Selective G-quadruplex DNA stabilizing agents based on bisquinolinium and bispyridinium derivatives of 1,8-naphthyridine

Article abstract of DOI:10.1021/jo201816g

Various biologically relevant G-quadruplex DNA structures offer a platform for therapeutic intervention for altering the gene expression or by halting the function of proteins associated with telomeres. One of the prominent strategies to explore the therapeutic potential of quadruplex DNA structures is by stabilizing them with small molecule ligands. Here we report the synthesis of bisquinolinium and bispyridinium derivatives of 1,8-naphthyridine and their interaction with human telomeric DNA and promoter G-quadruplex forming DNAs. The interactions of ligands with quadruplex forming DNAs were studied by various biophysical, biochemical, and computational methods. Results indicated that bisquinolinium ligands bind tightly and selectively to quadruplex DNAs at low ligand concentration (～0.2-0.4 μM). Furthermore, thermal melting studies revealed that ligands imparted higher stabilization for quadruplex DNA (an increase in the T_m of up to 21 °C for human telomeric G-quadruplex DNA and >25 °C for promoter G-quadruplex DNAs) than duplex DNA (ΔT_m ≥ 1.6 °C). Molecular dynamics simulations revealed that the end-stacking binding mode was favored for ligands with low binding free energy. Taken together, the results indicate that the naphthyridine-based ligands with quinolinium and pyridinium side chains form a promising class of quadruplex DNA stabilizing agents having high selectivity for quadruplex DNA structures over duplex DNA structures.

Full text of DOI:10.1021/jo201816g

Article
pubs.acs.org/joc
Selective G-quadruplex DNA Stabilizing Agents Based on
Bisquinolinium and Bispyridinium Derivatives of 1,8-Naphthyridine
§
‡
V. Dhamodharan, S. Harikrishna, C. Jagadeeswaran, K. Halder, and P. I. Pradeepkumar*
Department of Chemistry, Indian Institute of Technology Bombay, Mumbai 400076, India
*
S Supporting Information
ABSTRACT: Various biologically relevant G-quadruplex
DNA structures offer a platform for therapeutic intervention
for altering the gene expression or by halting the function of
proteins associated with telomeres. One of the prominent
strategies to explore the therapeutic potential of quadruplex
DNA structures is by stabilizing them with small molecule
ligands. Here we report the synthesis of bisquinolinium and
bispyridinium derivatives of 1,8-naphthyridine and their
interaction with human telomeric DNA and promoter G-
quadruplex forming DNAs. The interactions of ligands with quadruplex forming DNAs were studied by various biophysical,
biochemical, and computational methods. Results indicated that bisquinolinium ligands bind tightly and selectively to quadruplex
DNAs at low ligand concentration (∼0.2−0.4 μM). Furthermore, thermal melting studies revealed that ligands imparted higher
stabilization for quadruplex DNA (an increase in the T of up to 21 °C for human telomeric G-quadruplex DNA and >25 °C for
m
promoter G-quadruplex DNAs) than duplex DNA (ΔT ≤ 1.6 °C). Molecular dynamics simulations revealed that the end-
m
stacking binding mode was favored for ligands with low binding free energy. Taken together, the results indicate that the
naphthyridine-based ligands with quinolinium and pyridinium side chains form a promising class of quadruplex DNA stabilizing
agents having high selectivity for quadruplex DNA structures over duplex DNA structures.
2
1
INTRODUCTION
G-quadruplexes are tertiary nucleic acid structures made up of
multiple Hoogsteen base paired G-quartets stacked on top of
direction. The length and sequence of intertwining loops are
important for the formation and the stability of quadruplex
■
2
2−24
structures.
Even though G-quadruplexes can adopt
1,2
different conformations, they still typically share a common
planar quartet structural feature, which offers a platform to
each other (Figure 1).
Putative G-quadruplex forming
7
sequences are found at the end of eukaryotic chromosomes
3
4
induce and stabilize the quadruplexes by means of small organic
molecules that stack on top of quartets. However, this common
structural feature poses challenges for the design of ligands with
considerable selectivity toward one type of quadruplex over
other G-quadruplex structures. Since the loop sizes vary from
one type of quadruplex form to the other, it is important to
consider ligand interactions with different types of loops and
grooves. Such interactions, coupled with end stacking, can be
used to achieve better selectivity and discrimination among
various quadruplex topologies.
G-quadruplex nucleic acids are potential therapeutic targets
for anticancer therapy.
diamidoanthraquinone mediated quadruplex stabilization was
shown to inhibit telomerase activity, many classes of ligands
(
telomeres), in promoter regions of important proto-
5
6,7
8
oncogenes such as c-kit and c-myc, in introns, and in the
untranslated regions (UTRs) of mRNAs. G-quadruplex
structures are considered to play important roles in the
regulation of gene expression and the maintenance of telomere
length. For example, formation of a quadruplex at the telomeric
end can halt the function of the telomerase enzyme.
Formation of quadruplex structures at the promoter regions
can regulate gene expression at the transcriptional level, and
induction of quadruplexes at the UTRs can modulate gene
expression at the translational level.
telomeric DNA is get transcribed into noncoding telomeric
RNA (TERRA) adds further structural and functional complex-
ities of potential quadruplex structures in biological systems.
Notably, a recent study in yeast has provided evidence for the
9
10
7
25−27
11−13
The discovery that
7
,28,29
Ever since the ligand 2,6-
30
14
31−33
have been studied as G-quadruplex stabilizing agents.
example, acridine-based ligand (BRACO-19), pentacyclic
For
34
existence of quadruplex structures in vivo and their effects on
35
1
5−18
acridinium ligand (RHPS4), bisquinolinium compounds
DNA replication.
3
6
37
(
360A), cationic porphyrin (TMPyP4), macrocyclic natural
G-quadruplexes are structurally diverse due to their strand
direction, sequence, loop orientation, and the nature of metal
cation stabilizing the quadruplexes.
38
product (telomestatin), and their analogues have been
investigated in both in vitro and in vivo settings. Though
2,19,20
G-quadruplex struc-
tures can be intermolecular (bi- and tetramolecular) or
21
intramolecular (unimolecular) in nature. The orientation of
the strands in the quadruplex can be parallel or antiparallel in
Received: September 2, 2011
Published: November 29, 2011
©
2011 American Chemical Society
229
dx.doi.org/10.1021/jo201816g | J. Org. Chem. 2012, 77, 229−242

The Journal of Organic Chemistry
Article
Figure 1. Structure of a G-quartet and a G-quadruplex. G-quartet is formed by the planar arrangement of four guanines connected by eight
Hoogsteen hydrogen bonds shown in dotted lines. The metal ion coordinates to O6-atoms of guanines in the quartet. The G-quartets are stacked on
top of each other to form a G-quadruplex; the conformer shown is the antiparallel basket-type structure.
Figure 2. Structures of G-quadruplex DNA stabilizing ligands. Ligands 3AQN and 6AQN contain a naphthyridine central core with quinolinium side
chains; the ligand 3APN contains a 1,8-naphthyridine central core with pyridinium side chains, and the reference compound 360A contains a
pyridine central core with quinolinium side chains.
numerous types of ligands have been reported as potential G-
quadruplex interacting/stabilizing agents, few have shown
specificity toward the targeted quadruplex structure over
with quadruplex DNA. All ligands were found to have strong
selectivity toward quadruplex DNA over duplex DNA. The
results presented here suggest that in addition to the structural
features of the central core of the ligand, the side chains also
play critical roles in achieving selective quadruplex DNA
stabilization.
3
9,40
other quadruplex topologies.
Moreover, the mechanism of
anticancer action of many of the quadruplex targeting ligands is
not well understood. It has been shown that many of the
ligands reported in the literature may not be the direct
inhibitors of telomerase. Instead they compete with or displace
the telomere binding proteins such as hPOT1 and thereby
RESULTS AND DISCUSSION
■
Ligand Design and Synthesis. Bicyclic heteroaromatic
compounds such as 1,8-naphthyridine can be utilized to
assemble potential G-quadruplex stabilizing ligands. Though a
dimeric form of 1,8-naphthyridine has been used to inhibit the
function of telomerase, its mode of action stems from an
interaction with a nonquadruplex structure at the telomere
2
8,29
induce a DNA damage response.
It has also been proposed
that formation of quadruplex structures at telomere ends may
lead to DNA strand breakage and thereby impart anticancer
2
8,29,41
activity.
In addition to the potential therapeutic applications, strong
and selective quadruplex binding agents can be used to probe
43
end. Moreover, to the best of our knowledge, naphthyridine
based ligands have not been explored as G-quadruplex DNA
stabilizing agents. Therefore, herein, three representatives of a
new class of 1,8-naphthyridine based ligands (3AQN, 6AQN,
and 3APN) were designed and synthesized to achieve specific
quadruplex stabilization (Figure 2). The potent G-quadruplex
stabilizing agent 360A, which has a pyridinium central core and
two quinolinium side chains, was prepared and used as
42
the presence of quadruplexes in vivo. Therefore, the search for
novel, selective G-quadruplex stabilizing agents has been
extensively pursued. Along these lines, here we report the
synthesis of bisquinolinium and bispyridinium derivatives of
1
,8-naphthyridine (Figure 2) and characterization of their
interactions with quadruplex DNA. The potent G-quadruplex
36
stabilizing agent 360A is used as a reference compound in our
studies. Binding efficacy of ligands has been tested with human
telomeric DNA as well as promoter DNAs such as c-kit1, c-kit2,
and c-myc. The discriminatory ability of the ligands to target
quadruplex DNA over duplex DNA was also investigated. We
employed various biophysical [fluorescence intercalator dis-
placement (FID) assay, CD titration, and CD melting] and
biochemical techniques (Taq polymerase stop assay and
nondenaturing gel electrophoresis), as well as molecular
dynamics (MD) simulations, to study the interaction of ligands
36
reference compound. The rationale for the design of our
ligands is that the internal H-bonds between the NH of amide
bond and the naphthyridine- N atom can lock the ligand
44
conformation into a planar crescent-shaped form. Addition-
ally, the large aromatic core of the naphthyridine ring
potentially offers better stacking on G quartets, and the
cationic side chains can interact with the negatively charged
phosphate backbone of loops of the quadruplex via electrostatic
45
interactions. The side chains of the ligands may also improve
2
30
dx.doi.org/10.1021/jo201816g | J. Org. Chem. 2012, 77, 229−242

The Journal of Organic Chemistry
Article
a
Scheme 1. Synthesis of G-quadruplex DNA Stabilizing Agents
a
Reagents and conditions: (i) ammonium formate, Pd (10%)/C, MeOH, 6 h, rt; (ii) (a) SeO , 1, 4-dioxane, 12 h, rt, (b) conc HNO 3 h, 80 °C;
2
3
(
iii) 3-aminoquinoline, EDC·HCl, HOBt, DMAP, DMF, 24 h, rt; (iv) 6-aminoquinoline, EDC·HCl, HOBt, DMAP, DMF, 24 h, rt; (v) 3-
aminopyridine, EDC·HCl, HOBt, DMAP, DMF, 24 h, rt; (vi) MeOTf, DMF, 80 °C for 4 d.
the selectivity for quadruplex DNA over duplex DNA. The
quinolinium side chains, previously identified through a
Methylation of compounds 4a, 4b and 4c by methyl triflate
gave the final product 3AQN in 55%, 6AQN in 52%, and
3APN in 57% yield, respectively. All ligands contain triflate
counterions, which increase ligand solubility in water unlike
widely used iodide counterions. All compounds were fully
4
6
screening assay, were chosen for our ligands because of
their presence in several potent quadruplex stabilizing ligands
46
such as triazine derivative (12459), pyridine-dicarboxamide
4
7
1
13
(
360A, 307A), phenanthroline-dicarboxamide (Phen-DC3
characterized by H NMR, C NMR, and HRMS.
48
and Phen-DC6),
mide (RR 82, RR 110).
and bis(2-quinolinyl)pyridine-dicarboxa-
Fluorescence Intercalator Displacement (FID) Assay.
Ligand binding affinity and selectivity toward quadruplex DNAs
4
2,49,50
Since the position of the
positive charges on the side chain varies in the 3-amino-
quinolinium (3AQN) and 6-aminoquinolinium (6AQN)
compounds, these new molecules offer an opportunity to
compare the efficiency of the side chain interactions with the
loops and grooves of the quadruplex structures. The pyridinium
side chain was selected to probe the structural differences in the
side chains, which affect the quadruplex recognition.
56
were determined by the FID assay. This assay is based on the
decrease in the fluorescence intensity due the displacement of
thiazole orange (TO) dye from the quadruplex structures upon
56
titration of quadruplex stabilizing ligands. FID curves (Figure
The synthetic strategy used to assemble the naphthyridine
ligands is shown in Scheme 1. The key intermediate, 2,7-
naphthyridinedicarboxylic acid 3, was prepared in six steps
5
1−54
using reported procedures
with slight modifications.
51
Compound 1 was prepared as previously described, and the
subsequent dechlorination using Pd(5%)/CaCO at 4 atm of
3
52
H was found to be low-yielding in our hands. However,
2
5
5
dechlorination by ammonium formate and Pd(10%)/C
yielded compound 2 in 86% yield. Oxidation of compound 2
by SeO followed by HNO treatment furnished 3 in 39%
Figure 3. FID assays of ligands with telomeric G-quadruplex DNA and
duplex DNA in the presence of 100 mM NaCl, 10 mM sodium
cacodylate buffer, pH 7.2, and 0.5 or 0.75 μM thiazole orange. (A)
Prefolded telomeric quadruplex (0.25 μM) with ligands (0 to 10 molar
equiv). (B) Duplex DNA (0.25 μM) with ligands (0 to 10 molar
equiv).
2
3
5
3,54
yield.
The direct coupling of 3 with 3-aminoquinoline by
using EDC·HCl, HOBt, and DMAP produced the amide 4a in
48% yield. Employing similar reagents and conditions with 6-
aminoquinoline and 3-aminopyridine, the amides 4b and 4c
were synthesized in 51% and 23% yield, respectively.
2
31
dx.doi.org/10.1021/jo201816g | J. Org. Chem. 2012, 77, 229−242

The Journal of Organic Chemistry
A and Figure S1, Supporting Information) were obtained by
Article
3
However, the ligand 3APN, which has pyridinium side chains,
G4
plotting percentage of displacement of thiazole orange versus
showed very weak binding to the quadruplex DNA ( DC >
50
concentration of ligand. The displacement concentration
2.5 μM). The large aromatic core of naphthyridine, together
with bisquinolinium side chains, (3AQN and 6AQN) offer
better affinity for the quadruplex.
G4
(
DC , concentration of ligand to displace 50% thiazole
50
orange from G-quadruplex DNA) values are reported in Table
To determine the selectivity of the ligands toward quadruplex
DNA over duplex DNA, self-complementary duplex DNA
(ds26) was used in FID assays. All ligands showed DC50
Table 1. Binding Affinities of Ligands to Various Quadruplex
and Duplex DNA Measured from Fluorescence Intercalator
Displacement (FID) assay
ds
values of >2.5 μM (>10 molar equiv), indicating ligands are
highly selective toward quadruplex DNA over duplex DNA
G4DC (μM)
a
5
0
(
Figure 3B and Table 1). The estimated selectivity toward
dsDC5
0
b
selectivity for
quadruplex over duplex DNA of 3AQN and 6AQN were found
to be 33- and 16-fold, respectively. Further, to determine the
affinity of ligands toward other quadruplex DNA structures, the
promoter sequences such as c-kit1, c-kit2, and c-myc were also
utilized. The reference compound 360A binds to all promoter
G-quadruplex DNAs with similar affinity (Table 1). However,
3AQN binds 2-fold more strongly to telomeric DNA over
(
μM)
human telomeric
DNA over
duplex
duplex
(ds26)
ligands telomeric c-kit1 c-kit2 c-myc
3
6
AQN
AQN
0.20
0.19
>2.5
0.41 c
0.49
0.35
>2.5
0.40
0.50
0.25
1.95
0.31
0.47
0.46
1.47
0.44
>2.5
>2.5
>2.5
>2.5
33
16
3
APN
c
3
60A
33 (42 )
(
0.29 )
G4
promoter DNAs ( DC > 0.4 μM). Similarly, 6AQN shows 2-
50
a
G4
DC50 is the concentration of ligand needed to displace 50% of
fold preference for telomeric DNA over c-myc DNA ( DC >
50
thiazole orange (TO). Experiments were duplicated and estimated
0
.4 μM). Ligand 3APN, which has pyridine chains, exhibited
b
error values are within ±5%. The selectivity of the ligands was
binding only to the promoter sequences such as c-myc and c-
kit2 (Table 1). Though the exact reason for this preference of
G4
G4
estimated using the formula 2.5/ C. ( C was calculated as follows: at
.5 μM ligand concentration, the percentage of TO displacement from
2
3APN toward promoter sequences is not clear, it can perhaps
the duplex DNA was calculated. The concentration of ligand to
achieve this much displacement from the telomeric quadruplex is
known as C.) Reported in the literature.
be attributed to the different preferred topologies of promoter
quadruplexes compared to the telomeric quadruplex.
G4
c
56
Circular Dichroism Studies. CD studies were performed
to explore the potential of new ligands to induce quadruplex
formation in different DNAs. In the absence of monovalent
metal cations, ligand may induce a particular quadruplex
structure. However, in presence of metal cations, ligand may
selectively bind to one kind of quadruplex. Interpretation of CD
spectra requires spectra of well characterized quadruplex
+
1
. For human telomeric DNA, Na (100 mM) salt was used
rather than K salt, since under Na+ salt conditions the
sequence forms the antiparallel quadruplex exclusively.
+
5
7
+
Moreover in the presence of K ions, time-dependent increase
in fluorescence intensity was observed with thiazole orange, and
this hampers the accurate measurement of ligand binding
efficiency. For the telomeric sequence, low concentration (0.2
μM) of 3AQN and 6AQN was required to displace 50%
thiazole orange, suggesting higher binding affinity of these
ligands for the quadruplex. These values are quite comparable
58
structures for comparison. For example, the CD spectra of
+
human telomeric quadruplex DNA under Na conditions shows
a positive peak around 292 nm and a negative peak around 262
nm. These peaks have been assigned as characteristics of
unimolecular antiparallel quadruplex topology, and this
G4
with that of reference compound 360A ( DC = 0.41 μM).
5
0
Figure 4. CD titration spectra of ligand 3AQN (0−5 molar equiv) to quadruplex DNA (12.5 μM) in Tris buffer (50 mM, pH 7.2) in the presence
and in the absence of monovalent cations at 25 °C. (A) Telomeric DNA in the absence of monovalent cations. (B) Telomeric DNA in the presence
+
+
of K (100 mM). (C) Telomeric DNA in the presence of Na (100 mM). (D) c-kit1 DNA in the absence of monovalent cations. (E) c-kit2 DNA in
the absence of monovalent cations. (F) c-myc DNA in the absence of monovalent cations.
2
32
dx.doi.org/10.1021/jo201816g | J. Org. Chem. 2012, 77, 229−242

The Journal of Organic Chemistry
Article
5
9
structure was supported by NMR studies. It should be noted
that although CD is useful in assigning topology of ligand-
induced quadruplex structures, this assignment needs to be
3APN led to formation of a peak around 290 nm and decrease
in the ellipticity at 260 nm (Figure 4E and Figure S6,
Supporting Information). The reference compound 360A also
induced the similar quadruplex topology (Figure S6C,
Supporting Information). These results indicate that parallel
quadruplex structures were induced to form a mixture of
60
125
further supported by NMR studies or
I-radioprobing
6
1
experiments.
Human telomeric DNA and promoter DNAs were studied in
+
+
+
presence and absence of Na and K ions. Telomeric DNA, in
the absence of any added monovalent cations, shows positive
peak around 290 and 252 nm and a small negative peak at 235
nm (Figure 4A). Upon addition of ligands (3AQN, 6AQN, and
APN) at 0.5−3 equiv relative to the DNA, a negative peak at
62 nm, a positive peak at 292 nm, and a minor positive peak at
45 nm appeared (Figure 4A, Figure S2A and B, Supporting
parallel and antiparallel structures. In the presence of K ions, c-
kit2 exhibited a positive peak at 260 nm and a negative peak at
240 nm indicating the parallel structure (Figure S7, Supporting
40
+
Information). In general, in the presence of K ions, addition
of ligands did not affect the peaks at 260 and 240 nm,
suggesting the quadruplex structure retains the parallel
topology (Figure S7, Supporting Information).
3
2
2
Information). As mentioned earlier, these are characteristic
In the absence of any added monovalent metal cations or
peaks for antiparallel quadruplex structure reported in the
ligands, the c-myc DNA exists in a parallel topology (Figure
4F). When 3AQN, 6AQN, and 3APN were added to the c-
5
9,62
40
literature.
AQN, and 3APN induce antiparallel quadruplex structures,
producing an effect similar to that of reference compound
60A (Figure S2C, Supporting Information). Although a slight
These results clearly suggest that ligands 3AQN,
6
myc DNA, parallel structure was further stabilized as evidenced
by the increase in ellipticity at 263 nm. Similar quadruplex
stabilization was observed with 360A as well (Figure S8,
3
+
decrease in the ellipticity was observed at higher concentration
of of ligands (4−5 equiv), the characteristic peaks for
antiparallel topology were retained.
In the presence of 100 mM KCl, telomeric DNA exhibits a
mixture of parallel and antiparallel structures, which have a
characteristic positive peak at 290 nm with a shoulder peak at
Supporting Information). In the presence K ions, c-myc DNA
shows a positive peak around 263 nm and a negative peak at
243 nm, which are characteristic peaks for parallel quadruplex
40
structure. Addition of ligands 3AQN and 6AQN to c-myc
DNA did not perturb the quadruplex structure, which was
already induced and stabilized by K+ ions (Figure S9,
Supporting Information).
2
70 nm, a small positive peak at 250 nm, and a small negative
62
peak at 234 nm (Figure 4B). Upon addition of ligands 3AQN
and 6AQN, a negative peak appeared at 260 nm and the
positive peak at 290 nm was retained, suggesting the induction
of antiparallel quadruplex structure (Figure 4B and Figure S3A,
Supporting Information). However, the ligand 3APN did not
induce the antiparallel form (Figure S3B, Supporting
Information). Like 3AQN and 6AQN, the reference compound
CD Melting Studies. Thermal stabilization of various
quadruplex DNA and duplex DNA in the presence of ligands
was studied using the CD melting experiment. Thermal
denaturation of antiparallel telomeric quadruplex DNA in
+
presence of Na was monitored at 295 nm. Monovalent metal
cation concentration (LiCl and NaCl) was adjusted to 100 mM
so as to obtain a T
ligands. This was expected to provide a large T window to
value around 50 °C in the absence of
m
63
3
60A also induced similar antiparallel quadruplex topology+
Figure S3C, Supporting Information). In the presence of Na
ions, telomeric DNA exists in an antiparallel basket-type
m
(
analyze the ligand stabilizing effects. All ligands increased the
stability of quadruplex DNAs (Figure 5). We observed that
59,62
conformation (Figure 4C).
Upon addition of ligands, this
antiparallel structure was retained (Figure S3D and E,
Supporting Information). Overall, these results indicate that
irrespective of the nature of metal ions, all ligands selectively
induce or stabilize the antiparallel quadruplex form of telomeric
DNA.
The promoter DNA sequence c-kit1, in the absence of any
monovalent ions, exhibits a small positive peak at 260 nm
40
indicative of a parallel quadruplex structure (Figure 4D).
Interestingly, addition of 3AQN resulted in a negative peak at
60 nm and a positive peak at 290 nm. This is a clear indication
of an antiparallel conformation being induced by ligand 3AQN
Figure 4D). However, in the presence ligand 6AQN, induction
2
(
of both parallel and antiparallel structures was observed (Figure
S4A, Supporting Information). Similar to 3AQN, both 3APN
and reference compound 360A stabilize the same topology
Figure 5. CD melting curves of telomeric DNA (5 μM, 10 mM NaCl,
9
0 mM LiCl, and 10 mM sodium cacodylate buffer pH 7.2) with 3
(
Figure S4B and C, Supporting Information). Moreover, c-kit1
molar equiv of ligands (15 μM). Ligand 3AQN provided higher
+
in the presence of K ions exists as a parallel structure, which
has a characteristic positive peak centered around 260 nm and a
negative peak at 240 nm (Figure S5, Supporting Informa-
tion). As it was already well stabilized by K metal ions, no
increase in CD ellipticity upon addition of ligands was
observed, and the parallel structure was retained.
stabilization than 3APN. ΔT values are listed in Table 2.
m
3AQN enhanced telomeric DNA quadruplex stability by 21.0
°C, which is 3 °C higher than that of the reference compound
3
8
+
360A (Table 2). The ΔT values of 6AQN and 3APN were
m
15.1 and 7.7 °C, respectively (Table 2). Furthermore, duplex
DNA was monitored by CD melting studies to examine the
effect of ligands on duplex stabilization. Even when increasing
the ligand concentration 3-fold, only a slight increase (up to 1.6
°C) of thermal stability was observed (Figure S10A, Supporting
In the absence of monovalent ions, c-kit2 exists predom-
inantly as a parallel structure as evidenced by the major positive
peak at 260 nm and minor negative peak at 240 nm (Figure
4
0
4
E). Increasing the concentrations of 3AQN, 6AQN, and
2
33
dx.doi.org/10.1021/jo201816g | J. Org. Chem. 2012, 77, 229−242

The Journal of Organic Chemistry
Article
Table 2. Thermal Stability of Various Quadruplex DNA and Duplex DNA with Ligands Measured by CD Melting Experiments
a
ΔTm
ligands
telomeric
c-kit1
c-kit2
c-myc
duplex (ds17)
3AQN
6AQN
3APN
360A
21.0 ± 0.4
15.1 ± 0.9
7.7 ± 0.4
17.4 ± 0.8
>20
>20
>25
>25
>30
>30
1.1 ± 0.5
1.6 ± 0.5
1.4 ± 0.4
0
28.9 ± 0.5
>20
23.0 ± 1.2
>25
21.2 ± 0.9
>30
a
ΔT represents difference in thermal melting [ΔTm = Tm (DNA + 3 molar equiv ligand) − T (DNA)]. The buffer used was 10 mM sodium
m
m
cacodylate buffer, pH 7.2. The T values are 44.5 ± 0.4 °C [telomeric DNA (5 μM) in 10 mM NaCl, 90 mM LiCl]; 46.5 ± 0.3 °C [c-kit1 DNA (15
m
μM) in 20 mM KCl, 80 mM LiCl]; 54.0 ± 0.5 °C [c-kit2 DNA (10 μM) in 5 mM KCl, 95 mM LiCl]; 47.6 ± 0.4 °C [c-myc DNA (5 μM) in 100 mM
LiCl]; 63.3 ± 0.5 °C [ds-17 DNA (15 μM) in 100 mM NaCl]. All experiments were triplicated, and the values reported are average of 3
measurements with the estimated standard deviation. The salt concentration was adjusted such that the melting temperature of DNA without ligand
63
is around 50 °C.
Information and Table 2). These results underscore the fact
that ligands selectively stabilize quadruplex DNA over duplex
DNA. The ΔT of values of 3AQN and 6AQN for telomeric
m
DNA and duplex DNA were comparable with that of reference
compound 360A.
The melting temperatures of parallel promoter quadruplex
DNAs such as c-kit1 and c-kit2 were monitored at 263 nm. All
ligands enhanced quadruplex stability similarly to reference
compound 360A (Table 2). Since very high stabilization was
observed with ligands 3AQN, 6AQN, and 360A, we were not
able to determine accurate melting temperatures from the
melting curves (Figure S10B and C, Supporting Information).
Ligand 3APN increased the T of c-kit1 by 28.9 °C and c-kit2
m
by 23 °C. In the case of the highly stable parallel c-myc
quadruplex DNA, thermal denaturation experiments were
+
performed in the absence of K ions. The ligands 3AQN and
6AQN enhanced the stability of the c-myc quadruplex more
than 30 °C (Table 2). Since a stable baseline curve was not
achieved even above 90 °C, accurate measurement of T was
m
also not possible in this case (Figure S10D, Supporting
Information). Tm enhancement of 3AQN and 6AQN were
comparable to that of 360A. Interestingly, ligand 3APN has
enhanced the stability of c-myc quadruplex by 21 °C (Table 2).
This is in agreement with FID studies, where it was found that
Figure 6. Denaturing PAGE for the Taq polymerase based primer
extension stop assay in the presence of 360A, 3AQN, 6AQN, and
3APN binds specifically to c-myc and c-kit1 DNAs. This shows
that 3APN stabilizes promoter quadruplexes much better than
human telomeric quadruplex.
Taq Polymerase Stop Assay. Quadruplex stabilization by
3
APN ligands. (A) Template containing human telomeric DNA with
increasing ligand concentration (0, 0.5, 1, 2, 4 μM). Primer extension
reaction in the presence of 100 mM NaCl at 35 °C. (B) Template
containing c-myc DNA with increasing ligand concentration (0, 0.25,
0.5, 1, 2 μM). Primer extension reaction at 55 °C. Conditions: 200 nM
template, 50 nM primer, 0.2 mM dNTs in Taq polymerase buffer. P
denotes primer. Formation of full length products decreases with
increasing ligand concentration.
the ligands was further tested by concentration-dependent Taq
64
DNA polymerase stop assay. Primer extension of DNA is
inhibited by the stabilization of a quadruplex structure in the
template sequence. DNA templates containing telomeric
sequence and c-myc sequence were used in these studies. For
telomeric DNA, the assay was carried out in the presence of
tration. The IC50 value 360A was slightly higher (∼1.2 μM).
Ligand 3APN did not inhibit the primer extension by Taq
polymerase. These results are in agreement with the results of
FID and CD melting experiments where bisquinolinium
derivatives of naphthyridine (3AQN and 6AQN) exhibit higher
quadruplex binding affinity and melting temperature than the
pyridinium based 3APN ligand.
100 mM NaCl. Though quadruplex formation was favored in
the presence of salts, primer extension was not inhibited in
absence of ligands. This indicates that unstable quadruplex
DNAs unfold easily and can be extended by Taq polymerase
leading to full extension product (Figure 6A). Stabilization of
quadruplex structure by ligands 3AQN, 6AQN, and 360A
inhibited the formation of full length products. As a result, stop
products at the quadruplex forming sites were observed with
increasing ligand concentration (Figure 6A). Normalized stop
products in each lane was plotted against concentration of
ligands, and IC50 values were calculated (Figure S11,
Supporting Information). Ligands 3AQN and 6AQN have
lower IC values of ∼0.8 and ∼0.7 μM, respectively, suggesting
For c-myc DNA, the assay was carried out at 55 °C to
destabilize the preformed quadruplex structures that could
65
otherwise interfere with ligand induced stabilization. A pause
at quadruplex forming sites was observed for extension
products in presence of all ligands (Figure 6B). The reference
compound 360A and ligands 3AQN and 6AQN have lower
IC50 values of ∼0.5, ∼0.7, and ∼1.0 μM, respectively (Figure
50
improved stabilization of quadruplex at lower ligand concen-
2
34
dx.doi.org/10.1021/jo201816g | J. Org. Chem. 2012, 77, 229−242

The Journal of Organic Chemistry
Article
7
0
S11B, Supporting Information). The IC value of ligand 3APN
AMBER 10. The structures shown in Figure 8 are the final
MD snapshot of each complex after 20 ns simulations.
Binding energies were estimated using molecular mechanics
5
0
was found to be more than 2.0 μM with c-myc DNA, suggesting
that at high ligand concentrations, 3APN could stabilize c-myc
quadruplex structure.
71
Poisson−Boltzmann surface area (MM-PBSA) and nmode
analysis. The binding free energy components are summarized
in Table 3. The individual energy components (Table S1,
Supporting Information) allowed a better understanding of the
ligand−quadruplex interaction and their driving forces. For all
complexes the electrostatic energy, van der Waals energy, and
nonpolar solvation energy contributed favorably to the binding
free energies. The electrostatic solvation energy was found to
be unfavorable for all of the ligands. A direct comparison of the
Nondenaturing Gel Electrophoresis. Ligand-induced
quadruplex formation was also studied by nondenaturing gel
electrophoresis. The quadruplex structures, being more
compact, move faster in gel compared to the unfolded
66
nonquadruplex forms. Telomeric DNA was titrated with
ligands in the absence of any added monovalent metal cations.
Interestingly, all ligands except 3APN accelerated the mobility
of telomeric DNA in the gel compared to the DNA in the
absence of ligands (Figure 7). The mobility of bands was
energy components of 3AQN [ΔG
= −89.2 ± 7.4] and
bind
3
60A [ΔG
= −84.8 ± 7.2] (Table S1, Supporting
bind
Information) complexes enables a better understanding of the
structure and activity relationship. van der Waals energy for the
AQN and quadruplex complex (−155.0 kcal mol ) was more
than that of the 360A and quadruplex complex (−128.2 kcal
mol ) (Table S1, Supporting Information). This can be
attributed to the presence of two aromatic rings in the central
core of 3AQN, which makes it a more efficient stacker on G-
quartets than 360A. nmode calculation revealed a more
−1
3
−1
−1
negative ΔS for 3AQN (−62.2 kcal mol ) and 6AQN
−1
−1
(
(
−59.3 kcal mol ) than that of 360A (−43.6 kcal mol )
Table S1, Supporting Information). This indicates a decrease
in the rotational and translational freedom of 3AQN and
AQN upon complexation with G-quadruplex when compared
to those of 360A. Although the number of aromatic rings
possessed by 3AQN and 6AQN are the same, ligand 6AQN
Figure 7. Nondenaturing PAGE of human telomeric DNA (5 μM)
with increasing molar equivalents of ligands (0, 1, 2, and 5) in the
absence of monovalent cations at 4 °C. Induction of stable compact
quadruplex structure by ligands results in accelerated mobility of
telomeric DNA. M denotes unstructured size markers, dT12 and dT22,
and the retarded mobilities of the markers are in agreement with the
6
shows slightly higher binding free energy (ΔG
= −80.4 ±
bind
8.4). This indicates that minor changes in the position of
methylated nitrogen in quinolone play a key role in
determining the binding affinity of the ligands. The crescent-
like scaffold in the 3AQN molecule was maintained during MD
simulation, enabling it to stack more effectively with the G-
quartet (Figure 8A). The planar crescent-like conformation of
68
literature findings.
increased with increasing ligand concentration from 1 to 2
molar equiv. However, the mobility of quadruplex DNA with 5
molar equiv was the same as with 2 molar equiv (Figure 7).
This suggests that complete induction of quadruplex form
might have been attained with 2 equiv of ligands. Hence, no
effect was observed upon further addition of ligands.
Furthermore, the electrophoretic mobilities of quadruplex
structures induced by the ligands in the absence of salts were
higher than the mobility of the T12 marker. This behavior is
similar to the native gel mobility of human telomeric DNA
3AQN is stabilized by strong intramolecular hydrogen bonds
[(N−H···N) indicated as a red dotted line in Figure 8A].
However, a reorientation of the side chain of 6AQN from the
G-quartet surface to the nearby groove/backbone region was
observed, which results in the loss of planarity of the compound
(Figure 8B). This reorientation was not observed in 3AQN or
in 360A (Figure S16, Supporting Information), and this
indicates that the positively charged N-methyl group at the 6-
amino position of the quinoline side chain is attracted by
electrostatic force to the negatively charged backbone atoms
(Figure 8B).
+
67
observed in K conditions. These results are consistent with
the observations from CD studies where ligands, in the absence
of monovalent ions, were shown to induce the telomeric DNA
into quadruplex form. Experiments were also performed in the
presence of NaCl. The addition of ligands did not have any
pronounced effect on the mobility (data not shown). This
The binding free energy of 3APN with quadruplex DNA is
not reported because after 3 ns of MD simulation, 3APN
moved away from the DNA with little disruption of the quartet
(Figure S17, Supporting Information). The pyridine side chains
of 3APN are positively charged and readily interact with the
backbone of the diagonal loop. Also, the pyridinium side chains
failed to form the stacking interaction with the quartet. The
strong interaction between the diagonal loop and side chain of
the ligand increases the distance between the diagonal loop and
the top quartet. Because of this, dG17 moves from the plane of
the quartet followed by dG18 in the middle quartet, which
+
supports the fact that Na induces the quadruplex structures
even in the absence of added ligands. Since the promoter
quadruplexes are much more stable and can be formed even in
the absence of ligands, native gel titrations were not performed
with those DNA sequences.
Molecular Modeling Studies. Initially the ligands were
energy optimized using Hartee-Fock method (HF/6-31G*,
Figures S12−S15, Supporting Information), and then they were
docked to the antiparallel human telomeric G-quadruplex DNA
57
69
+
(
PDB entry 143D) using Autodock. As anticipated, ligands
moves toward the top quartet. Furthermore, the K ion is not
readily bound to the pseudointercalation site at the top quartet.
On the basis of docking results, 20 ns MD simulations were
carried out for all ligands and quadruplex DNA complex using
precisely coordinated when one of the guanines moves away
from the plane of the quartet (Figure S17, Supporting
Information).
2
35
dx.doi.org/10.1021/jo201816g | J. Org. Chem. 2012, 77, 229−242

The Journal of Organic Chemistry
Article
Figure 8. Final MD snapshots of the ligand-quadruplex complexes after 20 ns simulations. Side views (left side) show the ligands bound onto the top
+
quartet of quadruplex DNA. DNA and ligands are represented as stick and sphere, respectively. The K ions, present in between the two quartets, are
shown as purple spheres. Axial views (right side) show the stick representation of top quartet and ligand. Hydrogen bonds present in the quartet are
shown in dotted lines. (A) 3AQN-quadruplex DNA complex. A hydrogen bond between carbonyl oxygen atom of ligand and N2 hydrogen atom of
dG-10 is indicated in red dotted line. (B) 6AQN-quadruplex DNA complex shows the reoriented side chain of the interacts with the backbone/
groove of quadruplex DNA.
−
1
Table 3. Estimated Free Energy of Binding (ΔG, kcal mol )
monitored for all MD trajectories by comparing those with
NMR structure using the ptraj module implemented in
AMBER10 (Figure S18, Supporting Information). By inspect-
ing the rmsd values, it can be concluded that the G-quartets are
stable over the course of simulation with all of the ligands
except 3APN. To investigate the overall stability of quadruplex
DNA, the rmsd values of backbone atoms were monitored. A
sharp increase in rmsds was observed between 2 and 4 ns
simulation in all complexes, which can be attributed to the
backbone relaxation of the starting structure. The complexes
were stabilized after 5 ns, when the rmsd values converged to a
steady state (Figure S18, Supporting Information). The
backbone atoms were not significantly shifted from the starting
structure in three complexes. Although the average rmsd values
were the same for all three, upon close examination of rmsds,
we observed the least change in backbone atoms of the
3AQN−quadruplex complex (2.5 Å) in comparison to the
360A complex (3.5 Å) and 6AQN complex (3.2 Å) (Table S2,
Supporting Information). This is perhaps due to the additional
flexibility of nucleotides in the diagonal loop in the 360A−
for Quadruplex and ds DNA with Each Ligand Calculated
a
from 20 ns MD Simulations
type of DNA
3AQN
6AQN
360A
human telomeric
ds DNA
−89.29 ± 7.49
−25.76 ± 2.3
−80.42 ± 8.42
−30.10 ± 3.4
−84.81 ± 7.28
−39.34 ± 2.12
a
The values reported from MM/PBSA and nmode analysis are the
average values of three independent MD simulations of the G-
quadruplex DNA and ligand complex. Different ligand conformations
at the same binding mode or position from docking results were used
in each MD run. As there was no significant interaction found between
3
APN and quadruplex DNA after 3 ns of MD simulation, its energy
value is not reported here.
The stability of the ligand−quadruplex structures after 20 ns
MD simulations is examined by measuring the root-mean-
square deviation (rmsd) values of the heavy atoms of ligands
and DNA and H-bond occupancies in the quartets and between
ligand and DNA, and by performing single point energy
calculations. rmsd values for heavy atoms in the G-quartet were
2
36
dx.doi.org/10.1021/jo201816g | J. Org. Chem. 2012, 77, 229−242

The Journal of Organic Chemistry
Article
quadruplex complex. To investigate this further, averaged
structures (Figure S19, Supporting Information) were obtained
from MD simulation snapshots that were taken from the final
In order to determine the selectivity of the ligands toward
quadruplex DNA over duplex DNA, the interaction between
the ligands and ds DNA (17 bp) was examined using 20 ns of
MD simulation by employing the same protocol used for
quadruplex and ligand simulations. The final MD snapshot of
ds DNA and ligands, (Figure S22, Supporting Information)
binding energy values (Table 3 and Table S5, Supporting
Information), and rmsd graphs (Figure S23, Supporting
Information) showed that, overall, the ligands neither stabilize
nor destabilize the ds DNA.
1
0 ns of the MD trajectory with an interval of every 20 ps. The
averaged structures were superimposed onto their correspond-
ing initial equilibrated docked structures. It can be clearly seen
that the 3AQN binding to G-quartet has better backbone
stability compared to the binding of 360A (Figure S19,
Supporting Information). The ligand conformational changes
were also analyzed using rmsd values. Larger rmsd fluctuation
was observed in 6AQN because of the reorientation of its
quinolinium side chain as mentioned earlier; rmsd values of the
ligand heavy atoms show that 3AQN has rmsd (0.81 Å) lower
than those of 6AQN (1.07 Å) and 360A (1.04 Å) (Table S2,
Supporting Information). Further, the movements of metal ions
inside the quartet cavity and ions in the solvent were observed
CONCLUSIONS
■
We have synthesized three novel amide derivatives of 1,8-
napthyridine and studied their interaction with various
quadruplex DNAs. The FID assay indicates that naphthyridine
bisquinolinium ligands 3AQN and 6AQN have high binding
affinity and selectivity for quadruplex DNAs over duplex DNA.
Moreover, the concentration-dependent Taq polymerase stop
assay shows that ligands at low concentration stabilize the
quadruplex and thus inhibit the Taq polymerase enzyme
activity. Ligand 3APN with pyridinium side chains does not
stabilize the human telomeric quadruplex, which clearly
suggests that unstable quadruplexes can be easily unwound
and extended by polymerase enzymes.
+
during MD simulations. The K metal cation on the outermost
exposed quartet was released into the solvent. However, the
+
other two K ions stayed stable during simulations (Figure S20,
Supporting Information).
To study the impact of ligand binding to the G-quartet, the
hydrogen bond (N −H···N7 and N1−H···O6) occupancies of
2
the quartet were calculated along all MD trajectories (Table S3,
Supporting Information). The inner hydrogen bond occupan-
cies in the middle and the bottom quartets were less than that
for the top ligand bound G-quartet. The average hydrogen
bond occupancy of all of the three G-quartets was slightly
higher for the 3AQN complex when compared to the 6AQN
and 360A complexes (Table S3, Supporting Information). This
suggests that 3AQN binding imparts more stability to G-
quartets. Hydrogen bond interactions between the quadruplex
and ligand were computed over the last 10 ns MD trajectories
keeping the distance cutoff as 3.0 Å and 35° of angle deviation.
There was only one stable hydrogen bond formed by the
CD studies show that ligands 3AQN and 6AQN induce and
stabilize only the antiparallel quadruplex form of human
telomeric DNA in both the absence and presence of
monovalent cations. Though 3APN induces the same form in
the absence of cations, it does not induce the antiparallel form
+
in the presence of K ions. This result indicates that formation
of the antiparallel quadruplex from the highly stable telomeric
+
quadruplex in K ions require strong stabilizing agents having
quinolinium side chains. It should be noted that the highly
potent quadruplex stabilizing ligand telomestatin also induces a
basket-type antiparallel quadruplex form in solution in the
3
AQN carbonyl oxygen atom with DNA (NH2 atom in
Guanine-10 at the top quartet) (Figure 8A). Additionally,
AQN and 6AQN interact with thymine base of diagonal loop
+
62
presence of K ions. In fact, a recent study shows that the
parallel form of telomeric quadruplex may not be biologically
3
73
by means of π−π stacking (Figure S21, Supporting
Information).
relevant. Therefore, ligands that could induce only antiparallel
quadruplex topology of human telomeric DNA may find use in
the therapeutic arena. Furthermore, stabilization of quadruplex
structures by ligands revealed by CD melting suggests that all
ligands could only stabilize quadruplex DNA structures and not
duplex DNA. More interestingly, ligand 3APN exhibited
enhanced stabilization of promoter quadruplexes (c-myc, c-
kit1, and c-kit2) and weak stabilization of telomeric quadruplex.
This underscores the importance of the side chains of ligands in
quadruplex topology recognition. Ligand 3APN could possibly
be fine-tuned to impart selective recognition of promoter
quadruplex topologies.
Since G-quartets are stacked together by π−π interactions,
stacking energies between the quartets with and without ligand
bound were calculated to investigate the impact of small
molecules on quadruplex stabilization. All single point energies
were calculated using BH&H/6-311++ G (d,p) in Gaus-
7
2
sian03. In the absence of ions, the stacking energy between
G-quartets was found to be −186.7 kcal/mol, and a further
decrease in stacking energy was observed upon ligand binding
to the ion-free G-quadruplex DNA (Table S4, Supporting
Information). It is thus clear that ligands have a strong impact
on the stabilization of quadruplex DNA even in the absence of
any ions. It was also evident that the quadruplex structure in the
geometry of the 3AQN complex has stronger interquartet
interactions (−217.1 kcal/mol) (Table S4, Supporting
Information). Quadruplexes in the 6AQN (−209.4 kcal/mol)
and 360A (−210.6 kcal/mol) complex has approximately the
same interquartet interactions (Table S4, Supporting Informa-
tion). Also, no effect was observed in the interaction of the last
quartet when the ligand bound to the top quartet. Along with
the ligands, addition of K+ ions resulted in considerable
Modeling studies provide the relative stability of DNA
quadruplex−ligand complexes. The rmsd, single point energy,
and binding energy calculations from molecular dynamics
studies suggest that the 3AQN−quadruplex DNA complex is
the most stable among the four ligand−quadruplex DNA
complexes studied. It is interesting to note that the position of
the positive charge in the quinoline side chains appears to play
an important role in the orientation of the ligand when bound
to quadruplex DNA. Ligand 3APN contains a small pyridinium
side chain, which is inefficient in forming a strong stacking
interaction with the G-quartet. Instead, it is involved in
electrostatic interactions with the backbone of the diagonal
loop that leads to the disruption of quadruplex DNA. Ligands
3AQN and 6AQN with naphthyridine as the central core are
+
stabilization of quartets. In the presence of K ions, 3AQN has
more effect on quartet stabilization; while 6AQN and 360A
bound quartets have similar interquartet stacking energy (Table
S4, Supporting Information).
2
37
dx.doi.org/10.1021/jo201816g | J. Org. Chem. 2012, 77, 229−242

The Journal of Organic Chemistry
Article
able to impart increased stability to quadruplex structures in
comparison to 360A, which has pyridine as the central moiety.
Although achieving selectivity among various quadruplex
topologies is considered to be an important challenge, a recent
study shows that ligands that target and stabilize more than one
type of quadruplex topologies (telomeric and c-kit) could still
impart high anticancer activity. Our studies indicate that
further optimization of side chains could provide discriminatory
ability to ligands in targeting the loops of different quadruplex
topologies. This in turn could lead to enhanced selectivity
between various quadruplex structures.
mmol), HOBt (25 mg, 0.18 mmol), and DMAP (22 mg, 0.18 mmol)
1
were used (210 mg, 48% yield). R = 0.38 (5% MeOH in DCM); H
f
NMR (300 MHz, DMSO-d ) δ 11.40 (s, 2H), 9.36 (d, J = 2.6 Hz, 2
6
H), 9.02 (d, J = 2.6 Hz, 2H), 8.93 (d, J = 8.4 Hz, 2 H), 8.51 (d, J = 8.4
1
3
Hz, 2 H), 8.02 (d, J = 8.4 Hz, 4H), 7.74−7.61 (m, 4H); C NMR
(
100 MHz, DMSO-d ) δ 163.4, 154.0, 152.5, 145.6, 144.7, 140.4,
6
1
32.1, 128.7, 128.5, 128, 127.7, 127.3, 125.6, 123.9, 121.5; HRMS
74
+
(
−
ESI) calcd for C H N O [M + H] 471.1569, found 471.1559 (Δm
28
19
6
2
0.0010, error −2.3 ppm).
N,N′-Di(quinolin-6-yl)-1,8-naphthyridine-2,7-dicarboxamide
(4b). Compound 3 (200 mg, 0.92 mmol) in 8 mL of dry DMF, 6-
aminoquinoline (264 mg, 1.83 mmol), EDC·HCl (440 mg, 2.30
mmol), HOBt (25 mg, 0.18 mmol), and DMAP (22 mg, 0.18 mmol)
In summary, this study presents an organized approach to
ascertain the importance of the central aromatic core of ligands
in quadruplex stabilization, which has been an important
criterion for design of quadruplex stabilizing ligands. Addition-
ally, our studies underscore the importance of side chains in
recognizing loops and discriminating among various quadruplex
topologies. Taken together, the results presented here clearly
suggest that naphthyridine derivatives are an important class of
G-quadruplex stabilizing agents with strong discrimination
against duplex DNA. Moreover, strong quadruplex stabilizing
agents such as the ones reported here may find applications to
1
were used (222 mg, 51% yield). R = 0.52 (5% MeOH in DCM); H
f
NMR (300 MHz, DMSO-d ) δ 11.22 (s, 2 H), 8.92−8.85 (m, 4 H),
6
8
.71 (s, 2 H), 8.49 (d, J = 8.4 Hz, 2 H), 8.38 (d, J = 8.1 Hz, 2 H), 8.27
(
d, J = 8.4 Hz, 2 H), 8.08 (d, J = 8.8 Hz, 2 H), 7.54 (dd, J = 8.1, 4.0
13
Hz, 2 H); C NMR (100 MHz, DMSO-d ) δ 162.8, 154.1, 152.3,
6
1
49.6, 145.1, 140.3, 136.2, 135.8, 129.6, 128.3, 125.4, 124.2, 122.0,
+
121.3, 116.6; HRMS (ESI) calcd for C H N O [M + H] 471.1 569,
28
19
6
2
found 471.1552 (Δm −0.0017, error −3.7 ppm).
N,N′-Di(pyridin-3-yl)-1,8-naphthyridine-2,7-dicarboxamide
(
4c). Compound 3 (100 mg, 0.45 mmol) in 4 mL dry DMF, 3-
aminopyridine (94 mg, 1.0 mmol), EDC·HCl (220 mg, 1.14 mmol),
42
HOBt (12 mg, 0.08 mmol) and DMAP (22 mg, 0.18 mmol) were used
sequester quadruplex forming sequences in vivo.
1
(
40 mg, 23%). R = 0.16 (5% MeOH in DCM); H NMR (300 MHz,
f
DMSO-d ) δ 11.14 (s, 2 H), 9.13 (d, J = 1.8 Hz, 2 H), 8.90 (d, J = 8.4
6
EXPERIMENTAL SECTION
General. Thin-layer chromatography (TLC) was performed on
Hz, 2 H), 8.45 (d, J = 8.4 Hz, 2 H), 8.39−8.36 (m, 4 H), 7.47 (dd, J =
■
8
1
.4, 4.8 Hz, 2 H); 13C NMR (100 MHz, DMSO-d ) δ 163.2, 154.0,
6
52.4, 144.7, 141.7, 140.3, 135.2, 128.1, 125.5, 124.0, 121.5; HRMS
silica gel plates precoated with fluorescent indicator with visualization
+
1
13
(ESI) calcd for C H N O [M + H] 371.1256, found 371.1267 (Δm
+0.0011, error +2.9 ppm).
by UV light (254 nm). H NMR (400 or 300 MHz), C NMR (100
20 15
6
2
MHz), and 19F NMR (376 MHz) were recorded on a 400 or 300 MHz
General Procedure for N-Methylation of Side Chains. To a
stirred solution of corresponding amine compound (1 equiv) in dry
DMF (2 mL) was added methyl triflate (∼58 equiv). It was heated at
instrument. The chemical shifts in parts per million were referenced to
1
the residual proton signal of deuterium solvents ( H NMR CDCl : δ
3
1
3
1
7
.26 ppm; C NMR CDCl : δ 77.2 ppm; H NMR DMSO-d : δ 2.50
3
6
13
1
8
0 °C, and stirring was continued for 4 days. The reaction mixture was
ppm; C NMR DMSO-d : δ 39.5 ppm). Multiplicities of H NMR
6
then cooled to room temperature followed by keeping at −20 °C for 3
h. The cooled reaction mixture was filtered through sintered funnel,
and the residue was washed with cold acetone and diethyl ether to
furnish the desired product.
spin couplings are reported as s (singlet), d (doublet), t (triplet), q
(
quartet), dd (doublet of doublets), or m (multiplet and overlapping
spin systems). Values for apparent coupling constants (J) are reported
in hertz. High resolution mass spectra (HRMS) were obtained in
positive ion electrospray ionization (ESI) mode. DNA sequences were
synthesized using automated synthesizer by employing standard
phosphoramidite chemistry.
3,3′-[1,8-Naphthyridinediyl-2,7-bis(carbonylimino)]bis(1-
methylquinolinium)triflate (3AQN). Compound 4a (50 mg, 0.106
mmol) in dry DMF (2 mL) and methyl triflate (0.7 mL, 6.19 mmol)
1
were used (47 mg, 55% yield). H NMR (400 MHz, DMSO-d ) δ
Preparation of 2,7-Dimethyl-1,8-naphthyridiene (2). To a
6
51
1
1.92 (s, 2 H), 10.07 (d, J = 1.8 Hz, 2H), 9.64 (s, 2H), 9.01 (d, J = 8.5
solution of compound 1 (4 g, 20.7 mmol) and ammonium formate
6.5 g, 103.2 mmol) in methanol (70 mL) and water (4 mL) was
Hz, 2H), 8.56−8.50 (m, 6H), 8.24−8.20 (m, 2H), 8.06 (t, J = 7.5 Hz,
(
2
1
H), 4.74 (s, 6H); 13C NMR (100 MHz, DMSO-d ) δ 164.0, 153.4,
added a small piece of dry ice to make an oxygen-free atmosphere. To
this solution was added Pd (10%)/C (1 g), and the reaction mixture
was stirred for 6 h in room temperature. Then the reaction mixture
was filtered through a Celite pad, and the filtrate was evaporated. The
resulting residue was dissolved in DCM (200 mL) and washed with
water (100 mL). The organic layer was dried over anhydrous Na SO .
6
52.6, 145.0, 141.1, 135.9, 134.7, 134.3, 132.8, 130.6, 130.2, 129.4,
19
126.3, 122.0, 119.3, 46.4; F NMR (376 MHz, DMSO-d
HRMS m/z calcd for C30
) δ −77.8;
H N O [M/2] 250.0980, found 250.0981
24 6 2
6
+
(Δm +0.0001, error +0.4 ppm).
6,6′-[1,8-Naphthyridinediyl-2,7-bis(carbonylimino)]bis(1-
methylquinolinium)triflate (6AQN). Compound 4b (50 mg, 0.106
2
4
Solvent was removed under reduced pressure to furnish compound 2
mmol) in dry DMF (2 mL), methyl triflate (0.7 mL, 6.19 mmol) were
as a yellow solid (2.8 g, 86% yield). R = 0.40 (5% MeOH in DCM);
f
1
1
used (44 mg, 52% yield). H NMR (400 MHz, DMSO-d ) δ 11.66 (s,
H NMR (400 MHz, CDCl ) δ 8.01 (d, J = 8.0 Hz, 2H), 7.31(d, J =
6
3
.0 Hz, 2H), 2.78 (s, 6H); 13C NMR (100 MHz) δ 162.7, 155.7, 136.6,
2H, N−H), 9.39 (d, J = 5.5 Hz, 2H), 9.30 (d, J = 8.3 Hz, 2H), 9.19 (d,
J = 2.3 Hz, 2H), 8.96 (d, J = 8.3 Hz, 2H), 8.71 (dd, J = 2.3, 9.7 Hz,
8
1
1
22.2, 118.7, 25.7; HRMS (ESI) calcd for C H N (M + H)
10
11
2
2
8
H), 8.64−8.59 (m, 2H), 8.52 (d, J = 8.3 Hz, 2H), 8.15 (dd, J = 5.8,
59.0922 found 159.0919 (Δm −0.0003, error −1.8 ppm).
.3 Hz, 2H), 4.65 (s, 6H); 13C NMR (100 MHz, DMSO-d ) δ 163.7,
General Procedure for Introduction of Amide Side Chains in
6
the Naphthyridine Core. To a stirred solution of diacid compound
153.9, 152.4, 148.6, 146.5, 140.6, 139.1, 135.4, 130.2, 129.4, 125.8,
53,54
19
3
(1 equiv) in 8 mL dry DMF under N atm were added the
122.5, 121.7, 120.3, 117.6, 45.3. F NMR (376 MHz, DMSO-d
6
) δ
−77.7; HRMS (ESI) calcd for C30H N O [M/2] 250.0980, found
24 6 2
2
+
corresponding amine (2 equiv), EDC·HCl (2.5 equiv), HOBt (0.2
equiv), and DMAP (0.2 equiv). The mixture was stirred for 24 h at
room temperature and then kept in a freezer for 6 h. The precipitate
formed was filtered through a sintered funnel and washed with
250.0977 (Δm −0.0003, error −1.2 ppm).
3,3′-[1,8-Naphthyridinediyl-2,7-bis(carbonylimino)]bis[1-
methylpyridinium]triflate (3APN). Compound 4c (40 mg, 0.108
saturated NaHCO , water, acetone, and diethyl ether to furnish the
mmol) in dry DMF (2 mL) and methyl triflate (0.7 mL, 6.19 mmol)
3
1
amide.
were used (43 mg, 57% yield). H NMR (400 MHz, DMSO-d
6
) δ
N,N′-Di(quinolin-3-yl)-1,8-naphthyridine-2,7-dicarboxamide
11.89 (s, 2H, N−H), 9.66 (s, 2H), 8.98 (d, J = 8.5 Hz, 2H), 8.89 (d, J
(
4a). Compound 3 (200 mg, 0.92 mmol) in 8 mL of dry DMF, 3-
= 8.5 Hz, 2H), 8.81 (d, J = 5.8 Hz, 2H), 8.50 (d, J = 8.5 Hz, 2H), 8.19
aminoquinoline (264 mg, 1.83 mmol), EDC·HCl (440 mg, 2.30
(dd, J = 5.9, 8.7 Hz, 2H), 4.45 (s, 6H); 13C NMR (DMSO-d , 100
6
2
38
dx.doi.org/10.1021/jo201816g | J. Org. Chem. 2012, 77, 229−242

The Journal of Organic Chemistry
Article
MHz) δ 163.9, 153.3, 152.4, 141.0, 140.8, 138.4, 136.9, 135.2, 128.0,
purified using a QIAquick nucleotide removal kit protocol provided by
Qiagen.
1
26.1, 122.3, 121.9, 48.7; 19F NMR (DMSO-d , 376 MHz) δ −77.7;
6
+
HRMS (ESI) calcd for C H N O [M/2] 200.0824, found 200.0816
DNA Polymerase Stop Assay. This assay was done as reported
22
20
6
2
6
4
(
Δm −0.0008, error −4.1 ppm).
,3′-[2,6-Pyridinediylbis(carbonylimino)]bis[1-
methylquinolinium]triflate (360A). The N,N′-bis(3-quilonyl)-
previously with slight modifications. Appropriate amount of labeled
primer oligonucleotide [∼15,000 counts per minute (CPM)] was
mixed with cold primer (50 nM) and template (200 nM). They were
annealed using an annealing buffer (5 mM Tris pH 7.5, 115 mM NaCl,
0.1 mM EDTA) by heating at 90 °C for 5 min followed by gradual
cooling to room temperature over 4−5 h. For c-myc stop assay,
corresponding primer−template duplex was annealed in the absence of
15 mM NaCl (5 mM Tris (pH 7.5), 0.1 mM EDTA). The annealed
primer−template was mixed with polymerase buffer [50 mM Tris, 0.5
mM DTT, 0.1 mM EDTA, 10 mM NaCl, 5 mM MgCl, 1 μg/μL BSA]
and dNTP (0.2 mM). The ligands in appropriate concentration were
added to the reaction mixture (10 μL total volume) and incubated for
30 min at room temperature. The primer extension reaction was
initiated by the addition of Taq DNA polymerase (0.5 U), and the
reactions were incubated at 35 and 55 °C for 30 min for telomeric and
c-myc DNA, respectively. The extension reaction was stopped by
adding 10 μL of 2× stop buffer (10 mM EDTA, 10 mM NaOH, 0.1%
each bromophenol blue (w/v) and xylene cyanole (w/v) in
formamide). The products were analyzed in 15% denaturing PAGE
3
75
pyridine-2,6-dicarboxamide (0.05 g, 0.119 mmol) in dry DMF (2
mL) and methyl triflate (0.8 mL, 7.07 mmol) were used (51 mg, 57%
1
yield). R = 0.35 (7% MeOH in DCM). H NMR (400 MHz, DMSO-
f
d ) δ 11.89 (s, 2H), 10.10 (s, 2H), 9.65 (s, 2H), 8.59−8.47 (m, 7H),
6
13
8
.24 (t, J = 8.0 Hz, 2H), 8.09 (t, J = 8.0 Hz, 2H), 4.78 (s, 6H); C
NMR (100 MHz, DMSO-d ) δ 162.5, 147. 5, 144.7, 141.2, 135.9,
6
19
1
34.5, 134.2, 132.3, 130.5, 130.0,129.3, 126.5, 122.3, 119.3, 49.2; F
NMR (DMSO-d , 376 MHz) δ −77.77; HRMS (ESI) calcd for
6
+
C H N O [M] 449.1852, found 449.1854 (Δm +0.0002, error +0.5
2
7
23
5
2
ppm).
Oligonucleotides. The following oligonucleotide sequences were
used for FID and CD and native gel experiments: human telomeric
DNA sequence (22AG: 5′-AGGGTTAGGGTTAGGGTTAGGG-3′);
self-complementary duplex sequence (ds26: 5′-CAATCGGATC-
GAATTCGATCCGATTG-3′); duplex sequence (ds17: 5′-
CCAGTTCGTAGTAACCC-3′and its complementary sequence 5′-
GGGTTACTA CGAACTGG-3′) and promoter DNA sequences (c-
kit1: 5′-GGGAGGGCGCTGGGAGGAGGG-3′; c-kit2: 5′-
GGGCGGGCGCGAGGGAGGGG-3′; c-myc: 5′-TGAGGGTGGG-
TAGGGTGGGTAA-3′). For Taq polymerase stop assay, primer
sequence (5′-ACGACTCACTATAGCAATTGCG-3′), template con-
taining telomeric DNA sequence (5′-AGGGTTAGGGTTAGGGT-
TAGGGGCCACCGCAATTGCTATAGTGAGTCGT-3′, where bold
letters indicate quadruplex forming region) and template containing c-
myc sequence (5′-TGAGGGTGGGTAGGGTGGGTAAGCCACCG-
CAATTGCTATAGTGAGTCGT -3′, where bold letters indicate
quadruplex forming region) were used. All sequences were synthesized
on 0.2 μmol scale with appropriate controlled pore glass (CPG) beads
used as 3′ solid support. All oligonucleotides were deprotected and
PAGE (20%, 7 M urea) purified employing standard protocols. The
concentration of all oligonucleotides was measured at 260 nm in UV−
vis spectrophotometer using appropriate molar extinction coefficients
(
2
7 M urea) in which 1× TBE (89 mM of each Tris and boric acid and
mM of EDTA, pH 8.3) was used as running buffer. Autoradiograms
were generated and bands were quantified by ImageQuantTL software
provided by GE healthcare.
Nondenaturing Gel Electrophoresis. Appropriate amount of
labeled oligonucleotides (∼14,000 CPM) was mixed with correspond-
ing cold oligonucleotides (5 μM in 10 mM Tris pH 7.2). Various
amounts (1−5 equiv) of ligands were incubated with DNA at 4 °C for
overnight. The total volume was 10 μL. Prior to loading the reaction
mixture onto the gel, 1 μL of 10× glycerol dye [60% glycerol (v/v),
0
.1% each bromophenol blue and xylene cyanol (w/v)] was added.
Analysis was carried out in 15% native PAGE at 4 °C in which 1× TB
89 mM of each Tris and boric acid, pH 8.3) was used as running
buffer.
CD Titrations and Melting. CD spectra were measured in the
(
wavelength range of 225−330 nm using a quartz cuvette with 1.0 mm
path length. The scanning speed of the instrument was set to 100 nm/
min, and response time used was 2 s. The strand concentration of
oligonucleotide used was 12.5 μM, and ligand stock solution used was
(ε). The integrity of oligonucleotides was confirmed by negative mode
of ESI-MS analysis.
Fluorescence Intercalator Displacement Assay. The FID
assay was carried out as described by Teulade-Fichou and co-
1
mM in water. The quadruplex DNA solutions were annealed by
heating corresponding quadruplex forming DNA (12.5 μM) with
76
workers. The quadruplex forming DNA (0.25 μM) in KCl (100
NaCl (100 mM) or KCl (100 mM) in Tris (50 mM, pH 7.2) buffer at
mM) or NaCl (100 mM) and sodium cacodylate buffer (10 mM, pH
9
5 °C for 5 min and cooling in ice for 10 min. For the studies without
7.2) were annealed by heating at 95 °C for 5 min and cooling in ice for
salt, DNA (12.5 μM) in Tris (50 mM, pH 7.2) buffer was used. Each
spectrum was an average of 3 measurements at 25 °C. All spectra were
baseline corrected and analyzed using Origin 8.0 software.
10 min. Two molar equivalents of thiazole orange (TO, 0.5 μM for
quadruplex DNA) or 3 molar equiv (0.75 μM for duplex DNA) was
added. After TO addition, 2−3 h equilibration time was provided.
Experiments were performed at 20 °C by using thermostatted cell
holders. The excitation and emission wavelength used were 501 and
For melting studies, 5−15 μM strand concentration of oligonucleo-
tide in 10 mM sodium cacodylate (pH 7.2), required amount of
monovalent salts such as LiCl, KCl, or NaCl, and 3 molar equiv of
ligands (15−45 μM) were used. Telomeric DNA (5 μM DNA in 10
mM NaCl and 90 mM LiCl), c-kit1 (15 μM DNA in 20 mM KCl and
5
10−750 nm, respectively, and the slit width was 5 nm. Ligands stock
solution were made (500 μM) in DMSO. Each addition of ligand
from 0 to 10 equiv, i.e., 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.8, 1.0, 1.25, 1.5,
.0, and 2.5 μM) was followed by 3−4 min equilibration period. Each
(
2
8
0 mM LiCl), c-kit2 (10 μM DNA in 5 mM KCl, and 95 mM LiCl), c-
myc quadruplex (5 μM in 100 mM LiCl), and duplex DNA (15 μM
ds17 in 100 mM NaCl) were annealed by heating at 95 °C for 5 min
followed by gradual cooling to room temperature. Thermal melting
was monitored at 295, 263, and 274 nm for telomeric, promoter and
duplex DNAs, respectively, at the heating rate of 1 °C/min. The
melting temperatures were determined from curve fit of melting
profiles using two state transition model implemented in Kaleida-
curve was integrated using Origin 8.0 software to get the fluorescence
area. The fluorescence area was converted into percentage of
displacement (PD) by using the following equation. PD = 100 −
[
(FA/FA ) × 100]; FA is fluorescence area of DNA−TO complex
0
0
alone (without ligand), and FA is fluorescence area in the presence of
added ligand. FID curves were obtained by plotting percentage of
displacement versus concentration of ligand used.
7
7
Graph.
5
′-End Radiolabeling of Oligonucleotides. Labeling of
Molecular Modeling Studies. The binding mode and interaction
of ligand−G-quadruplex DNA complexes were studied by performing
docking, molecular dynamics, and binding energy evaluation by
oligonucleotide was carried out for stop assay and native gel. The
DNA (10 pmol) was mixed with T4 polynucleotide kinase (PNK)
enzyme (5 U) and [γ- P] ATP (3000 Ci/mmol) in 1 x PNK buffer
50 mM Tris-HCl (pH 7.6), 10 mM MgCl , 5 mM DTT, 0.1 mM each
32
78
following the protocol reported by Haider and Neidle. The
(
coordinates were derived from PDB code 143D, which is a 6 solution
2
spermidine and EDTA) in a total volume of 10 μL. The reaction
mixture was incubated at 37 °C for 1 h followed by deactivation of
enzyme by heating at 70 °C for 3 min. The end labeled DNA was then
NMR structure of human telomeric unimolecular antiparallel basket-
5
7
type G-quadruplex. The single point energies were calculated for all
79
of the 6 models in NMR structures using AMBER force-field FF03.
2
39
dx.doi.org/10.1021/jo201816g | J. Org. Chem. 2012, 77, 229−242

The Journal of Organic Chemistry
Article
The structure with the lowest energy was taken as our study model.
AMBER 10. All of the structures were visualized and the figures were
generated using PyMOL v0.99 (http://www.pymol.org).
78
The pseudointercalation binding site was created between the
diagonal loop (TTA) and the top G-Quartet using Biopolymer
building module implemented in Discovery Studio 2.5 from Accelrys
ASSOCIATED CONTENT
Supporting Information
80
■
Inc. Ligand structures were constructed and optimized with Gaussian
*
S
7
2
03
using Hartree−Fock method with 6-31G* as the basis set.
69
Additional experimental data from FID assays, CD titrations,
polymerase stop assay, molecular modeling studies, ESI-MS
data of oligonucleotides, and copies of NMR spectra of all of
the compounds. This material is available free of charge via the
Internet at http://pubs.acs.org.
Docking studies were performed with Autodock4.0 program. Auto
dock-tools (ADT) was used to merge the nonpolar hydrogens of the
quadruplex DNA to their corresponding carbons. Following this partial
atomic charges were assigned. Similarly for the ligands, ADT was used
to merge nonpolar hydrogens and assign rotatable bonds. Grid maps
were generated for each atom type in the ligand using Auto grid. An
active site box was created and centered at the quadruplex DNA with a
grid spacing of 0.375 Å. Docking calculations were performed using
Lamarckian genetic algorithm. A population of random individuals
AUTHOR INFORMATION
Corresponding Author
E-mail: pradeep@chem.iitb.ac.in.
■
*
(
size 150) was used with a maximum number of 25,000,000 energy
evaluations, a maximum number of 27,000 generations and a mutation
rate of 0.02. For each ligand, 200 independent dockings were carried
out. The resulting positions were subsequently clustered according to a
root-mean-square criterion of 0.5 Å.
Present Addresses
Department of Chemistry, University of Illinois at Urban-
§
a−Champaign, Illinois, USA.
‡
Department of Chemistry, University of Konstanz, Germany.
On the basis of the structures derived from docking studies, MD
studies were carried out for the complexes with the SANDER module
in AMBER 10 with FF03 force field for DNA. Generalized AMBER
ACKNOWLEDGMENTS
■
8
1
We are thankful to Computer Center, IIT Bombay and BRAF-
CDAC, Pune for providing computing facility and SAIF-IIT
Bombay for NMR spectra. We are also thankful to Dr. Claudia
Hobartner and Benjamin Brandsen for critical reading of the
manuscript; Prof. David A. Case for waiving of the licensing fee
for AMBER 10; Dr. Ashok K. Varma for providing access to
Discovery Studio; Prof. Raghavan B. Sunoj, Sudarshan Wadkar,
and Rajeev, R. for giving valuable suggestions and their help in
performing single point energy calculations; Dr. Ruchi Anand
for providing access to her laboratory facilities; Prof. Marie-
Paule Teulade-Fichou and Eric Largy for their advice on FID
assay; and Prof. Philip C. Bevilacqua and Betsy Whitman for
their assistance in melting curve analysis using Kaleidagraph.
This work was financially supported by grants from Council of
Scientific and Industrial Research (CSIR, 01-2233/08/EMR-
II)-Government of India; IRCC-IIT Bombay; Department of
Biotechnology (DBT)-Government of India (BT/PR10693/
AGR/36/586/2008); and Department of Science and Tech-
nology (DST)-Government of India (FAST track scheme, SR/
FT/LS-133/2008). P.I.P is a recipient of Max-Planck India
Fellowship (MPG-DST scheme). V.D thanks CSIR for the
fellowship.
force field (GAFF) parameters were used for the ligand molecule.
Partial atomic charges obtained with the restrained electrostatic
82
potential (RESP) were calculated using the Gaussian03 program at
HF/6-31G* level. The charges were assigned to the atoms using the
Antechamber program in AMBER 10. For MD simulations, G-
quadruplex DNA and ligands were solvated by a truncated octahedron
TIP3P water box extending to a distance of 10 Å from any solute
+
atom, which yielded 4500−4900 water molecules. K ions were added
+
to neutralize the DNA backbone charges, and three K ions were
manually added in the core of the G-quartets. The solvated structures
were subjected to two stages of minimization by using the well-defined
78
parameters. Subsequently, constant pressure MD simulation of 20 ns
was then performed in an NPT ensemble at 1 atm and 300 K. The
hydrogen bonds were constrained using SHAKE algorithm. For the
nonbonded interaction the residue based cutoff of 10 Å was used. The
output and trajectory files were saved for every 0.1 and 1 ps
respectively for the subsequent analysis. All trajectory analysis was
done with the ptraj module in the AMBER 10 suite and examined
8
3
visually using the Visual Molecular Dynamics (VMD).
71
In MM/PBSA calculations, all of the ions and water molecules
were removed except the ions present in the core of the G-quadruplex.
Independent free energy estimates for the complex formed by G-
quadruplex and ligands were calculated from the collected snapshots
7
0
using the MM/PBSA energy analysis in AMBER 10. The solute
entropic contribution (TΔS) was estimated with the nmode module.
The Poisson−Boltzmann polar solvation free energy (ΔG ) was
REFERENCES
PB
■
obtained with a built-in PBSA module in AMBER 10. The nonpolar
(
1) Burge, S.; Parkinson, G. N.; Hazel, P.; Todd, A. K.; Neidle, S.
Nucleic Acids Res. 2006, 34, 5402−5415.
2) Patel, D. J.; Phan, A. T.; Kuryavyi, V. Nucleic Acids Res. 2007, 35,
solvation free energy (ΔG ), calculated by MOLSURF, was directly
np
84
related to the solvent-accessible surface area (SASA). To study the
impact of the ligand binding to the stability of the G-quartet, the
hydrogen bond occupancies of the G-quartet were calculated along all
MD trajectories.
(
7429−7455.
(3) Wright, W. E.; Tesmer, V. M.; Huffman, K. E.; Levene, S. D.;
Shay, J. W. Genes Dev. 1997, 11, 2801−2809.
(4) Huppert, J. L.; Balasubramanian, S. Nucleic Acids Res. 2007, 35,
406−413.
85
Single point energy calculations were carried out to study π−π
stacking with the Becke’s half-and-half functional (BH&H/6-311++G
(
d, p)) method in Gaussian. In these calculations the G-quadruplex
(5) Rankin, S.; Reszka, A. P.; Huppert, J.; Zloh, M.; Parkinson, G. N.;
Todd, A. K.; Ladame, S.; Balasubramanian, S.; Neidle, S. J. Am. Chem.
Soc. 2005, 127, 10584−10589.
structures emerged from 20 ns MD simulations were studied after
removing the ligands. The G-quadruplex DNA is excised to the central
+
core of 12 guanine bases containing two K ions. Dangling bonds on
(6) Agarwal, T.; Roy, S.; Chakraborty, T. K.; Maiti, S. Biochemistry
2010, 49, 8388−8397.
the guanines were terminated with hydrogen atoms leaving a total of
194 atoms. To compare the ligand impact on quartet stabilization,
(7) Balasubramanian, S.; Hurley, L. H.; Neidle, S. Nat. Rev. Drug
Discovery 2011, 10, 261−275.
stacking energy of G-quartets in the starting NMR structure was also
computed.
Molecular modeling studies of the interactions between ligand and
duplex DNA were performed following the same procedures and
parameters described for quadruplex-ligand complexes. A double
stranded duplex DNA (17 bp) was built using nucgen implemented in
(8) Eddy, J.; Maizels, N. Nucleic Acids Res. 2008, 36, 1321−1333.
(9) Huppert, J. L.; Bugaut, A.; Kumari, S.; Balasubramanian, S.
Nucleic Acids Res. 2008, 36, 6260−6268.
(10) Zahler, A. M.; Williamson, J. R.; Cech, T. R.; Prescott, D. M.
Nature 1991, 350, 718−720.
2
40
dx.doi.org/10.1021/jo201816g | J. Org. Chem. 2012, 77, 229−242

The Journal of Organic Chemistry
Article
(
6
(
11) Halder, K.; Wieland, M.; Hartig, J. S. Nucleic Acids Res. 2009, 37,
811−6817.
12) Arora, A.; Dutkiewicz, M.; Scaria, V.; Hariharan, M.; Maiti, S.;
Kurreck, J. RNA 2008, 14, 1290−1296.
13) Kumari, S.; Bugaut, A.; Huppert, J. L.; Balasubramanian, S. Nat.
Chem. Biol. 2007, 3, 218−221.
14) Azzalin, C. M.; Reichenbach, P.; Khoriauli, L.; Giulotto, E.;
Lingner, J. Science 2007, 318, 798−801.
15) Paeschke, K.; Capra, J. A.; Zakian, V. A. Cell 2011, 145, 678−
91.
(45) Campbell, N. H.; Parkinson, G. N.; Reszka, A. P.; Neidle, S. J.
Am. Chem. Soc. 2008, 130, 6722−6724.
(46) Riou, J. F.; Guittat, L.; Mailliet, P.; Laoui, A.; Renou, E.;
́ ́ ̀
Petitgenet, O.; Megnin-Chanet, F.; Helene, C.; Mergny, J. L. Proc.
(
Natl. Acad. Sci. U.S.A. 2002, 99, 2672−2677.
(47) Pennarun, G.; Granotier, C.; Gauthier, L. R.; Gomez, D.;
Hoffschir, F.; Mandine, E.; Riou, J. F.; Mergny, J. L.; Mailliet, P.;
Boussin, F. D. Oncogene 2005, 24, 2917−2928.
(
(
6
(
(
(48) De Cian, A.; DeLemos, E.; Mergny, J. L.; Teulade-Fichou, M. P.;
Monchaud, D. J. Am. Chem. Soc. 2007, 129, 1856−1857.
(49) Rodriguez, R.; Muller, S.; Yeoman, J. A.; Trentesaux, C.; Riou,
̈
16) Lipps, H. J.; Rhodes, D. Trends Cell Biol. 2009, 8, 414−422.
17) Ribeyre, C.; Lopes, J.; Boule, J.-B.; Piazza, A.; Guedin, A.;
J.-F.; Balasubramanian, S. J. Am. Chem. Soc. 2008, 130, 15758−15759.
(50) Bugaut, A.; Rodriguez, R.; Kumari, S.; Hsu, S. D.;
Balasubramanian, S. Org. Biomol. Chem. 2010, 8, 2771−2776.
(51) Chandler, C. J.; Deady, L. W.; Reiss, J. A.; Tzimos, V. J.
Heterocycl. Chem. 1982, 19, 1017−1019.
Zakian, V. A.; Mergny, J.-L.; Nicolas, A. PLoS Genet. 2009, 5,
e1000475.
(
18) Lopes, J.; Piazza, A.; Bermejo, R.; Kriegsman, B.; Colosio, A.;
Teulade-Fichou, M.-P.; Foiani, M.; Nicolas, A. EMBO J. 2011, 30,
4
(
033−4046.
(52) He, C.; Lippard, S. J. Tetrahedron 2000, 56, 8245−8252.
(53) Goswami, S.; Mukherjee, R.; Mukherjee, R.; Jana, S.; Maity, A.
C.; Adak, A. K. Molecules 2005, 10, 929−936.
19) Dai, J.; Carver, M.; Yang, D. Biochimie 2008, 8, 1172−1183.
20) Lim, K. W.; Amrane, S.; Bouaziz, S.; Xu, W.; Mu, Y.; Patel, D. J.;
(
Luu, K. N.; Phan, A. N. J. Am. Chem. Soc. 2009, 131, 4301−4309.
(54) Fahrni, C. J.; Pfaltz, A. Helv. Chim. Acta 1998, 81, 491−506.
(55) Anwer, M. K.; Sherman, B. D.; Roney, J. G.; Spatola, A. F. J. Org.
Chem. 1989, 54, 1284−1289.
(
(
(
(
(
21) Huppert, J. L. Chem. Soc. Rev. 2008, 37, 1375−1384.
22) Cevec, M.; Plavec, J. Biochemistry 2005, 44, 15238−15246.
23) Risitano, A.; Fox, K. R. Nucleic Acids Res. 2004, 32, 2598−2606.
24) Chaires, J. B. FEBS J. 2010, 277, 1098−1106.
(56) Monchaud, D.; Allain, C.; Bertrand, H.; Smargiasso, N.; Rosu,
F.; Gabelica, V.; De Cian, A.; Mergny, J. L.; Teulade-Fichou, M. P.
Biochimie 2008, 90, 1207−1223.
25) Campbell, N. H.; Patel, M.; Tofa, A. B.; Ghosh, R.; Parkinson,
G. N.; Neidle, S. Biochemistry 2009, 48, 1675−1680.
26) Haider, S. M.; Neidle, S.; Parkinson, G. N. Biochimie 2011, 93,
239−1251.
27) Xue, L.; Ranjan, N.; Arya, D. P. Biochemistry 2011, 50, 2838−
849.
(57) Wang, Y.; Patel, D. J. Structure 1993, 1, 263−282.
(58) Paramasivan, S.; Rujan, I.; Bolton, P. H. Methods 2007, 43, 324−
331.
(
1
(
2
(
(
(59) Ambrus, A.; Chen, D.; Dai, J.; Bialis, T.; Jones, R. A.; Yang, D.
Nucleic Acids Res. 2006, 34, 2723−2735.
28) Neidle, S. FEBS. J. 2010, 127, 1118−1125.
29) Balasubramanian, S.; Neidle, S. Curr. Opin. Chem. Biol. 2009, 13,
(60) Dailey, M. M.; Miller, M. C.; Bates, P. J.; Lane, A. N.; Trent, J.
O. Nucleic Acids Res. 2010, 38, 4877−4888.
3
(
45−353.
30) Sun, D.; Thompson, B.; Cathers, B. E.; Salazar, M.; Kerwin, S.
M.; Trent, J. O.; Jenkins, T. C.; Neidle, S.; Hurley, L. H. J. Med. Chem.
997, 40, 2113−2116.
31) Monchaud, D.; Teulade-Fichou, M. P. Org. Biomol. Chem. 2008,
, 627−636.
32) Ou, T.; Lu, Y.; Tan, J.; Huang, Z.; Wong, K.; Gu, L. Chem. Med.
Chem. 2008, 3, 690−713.
33) De Cian, A.; Cristofari, G.; Reichenbach, P.; Lemos, E. L.;
(61) Gaynutdinov, T. I.; Neumann, R. D.; Panyutin, I. G. Nucleic
Acids Res. 2008, 36, 4079−4087.
(62) Rezler, E. M.; Seenisamy, J.; Bashyam, S.; Mu-Yong, K.; White,
E.; Wilson, W. D.; Hurley, L. H. J. Am. Chem. Soc. 2005, 127, 9439−
9447.
1
(
6
(
(63) Guedin, A.; Lacroix, L.; Mergny, J. L. Methods Mol. Biol. 2010,
613, 25−35.
(64) Sun, D.; Hurley, L. H. Methods Mol. Biol. 2010, 608, 65−79.
(65) Seenisamy, J.; Bashyam, S.; Gokhale, V.; Vankayalpati, H.;
Grand, C. L.; Siddiqui-Jain, A.; Streiner, N.; Wilson, W. D.; Hurley, L.
H. J. Am. Chem. Soc. 2005, 127, 2944−2959.
(
Monchaud, D.; Teulade-Fichou, M. P.; Shin-ya, K.; Lacroix, L.;
Lingner, J.; Mergny, J. L. Proc. Natl. Acad. Sci. U.S.A. 2007, 104,
1
7347−17352.
34) Burger, A. M.; Dai, F.; Schultes, C. M.; Reszka, A. P.; Moore, M.
J.; Double, J. A.; Neidle, S. Cancer Res. 2005, 65, 1489−1496.
35) Phatak, P.; Cookson, J. C.; Dai, F.; Smith, V.; Gartenhaus, R. B.;
Stevens, M. F.; Burger, A. M. Br. J. Cancer 2007, 96, 1223−1233.
36) Granotier, C.; Pennarun, G.; Riou, L.; Hoffschir, F.; Gauthier, L.
(66) Kim, M. Y.; Vankayalapati, H.; Kazuo, S.; Wierzba, K.; Hurley,
L. H. J. Am. Chem. Soc. 2002, 124, 2098−2099.
(
(67) Balagurumoorthy, P.; Brahmachari, S. K. J. Biol. Chem. 1994,
269, 21858−21869.
(
(68) Kejnovska, I.; Kypr, J.; Vorlickova, M. Biochem. Biophys. Res.
Commun. 2007, 353, 776−779.
(
R.; De Cian, A.; Gomez, D.; Mandine, E.; Riou, J. F.; Mergny, J. L.;
Mailliet, P.; Dutrillaux, B.; Boussin, F. D. Nucleic Acids Res. 2005, 33,
(69) Morris, G. M.; Goodsell, D. S.; Halliday, R. S.; Huey, R.; Hart,
W. E.; Belew, R. K.; Olson, A. J. J. Comput. Chem. 1998, 19, 1639−
1662.
4
(
182−4190.
37) Izbicka, E.; Wheelhouse, R. T.; Raymond, E.; Davidson, K. K.;
(70) Case, D. A. AMBER 10; University of California: San Francis co,
Lawrence, R. A.; Sun, D.; Windle, B. E.; Hurley, L. H.; Von Hoff, D. D.
CA, 2008.
Cancer Res. 1999, 59, 639−644.
(71) Kollman, P. A.; Massova, I.; Reyes, C.; Kuhn, B.; Huo, S.;
Chong, L.; Lee, M.; Lee, T.; Duan, Y.; Wang, W.; Donini, O.; Cieplak,
P.; Srinivasan, J.; Case, D. A.; Cheatham, T. E. Acc. Chem. Res. 2000,
33, 889−897.
(
38) Tauchi, T.; Shin-Ya, K.; Sashida, G.; Sumi, M.; Okabe, S.;
Ohyashiki, J. H.; Ohyashiki, K. Oncogene 2006, 25, 5719−5725.
39) Sparapani, S.; Haider, S. M.; Doria, F.; Gunaratnam, M.; Neidle,
S. J. Am. Chem. Soc. 2010, 132, 12263−12272.
40) Dash, J.; Shirude, P. S.; Hsu, S. D.; Balasubramanian, S. J. Am.
Chem. Soc. 2008, 130, 15950−15956.
41) Huang, Y. U.; Cheng, A. K. H.; Yu, H.; Sen, D. Biochemistry
009, 48, 6794−804.
42) Muller, S.; Kumari, S.; Rodriguez, R.; Balasubramanian, S. Nat.
Chem. 2010, 12, 1095−1098.
43) Nakatani, K.; Hagihara, S.; Sando, S.; Sakamoto, S.; Yamaguchi,
K.; Maesawa, C.; Saito, I. J. Am. Chem. Soc. 2003, 125, 662−666.
44) Monchaud, D.; Yang, P.; Lacroix, L.; Teulade-Fichou, M. P.;
Mergny, J. L. Angew. Chem. 2008, 47, 4858−4861.
(
(72) Frisch, M. J. et al. Gaussian 03, Revisions C.02 E. 01; Gaussian,
Inc.: Wallingford, CT, 2004.
(
(73) Hansel, R.; Lohr, F.; Foldynova-Trantirkova, S.; Bamberg, E.;
Trantirek, L.; Dotsch, V. Nucleic Acids Res. 2011, 39, 5768−5775.
(74) Gunaratnam, M.; Swank, S.; Haider, S. M.; Galesa, K.; Reszka,
A. P.; Beltran, M.; Cuenca, F.; Fletcher, J. A.; Neidle, S.; Gunaratnam,
M. J. Med. Chem. 2009, 52, 3774−3783.
(75) Dorazco-Gonzalez, A.; Hopfl, H.; Medrano, F.; Yatsimirsky, A.
K. J. Org. Chem. 2010, 75, 2259−2273.
(76) Monchaud, D.; Teulade-Fichou, M. P. Methods Mol. Biol. 2010,
608, 257−271.
(
2
(
̈
(
(
2
41
dx.doi.org/10.1021/jo201816g | J. Org. Chem. 2012, 77, 229−242

The Journal of Organic Chemistry
Article
(
77) Siegfried, N. A.; Bevilacqua, P. C. Methods Enzymol. 2009, 455,
3
(
(
65−393.
78) Haider, S.; Neidle, S. Methods Mol. Biol. 2010, 608, 17−37.
79) Yang, L.; Tan, C. H.; Hsieh, M. J.; Wang, J.; Duan, Y.; Cieplak,
P.; Caldwell, J.; Kollman, P. A.; Luo, R. J. Phys. Chem. B 2006, 110,
3166−13176.
80) Accelrys; Discovery Studio, version 2.0; Accelrys Inc.: San Diego,
CA, 2007.
81) Wang, J.; Wolf, R. M.; Caldwell, J. W.; Kollman, P. A.; Case, D.
1
(
(
A. J. Comput. Chem. 2004, 25, 1157−1174.
(
(
82) Fox, T.; Kollman, P. A J. Phys. Chem. B 1998, 102, 8070−8079.
83) Humphrey, W.; Dalke, A.; Schulten, K. J. Mol. Graphics 1996,
1
(
3
(
4, 33−38.
84) Sitkoff, D.; Sharp, K. A.; Honig, B. Biophys. Chem. 1994, 51,
97−409.
85) Clay, E. H.; Gould, I. R. J. Mol. Graphics Model. 2005, 24, 138−
46.
1
2
42
dx.doi.org/10.1021/jo201816g | J. Org. Chem. 2012, 77, 229−242