blank for 18 h. Then JS 5/05 strain were used to infect the cells at an MOI of 0.1. Eighteen hours post infection, the cytoplasmic and nuclear
proteins of the cells were prepared as described above. Western blot was used to detect the translocation of p65 from cytoplasm to the nucleus (A,D). The relative
p65 expression in cytoplasm (B,E) or nucleus (C,F) was analyzed by Image J software and calculated normalized on the basis of tubulin β or histone H3,
respectively. Data are representative of three independent experiments and presented as means ± SD. ∗p < 0.05, ∗∗p < 0.01.
Frontiers in Microbiology | www.frontiersin.org
10
August 2019 | Volume 10 | Article 2006

Chen et al.
Gga-miR-19b-3p Inhibits NDV Replication
NF-κB signaling pathway, thus inhibiting HIV replication
(Li et al., 2010).
To further elucidate the association of the regulated roles
of RNF11 and ZMYND11, we knocked down or overexpressed
RNF11 is an evolutionarily conserved 154 amino acid of both proteins concurrently or knocked down one of them
protein that acts as a negative regulator of NF-κB signaling while overexpressed the other one before NDV infection.
pathway through its associations with the A20 ubiquitin- We found that simultaneous knockdown or overexpression of
editing protein complex (Pranski et al., 2012). Earlier studies both proteins showed synergistic effects on viral replication
have shown that ZMYND11 or BS69, a multidomain cellular and NF-κB activity. However, overexpression of ZMYND11
protein, can directly interact with tumor necrosis factor and knockdown of RNF-11, or overexpression of RNF-11
receptor associated factor 3 (TRAF3) to negatively regulated and knockdown of ZMYND11 showed no effect on viral
Epstein–Barr virus latent membrane protein 1-mediated replication and NF-κB activity. However, we believe that
NF-κB activation and then enhanced IL-6 expression (Ikeda these results do not indicate that RNF11 and ZMYND11
et al., 2010). Moreover, recent studies demonstrated that have similar abilities in regulating NDV replication and NF-
ZMYND11 could negatively regulate the NF-κB signaling κB activity. Since the interference efficiency of both genes
pathway in mycoplasma gallisepticum-infected chicken is approximately 30%, while the overexpression efficiency of
embryos and DF-1 cells (Hu et al., 2016). In our present both genes is approximately five to sevenfold. Moreover, the
study, we found that RNF11 and ZMYND11were directly expression levels of endogenous RNF11 and ZMYND11 are also
targets of gga-miR-19b-3p in DF-1 cells. Since gga-miR-19b- different in DF-1 cells. Therefore, further precise experiments
3p enhanced NDV-induced inflammatory response, it was are needed to confirm which protein plays more critical role on
imperative to evaluate effect of RNF11 and ZMYND11 on NDV replication.
inflammatory cytokines production in NDV-infected DF-1
In summary, our results indicate that NDV-induced gga-
cells. We found that knockdown of RNF11 and ZMYND11 miR-19b-3p inhibits the expressions of RNF11 and ZMYND11
increased NDV-induced inflammatory cytokines and inhibited by directly binding them, thereby enhancing NF-κB activity
NDV replication, similar to the effect of gga-miR-19b-3p. and increasing inflammatory cytokines production, which finally
However, overexpression of RNF11 and ZMYND11 showed leads to the inhibition of NDV replication in DF-1 cells. However,
an opposite effect. These results suggested that gga-miR- the study of gga-miR-19b-3p in vivo is more complicated than
19b-3p enhances NDV-induced inflammatory response via that in DF-1 cells, further studies are needed to elucidate the role
targeting RNF11 and ZMYND11. Moreover, different virulence of gga-miR-19b-3p in host response to NDV infection.
NDV strains infection resulted in a similar suppression of
these two proteins expression, indicated that a virulence-
independent regulation of RNF11 and ZMYND11 during NDV
infection in vitro.
DATA AVAILABILITY
Further research of mechanism by which RNF11 and All datasets generated for this study are included in the
ZMYND11 influence NDV-induced inflammatory response, manuscript and/or the supplementary files.
we found that silencing of these two proteins by siRNAs
promotes NDV-induced NF-κB activity indicated that
these two proteins negatively regulate NF-κB signaling
pathway in avian cells. It has been well established that
AUTHOR CONTRIBUTIONS
phosphorylation and subsequent proteasomal degradation YC was responsible for experiment design, data analysis, and
of IκB-α and translocation of NF-κB from the cytoplasm writing the manuscript. WL, HX, YD, HC, TZ, XLL, TL, LG, SZ,
to the nucleus are key determinants of NF-κB activation and YP were responsible for performing the experiments. JL, JH,
(Woronicz et al., 1997; Zhu et al., 2015). Therefore, we also XW, MG, and XWL were responsible for suggestion during the
determined the effect of RNF11 and ZMYND11 on the experiments performance. ZH, SH, and XFL were responsible
expression of p-IκB-α and IκB-α and nucleus translocation for revising the manuscript. All authors read and approved the
of NF-κB after NDV infection in DF-1 cells. We found that final manuscript.
treatment of DF-1 cells with siRNA-RNF11 and siRNA-
ZMYND11 enhanced the expression of p-IκB-α and nucleus
translocation of p65 and inhibited IκB-α expression, whereas
its overexpression prevented the expression of p-IκB-α and
FUNDING
p65 nuclear translocation and increased IκB-α expression. All This work was supported by grants from the National
these results strongly indicate that RNF11 and ZMYND11can Key Research and Development Program of China
negatively regulate NF-κB activity in DF-1 cells after NDV (2017YFD0500101), the National Key Technology R&D
infection and their down-regulation after NDV infection Program of China (2015BAD12B03). The Earmarked Fund
may be responsible for gga-miR-19b-3p stimulative role on For China Agriculture Research System (CARS-40), the
NDV-induced inflammatory cytokines expression. However, National Key Research and Development Program of China
the molecular mechanism by which RNF11 and ZMYND11 (2017YFD500101 and 2017YFD0500702), and a project funded
negatively regulate NF-κB activity in DF-1 cells remains to be by the Priority Academic Program Development of Jiangsu
further investigated.
Higher Education Institutions.
Frontiers in Microbiology | www.frontiersin.org
11
August 2019 | Volume 10 | Article 2006

Chen et al.
Gga-miR-19b-3p Inhibits NDV Replication
Liao, Y., Gu, F., Mao, X., Niu, Q., Wang, H., Sun, Y., et al. (2016). Regulation of
de novo translation of host cells by manipulation of PERK/PKR and GADD34-
PP1 activity during Newcastle disease virus infection. J. Gen. Virol. 97, 867–879.
doi: 10.1099/jgv.0.000426
Miller, P. J., Afonso, C. L., El Attrache, J., Dorsey, K. M., Courtney, S. C., Guo,
Z., et al. (2013). Effects of Newcastle disease virus vaccine antibodies on the
shedding and transmission of challenge viruses. Dev. Comp. Immunol. 41,
505–513. doi: 10.1016/j.dci.2013.06.007
Miller, P. J., Estevez, C., Yu, Q., Suarez, D. L., and King, D. J. (2009). Comparison of
viral shedding following vaccination with inactivated and live Newcastle disease
vaccines formulated with wild-type and recombinant viruses. Avian. Dis. 53,
39–49. doi: 10.1637/8407-071208-Reg.1
Munir, M., Abbas, M., Khan, M. T., Zohari, S., and Berg, M. (2012). Genomic and
biological characterization of a velogenic Newcastle disease virus isolated from
a healthy backyard poultry flock in 2010. Virol. J. 9:46. doi: 10.1186/1743-422
x-9-46
Pranski, E. L., Dalal, N. V., Herskowitz, J. H., Orr, A. L., Roesch, L. A., Fritz, J. J.,
et al. (2012). Neuronal RING finger protein 11 (RNF11) regulates canonical
NF-kappaB signaling. J. Neuroinflamm. 9:67. doi: 10.1186/1742-2094-9-67
Qin, Z. M., Tan, L. T., Xu, H. Y., Ma, B. C., Wang, Y. L., Yuan, X. Y., et al. (2008).
Pathotypical characterization and molecular epidemiology of Newcastle disease
virus isolates from different hosts in China from 1996 to 2005. J. Clin. Microbiol.
46, 601–611. doi: 10.1128/jcm.01356-7
Rajmani, R. S., Gupta, S. K., Singh, P. K., Gandham, R. K., Sahoo, A. P., Chaturvedi,
U., et al. (2016). HN protein of Newcastle disease virus sensitizes HeLa cells to
TNF-alpha-induced apoptosis by downregulating NF-kappaB expression. Arch.
Virol. 161, 2395–2405. doi: 10.1007/s00705-016-2923-7
REFERENCES
Ashraf, U., Zhu, B., Ye, J., Wan, S., Nie, Y., Chen, Z., et al. (2016). MicroRNA-19b-
3p modulates japanese encephalitis virus-mediated inflammation via targeting
RNF11. J. Virol. 90, 4780–4795. doi: 10.1128/jvi.02586-15
Bakre, A., Mitchell, P., Coleman, J. K., Jones, L. P., Saavedra, G., Teng, M., et al.
(2012). Respiratory syncytial virus modifies microRNAs regulating host genes
that affect virus replication. J. Gen. Virol. 93(Pt 11), 2346–2356. doi: 10.1099/
vir.0.044255-0
Bartel, D. P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function.
Cell 116, 281–297.
Cheng, J., Sun, Y., Zhang, X., Zhang, F., Zhang, S., Yu, S., et al. (2014). Toll-like
receptor 3 inhibits newcastle disease virus replication through activation of pro-
inflammatory cytokines and the type-1 interferon pathway. Arch. Virol. 159,
2937–2948. doi: 10.1007/s00705-014-2148-6
Cheng, X., Wang, W., Xu, Q., Harper, J., Carroll, D., Galinski, M. S., et al. (2016).
Genetic modification of oncolytic newcastle disease virus for cancer therapy.
J. Virol. 90, 5343–5352. doi: 10.1128/jvi.00136-16
Dalal, N. V., Pranski, E. L., Tansey, M. G., Lah, J. J., Levey, A. I., and Betarbet, R. S.
(2012). RNF11 modulates microglia activation through NF-kappaB signalling
cascade. Neurosci. Lett. 528, 174–179. doi: 10.1016/j.neulet.2012.08.060
Deng, L., Zeng, Q., Wang, M., Cheng, A., Jia, R., Chen, S., et al. (2018). Suppression
of NF-kappaB activity: a viral immune evasion mechanism. Viruses 10:409.
doi: 10.3390/v10080409
Dimitrov, K. M., Afonso, C. L., Yu, Q., and Miller, P. J. (2017). Newcastle disease
vaccines-A solved problem or a continuous challenge? Vet. Microbiol. 206,
126–136. doi: 10.1016/j.vetmic.2016.12.019
Dimitrov, K. M., Ramey, A. M., Qiu, X., Bahl, J., and Afonso, C. L. (2016).
Reed, L. J., and Muench, H. (1938). A simple method of estimating fifty per cent
endpoints12. Am. J. Epidemiol. 27, 493–497. doi: 10.1093/oxfordjournals.aje.
a118408
Rue, C. A., Susta, L., Cornax, I., Brown, C. C., Kapczynski, D. R., Suarez, D. L.,
et al. (2011). Virulent Newcastle disease virus elicits a strong innate immune
response in chickens. J. Gen. Virol. 92, 931–939. doi: 10.1099/vir.0.025486-0
Ruland, J. (2011). Return to homeostasis: downregulation of NF-kappaB responses.
Nat. Immunol. 12, 709–714. doi: 10.1038/ni.2055
Temporal, geographic, and host distribution of avian paramyxovirus
1
(Newcastle disease virus). Infect. Genet. Evol. 39, 22–34. doi: 10.1016/j.meegid.
2016.01.008
Foo, C. H., Rootes, C. L., Cowley, K., Marsh, G. A., Gould, C. M., Deffrasnes, C.,
et al. (2016). Dual microRNA Screens reveal that the immune-responsive miR-
181 Promotes henipavirus entry and cell-cell fusion. PLoS Pathog. 12:e1005974.
doi: 10.1371/journal.ppat.1005974
Ganar, K., Das, M., Sinha, S., and Kumar, S. (2014). Newcastle disease virus: current
status and our understanding. Virus Res. 184, 71–81. doi: 10.1016/j.virusres.
2014.02.016
Hu, Q., Zhao, Y., Wang, Z., Hou, Y., Bi, D., Sun, J., et al. (2016). Chicken gga-
miR-19a targets ZMYND11 and plays an important role in host defense against
Mycoplasma gallisepticum (HS Strain) infection. Front. Cell Infect. Microbiol.
6:102. doi: 10.3389/fcimb.2016.00102
Hu, Z., Hu, S., Meng, C., Wang, X., Zhu, J., and Liu, X. (2011). Generation of
a genotype VII Newcastle disease virus vaccine candidate with high yield in
embryonated chicken eggs. Avian. Dis. 55, 391–397. doi: 10.1637/9633-122410-
Reg.1
Ikeda, O., Miyasaka, Y., Yoshida, R., Mizushima, A., Oritani, K., Sekine, Y.,
et al. (2010). BS69 cooperates with TRAF3 in the regulation of Epstein-Barr
virus-derived LMP1/CTAR1-induced NF-kappaB activation. FEBS Lett. 584,
865–872. doi: 10.1016/j.febslet.2010.01.060
Schoggins, J. W., and Rice, C. M. (2011). Interferon-stimulated genes and their
antiviral effector functions. Curr. Opin. Virol. 1, 519–525. doi: 10.1016/j.coviro.
2011.10.008
Shembade, N., Parvatiyar, K., Harhaj, N. S., and Harhaj, E. W. (2009). The
ubiquitin-editing enzyme A20 requires RNF11 to downregulate NF-kappaB
signalling. EMBO J. 28, 513–522. doi: 10.1038/emboj.2008.285
Stewart, C. R., Marsh, G. A., Jenkins, K. A., Gantier, M. P., Tizard, M. L., Middleton,
D., et al. (2013). Promotion of Hendra virus replication by microRNA 146a.
J. Virol. 87, 3782–3791. doi: 10.1128/jvi.01342-12
Sun, Y., Ding, N., Ding, S. S., Yu, S., Meng, C., Chen, H., et al. (2013). Goose RIG-I
functions in innate immunity against Newcastle disease virus infections. Mol.
Immunol. 53, 321–327. doi: 10.1016/j.molimm.2012.08.022
Thornburg, N. J., Hayward, S. L., and Crowe, J. E. Jr. (2012). Respiratory
syncytial virus regulates human microRNAs by using mechanisms involving
beta interferon and NF-kappaB. mBio 3:e00220-12. doi: 10.1128/mBio.
00220-12
Ikeda, O., Sekine, Y., Mizushima, A., Oritani, K., Yasui, T., Fujimuro, M., et al.
(2009). BS69 negatively regulates the canonical NF-kappaB activation induced
by Epstein-Barr virus-derived LMP1. FEBS Lett. 583, 1567–1574. doi: 10.1016/
j.febslet.2009.04.022
Tian, H., and He, Z. (2018). miR-215 enhances HCV replication by targeting
TRIM22 and inactivating NF-kappaB signaling. Yonsei Med. J. 59, 511–518.
doi: 10.3349/ymj.2018.59.4.511
Ingle, H., Kumar, S., Raut, A. A., Mishra, A., Kulkarni, D. D., Kameyama, T., et al.
(2015). The microRNA miR-485 targets host and influenza virus transcripts to
regulate antiviral immunity and restrict viral replication. Sci. Signal. 8:ra126.
doi: 10.1126/scisignal.aab3183
Jia, Y. Q., Wang, X. L., Wang, X. W., Yan, C. Q., Lv, C. J., Li, X. Q., et al. (2018).
Common microRNA(-)mRNA interactions in different newcastle disease virus-
infected chicken embryonic visceral tissues. Int. J. Mol. Sci. 19:E1291. doi:
10.3390/ijms19051291
Trobaugh, D. W., and Klimstra, W. B. (2017). MicroRNA regulation of RNA
virus replication and pathogenesis. Trends Mol. Med. 23, 80–93. doi: 10.1016/j.
molmed.2016.11.003
Vermeulen, L., De Wilde, G., Notebaert, S., Vanden Berghe, W., and Haegeman, G.
(2002). Regulation of the transcriptional activity of the nuclear factor-kappaB
p65 subunit. Biochem. Pharmacol. 64, 963–970. doi: 10.1016/s0006-2952(02)
01161-9
Wang, X., Jia, Y., Wang, X., Wang, C., Lv, C., Li, X., et al. (2019). MiR-375 has
contrasting effects on Newcastle disease virus growth depending on the target
gene. Int. J. Biol. Sci. 15, 44–57. doi: 10.7150/ijbs.25106
Kato, H., Takeuchi, O., and Akira, S. (2006). [Cell type specific involvement of
RIG-I in antiviral responses]. Nihon Rinsho 64, 1244–1247.
Li, T., Morgan, M. J., Choksi, S., Zhang, Y., Kim, Y. S., and Liu, Z. G.
(2010). MicroRNAs modulate the noncanonical transcription factor NF-
kappaB pathway by regulating expression of the kinase IKKalpha during
macrophage differentiation. Nat. Immunol. 11, 799–805. doi: 10.1038/ni.1918
Wang, Z., Ning, Z., Sun, M., Gao, S., Kang, Y., Xie, P., et al. (2014). Interferon
regulatory factor 7- (IRF7-) mediated immune response affects Newcastle
disease virus replication in chicken embryo fibroblasts. Acta Vet. Hung. 62,
500–511. doi: 10.1556/AVet.2014.023
Frontiers in Microbiology | www.frontiersin.org
12
August 2019 | Volume 10 | Article 2006

Chen et al.
Gga-miR-19b-3p Inhibits NDV Replication
Woronicz, J. D., Gao, X., Cao, Z., Rothe, M., and Goeddel, D. V. (1997). IkappaB
kinase-beta: NF-kappaB activation and complex formation with IkappaB
kinase-alpha and NIK. Science 278, 866–869. doi: 10.1126/science.278.5339.866
Wu, S., Wang, W., Yao, C., Wang, X., Hu, S., Cao, J., et al. (2011). Genetic diversity
of Newcastle disease viruses isolated from domestic poultry species in Eastern
China during 2005-2008. Arch. Virol. 156, 253–261. doi: 10.1007/s00705-010-
0851-5
Zhu, B., Ye, J., Nie, Y., Ashraf, U., Zohaib, A., Duan, X., et al. (2015). MicroRNA-
15b modulates Japanese encephalitis virus-mediated inflammation via targeting
RNF125. J. Immunol. 195, 2251–2262. doi: 10.4049/jimmunol.1500370
Conflict of Interest Statement: The authors declare that the research was
conducted in the absence of any commercial or financial relationships that could
be construed as a potential conflict of interest.
Yin, L. B., Song, C. B., Zheng, J. F., Fu, Y. J., Qian, S., Jiang, Y. J., et al.
(2018). Elevated expression of miR-19b enhances CD8(+) T Cell function by
targeting PTEN in HIV infected long term non-progressors with sustained viral
suppression. Front. Immunol. 9:3140. doi: 10.3389/fimmu.2018.03140
Zheng, H., Xu, L., Liu, Y., Li, C., Zhang, L., Wang, T., et al. (2018). MicroRNA-221-
5p inhibits porcine epidemic diarrhea virus replication by targeting genomic
viral RNA and activating the NF-kappaB pathway. Int. J. Mol. Sci. 19:E3381.
doi: 10.3390/ijms19113381
Copyright © 2019 Chen, Liu, Xu, Liu, Deng, Cheng, Zhan, Lu, Liao, Guo, Zhu,
Pei, Hu, Hu, Liu, Wang, Gu, Hu and Liu. This is an open-access article distributed
under the terms of the Creative Commons Attribution License (CC BY). The use,
distribution or reproduction in other forums is permitted, provided the original
author(s) and the copyright owner(s) are credited and that the original publication
in this journal is cited, in accordance with accepted academic practice. No use,
distribution or reproduction is permitted which does not comply with these terms.
Frontiers in Microbiology | www.frontiersin.org
13
August 2019 | Volume 10 | Article 2006