Molecular characterization and mutational analysis of recombinant diadenosine 5′,5″-P1,P4-tetraphosphate hydrolase from Plasmodium falciparum

Article abstract of DOI:10.1248/bpb.b12-00165

Asymmetrical diadenosine 5′,5″-P¹,P ⁴-tetraphosphate hydrolase (EC 3.6.1.17) from human malaria parasite Plasmodium falciparum was expressed in Escherichia coli, purified to homogeneity, and characterized for the first time as a biological target for chemotherapeutic agents against malaria. Plasmodium falciparum Ap₄A (PfAp₄A) hydrolase not only catalyzes diadenosine 5′,5″-P¹,P⁴-tetraphosphate (Ap₄A) to ATP and AMP, but also diadenosine 5′,5″-P¹,P ⁵-pentaphosphate (Ap₅A) to ATP and ADP. Marked enzyme heat stability corresponding to the highest level of activity was observed at 60°C. The recombinant enzyme showed maximal activity in the presence of 5 mM Mg²⁺ ions. Kinetic analysis revealed the values of K_m and K_cat as 0.6 μM and 2.5 min^-1, respectively. Comparative protein modeling indicated an additional space in the substrate binding site of the parasitic enzyme compared with that of humans. Mutagenic analysis of the amino acid residue (Pro133) forming the additional space revealed a 5-fold increase in the wild-type K_m value when replaced by a smaller (Ala) residue. Furthermore, catalytic activity was markedly affected by introducing a larger residue (Phe), thus creating the potential to develop a specific inhibitor of PfAp₄A hydrolase.

Full text of DOI:10.1248/bpb.b12-00165

July 2012
Note
Biol. Pharm. Bull. 35(7) 1191–1196 (2012)
1191
Molecular Characterization and Mutational Analysis of Recombinant
Diadenosine 5ꢀ,5ꢁ-P1,P4-Tetraphosphate Hydrolase from Plasmodium
falciparum
,a,c,d
Waleed Osman,a Satoshi Endo,b Kentaro Oh-hashi,c Yoshiaki Kitamura,d and Yukio Kitade*
c
a United Graduate School of Drug Discovery and Medical Information Sciences, Gifu University; Department of Bio-
d
molecular Science, Faculty of Engineering, Gifu University; Center for Advanced Drug Research, Gifu University;
b
1–1 Yanagido, Gifu 501–1193, Japan: and Laboratory of Biochemistry, Gifu Pharmaceutical University; Daigaku-
Nishi, Gifu 501–1196, Japan. Received February 17, 2012; accepted April 2, 2012
Asymmetrical diadenosine 5ꢀ,5ꢁ-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17) from human malaria para-
site Plasmodium falciparum was expressed in Escherichia coli, purified to homogeneity, and characterized
for the first time as a biological target for chemotherapeutic agents against malaria. Plasmodium falciparum
Ap4A (PfAp4A) hydrolase not only catalyzes diadenosine 5ꢀ,5ꢁ-P1,P4-tetraphosphate (Ap4A) to ATP and AMP,
but also diadenosine 5ꢀ,5ꢁ-P1,P5-pentaphosphate (Ap5A) to ATP and ADP. Marked enzyme heat stability cor-
°
responding to the highest level of activity was observed at 60 C. The recombinant enzyme showed maximal
activity in the presence of 5mM Mg2+ ions. Kinetic analysis revealed the values of Km and Kcat as 0.6µM and
2.5minꢂ1, respectively. Comparative protein modeling indicated an additional space in the substrate binding
site of the parasitic enzyme compared with that of humans. Mutagenic analysis of the amino acid residue
(Pro133) forming the additional space revealed a 5-fold increase in the wild-type Km value when replaced by
a smaller (Ala) residue. Furthermore, catalytic activity was markedly affected by introducing a larger resi-
due (Phe), thus creating the potential to develop a specific inhibitor of PfAp4A hydrolase.
Key words malaria; Plasmodium; Ap4A hydrolase; diadenosine tetraphosphate; mutational analysis; chemo-
therapeutic
Malaria is a tenacious and constantly evolving pandemic by the highly conserved 23-residue sequence motif or Nudix
that kills nearly 800000 people annually. There are about 106 box (GX5EX7REUXEEXGU) where U is a bulky hydropho-
malaria-endemic countries, and it is estimated that the number bic residue and X is any amino acid. It occurs in a variety of
of malaria cases peaked at 225 million in 2009. Moreover, animals, bacteria, plants, yeasts, and proteobacteria.15)
antimalarial drug resistance is a major public health problem
When considering Ap4A hydrolase as a target for antima-
that hinders the control of malaria.1) Thus, the continuous larial agents, it is essential to be aware of the features that
increase in drug resistance necessitates the discovery of new distinguish Plasmodium enzyme from human enzyme for the
antimalarial drugs.
design of selective inhibitors. Therefore, differential character-
Enzymes are excellent and common targets for drug dis- ization and mutational analysis may reveal a potential therapy
covery and pharmacological intervention due to their essential against malaria.
roles in biological and pathophysiological processes.
Diadenosine 5′,5″-P1,P4-tetraphosphate (Ap4A) is an un-
MATERIALS AND METHODS
avoidable by-product of the reaction catalyzed by aminoacyl-
tRNA synthetase and other ligases.2) It is found at intracellular
Materials Ap4A, Ap5A, and Ap3A were purchased from
concentrations in the submicromolar to micromolar range.3) In Sigma-Aldrich Inc. (St. Louis, MO, U.S.A.). Talon metal affin-
eukaryotes, Ap4A plays an important role in several functions ity resin was purchased from Clontech Laboratories, Inc. (Palo
including regulation of ATP-sensitive K+ channels,4) activation Alto, CA, U.S.A.). KOD-Plus Mutagenesis Kit was obtained
of gene expression,5) signal function for the initiation of DNA from Toyobo (Osaka, Japan). ENLITEN® ATP Assay System
replication,6,7) cellular responses to metabolic stress and DNA was purchased from Promega (Madison, WI, U.S.A.).
damage,8) initiation of apoptosis,9,10) and modulation of Fhit tu-
Cloning and Construction of Expression Plasmid
mor suppressor protein activity.11) Furthermore, the enhanced cDNA encoding the open reading frame of PfAp4A hydrolase
ability of asymmetrical Ap4A hydrolase in some invasive was amplified by reverse transcription-polymerase chain reac-
bacteria is a characteristic feature that increases their chances tion (PCR) from P. falciparum (FCR-3 strain) mRNA. The
of survival.12) On the other hand, Ap4A concentration needs to gene encoding PfAp4A hydrolase was obtained by PCR using
be kept below the potential toxic level that might otherwise a pair of specific primers (Table 1). The primers were designed
inhibit kinases and other ATP-dependent enzymes.13) It is to contain BamHI and PstI restriction sites. The PCR product
conceivable that both interpretations are correct: synthesis and was digested with BamHI and PstI restriction enzymes and
degradation of Ap4A must be tightly controlled.
Ap4A hydrolase is the enzyme responsible for controlling product was extracted from the gel using a QIAquick Gel Ex-
checked for specificity by gel electrophoresis. Digested PCR
14)
“
”
the intracellular level of Ap4A ( housecleaning ). Asymmet- traction Kit and ligated to the His-Tag pQE-30 vector, which
rical Ap4A hydrolase belongs to the Nudix hydrolase super- was previously purified and digested with the same enzymes.
family of Mg2+-requiring enzymes. This family is recognized The resulting plasmid was termed pQE-PfAp4AH. Escherichia
coli JM109 competent cells were transformed with the plas-
The authors declare no conflict of interest.
mid pQE-PfAp4AH. Grown colonies were picked from an LB
*To whom correspondence should be addressed. e-mail: ykkitade@gifu-u.ac.jp
© 2012 The Pharmaceutical Society of Japan

1192
Vol. 35, No. 7
Fig. 1. Multiple Amino-Acid Sequence Alignment of Putative P. falciparum Ap4A Hydrolase with Similar Animal and Worm Sequences
The protein accession numbers are as follows: H (Homo sapiens), P50583; C.e (Caenorhabditis elegans), CAB63351; P.f (Plasmodium falciparum), CAX63975; P.k (Plas-
modium knowlesi), CAQ40378; P.v (Plasmodium vivax), EDL44024; P.c (Plasmodium chabaudi), CAH77553; and P.y (Plasmodium yoelii), EAA16360. Residues conserved
in the seven protein sequences are shaded black, and those shared among more than four sequences are shaded grey. Adenosine binding residues are marked with asterisks.
(Luria–Bertani) agar plate containing 50µg/mL ampicillin and as those used for the wild-type.
screened by colony PCR. Positive colonies were sequenced,
confirming the desired recombinant plasmid-containing puta- mined by HPLC and luciferase-based bioluminescence assay.
tive gene sequence. HPLC was used to determine enzyme activity by quantifying
Enzyme Assays The rate of Ap4A degradation was deter-
Expression and Purification of Recombinant Plasmid the amount of ATP produced. For optimal separation of the
E. coli cells containing recombinant plasmids were grown adsorbed nucleotides, a gradient separation was generated
overnight in LB broth containing 50µg/mL ampicillin at by mixing pure water (A) with buffered mobile phase (B)
°
37 C. Expression was induced by the addition of isopropyl consisting of 150mM NaH2PO4 (pH 6.0 with NaOH) and 10%
β-D-1-thiogalactopyranoside (IPTG) to a final concentration of (v/v) MeOH as follows: 0–3min, 80% buffer B; 3–6min, 90%
°
1mM and cell growth was continued at 37 C for an additional buffer B; 6–9min, 100% buffer B. The separation process was
4h. The harvested cells were lysed in an extraction buffer carried out at ambient temperature at a flow rate of 0.7mL/
(25mM Tris–HCl buffer, pH 7.5, containing 300mM NaCl) and min and detection at 254nm. The reaction mixture (100µL)
disintegrated by sonication on ice for 30s (three cycles with consisted of 100mM KH2PO4 (pH 7.5), 100µM Ap4A, 5mM
30s intervals). The lysate was centrifuged and the supernatant MgCl2, and purified enzyme. This mixture was incubated at
°
(50mL) was applied to a purification column containing 2mL 37 C for 10min, and the reaction was stopped by heating at
°
of Talon Metal Affinity Resin and purified according to the 100 C for 5min followed by centrifugation of the reaction
’
manufacturer s instructions. Protein concentration was deter- solution at 15000rpm for 3min. The clear supernatant was
mined by the Bradford method using Bio-Rad dye with bovine analyzed using an Inertsil ODS-3 (5µm, 4.6×150mm) HPLC
serum albumin as a standard.16)
Column. The luciferase-based bioluminescence assay was
Site-Directed Mutagenesis Site-directed mutagenesis used to identify the kinetic constants of wild-type and mutant
was performed to produce mutant enzymes containing a enzymes by the detection of ATP. The 100µL assay mixture
single amino-acid substitution. Pairs of complementary mutant consisted of 100mM Tris–HCl buffer (pH 7.5) containing
primers (Table 1) were used to prime replication of the circu- 10µL of reconstituted rL/L Reagent, 5mM MgCl2, 10µL of
lar pQE-PfAp4AH plasmid by KOD-Plus DNA Polymerase ac- different concentrations of Ap4A, and 10ng of purified en-
’
cording to the manufacturer s instructions. The mutated plas- zyme, and the reaction was carried out at room temperature.
mids were transformed to JM109 competent cells. The mutant Light output was measured by a GloMaxTM 20/20 luminometer
enzymes were expressed and purified by the same procedures and converted into units of enzyme activity (µmol/min) using
Table 1. Wild and Mutagenic Primers Used for Site-Directed Mutagenesis of P. falciparum Ap4A Hydrolase
Mutations
Wild
Primer name
Primer sequence (5′–3′)
Wild fw.
CGCGGATCCATGAAAATTAATATTATTAAAGC
GCGCTGCAGTTATAGTTGTTCTTTATTTAAAAATTC
CGTATAACCTTGCTGAATCCTTAGCTG
Wild rev.
P133A fw.
P133A rev.
P133F fw.
P133F rev.
P133A
P133F
CAGCTAAGGATTCAGCAAGGTTATACG
GTATAACCTTTTTGAATCCTTAGCTGATTTAT
ATAAATCAGCTAAGGATTCAAAAAGGTTATAC
The mutated amino acids are underlined.

July 2012
1193
Table 3. Substrate Utilization by PfAp4A Hydrolase
Substrate
Major productsa)
Relative activity (%)b)
Ap4A
Ap5A
Ap3A
ATP
ATP+AMP
ATP+ADP
100%
42%
NDc)
NDc)
NDc)
—
—
—
NADH
a) Products were detected using HPLC. b) Related to the rate of Ap4A hydrolysis
in the presence of 100µM Ap4A. c) Not detected.
Expression and Purification Recombinant wild-type and
mutant enzymes were generated as a histidine-tagged fusion
protein from pQE-30 vector and expressed in JM109 E. coli
cells. The fusion protein was bound to Co2+ ion of TALON
Fig. 2. Analysis of Expressed and Purified Recombinant PfAp4A Hy- Metal Affinity Resin. After binding and washing, the protein
drolases by SDS-PAGE
was eluted using 250mM imidazole. The eluted wild-type
protein was purified to 13.6-fold and a single band was ob-
served at 17kDa. Table 2 summarizes the results of wild-type
Lane 1, protein marker; lane 2, whole cell proteins from E. coli expressing the
putative protein (17kDa); lane 3, purified wild-type PfAp4A hydrolase; lane 4, puri-
fied mutant P133A enzyme; lane 5, purified mutant P133F enzyme.
enzyme purification. The size and purity of eluted wild-type
a calibration ATP curve.
RESULTS
and mutant proteins were assessed by sodium dodecyl sulfate-
polyacrylamide gel electrophoresis (SDS-PAGE) stained with
Coomassie Brilliant Blue (Fig. 2).
Substrate Specificity PfAp4A hydrolase activity was
Amino Acid Sequence Alignment PfAp4A hydrolase screened by HPLC using various substrates (Ap4A, Ap5A,
cDNA encodes an open reading frame of 152 amino acids. Ap3A, ATP, and reduced nicotinamide adenine dinucleotide
PfAp4A hydrolase possesses a Nudix motif, which is reported (NADH)) at a concentration of 100µM in the presence of 5mM
to be a characteristic feature of all asymmetrical Ap4A hydro- MgCl2, as described previously. PfAp4A hydrolase catalyzes
lases and is found at residues G49–G70. Amino acid sequence asymmetric hydrolysis of Ap4A to products ATP and AMP.
alignment was conducted between P. falciparum Ap4A hydro- Plasmodium enzyme showed significant activity towards
lase and several Ap4A hydrolases. Human and Caenorhabditis Ap5A, producing ATP, and ADP with relative activity reach-
elegans (C. elegans) Ap4A hydrolases shared 36% amino acid ing 42%. No enzyme activity was detected with diadenosine
sequence identity with the parasitic enzyme. Ap4A hydrolases 5′,5″-P1,P3-triphosphate (Ap3A), ATP, or NADH as substrates
of other Plasmodium species, P. knowlesi, P. vivax, P. cha- (Table 3).
baudi, and P. yoelii, showed 72%, 70%, 51%, and 66% iden-
Optimum pH and Temperature The activity of PfAp4A
tity, respectively (Fig. 1).
hydrolase was observed over a wide pH range (5–11) with
Fig. 3. The Effect of pH (A) and Temperature (B) on Plasmodium falciparum Ap4A Hydrolase Enzyme Activity
Table 2. Purification Summary of P. falciparum Ap4A Hydrolase
Fraction
Total protein (mg)
Total activity (units)
Specific activity (U/mg)
Purity (fold)
Cell extract
61.0
1.7
146.4
55.7
2.4
1.0
Metal affinity
32.8
13.6

1194
Vol. 35, No. 7
Table 4. Kinetic Constants of Wild and Mutant P. falciparum Ap4A
Hydrolases
Mutations
Km (µM)
Kcat (min−1
)
Wild
0.6 0.05
3.0 0.26
0.8 0.12
2.5 0.09
4.8 1.07
0.8 0.15
P133A
P133F
(large size) were investigated.
Mutational Analysis Mutational analysis was conducted
at the adenosine binding site by site-directed mutagenesis. Km
and Kcat values were identified for the mutant enzymes to de-
termine the effects of each mutation on substrate binding and
catalytic efficiency. The kinetic constants of both the wild-
type and mutant enzymes were measured using a luciferase-
based bioluminescence assay (Table 4). The wild-type Km and
Kcat values were 0.6µM and 2.5min−1, respectively, in common
with animal Ap4A hydrolases. As expected, P133A showed a
Fig. 4. The Effects of Divalent Metal Ions (5mM) on Enzymatic Activ-
ity
a Relative to the rate of hydrolysis of 100µM Ap4A (considered 100% in the pres-
ence of Mg2+); b ND, not detected.
optimum activity noted at pH 7.5 (Fig. 3A). The enzyme 5-fold increase in Km compared with wild-type, while the Kcat
°
showed marked heat stability at 60 C at which the most effi- value did not differ significantly. The Km value of P133F was
cient activity was detected, while the enzyme maintained 39% not significantly affected while the Kcat value showed a 3-fold
°
of its activity when incubated at 70 C for 10min (Fig. 3B).
decrease.
Metal Ion Requirements PfAp4A hydrolase showed max-
imum activity in the presence of 5mM Mg2+. Furthermore,
enzyme activity was observed in the presence of 5mM Co2+
(relative activity 42%), 5mM Mn2+ (relative activity 11%), and
DISCUSSION
In the development of antimalarial drugs, it may be appro-
5mM Zn2+ (relative activity 2%) (Fig. 4). Enzyme activity priate to select targets from parasitic pathways that are absent
was not detected in the presence of Ca2+, and relative activity in humans. Nevertheless, even if a target is common to both
decreased by 70% in the presence of 5mM of both Mg2+ and parasite and host, slight structural differences can enhance the
Ca2+.
optimization of a new drug.18) A difference in only one amino
Homology Modeling A comparison of the three dimen- acid residue between humans and Plasmodium S-adenosyl-l-
sional structures of human (as observed in the NMR struc- homocysteine hydrolase has led to the discovery of a highly
ture)17) and P. falciparum (as predicted from protein modeling) selective inhibitor for the malaria parasite.19) To aid the de-
Ap4A hydrolases indicated an overall similarity between both velopment of antimalarial agents targeting Ap4A hydrolase,
enzymes (data not shown), with an interesting difference at characterization of the parasitic enzyme has been conducted
the adenosine binding site. In the human enzyme, the adenos- and compared with other forms of Ap4A hydrolase, par-
ine moiety is stacked between two phenyl rings of Tyr87 and ticularly that of humans. Ap4A hydrolases are classified into
Phe133 leaving a small space, while the adenosine moiety of two subgroups according to their primary structure: animals
the enzyme of P. falciparum lies between the phenyl ring of including archaea, and plants with proteobacteria.20) Amino
Tyr87 on one side and Pro133 on other side, leaving a larger acid sequence analysis confirmed that PfAp4A hydrolase be-
space (Fig. 5). Therefore, the Plasmodium Pro133 residue longs to the animal subgroup. The properties of P. falciparum
should have an important role in substrate binding, thus the Ap4A hydrolase are in good agreement with those of animal
effects of replacing the residue with Ala (small size) or Phe Ap4A hydrolases previously described. The substrates utilized
Fig. 5. A Comparison of the Surface Models of the Ado (Adenosine) Binding Site in H. sapiens (A) and Plasmodium falciparum (B) Ap4A Hydro-
lases

July 2012
1195
revealed that the enzyme is active toward dinucleoside poly- will confirm this possibility.
phosphates containing four or five phosphate residues, in com-
mon with animal Ap4A hydrolases. There was no evidence
Acknowledgements W.O. is the recipient of a postgradu-
that the enzyme could catalyze the symmetrical hydrolysis of ate scholarship from the Mitsubishi Corporation.
Ap4A to ADP as in the case of E. coli.21) PfAp4A hydrolase is
inhibited by Ca2+, unlike the human placental enzyme which
REFERENCES
shows limited activity (relative activity 20%) when Ca2+ is
the only divalent ion in the incubation mixture.22) A possible
mechanism for inhibition of parasitic enzyme by Ca2+ is the
competitive binding between Ca2+ and Mg2+, and hence dis-
placement of Mg2+ from the active site. Despite the ability
of Ca2+ to bind to the same active sites of Mg2+, it fails to
activate Mg2+-activated enzymes, was first demonstrated with
pyruvate kinase.23) It may be ascribed to the larger ionic ra-
dius of Ca2+ compared to Mg2+, Co2+, Mn2+, and Zn2+, which
disturbs its proper positioning for catalysis. The low Km value
of wild-type enzyme indicated that the Plasmodium enzyme
has high affinity for Ap4A; this high substrate affinity was
previously observed for Ap4A hydrolase isolated from both
human erythrocytes (Km 0.7µM) and leukocytes (Km 1.5µM).24)
Several studies of Nudix hydrolases have referred to the
importance of catalytic residues inside and adjacent to the
catalytic motif. The principles of this catalytic mechanism
appear to be well conserved among the Nudix hydrolases,
including those of humans. However, less attention has been
focused on residues involved in substrate binding.25) The
aromatic residues, which stack one substrate adenosine moi-
ety between them, are highly conserved in structure-based
amino acid sequence alignments of animal and plant Ap4A
hydrolases,17) suggesting that both residues have important
effects on substrate binding. The importance of stacking resi-
dues for substrate binding in C. elegans has been previously
confirmed by replacing Tyr121 by Ala, which led to an 8-fold
increase in wild-type Km value.25) Only one aromatic residue
(Tyr87) is conserved in the Plasmodium enzyme and the other
stacking equivalent residue is smaller Pro133, which creates
additional space in the Plasmodium adenosine binding site
“
”
1) World Health Organization. World Malaria Report 2010. :
‹http://www.who.int/malaria/world_malaria_report_2010/
worldmalariareport2010.pdf›, cited 14 December, 2010.
2) Sillero A, Sillero MA. Synthesis of dinucleoside polyphosphates
catalyzed by firefly luciferase and several ligases. Pharmacol. Ther.,
87, 91–102 (2000).
3) Guranowski A. Analogs of diadenosine tetraphosphate (Ap4A). Acta
Biochim. Pol., 50, 947–972 (2003).
4) Jovanovic A, Alekseev AE, Terzic A. Intracellular diadenosine
polyphosphates: a novel family of inhibitory ligands of the ATP-
sensitive K+ channel. Biochem. Pharmacol., 54, 219–225 (1997).
5) Lee YN, Nechushtan H, Figov N, Razin E. The function of lysyl-
tRNA synthetase and Ap4A as signaling regulators of MITF activity
in FcepsilonRI-activated mast cells. Immunity, 20, 145–151 (2004).
6) Flodgaard H, Klenow H. Abundant amounts of diadenosine
5′,5‴-P1,P4-tetraphosphate are present and releasable, but metaboli-
cally inactive, in human platelets. Biochem. J., 208, 737–742 (1982).
7) Baril EF, Coughlin SA, Zamecnik PC. 5′,5‴-P1,P4 diadenosine tet-
raphosphate (Ap4A): a putative initiator of DNA replication. Cancer
Invest., 3, 465–471 (1985).
8) Baker JC, Jacobson MK. Alteration of adenyl dinucleotide me-
tabolism by environmental stress. Proc. Natl. Acad. Sci. U.S.A., 83,
2350–2352 (1986).
9) Vartanian A, Alexandrov I, Prudowski I, McLennan A, Kisselev L.
Ap4A induces apoptosis in human cultured cells. FEBS Lett., 456,
175–180 (1999).
10) Vartanian AA, Suzuki H, Poletaev AI. The involvement of di-
adenosine 5′,5‴-P1,P4-tetraphosphate in cell cycle arrest and regula-
tion of apoptosis. Biochem. Pharmacol., 65, 227–235 (2003).
11) Brenner C. Hint, Fhit, and GalT: function, structure, evolution, and
mechanism of three branches of the histidine triad superfamily of
nucleotide hydrolases and transferases. Biochemistry, 41, 9003–9014
(2002).
compared with the human enzyme. An increase in the size of 12) Ismail TM, Hart CA, McLennan AG. Regulation of dinucleoside
polyphosphate pools by the YgdP and ApaH hydrolases is essential
for the ability of Salmonella enterica serovar typhimurium to in-
vade cultured mammalian cells. J. Biol. Chem., 278, 32602–32607
(2003).
the adenosine binding cavity of the Plasmodium enzyme (by
replacing Pro133 by Ala) led to a 5-fold increase in Km value
due to loose stacking of the adenosine ring. While extensive
stacking of the adenosine ring (replacing Pro133 by Phe) re-
sulted in a 3-fold decrease in enzyme catalysis, suggests that
the introducing of a larger residue to the active site precludes
13) McLennan AG. Dinucleoside polyphosphates-friend or foe? Phar-
macol. Ther., 87, 73–89 (2000).
’
“
14) Bessman MJ, Frick DN, O Handley SF. The MutT proteins or Nu-
the free movement of domain which is expected to occur dur-
ing catalysis, with keeping the complete substrate ability to
bind to active site effectively. These findings confirmed the
importance of the adenosine binding pocket in enzyme bind-
ing and catalysis. The additional space in the binding site of
the Plasmodium enzyme compared with the human enzyme
offers an opportunity to design potent and selective PfAp4A
hydrolase inhibitors.
We conclude that the properties of P. falciparum Ap4A
hydrolase showed differences compared with human Ap4A
hydrolase. PfAp4A hydrolase (a) exhibited high temperature
stability, (b) did not recruit Ca2+ ions as cofactors for enzyme
activity, and (c) showed a marked divergence in the adenosine
ring binding site compared with the human Ap4A hydrolase.
Our findings could aid the discovery of a Plasmodium Ap4A
hydrolase chemotherapeutic agent. Analysis of the crystal
structures of this enzyme in free and binary complex forms
”
“
dix hydrolases, a family of versatile, widely distributed, house-
”
cleaning enzymes. J. Biol. Chem., 271, 25059–25062 (1996).
15) Guranowski A. Specific and nonspecific enzymes involved in the
catabolism of mononucleoside and dinucleoside polyphosphates.
Pharmacol. Ther., 87, 117–139 (2000).
16) Bradford MM. A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-
dye binding. Anal. Biochem., 72, 248–254 (1976).
17) Swarbrick JD, Buyya S, Gunawardana D, Gayler KR, McLennan
AG, Gooley PR. Structure and substrate-binding mechanism of hu-
man Ap4A hydrolase. J. Biol. Chem., 280, 8471–8481 (2005).
18) Fidock DA, Rosenthal PJ, Croft SL, Brun R, Nwaka S. Antimalarial
drug discovery: efficacy models for compound screening. Nat. Rev.
Drug Discov., 3, 509–520 (2004).
19) Ando T, Iwata M, Zulfiqar F, Miyamoto T, Nakanishi M, Kitade Y.
Synthesis of 2-modified aristeromycins and their analogs as potent
inhibitors against Plasmodium falciparum S-adenosyl-L-homocyste-
ine hydrolase. Bioorg. Med. Chem., 16, 3809–3815 (2008).

1196
Vol. 35, No. 7
20) Abdelghany HM, Gasmi L, Cartwright JL, Bailey S, Rafferty JB,
Purif., 4, 45–51 (1993).
McLennan AG. Cloning, characterisation and crystallisation of a 23) Mildvan AS, Cohn M. Kinetic and magnetic resonance studies of
diadenosine 5′,5‴-P(1),P(4)-tetraphosphate pyrophosphohydrolase
from Caenorhabditis elegans. Biochim. Biophys. Acta, 1550, 27–36
(2001).
the pyruvate kinase reaction. II. Complexes of enzyme, metal, and
substrates. J. Biol. Chem., 241, 1178–1193 (1966).
24) Hankin S, Matthew N, Thorne H, McLennan AG. Diadenosine
5′,5‴-P1,P4-tetraphosphate hydrolase is present in human erythro-
cytes, leukocytes and platelets. Int. J. Biochem. Cell Biol., 27,
201–206 (1995).
21) Guranowski A, Jakubowski H, Holler E. Catabolism of diadenosine
5′,5‴-P1,P4-tetraphosphate in procaryotes. Purification and proper-
ties of diadenosine 5′,5‴-P1,P4-tetraphosphate (symmetrical) pyro-
phosphohydrolase from Escherichia coli K12. J. Biol. Chem., 258, 25) Abdelghany HM, Bailey S, Blackburn GM, Rafferty JB, McLen-
14784–14789 (1983).
nan AG. Analysis of the catalytic and binding residues of the
diadenosine tetraphosphate pyrophosphohydrolase from Caenorhab-
ditis elegans by site-directed mutagenesis. J. Biol. Chem., 278,
4435–4439 (2003).
22) Lazewska D, Starzyńska E, Guranowski A. Human placental
(asymmetrical) diadenosine 5′,5‴-P1,P4-tetraphosphate hydrolase:
purification to homogeneity and some properties. Protein Expr.