Expression, characterization, and site-specific covalent immobilization of an L-amino acid oxidase from the fungus Hebeloma cylindrosporum

Article abstract of DOI:10.1007/s00253-018-09609-7

l-Amino acid oxidases (LAAOs) are flavoproteins, which use oxygen to deaminate l-amino acids and produce the corresponding α-keto acids, ammonia, and hydrogen peroxide. Here we describe the heterologous expression of LAAO4 from the fungus Hebeloma cylindrosporum without signal sequence as fusion protein with a 6His tag in Escherichia coli and its purification. 6His-hcLAAO4 could be activated by exposure to acidic pH, the detergent sodium dodecyl sulfate, or freezing. The enzyme converted 14 proteinogenic l-amino acids with l-glutamine, l-leucine, l-methionine, l-phenylalanine, l-tyrosine, and l-lysine being the best substrates. Methyl esters of these l-amino acids were also accepted. Even ethyl esters were converted but with lower activity. K_m values were below 1?mM and v_max values between 19 and 39?U?mg^?1 for the best substrates with the acid-activated enzyme. The information for an N-terminal aldehyde tag was added to the coding sequence. Co-expressed formylglycine-generating enzyme was used to convert a cysteine residue in the aldehyde tag to a C^α-formylglycine residue. The aldehyde tag did not change the properties of the enzyme. Purified Ald-6His-hcLAAO4 was covalently bound to a hexylamine resin via the C^α-formylglycine residue. The immobilized enzyme could be reused repeatedly to generate phenylpyruvate from l-phenylalanine with a total turnover number of 17,600 and was stable for over 40?days at 25?°C.

Full text of DOI:10.1007/s00253-018-09609-7

Applied Microbiology and Biotechnology
https://doi.org/10.1007/s00253-018-09609-7
BIOTECHNOLOGICALLY RELEVANT ENZYMES AND PROTEINS
Expression, characterization, and site-specific covalent immobilization
of an L-amino acid oxidase from the fungus Hebeloma cylindrosporum
1
2
3
3
2
1
Svenja Bloess & Tobias Beuel & Tobias Krüger & Norbert Sewald & Thomas Dierks & Gabriele Fischer von Mollard
Received: 27 August 2018 /Revised: 21 December 2018 /Accepted: 28 December 2018
#
Springer-Verlag GmbH Germany, part of Springer Nature 2019
Abstract
L-Amino acid oxidases (LAAOs) are flavoproteins, which use oxygen to deaminate L-amino acids and produce the corresponding
α-keto acids, ammonia, and hydrogen peroxide. Here we describe the heterologous expression of LAAO4 from the fungus
Hebeloma cylindrosporum without signal sequence as fusion protein with a 6His tag in Escherichia coli and its purification.
6
His-hcLAAO4 could be activated by exposure to acidic pH, the detergent sodium dodecyl sulfate, or freezing. The enzyme
converted 14 proteinogenic L-amino acids with L-glutamine, L-leucine, L-methionine, L-phenylalanine, L-tyrosine, and L-lysine
being the best substrates. Methyl esters of these L-amino acids were also accepted. Even ethyl esters were converted but with
−1
lower activity. K values were below 1 mM and v
values between 19 and 39 U mg for the best substrates with the acid-
m
max
activated enzyme. The information for an N-terminal aldehyde tag was added to the coding sequence. Co-expressed
α
formylglycine-generating enzyme was used to convert a cysteine residue in the aldehyde tag to a C -formylglycine residue.
The aldehyde tag did not change the properties of the enzyme. Purified Ald-6His-hcLAAO4 was covalently bound to a
α
hexylamine resin via the C -formylglycine residue. The immobilized enzyme could be reused repeatedly to generate
phenylpyruvate from L-phenylalanine with a total turnover number of 17,600 and was stable for over 40 days at 25 °C.
.
.
.
.
.
Keywords L-amino acid oxidase Heterologous expression E. coli Aldehyde tag Formylglycine Formylglycine-generating
.
enzyme Enzyme immobilization
Introduction
active site. These enzymes are found in many organisms includ-
ing bacteria, algae, fungi, and animals even though their function
is very divergent. On one hand, LAAOs are components of
snake venom and have antimicrobial activities in bacteria, fungi,
molluscs, and fish because of H O production (Du and
L-Amino acid oxidases (LAAOs; EC 1.4.3.2) catalyze the oxi-
dative deamination of L-amino acids forming the corresponding
α-keto acids, ammonia, and hydrogen peroxide (Hossain et al.
2
2
2
014; Pollegioni et al. 2013). An essential cofactor for this reac-
Clemetson 2002; Kasai et al. 2010; Tong et al. 2008; Yang
et al. 2011; Yang et al. 2005). On the other hand, the formation
of ammonia is important as nitrogen source for anabolic reac-
tions in fungi (Davis et al. 2005; Nuutinen and Timonen 2008).
Amino acid oxidases are of interest for biotechnological
applications because they can be used to obtain
enantiomerically pure α-amino acids from racemic mixtures
by enzymatic resolution or for production of α-keto acids.
However, only recombinantly expressed D-amino acid oxi-
dases are currently available for biotechnological applications
tion is flavin adenine dinucleotide (FAD), which is tightly, but
not covalently bound. LAAOs form homodimers and share con-
served amino acid residues, which interact with FAD, are typical
for H O generating flavoenzymes and bind L-amino acids in the
2
2
*
Gabriele Fischer von Mollard
gabriele.mollard@uni-bielefeld.de
1
2
3
Biochemie III, Fakultät für Chemie, Universität Bielefeld,
Universitätsstrasse 25, 33615 Bielefeld, Germany
(
Pollegioni and Molla 2011). Recombinant expression of
broad spectrum LAAOs has not been successful enough for
biotechnological applications so far (Hossain et al. 2014;
Pollegioni et al. 2013). Some LAAOs with a narrow substrate
spectrum have been expressed heterologously (Bifulco et al.
Biochemie I, Fakultät für Chemie, Universität Bielefeld,
Universitätsstrasse 25, 33615 Bielefeld, Germany
Organische und Bioorganische Chemie, Fakultät für Chemie,
Universität Bielefeld, Universitätsstrasse 25,
2013; Cheng et al. 2011; Liu et al. 2013; Tong et al. 2008).
3
3615 Bielefeld, Germany

Appl Microbiol Biotechnol
Recently, we were able to express an LAAO from the fun-
gus Rhizoctonia solani as a fusion protein with maltose bind-
ing protein (Hahn et al. 2017b). This enzyme converts large
hydrophobic and basic L-amino acids. However, it has to be
activated by low amounts of SDS (Hahn et al. 2017a), which
was also observed for heterologously expressed LAAO1 from
the fungus Hebeloma cylindrosporum (Nuutinen et al. 2012).
SDS may interfere with process development. Therefore, we
set out to identify a more suitable LAAO with a broader sub-
strate spectrum and without requirement of activation by SDS.
Here we show overexpression of LAAO4 from the fungus
H. cylindrosporum, describe its activation by acid, and char-
acterize its broad substrate spectrum. Moreover, we show en-
gineering and production of an aldehyde-tagged version of
LAAO4 by co-expression of formylglycine-generating en-
zyme, which after site-specific immobilization acts as a robust
catalyst.
are underlined and the aldehyde tag sequence is in italics):
A A G A AT T C T TAT G TA C T C C T T C T C G T C AT C
ATCATCATCATCACAGCAGC and AAGAATTCGCTG
CTGCCCATGGTATATC, generating pSBL14 (Ald-6His-
hcLAAO4) after EcoRI digestion and ligation.
Expression
pSBL7 and pSBL14 were transformed into Escherichia coli
Arctic Express (DE3) (Ferrer et al. 2004) competent cells.
Transformants kept on plates for a maximum of 4 weeks were
cultured overnight at 37 °C in 20 mL LB broth with
−1
−1
50 μg mL kanamycin and 25 μg mL gentamycin for selec-
tion of the cpn10/cpn60 chaperonin expression plasmid. For
co-expression of Ald-6His-hcLAAO4 with formylglycine-
generating enzyme (FGE), pSBL14 was co-transformed with
the pET14b-mtbFGE-His6 plasmid, which was kindly provid-
ed by David Rabuka (Redwood Bioscience, Emeryville, USA),
−1
and 100 μg mL ampicillin was used as additional selection
Materials and methods
marker. The culture was diluted with 500 mL of the high cell
density medium HSG (13.5 g L soy peptone, 7 g L yeast
−1
−1
−
1
−1
−1
Amplification and cloning of the hcLAAO4
extract, 14.9 g L glycerol (99%), 2.5 g L NaCl, 2.3 g L
−
1
−1
K HPO , 1.5 g L KH PO , 0.14 g L MgSO ·H O, pH 7.4)
2
4
2
4
4
2
−
1
−1
The partial sequence of a putative H. cylindrosporum LAAO4
with 50 μg mL kanamycin and 25 μg mL gentamycin and
incubated at 30 °C until the OD600 reached 10–14. Expression
was induced after a 15-min preincubation at 11 °C by 0.2 mM
isopropyl β-D-1-thiogalactopyranoside (IPTG) for 24 h at
11 °C. Cells of the culture were pelleted and aliquoted into
three pellets of 2.5–3 g wet mass and stored at − 20 °C.
(AFA35113 direct submission by Nuutinen et al.) contained a
putative ER signal sequence. Sequence alignments indicate
that only the sequence encoding the beginning of the ER sig-
nal sequence is missing. A synthetic gene (Life Technologies)
starting at the codon for alanine 19, the predicted first amino
acid of the mature protein after cleavage of the signal se-
quence, was codon optimized for expression in Pichia
pastoris (sequence in GenBank under accession number
MH751433). This gene was cloned into the expression vector
pET28b (Novagen) encoding an N-terminal 6His tag followed
by a recognition site for the thrombin protease under the con-
trol of a T7 promoter via the restriction sites NdeI and NotI
generating pSBL7 (6His-hcLAAO4).
An aldehyde tag sequence (LCTPSR) was inserted up-
stream of the 6His tag. The thrombin recognition site was
exchanged with a sequence encoding the PreScission protease
recognition site, to enable the low-temperature cleavage of the
fusion protein. In the first step, the sequence encoding the
PreScission protease recognition site was introduced upstream
of the hcLAAO4 coding sequence. A forward primer
Purification of 6His-hcLAAO4 and Ald-6His-hcLAAO4
proteins
Purification of the tagged proteins was carried out at 4 °C.
Pellets were resuspended in His buffer (50 mM NaH PO
2
4
buffer pH 7.0, 300 mM NaCl, 10 mM imidazole) and
disrupted by French press. After centrifugation at 27,000×g
for 30 min, the resulting soluble fraction was applied to a
2
+
Ni -NTA column, which was equilibrated with His buffer.
The column was washed with 40 column volumes (cv) 2 M
urea in His buffer as described (Belval et al. 2015) to remove
Cpn60 (2 M urea did not influence the activity of the enzyme),
followed by 40 cv His buffer containing 20 mM imidazole and
20 cv His buffer with 50 mM imidazole. 6His-hcLAAO4 or
Ald-6His-hcLAAO4 was eluted with His buffer containing
500 mM imidazole (pH 7.0). 6His-hcLAAO4 was concentrat-
ed via ultrafiltration (Vivaspin 6 30,000 MWCO, Sartorius),
and further purified by size exclusion chromatography with an
Ettan LC (GE Healthcare Life Sciences, Chicago, IL, USA)
on a Superdex® 200 Increase 10/300 GL column (GE
Healthcare Life Sciences, Chicago, IL, USA), using 50 mM
NaH PO buffer pH 7.0, 300 mM NaCl at a flow rate of
(
AAGGATCCCATATGGCTGACACTACTTCCGTT) with
a BamHI site (underlined sequence) and a reverse primer
AAGGATCCGGGCCCCTGGAACAGAACTT
(
CCAGGCCGCTGCTGTGATG) with a BamHI site and the
PreScission protease recognition site (bold) were used to
PCR-amplify pSBL7. The PCR product was digested with
BamHI and ligated yielding pSBL13. The aldehyde tag was
introduced upstream of the 6His tag by PCR amplification of
pSBL13 with the following primers (EcoRI restriction sites
2
4
−
1
0.3 mL min . After pooling of the elution fractions and

Appl Microbiol Biotechnol
concentration via ultrafiltration, Ald-6His-hcLAAO4 was
buffer exchanged to His buffer without imidazole, activated
by dilution with 4 volumes of citric acid buffer pH 3, and
finally buffer exchanged to HEPES buffer (100 mM HEPES
buffer pH 7.0, 150 mM NaCl).
The concentration of hcLAAO4 proteins was determined
according to the method developed by Bradford (1976) using
bovine serum albumin as standard. The purity and expression
rates of hcLAAO4 samples were monitored by sodium dode-
cyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)
with 11% acrylamide in the separating gel (Laemmli 1970).
Proteins were stained with Coomassie Brilliant Blue R-250.
supplemented with different SDS concentrations or buffers
at different pH values (Sörensen HCl-glycine buffers
pH 1.5–2.5 (Sörensen 1909) and 200 mM Na HPO ,
100 mM citric acid buffers pH 3–7.5 (McIlvaine 1921)) before
the assay. After preincubation for 10 min at 25 °C, 5 μL of
activated enzyme was used per assay (200 μL).
2
4
α
Determination of C -formylglycine conversion
Twenty micrograms of Ald-6His-hcLAAO4 was supplement-
ed with PreScission cleavage buffer (50 mM Tris-HCl,
150 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol (DTT),
pH 7.5) and PreScission protease in a ratio of 1:20 (w/w).
The sample was incubated at 4 °C overnight. After addition
Size exclusion chromatography
2
+
of 50 μL Ni -NTA slurry and incubation for 15 min, the
slurry was washed with His buffer and the bound peptide
eluted with 50 μL His buffer containing 500 mM imidazole.
The sample was desalted using ZipTip U-C18 tips (Millipore)
and eluted into 5 μL 50% acetonitrile/ 0.1% TFA. The sample
was 1:1 co-crystallized with 4-chloro-α-cyanocinnamic acid
matrix (10 mg mL , Sigma) and analyzed by MALDI-ToF-
MS (UltrafleXtreme, Bruker Daltonics) in reflector positive
mode (m/z 500–5000).
The molecular mass of the purified 6His-hcLAAO4 was esti-
mated by size exclusion chromatography with an Ettan LC
(
GE Healthcare Life Sciences, Chicago, IL, USA) on a
Superdex® 200 Increase 10/300 GL column (GE Healthcare
Life Sciences, Chicago, IL, USA), using 50 mM NaH PO
2
4
1
−
−1
buffer pH 7.0, 300 mM NaCl at a flow rate of 0.3 mL min .
The purified enzyme was supplemented with 100 mM citric
acid buffer pH 3 (McIlvaine 1921) and diluted with 50 mM
NaH PO buffer pH 7.0, 300 mM NaCl or frozen at − 80 °C
2
4
and thawed on ice before chromatography to analyze the be-
havior of activated 6His-hcLAAO4 in comparison to the un-
treated enzyme. Dextran blue, thyroglobulin (669 kDa), ferri-
tin (440 kDa), bovine serum albumin (66 kDa), ovalbumin
Fluorescence labeling with HIPS-carboxyfluorescein
Hydrazino-iso-Pictet-Spengler-carboxyfluorescein (HIPS-
CF) is a fluorescent probe for specific labeling of aldehyde-
containing proteins (Krüger et al. 2018). To assess the func-
tionality of the aldehyde tag, 5 μg (3.4 μM) Ald-6His-
hcLAAO4, produced with or without co-expression of FGE,
or 6His-hcLAAO4 as control, and HIPS-CF (340 μM) were
added to conjugation buffer (100 mM NaH PO , 20 mM
(
43 kDa), cytochrome C (12.4 kDa), and aprotinin (6.5 kDa)
were employed as standards to obtain calibration curves.
Absorbance at 280 nm was used to monitor proteins, absor-
bance at 450 nm for FAD detection.
2
4
Enzyme assay
NaCl, pH 6.0) and incubated overnight at 4 °C with shaking
at 800 rpm. The reaction mixtures were separated by SDS-
PAGE (10%) and analyzed by in-gel fluorescence detection
(LAS-3000, Fujifilm, filter FL-Y515) followed by Blue Silver
Coomassie staining (Candiano et al. 2004).
The enzymatic activities of 6His-hcLAAO4 and Ald-6His-
hcLAAO4 were determined by measuring the initial rate of
H O production by a coupled peroxidase/o-dianisidine assay
2
2
with 10 mM L-amino acids as described (Hahn et al. 2017b).
The standard assay mixture contained 10 mM L-glutamine,
Immobilization of Ald-6His-hcLAAO4
−
1
5
0 mM TEA/HCl buffer (pH 7.0), 0.2 mg mL of o-
−1
dianisidine, 5 U mL peroxidase, and hcLAAO4 in limiting
amounts. Reactions were carried out in 96-well plates at 30 °C
in a Tecan Infinite 200 microplate reader at 436 nm. One unit
was defined as the amount of enzyme that catalyzes the con-
version of 1 μmol L-amino acid per minute. Initial velocities
of H O production were determined with 16 different L-ami-
Ald-6His-hcLAAO4 at various concentrations (see BResults^)
in 150 μL HEPES buffer was added to 10 mg of hexylamine
(HA)-functionalized polymethyl methacrylate polymer resin
(ReliZyme™ HA 403/S; particle size 100–300 μm, pore size
400–600 Å, purchased from Resindion S.r.l. (Rome, Italy)).
After overnight incubation at 4 °C with shaking (500 rpm),
samples were subjected to a reduction step (20 min at 4 °C and
2
2
no acid concentrations between 0.02 and 20 mM for the un-
treated and acid-activated 6His-hcLAAO4. Km and vmax
values were calculated from Hanes-Woolf plots.
500 rpm) with NaCNBH (50 mM). The resin was washed
3
three times with 1 M NaCl and three times with HEPES buff-
er, pH 7.0. The immobilized enzyme preparation was stored
on HEPES buffer at 4 °C. All immobilization experiments
were performed in duplicates.
−1
Untreated enzyme (0.15 mg mL ) was frozen at different
temperatures with or without glycerol and activity was mea-
sured after thawing on ice. The untreated enzyme was also

Appl Microbiol Biotechnol
Activity assay for immobilized Ald-6His-hcLAAO4
L-Phenylalanine (5 mM) and 32.5 U catalase in 50 mM TEA
buffer (pH 7.0) in a total volume of 650 μL were added to the
immobilized enzyme preparation and incubated for 20 min at
3
0 °C with shaking (800 rpm). Supernatants were boiled to
denature proteins, centrifuged, and 10 μL of the supernatant
was separated by HPLC (Shimadzu Nexera XR) with a
Phenomenex RP 18 column (Luna® C18, 2 × 100 mm,
3
μm with a guard column) using eluent A (0.1% (v/v)
trifluoroacetic acid (TFA) in water) and eluent B (0.1% (v/v)
TFA in acetonitrile) at 254 nm. Separation of L-phenylalanine
and phenylpyruvate was performed at a flow rate of
mL min− and a linear gradient from 0 to 100% B over
1
1
7
Fig. 1 Purification of recombinant 6His-hcLAAO4. A 6His-hcLAAO4
fusion protein was expressed in the E. coli strain Arctic Express (DE3) at
.5 min. Conversion of the amino acid was quantified by peak
integration and calculated based on standard curves recorded
with known amounts of L-phenylalanine.
1
1 °C for 24 h. Cells were lysed, the pellet fraction (P) separated by
2+
centrifugation, and the soluble fractions (S) loaded onto Ni -NTA resin.
After collection of the flow through (F) and washing with 2 M urea (W),
proteins were eluted using 500 mM imidazole (E1). 6His-hcLAAO4 was
further purified by size exclusion chromatography on a Superdex 200
Increase 10/300 GL column (E2). Fractions were separated by SDS-
PAGE and proteins were stained with Coomassie
Results
Expression and purification of 6His-hcLAAO4
Therefore, the resin was washed with 2 M urea as described
Potential LAAOs have been identified from dozens of fungal
genomes. Most of these proteins do not contain a putative
signal sequence for import into the endoplasmic reticulum
(Belval et al. 2015), which removed part of the Cpn60 (Fig. 1,
fraction W). The eluate (Fig. 1, fraction E1) still contained
Cpn60, which was fully removed by a subsequent size exclu-
sion chromatography (Fig. 1, fraction E2) resulting in a ho-
mogenous 6His-hcLAAO4 preparation with little impurities.
The occupancy with FAD was 80–100% in different prepara-
tions (data not shown), as determined spectroscopically (see
Hahn et al. 2017b). This purification method yielded 4 mg of
enzyme from 5 g of bacterial wet mass. A fusion protein with a
(
ER). Among these enzymes are R. solani rsLAAO1 and
hcLAAO1 (Hahn et al. 2017b; Nuutinen et al. 2012). The
Basidiomycota H. cylindrosporum encodes an additional pu-
tative LAAO submitted as hcLAAO4 by Nuutinen et al. to
GenBank (accession number AFA35113), which has an N-
terminal ER import signal sequence according to prediction
programs PSORT II (Nakai and Horton 1999) and Signal P
6His tag resulted in higher yields of active pure enzyme com-
4
.1 (Petersen et al. 2011). hcLAAO4 shares only 38% of the
pared to a fusion protein carrying a maltose binding protein
tag (data not shown).
amino acid residues with hcLAAO1 and 34% with rsLAAO1.
The cytosol and the ER contain different chaperones and dif-
fer in their redox environment. Therefore, folding properties
of their resident proteins may vary. Thus, we wanted to com-
pare rsLAAO1 with hcLAAO4 after cytosolic expression in
E. coli. A synthetic gene encoding hcLAAO4 lacking the
information for the 18 amino acids of the putative signal se-
quence (GenBank accession number MH751433) was cloned
into the E. coli expression vector pET28b resulting in a fusion
protein with an N-terminal 6His tag. The 6His-hcLAAO4 was
found predominantly in the pellet (Fig. 1, fraction P) with a
small fraction in the supernatant. Expression in the E. coli
strain Arctic Express (DE3) (Ferrer et al. 2004) at 11 °C re-
sulted in the highest yield of soluble protein (Fig. 1, fraction
Activation of 6His-hcLAAO4
Enzymatic activity of 6His-hcLAAO4 was measured by de-
termination of the initial production rate of H O using a
2
2
coupled peroxidase o-dianisidine assay with L-glutamine as
substrate. The assay was conducted in buffers between pH 4
and 11 to investigate the pH dependency of 6His-hcLAAO4
(Fig. 2a). Surprisingly, the highest enzymatic activity was de-
tected in buffers of pH 4–5. It is known that some enzymes
can be activated by a brief exposure to acidic pH (Kanade
et al. 2006; Kenten 1957). To test if 6His-hcLAAO4 belongs
to this group of enzymes, 6His-hcLAAO4 was incubated at
pH 3 for 10 min followed by dilution into assay buffers of
different pH and determination of enzymatic activity. After
this treatment, 6His-hcLAAO4 showed a broad pH optimum
between pH 6 and 8 (Fig. 2b). To analyze this acid activation
2
+
S). Ni -NTA resin was used to purify the enzyme from the
supernatant. However, the fusion protein was strongly con-
taminated with Cpn60 (identified by mass spectrometry, data
not shown), which is one of the cold-adapted chaperonins
expressed in the E. coli strain Arctic Express (DE3).

Appl Microbiol Biotechnol
Fig. 2 pH activation and pH optimum of 6His-hcLAAO4. a Enzymatic
activity was assayed with peroxidase and o-dianisidine in citrate buffer
values for 10 min and assayed with 10 mM L-glutamine as substrate at
pH 7.0. Data are means of 3 (a, b) or 3–12 (c) independent experiments;
error bars represent standard deviations. d Untreated (black) and acid
treated 6His-hcLAAO4 (gray) was separated by size exclusion chroma-
tography. Untreated enzyme was found at a retention volume of 12.95 mL
corresponding to a molecular mass of 102 kDa. Acid-activated 6His-
hcLAAO4 was detected at a retention volume of 12.07 mL (158 kDa).
Protein was measured as absorbance at 280 nm, FAD as absorbance at
450 nm
(circles), phosphate buffer (triangles), TEA buffer (squares), and glycine
buffer (diamonds) at the indicated pH for L-glutamine. The highest ac-
tivity was observed between pH 4 and 5 for the untreated enzyme. b 6His-
hcLAAO4 was incubated for 10 min at pH 3 before dilution into the
indicated pH for activity assay. The pH optimum was between pH 6
and 8 for the acid-activated enzyme. c The enzyme was preincubated with
glycine-HCl buffer (squares) or citrate buffers (circles) at different pH
in more detail, 6His-hcLAAO4 was preincubated at pH values
between 1.5 and 7.5 for 10 min before activity assay at pH 7.0
The effect of SDS on 6His-hcLAAO4 was tested by
preincubation with different concentrations of SDS for
10 min. The enzyme was diluted into assay buffer without
SDS followed by activity determination. Preincubation in
1.5 to 10 mM SDS increased the activity of the untreated
enzyme 3- to 4-fold (Fig. 3a). A specific activity of up to
(
Fig. 2c). Acidic pH between 2 and 5 activated 6His-
−
1
hcLAAO4 to specific activities up to 20 U mg
.
Noteworthy, specific activities varied between different en-
−1
zyme preparations and reached up to 44 U mg . Activity
was completely lost after preincubation at pH 1.5 indicating
that the enzyme denatured at this pH. No activation was ob-
served at pH 5.5 and higher. 6His-hcLAAO4 remained acid-
activated if returned to neutral pH for storage (data not
shown). rsLAAO1 was activated by low concentrations of
SDS and a conformational change was shown by different
methods including an increase of the hydrodynamic radius
by size exclusion chromatography (Hahn et al. 2017a; Hahn
et al. 2017b). Thus, we also subjected untreated and acid-
activated 6His-hcLAAO4 to size exclusion chromatography.
Untreated 6His-hcLAAO4 was detected at a retention volume
of 12.95 mL corresponding to a molecular mass of 102 kDa
−1
14 U mg was reached. However, the SDS-treated enzyme
was less thermally stable (data not shown). A combination of
SDS and pH activation did not result in higher specific activ-
ities suggesting the existence of a single active conformation
(data not shown). Next, the behavior of untreated 6His-
hcLAAO4 towards freezing was tested. Freezing in a − 20
and a − 80 °C freezer increased the activity after thawing
compared to storage at 4 °C about 4-fold (Fig. 3b). Protein
samples after a − 80 °C freeze-thaw cycle were separated on a
size exclusion column and the enzyme activity determined in
different fractions. A double peak was observed with a more
active form at a higher hydrodynamic radius (12.10 mL,
156 kDa) corresponding to the acid-activated 6His-
hcLAAO4. The second peak (12.93 mL, 103 kDa) with a
retention volume similar to the untreated 6His-hcLAAO4
was less active (Fig. 3c). Rapid freezing in liquid nitrogen
(
Fig. 2d). Acid-treated 6His-hcLAAO4 was found already at a
retention volume of 12.07 mL equivalent to a molecular mass
of 158 kDa indicating that the enzyme underwent a confor-
mational change.

Appl Microbiol Biotechnol
Fig. 3 The activity of 6His-hcLAAO4 can be increased by low amounts
of SDS or freeze-thawing. a 6His-hcLAAO4 was preincubated with the
ƒ
indicated concentration of SDS for 10 min. Activity of the untreated
−1
enzyme is set to 1, b 6His-hcLAAO4 (0.15 mg mL ) was stored at 4,
−
20, − 80 °C (with and without 20% glycerol) or frozen with liquid
nitrogen. Activity of the untreated enzyme is set to 1. LAAO activity
was measured using a coupled peroxidase o-dianisidine assay with
1
0 mM L-glutamine as substrate at pH 7.0. Data are means of three
independent experiments, error bars represent standard deviations. c
Enzyme was separated by size exclusion chromatography after − 80 °C
freeze-thawing and the activity assayed for the indicated fractions. The
active form was detected at an elution volume of 12.10 mL and slightly
larger than the less active form (12.93 mL)
Substrate spectrum and kinetic properties
of 6His-hcLAAO4
Next, we tested which amino acids were substrates for 6His-
hcLAAO4. L-Glutamine and L-leucine were the best sub-
strates at a concentration of 10 mM (Table 1). L-Asparagine
resulted in 40% of the activity found for L-glutamine. L-
Glutamate was also a substrate but with 29% relative activity
compared to L-glutamine indicating that a γ-carboxyl group is
also tolerated by the active site. By contrast, L-aspartate was
not converted. These data indicate that the enzyme preferred
substrates with an additional CH -moiety. The enzyme also
2
displayed good activities towards basic and aromatic L-amino
acids. L-Leucine and L-norleucine were better substrates than
L-isoleucine and L-valine, while L-tert-leucine was not accept-
ed (Fig. 4). These data indicate that L-amino acids with a
branched β-position fit poorly into the binding pocket, while
L-tert-leucine with three CH -groups at the β-position did not
3
fit at all. 6His-hcLAAO4 had a very broad substrate spectrum,
accepting 14 of the proteinogenic L-amino acids. D-Amino
acids were not converted. Interestingly, the enzyme also con-
verted methyl esters of L-leucine, L-phenylalanine, L-methio-
nine, and L-tyrosine almost as good as the free L-amino acids
(Table 1 and Fig. 4). This indicates that the carboxyl group is
not essential for binding in the active site. The activity towards
L-glutamic acid dimethyl ester (66%) was even higher than
that towards L-glutamate (29%, Table 1) suggesting that the
negative charge of the γ-carboxyl group reduced binding to
the active site. Even L-leucine ethyl ester was converted but
with reduced activity (Fig. 4). Acid-activated and untreated
6
His-hcLAAO4 converted the same L-amino acids (data not
shown).
Kinetic properties were determined for untreated and acid-
activated 6His-hcLAAO4 by measuring initial velocities at
different substrate concentrations and using Hanes-Woolf
plots (Table 2). The Km values were below 1 mM for the
studied substrates L-glutamine, L-leucine, L-phenylalanine
and barely changed after acid activation indicating that the
activation did not change affinity for the substrate. By con-
trast, kcat values strongly increased due to acid activation for
all substrates. The presence of a methyl ester group had a
increased enzymatic activity to a lesser extent than slower
freezing. Addition of 20% glycerol before freezing led to a
clearly reduced enzyme activation by freezing at − 80 °C.
These data strongly suggest that pH or salt effects close to
the enzyme surface during freezing or phase changes in the
aqueous solvent induced a conformational change to the larger
active form.

Appl Microbiol Biotechnol
Table 1 Substrate spectrum of 6His-hcLAAO4
L-Amino acid
Relative
activity (%)
Hydrophobic
amino acids
L-alanine
L-isoleucine
L-leucine
L-tert-leucine
L-norleucine
L-methionine
L-phenylalanine
L-phenylglycine
rac-β-phenylalanine
L-proline
39
28
94
0
69
55
52
0
0
0
L-tryptophane
L-valine
8.3
5.5
Polar amino acids
L-asparagine
L-cysteine
L-glutamine
L-serine
40
0
100
0
L-threonine
L-tyrosine
0
45
Fig. 4 Relative activity of acid-activated 6His-hcLAAO4 with L-leucine,
derivates, and related amino acids. Activity with L-glutamine is set at
a
1
00%. The methyl ester was converted with nearly the same activity as
Basic amino acids
Acidic amino acids
L-arginine
L-canavanine
L-histidine
L-lysine
29
17
39
45
57
L-leucine, while L-leucine ethyl ester and L-isoleucine were converted
with a rate less than 40%. L-Norleucine served as a good and L-valine
as a very poor substrate. L-tert-Leucine was not converted at all. A
coupled peroxidase o-dianisidine assay was used with a substrate concen-
tration of 10 mM
L-ornithine
L-aspartic acid
L-glutamic acid
0
29
enzyme from 5 g of bacterial wet mass after purification on
Amino acid derivates L-alanine ethyl ester
L-glutamic acid dimethyl ester
10
66
87
41
54
46
25
0
2
+
Ni -NTA resin, which is equivalent to 26% of the yield for
the non-aldehyde-tagged enzyme. The enzymatic activity of
Ald-6His-hcLAAO4 was measured using L-glutamine as sub-
strate. After activation at acidic pH, the enzyme exhibited a
L-leucine methyl ester
L-leucine ethyl ester
L-methionine methyl ester
L-phenylalanine methyl ester
L-tyrosine methyl ester
S-alpha methyl phenylalanine
N-acetylmethionine methyl ester
−1
specific activity between 25 and 50 U mg .
After PreScission protease treatment, the cleaved N-
terminal fragment was subjected to MALDI-ToF mass spec-
trometric analysis in order to determine the extent of conver-
0
Standard substrate concentration was 10 mM amino acid in the assay
α
a
sion of the cysteine within the aldehyde tag sequence to C -
Because of low solubility, 2.5 mM concentration was used for L-
tyrosine
formylglycine (FGly). Expression of Ald-6His-hcLAAO4
alone led to a conversion of about 45% (Fig. 5c), which can
stronger influence on Km values (0.26 mM for L-leucine,
0
.67 mM for L-leucine methyl ester) than on k values
cat
−1
−1
Table 2 Kinetic properties of untreated (top) and acid-activated 6His-
hcLAAO4 (bottom). K und vmax were calculated from Hanes-Woolf
m
plots. Data are means of three independent experiments with standard
deviations
(
45 s for L-leucine, 28 s for L-leucine methyl ester) for
the acid-activated enzyme. The differences in kcat values were
even smaller for the untreated enzyme (2.3 versus 2.6 s ).
−1
−
1
−1
Substrat
v
max[U mg ]
K
m
[mM]
kcat[s ] kcat/K
m
Expression and characterization of Ald-6His-hcLAAO4
L-Glutamine
L-Leucine
2.22 ± 0.65
2.01 ± 0.70
0.46 ± 0.07 2.56
0.27 ± 0.04 2.32
0.69 ± 0.07 2.60
0.26 ± 0.11 0.83
5.58
8.48
3.77
3.14
For subsequent site-specific immobilization, we fused the al-
dehyde tag sequence LCTPSR to the N-terminus of 6His-
hcLAAO4, which is recognized by FGE. In addition, a
PreScission protease cleavage site was introduced between
the 6His and the hcLAAO4 sequence, thus enabling removal
of the complete N-terminus after purification (see Fig. 5a).
Expression in E. coli Arctic Express (DE3) together with
FGE from Mycobacterium tuberculosis yielded 1 mg of
L-Leucine methyl ester 2.25 ± 0.43
L-Phenylalanine
Substrate
0.72 ± 0.21
−
1
−1
v
max[U mg ]
K
m
[mM]
kcat[s ] kcat/K
m
L-Glutamine
L-Leucine
33.6 ± 7.4
0.56 ± 0.17 38.8
0.26 ± 0.13 45.3
0.67 ± 0.40 27.8
0.48 ± 0.16 21.9
69.4
176.2
41.5
45.2
39.2 ± 12.1
L-Leucine methyl ester 24.1 ± 6.7
L-Phenylalanine 18.9 ± 0.7

Appl Microbiol Biotechnol
Fig. 5 In vivo C -formylglycine (FGly) formation in Ald-6His-
α
ƒ
hcLAAO4. a The N-terminal aldehyde tag sequence (LCTPSR) is recog-
nized by co-expressed formylglycine-generating enzyme (FGE) and the
cysteine residue within the sequence is converted to FGly. A PreScission
Protease (PP) cleavage site, introduced between the 6His and the
hcLAAO4 sequence, enables removal of the complete N-terminus after
purification. b, c After expression with (b) or without FGE (c) and
HisTrap purification of the Ald-6His-hcLAAO4 fusion protein, the N-
terminal peptide containing the aldehyde tag and 6His tag was cleaved
off by PreScission protease and analyzed by MALDI-ToF. The cysteine-
+
containing peptide can be observed at m/zcalc 2966.4 ([M + H ]), while
α
conversion of cysteine to C -formylglycine gives rise to an ion peak at
m/zcalc 2948.4. An additional peak can be observed at m/zcalc 2930.4,
which is due to internal Schiff base formation by reaction of the N-
terminal amino group with the aldehyde, leading to elimination of H O,
2
as observed before (Krüger et al. 2018). d 6His-hcLAAO4 and Ald-6His-
hcLAAO4 (produced without and with co-expression of FGE, as indicat-
ed) were incubated with HIPS-carboxyfluorescein overnight. Samples
were analyzed by SDS-PAGE followed by in-gel fluorescence detection
and Coomassie staining
carboxyfluorescein probe (Krüger et al. 2018), followed by
SDS-PAGE analysis and in-gel fluorescence imaging. The
result shows a specific labeling of the aldehyde-tagged en-
zyme (Fig. 5d) and confirms the much higher FGly content
obtained after co-expression with FGE (compare fluorescence
signals in Fig. 5d to FGly mass spec signals in Fig. 5b, c).
Taken together, these data prove efficient FGly-tagging of
Ald-6His-hcLAAO4 as well as accessibility of this N-
terminal aldehyde tag for selective bioconjugation.
Immobilization of Ald-6His-hcLAAO4 on HA403
For immobilization, we used the commercially available
macroporous polymethyl methacrylate (PMMA) enzyme carri-
er HA403/S (Resindion), which is functionalized with HA
groups. Covalent linkage could be achieved through Schiff base
formation between a free amino group of the carrier and the
aldehyde group of the FGly residue of Ald-6His-hcLAAO4. To
overcome the reversibility of the Schiff base linkage causing
instability of the immobilized enzyme preparation, a down-
stream reducing step is required. For such reductive amination
reactions, sodium cyano borohydride (NaCNBH ) is a biocom-
3
patible reducing agent, which in fact did not show any inhibi-
tory effect on the activity of hcLAAO4 (data not shown). Thus,
for immobilization, we chose an overnight incubation step (at
4
°C) of the HA403 resin with the enzyme preparation followed
by a 20-min reduction step with 50 mM NaCNBH as a stan-
3
be attributed to E. coli’s endogenous FGly-generating system
Benjdia et al. 2007). Co-expression with FGE resulted in
nearly 100% conversion of cysteine to FGly within the alde-
hyde tag (Fig. 5b).
To assess the general ability of the aldehyde-tagged
hcLAAO4 for site-selective modification, we subjected
dard protocol (see Methods for further details).
(
To optimize immobilization yields, 150 μL of Ald-6His-
hcLAAO4 at varying enzyme concentrations were subjected
to immobilization on 10 mg of resin (dry weight). The enzy-
matic activity of the immobilized material, after washing with
1 M NaCl and HEPES buffer, was assayed by determining L-
phenylalanine turnover within 20 min (at 30 °C), as quantified
by HPLC analysis (see Methods). As shown in Fig. 6a,
6
His-hcLAAO4 with and without tag to aldehyde-specific
HIPS ligation. Both proteins were incubated with a HIPS-

Appl Microbiol Biotechnol
Fig. 6 Characteristics of Ald-6His-hcLAAO4 immobilized on HA403. a
ƒ
1
50 μL enzyme preparation (0–8 μM, as indicated) was subjected to
immobilization on 10 mg of hexylamine resin HA403 by reductive
amination (see Methods). After thorough washing of the resin, the
activity of immobilized Ald-6His-hcLAAO4 was assayed using 10 mM
L-phenylalanine as substrate, followed by HPLC-based quantification of
its conversion (see Methods). Immobilization efficiency was saturated at
an enzyme concentration of 6 μM. b Immobilized Ald-6His-hcLAAO4
was repeatedly incubated with 10 mM L-phenylalanine solution followed
by HPLC-based quantification of its conversion. The immobilized en-
zyme could be reused for 12 cycles without apparent loss in activity. c
Free Ald-6His-hcLAAO4 (circles) and immobilized enzyme preparation
(squares) were incubated at 25 °C and activity was measured every 7 days
by HPLC analysis of L-phenylalanine conversion. The immobilized en-
zyme exhibited an extensive storage stability for more than 40 days at
2
5 °C
immobilization efficiency could be saturated at 6 μM enzyme
concentration, which resulted in a specific activity of the
−1
immobilized Ald-6His-hcLAAO4 of 10.15 mU mg of resin.
Biocatalytic robustness of immobilized
Ald-6His-hcLAAO4
Immobilization on a solid support represents an attractive solu-
tion to stabilize enzymes, which often makes their industrial
applications as biocatalysts economic at all. In this regard, we
examined the catalytic stability of immobilized hcLAAO4 in
repeated cycles of substrate conversion. Ten milligrams of
immobilized hcLAAO4 preparation was incubated with L-phe-
nylalanine for 20 min at 30 °C and the supernatant subjected to
HPLC-based activity analysis to detect remaining L-phenylala-
nine and the reaction product phenylpyruvate. The formation of
phenylpyruvate was confirmed by mass spectrometry (data not
shown). After washing of the resin, fresh substrate solution was
repeatedly applied and all incubations followed by activity anal-
ysis steps were performed in the same manner. Figure 6b shows
that the immobilized enzyme preparation could be used for
12 cycles without any loss of catalytic activity, corresponding
to a total turnover number (TTN) of 17,600, hence proving the
feasibility of the immobilized hcLAAO4 preparation for larger-
scale substrate conversions.
A further criterion for the economic usability of enzymes as
biocatalysts is their storage stability. Commonly, immobilized
enzymes exhibit an extended storage stability compared to
their free counterparts, which is often attributed to their re-
duced mobility. To analyze if this holds true also for the
immobilized hcLAAO4, we incubated an immobilized en-
zyme preparation, and, as reference, free Ald-6His-
hcLAAO4, for extended periods at 25 °C and assessed the
remaining activity, with regard to the activity at day 0, every
7
days by incubation with L-phenylalanine and subsequent
HPLC analysis. The immobilized enzyme showed clearly en-
hanced storage stability. While the catalytic activity of the free
enzyme sharply decreased after 30 days (with 11% residual

Appl Microbiol Biotechnol
activity at day 35 and complete loss of activity at day 42), the
immobilized enzyme preparation exhibited almost full activity
for the entire period of analysis (Fig. 6c).
freezing, which is due to a conformational change in the vicin-
ity of the flavine (Coles et al. 1977; Curti et al. 1968). By
contrast, 6His-hcLAAO4 was activated by freezing, again ac-
companied by an increase in hydrodynamic radius, while ac-
tivity of MBP-rsLAAO1 did not increase (data not shown).
Freezing was not additive with SDS suggesting a switch be-
tween two conformations. An activation by freeze-thawing is
not without precedent as it was observed for a nitrite reductase
isolated from its natural source, the bacterium Alcaligenes sp.
NCBI 11015 (Masuko and Iwasaki 1984). This activation is
due to a small conformational change exposing some hydro-
phobic sites to the solvent (Masuko et al. 1985). It could be
caused by phase changes of the water due to freezing, pH
changes, or increased salt concentrations next to the protein.
The previously described hcLAAO1 (Nuutinen et al. 2012)
and 6His-hcLAAO4 both accept the majority of proteinogenic
L-amino acids. However, there are differences in the activities
towards different substrates. L-Glutamate is the preferred sub-
strate for hcLAAO1 followed by L-glutamine, L-aspartate, and
L-leucine indicating that an acidic side chain fits very well into
the active site. 6His-hcLAAO4 had similar activities towards
L-glutamine and L-leucine, followed in relative activity by L-
methionine and L-phenylalanine suggesting a more hydropho-
bic environment in the active site. The basic L-amino acids L-
lysine and L-arginine were better substrates for 6His-
hcLAAO4 (45 and 29% relative activity, respectively) than
for hcLAAO1 (25 and 12%). By contrast, L-arginine was con-
verted with the highest activity by MBP-rsLAAO1 (Hahn
et al. 2017b), which lacked the ability to convert L-glutamate,
L-glutamine, and L-asparagine, and thereby had a narrower
substrate spectrum than 6His-hcLAAO4. These three en-
zymes share the ability to convert methyl esters of L-amino
acids. This is a useful property, because methyl esters of α-
keto acids are more stable than free α-keto acids. 6His-
hcLAAO4 converted L-leucine ethyl ester but with reduced
activity suggesting that there is limited space in the active site.
In addition to the broader substrate spectrum, 6His-
hcLAAO4 offers the following further advantages over MBP-
rsLAAO1 for potential biotechnological applications. Activation
by brief exposure to acidic pH does not leave a chemical such as
the detergent SDS in the enzyme preparation, which could inter-
fere with process development or could be difficult to remove
from the product. Expression of 6His-hcLAAO4 was more effi-
Discussion
The purified, untreated 6His-hcLAAO4 displayed v values
max
of 2 U mg− for the best substrates, which is much higher than
1
the activity observed for untreated MBP-rsLAAO1
−1
(
0.1 U mg ) (Hahn et al. 2017b). Two molars of urea used
during purification did not activate 6His-hcLAAO4 (data not
shown). Small amounts of SDS increased the specific activity
−1
of MBP-rsLAAO1 about 50–100-fold to 9 U mg for the best
substrates. LAAO1 from H. cylindrosporum (hcLAAO1) was
inactive after heterologous expression in E. coli, but could be
−1
activated by SDS to 14 U mg for L-glutamate, the best sub-
strate (Nuutinen et al. 2012). Therefore, we also tested SDS
treatment for 6His-hcLAAO4. This enzyme was activated
−1
about 4-fold by 1.5 mM SDS; 14 U mg was reached in the
best preparations. This means that the specific activity of the
SDS-activated 6His-hcLAAO4 was higher than that of MBP-
rsLAAO1. Activation of 6His-hcLAAO4 remained almost
constant at SDS concentrations up to 10 mM but SDS
destabilized the enzyme. By contrast, 10 mM SDS was less
effective than 2 mM for 9His-rsLAAO1 and MBP-rsLAAO1
(
Hahn et al. 2017b). SDS activation was also described for
endogenous tyrosinases and polyphenol oxidases. They are
synthesized as inactive, latent oxidases in Xenopus laevis and
plants, which can be activated to induce enzymatic browning of
vegetables and plants (Espin and Wichers 1999; Moore and
Flurkey 1990; Wittenberg and Triplett 1985). Upon analyzing
the pH optimum, we noticed that 6His-hcLAAO4 is activated
by a brief exposure to an acidic pH between 2 and 5 to a
−1
specific activity between 20 and 44 U mg . The active state
was retained for days after return to neutral pH. This indicates
that acid treatment induces a conformational change into a
stable active form as reflected also by an increase in its hydro-
dynamic radius. pH activation resulted in slightly higher spe-
cific activities than SDS activation for the same batch of puri-
fied enzyme. Exposure to acidic pH and SDS did not result in
additive effects. Similar activation behavior has been observed
for polyphenol oxidases. The latent phenolase from broad bean
can be activated by SDS as well as by a brief exposure to an
acid pH between 2 and 4 (Kenten 1957; Kenten 1958). These
agents also activate a polyphenol oxidase from field bean and
induce a conformational change (Kanade et al. 2006). By con-
trast, 9His-rsLAAO1 was not activated by acidic pH (data not
shown). Snake LAAOs are also influenced by pH. They are
isolated from the slightly acidic snake venom, reversibly
inactivated by exposure to neutral or slightly basic pH and
can be reactivated by slightly acidic pH (Kearney and Singer
−1
cient with 2 U mg for the best substrate in E. coli lysates
−1
compared to 0.2 U mg for MBP-rsLAAO1 after activation.
For large hydrophobic L-amino acids, which are good substrates
for both enzymes, vmax values were twice as high for L-phenyl-
alanine or more than 4-fold higher for L-leucine in 6His-
hcLAAO4 compared to MBP-rsLAAO1. In addition, the acid-
activated form of 6His-hcLAAO4 was more stable compared to
SDS-activated MBP-rsLAAO1.
Ald-6His-hcLAAO4 was obtained with a much lower yield
of only 26% compared to the non-aldehyde-tagged form. This
1
951). Snake venom LAAOs are reversibly inactivated by

Appl Microbiol Biotechnol
most likely can be attributed to two factors: First, co-
expression of FGE causes additional stress to the protein ex-
pression system of the cells, negatively impacting the overall
protein yield (Glick 1995). Secondly, fusion with the aldehyde
tag by itself can lead to a lower expression yield, as reported
earlier (Jian et al. 2016). The specific activity of Ald-6His-
hcLAAO4 after acid activation was between 25 and
as the operational application of the immobilized enzyme in a
reactor (Rios et al. 2004; Seelbach et al. 1997).
The high catalytic stability of the immobilized hcLAAO4
preparation was further demonstrated by comparison of the
long-term storage stability of free and immobilized LAAO.
The immobilized enzyme displayed a more than 50% higher
stability than the free counterpart, as reflected by the sustained
catalytic activity even after 40 days, compared to the free
enzyme which lost activity already after 28 days. This extend-
ed stability may be attributed to the prevention of aggregation,
autolysis, and proteolysis by immobilization within the porous
matrix (Mateo et al. 2007).
To summarize this work on hcLAAO4, we present a new and
biotechnologically highly potent biocatalyst and, moreover, de-
scribe a straightforward and innovative strategy for its immobi-
lization thereby establishing a robust biocatalyst. In agreement
with previous applications of the aldehyde tag for enzyme im-
mobilization (Jian et al. 2016; Sungkeeree et al. 2017; Wang et al.
2013), our results underline the benefits of the bioorthogonal
covalent immobilization via the aldehyde tag compared to more
widespread, but less targeted methods. The covalent linkage min-
imizes leaching of the enzyme from the support (Zhao et al.
2006), as evidenced by the exceptionally high reusability of the
immobilized enzyme preparation for 12 cycles of catalytic appli-
cation. At the same time, the site-specific immobilization medi-
ated by the genetically encoded tag enables a defined arrange-
ment of the enzyme, thus minimizing steric hindrances and
avoiding the potential loss of the catalytic activity during the
immobilization process (Camarero 2008).
−1
5
0 U mg , i.e., in the same range as the activity of the non-
aldehyde-tagged enzyme. Thus, the aldehyde tag has no neg-
ative impact on the catalytic efficiency.
Without co-expressing FGE, about 45% of Ald-6His-
hcLAAO4 was converted to the formylglycine-bearing spe-
cies, which can be attributed to the yet unidentified endoge-
nous FGly-generating system of E. coli (Benjdia et al. 2007)
and is in line with previously published results (Carrico et al.
2
007), reporting a conversion of 35 ± 5% by the endogenous
system. To maximize the yield of aldehyde-modified
hcLAAO4, we co-expressed a prokaryotic FGE used earlier
(
9
Krüger et al. 2018), thereby achieving a conversion rate of >
5%. A proof-of-concept aldehyde-specific conjugation was
carried out with the purified enzyme using a recently de-
scribed HIPS-carboxyfluorescein probe as fluorescent marker
(
Krüger et al. 2018). Fluorescence labeling was clearly depen-
dent on the presence of FGly and its efficiency correlated with
FGly content, thus demonstrating the selectivity and accessi-
bility of the aldehyde tag for site-specific modification.
FGly-modified hcLAAO4 was used for bioorthogonal im-
mobilization via reductive amination on the hexylamine mod-
ified PMMA matrix HA403. Although hcLAAO4 contains a
potentially redox-sensitive FAD cofactor, incubation of the
Acknowledgements We thank Marco Wißbrock and Annalena Lausch for
excellent technical assistance. The pET14b-mtbFGE-His6 plasmid was kind-
ly provided by David Rabuka (Redwood Bioscience, Emeryville, USA).
enzyme with NaCNBH under standard reduction conditions
3
(
50 mM, 20 min, 4 °C) did not show any negative impact on
enzyme activity (data not shown). We were able to immobilize
0.15 mU per mg of resin, which is the same as achieved
1
Funding This study was funded by Universität Bielefeld as a strategic
previously for the immobilization of the thermophilic L-
aspartate oxidase from Sulfolobus tokodaii (StLASPO) on
HA403 modified with glutaraldehyde (D’Arrigo et al. 2015).
Assuming no loss in the specific activity by the immobiliza-
tion procedure, this corresponds to 0.8 μg of hcLAAO4
immobilized per milligram of resin.
project.
Compliance with ethical standards
Conflict of interest All authors declare that they have no conflict of
interest.
Immobilization of enzymes is of growing interest for biotech-
nological applications, since reusability of the biocatalyst can
drastically increase its TTN, the amount of product yielded per
amount of catalyst which is directly correlated to the relative
catalyst costs (Liese and Hilterhaus 2013). We therefore tested
the catalytic stability of the immobilized LAAO preparation. The
immobilized enzyme could be reused in 12 cycles without any
loss in activity, corresponding to a TTN of more than 17,000.
This value is well above the limit of 1000 given for an economic
catalyst use for small-scale, high-value products, but still below
the limit of 50,000 given for large-scale products (Blaser and
Studer 1999). In follow-up experiments, this number should be
increased by further optimizing the reaction conditions, as well
Ethical approval This article does not contain any studies with human
participants or animals performed by any of the authors.
Publisher’s Note Springer Nature remains neutral with regard to jurisdic-
tional claims in published maps and institutional affiliations.
References
Belval L, Marquette A, Mestre P, Piron MC, Demangeat G, Merdinoglu
D, Chich JF (2015) A fast and simple method to eliminate Cpn60
from functional recombinant proteins produced by E-coli Arctic
Express. Protein Expr Purif 109:29–34. https://doi.org/10.1016/j.
pep.2015.01.009

Appl Microbiol Biotechnol
Benjdia A, Deho G, Rabot S, Berteau O (2007) First evidences for a third
sulfatase maturation system in prokaryotes from E. coli aslB and
ydeM deletion mutants. Febs L 581:1009–1014. https://doi.org/10.
Hahn K, Neumeister K, Mix A, Kottke T, Gröger H, von Mollard G
(2017b) Recombinant expression and characterization of a L-
amino acid oxidase from the fungus Rhizoctonia solani. Appl
Microbiol Biotechnol 101:2853–2864. https://doi.org/10.1007/
s00253-016-8054-y
Hossain GS, Li J, Shin H-d DG, Liu L, Chen J (2014) L-Amino acid
oxidases from microbial sources: types, properties, functions, and
applications. Appl Microbiol Biotechnol 98:1507–1515. https://doi.
org/10.1007/s00253-013-5444-2
Jian H, Wang YW, Bai Y, Li R, Gao RJ (2016) Site-specific, covalent
immobilization of dehalogenase ST2570 catalyzed by
formylglycine-generating enzymes and its application in batch and
semi-continuous flow reactors. Molecules 21. https://doi.org/10.
3390/molecules21070895
Kanade SR, Paul B, Rao AGA, Gowda LR (2006) The conformational
state of polyphenol oxidase from field bean (Dolichlos lablah) upon
SDS and acid-pH activation. Biochem J 395:551–562. https://doi.
org/10.1042/bj20051509
1
016/j.febslet.2007.01.076
Bifulco D, Pollegioni L, Tessaro D, Servi S, Molla G (2013) A thermo-
stable L-aspartate oxidase: a new tool for biotechnological applica-
tions. Appl Microbiol Biotechnol 97:7285–7295. https://doi.org/10.
1
007/s00253-013-4688-1
Blaser HU, Studer M (1999) Critical issues for using enantioselective
catalysis for fine chemicals production. Chirality 11:459–464.
https://doi.org/10.1002/(sici)1520-636x(1999)11:5/6<459::aid-
chir17>3.0.co;2-n
Bradford MM (1976) Rapid and sensitive method for quantitation of
microgram quantities of protein utilizing principle of protein-dye
binding. Anal Biochem 72:248–254. https://doi.org/10.1006/abio.
1
976.9999
Camarero JA (2008) Recent developments in the site-specific immobili-
zation of proteins onto solid supports. Biopolymers 90:450–458.
https://doi.org/10.1002/bip.20803
Candiano G, Bruschi M, Musante L, Santucci L, Ghiggeri GM,
Carnemolla B, Orecchia P, Zardi L, Righetti PG (2004) Blue silver:
a very sensitive colloidal Coomassie G-250 staining for proteome
analysis. Electrophoresis 25:1327–1333. https://doi.org/10.1002/
elps.200305844
Kasai K, Ishikawa T, Komata T, Fukuchi K, Chiba M, Nozaka H,
Nakamura T, Sato T, Miura T (2010) Novel L-amino acid oxidase
with antibacterial activity against methicillin-resistant
Staphylococcus aureus isolated from epidermal mucus of the floun-
der Platichthys stellatus. FEBS J 277:453–465. https://doi.org/10.
1111/j.1742-4658.2009.07497.x
Carrico IS, Carlson BL, Bertozzi CR (2007) Introducing genetically
encoded aldehydes into proteins. Nat Chem Biol 3(6):321–322.
https://doi.org/10.1038/nchembio878
Kearney EB, Singer TP (1951) The L-amino acid oxidases of snake
venom. III. Reversible inactivation of l-amino acid oxidases. Arch
Biochem Biophys 33:377–396. https://doi.org/10.1016/0003-
9861(51)90125-7
Cheng CH, Yang CA, Liu SY, Lo CT, Huang HC, Liao FC, Peng KC
(
2011) Cloning of a novel L-amino acid oxidase from Trichoderma
Kenten RH (1957) Latent phenolase in extracts of broad-bean (Vicia faba
L.) leaves. Activation by acid and alkali. Biochem J 67:300–307.
https://doi.org/10.1042/bj0670300
Kenten RH (1958) Latent phenolase in extracts of broad-bean (Vicia faba
L.) leaves. 2. Activation by anionic wetting agents. Biochem J 68:
244–251. https://doi.org/10.1042/bj0680244
Krüger T, Weiland S, Falck G, Gerlach M, Boschanski M, Alam S,
Muller KM, Dierks T, Sewald N (2018) Two-fold bioorthogonal
derivatization by different formylglycine-generating enzymes.
Angew Chem Int Ed 57:7245–7249. https://doi.org/10.1002/anie.
201803183
harzianum ETS 323 and bioactivity analysis of overexpressed L-
amino acid oxidase. J Agric Food Chem 59:9142–9149. https://doi.
org/10.1021/jf201598z
Coles CJ, Edmondson DE, Singer TP (1977) Reversible inactivation of
L-amino-acid oxidase - properties of 3 conformational forms. J Biol
Chem 252:8035–8039
Curti B, Massey V, Zmudka M (1968) Inactivation of snake venom L-
amino acid oxidase by freezing. J Biol Chem 243:2306–2314
D'Arrigo P, Allegretti C, Fiorati A, Piubelli L, Rosini E, Tessaro D,
Valentino M, Pollegioni L (2015) Immobilization of L-aspartate
oxidase from Sulfolobus tokodaii as a biocatalyst for resolution of
aspartate solutions. Catal Sci Technol 5:1106–1114. https://doi.org/
Laemmli UK (1970) Cleavage of structural proteins during the assembly
of the head of bacteriophage T4. Nature 227:680–685
1
0.1039/c4cy00968a
Liese A, Hilterhaus L (2013) Evaluation of immobilized enzymes for
industrial applications. Chem Soc Rev 42:6236–6249. https://doi.
org/10.1039/c3cs35511j
Liu L, Hossain GS, Shin HD, Li JH, Du GC, Chen J (2013) One-step
production of alpha-ketoglutaric acid from glutamic acid with an
engineered L-amino acid deaminase from Proteus mirabilis. J
Biotechnol 164:97–104. https://doi.org/10.1016/j.jbiotec.2013.01.005
Masuko M, Iwasaki H (1984) Activation of nitrite reductase in a cell-free
system from the denitrifier Alcaligenes sp by freeze-thawing. Plant
Cell Physiol 25:439–446
Masuko M, Iwasaki H, Sakurai T, Suzuki S, Nakahara A (1985) Effects of
freezing on purified nitrite reductase from a denitrifier, Alcaligenes
sp ncib 11015. J Biochem 98:1285–1291. https://doi.org/10.1093/
oxfordjournals.jbchem.a135395
Mateo C, Palomo JM, Fernandez-Lorente G, Guisan JM, Fernandez-
Lafuente R (2007) Improvement of enzyme activity, stability and selec-
tivity via immobilization techniques. Enzyme Microbial Technol 40:
1451–1463. https://doi.org/10.1016/j.enzmictec.2007.01.018
McIlvaine TC (1921) A buffer solution for colorimetric comparison. J
Biol Chem 49:183–186
Davis MA, Askin MC, Hynes MJ (2005) Amino acid catabolism by an
areA-regulated gene encoding an L-amino acid oxidase with broad
substrate specificity in Aspergillus nidulans. Appl Environ
Microbiol 71:3551–3555. https://doi.org/10.1128/aem.71.7.3551-
3
555.2005
Du XY, Clemetson KJ (2002) Snake venom L-amino acid oxidases.
Toxicon 40:659–665. https://doi.org/10.1016/s0041-0101(02)
0
0102-2
Espin JC, Wichers HJ (1999) Activation of a latent mushroom (Agaricus
bisporus) tyrosinase isoform by sodium dodecyl sulfate (SDS). ki-
netic properties of the SDS-activated isoform. J Agric Food Chem
4
7:3518–3525. https://doi.org/10.1021/jf981275p
Ferrer M, Chernikova TN, Timmis KN, Golyshin PN (2004) Expression
of a temperature-sensitive esterase in a novel chaperone-based
Escherichia coli strain. Appl Environ Microbiol 70:4499–4504.
https://doi.org/10.1128/aem.70.8.4499-4504.2004
Glick BR (1995) Metabolic load and heterologous gene-expression.
Biotechnol Adv 13:247–261. https://doi.org/10.1016/0734-
9
750(95)00004-a
Hahn K, Hertle Y, Bloess S, Kottke T, Hellweg T, von Mollard G (2017a)
Activation of recombinantly expressed L-amino acid oxidase from
Rhizoctonia solani by sodium dodecyl sulfate. Molecules 22(12).
https://doi.org/10.3390/molecules22122272
Moore BM, Flurkey WH (1990) Sodium dodecyl-sulfate activation of a
plant polyphenoloxidase—effect of sodium dodecyl-sulfate on en-
zymatic and physical characteristics of purified broad bean
polyphenoloxidase. J Biol Chem 265:4982–4988

Appl Microbiol Biotechnol
Nakai K, Horton P (1999) PSORT: a program for detecting sorting signals
in proteins and predicting their subcellular localization. Trends
Biochem Sci 24:34–35. https://doi.org/10.1016/s0968-0004(98)
Sörensen SPL (1909) Enzymstudien. II. Mitteilung. Über die Messung
und die Bedeutung der Wasserstoffion Konzentration bei
enzymatischen Prozessen. Biochem Z 21:131
0
1336-x
Sungkeeree P, Whangsuk W, Sallabhan R, Dubbs J, Mongkolsuk S,
Loprasert S (2017) Efficient removal of toxic phthalate by
immobilized serine-type aldehyde-tagged esterase G. Process
Biochem 63:60–65. https://doi.org/10.1016/j.procbio.2017.09.009
Tong HC, Chen W, Shi WY, Qi FX, Dong XZ (2008) SO-LAAO, a novel
L-amino acid oxidase that enables Streptococcus oligofermentans to
Nuutinen JT, Timonen S (2008) Identification of nitrogen mineralization
enzymes, L-amino acid oxidases, from the ectomycorrhizal fungi
Hebeloma spp. and Laccaria bicolor. Mycol Res 112:1453–1464.
https://doi.org/10.1016/j.mycres.2008.06.023
Nuutinen JT, Marttinen E, Soliymani R, Hilden K, Timonen S (2012) L-
Amino acid oxidase of the fungus Hebeloma cylindrosporum dis-
plays substrate preference towards glutamate. Microbiology 158:
2 2
outcompete Streptococcus mutans by generating H O from peptone.
J Bacteriol 190:4716–4721. https://doi.org/10.1128/jb.00363-08
Wang AM, Du FC, Wang F, Shen YQ, Gao WF, Zhang PF (2013)
Convenient one-step purification and immobilization of lipase using
a genetically encoded aldehyde tag. Biochem Eng J 73:86–92.
https://doi.org/10.1016/j.bej.2013.02.003
2
72–283. https://doi.org/10.1099/mic.0.054486-0
Petersen TN, Brunak S, von Heijne G, Nielsen H (2011) SignalP 4.0:
discriminating signal peptides from transmembrane regions. Nat
Meth 8:785–786. https://doi.org/10.1038/nmeth.1701
Pollegioni L, Molla G (2011) New biotech applications from evolved D-
amino acid oxidases. Trends Biotechnol 29:276–283. https://doi.
org/10.1016/j.tibtech.2011.01.010
Pollegioni L, Motta P, Molla G (2013) L-Amino acid oxidase as biocat-
alyst: a dream too far ? Appl Microbiol Biotechnol 97:9323–9341.
https://doi.org/10.1007/s00253-013-5230-1
Rios GM, Belleville MP, Paolucci D, Sanchez J (2004) Progress in enzy-
matic membrane reactors—a review. J Membr Sci 242:189–196.
https://doi.org/10.1016/j.memsci.2003.06.004
Wittenberg C, Triplett EL (1985) A detergent-activated tyrosinase from
Xenopus laevis. 2. Detergent activation and binding. J Biol Chem
2
60:2542–2546
Yang HC, Johnson PM, Ko KC, Kamio M, Germann MW, Derby CD, Tai
PC (2005) Cloning, characterization and expression of escapin, a
broadly antimicrobial FAD-containing L-amino acid oxidase from
ink of the sea hare Aplysia californica. J Exp Biol 208:3609–3622.
https://doi.org/10.1242/jeb.01795
Yang CA, Cheng CH, Lo CT, Liu SY, Lee JW, Peng KC (2011) A novel
L-amino acid oxidase from Trichoderma harzianum ETS 323 asso-
ciated with antagonism of Rhizoctonia solani. J Agric Food Chem
Seelbach K, vanDeurzen MPJ, vanRantwijk F, Sheldon RA, Kragl U
(
1997) Improvement of the total turnover number and space-time
yield for chloroperoxidase catalyzed oxidation. Biotechnol Bioeng
5:283–288
5
9:4519–4526. https://doi.org/10.1021/jf104603w
Zhao XS, Bao XY, Guo WP, Lee FY (2006) Immobilizing catalysts on
porous materials. Mater Today 9:32–39. https://doi.org/10.1016/
s1369-7021(06)71388-8
5