Synthesis and antiviral activity of a novel glycosyl sulfoxide against classical swine fever virus

Article abstract of DOI:10.1016/j.bmc.2014.03.027

A novel compound - 2″,3″,4″,6″-tetra-O-acetyl- β-d-galactopyranosyl-(1→4)-2′,3′,6′-tri-O-acetyl-1- thio-β-d-glucopyranosyl-(5-nitro-2-pyridyl) sulfoxide - designated GP6 was synthesized and assayed for cytotoxicity and in vitro antiviral properties against classical swine fever virus (CSFV) in this study. We showed that the examined compound effectively arrested CSFV growth in swine kidney cells (SK6) at a 50% inhibitory concentration (IC₅₀) of 5 ± 0.12 μg/ml without significant toxicity for mammalian cells. Moreover, GP6 reduced the viral E2 and E^rns glycoproteins expression in a dose-dependent manner. We have excluded the possibility that the inhibitor acts at the replication step of virus life cycle as assessed by monitoring of RNA level in cells and culture medium of SK6 cells after single round of infection as a function of GP6 treatment. Using recombinant E^rns and E2 proteins of classical swine fever virus produced in baculovirus expression system we have demonstrated that GP6 did not influence glycoprotein production and maturation in insect cells. In contrast to mammalian glycosylation pathway, insect cells support only the ER-dependent early steps of this process. Therefore, we concluded that the late steps of glycosylation process are probably the main targets of GP6. Due to the observed antiviral effect accompanied by low cytotoxicity, this inhibitor represents potential candidate for the development of antiviral agents for anti-flavivirus therapy. Further experiments are needed for investigating whether this compound can be used as a safe antiviral agent against other viruses from unrelated groups.

Full text of DOI:10.1016/j.bmc.2014.03.027

Bioorganic & Medicinal Chemistry 22 (2014) 2662–2670
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Synthesis and antiviral activity of a novel glycosyl sulfoxide against
classical swine fever virus
b
a
c
b
Ewelina Krol a, , Gabriela Pastuch-Gawolek , Dawid Nidzworski , Michal Rychlowski , Wieslaw Szeja ,
⇑
Grzegorz Grynkiewicz d, Boguslaw Szewczyk a
a Department of Recombinant Vaccines, Intercollegiate Faculty of Biotechnology, University of Gdansk and Medical University of Gdansk, Kladki 24, 80-822 Gdansk, Poland
b Department of Organic Chemistry, Bioorganic Chemistry and Biotechnology, Faculty of Chemistry, Silesian University of Technology, Krzywoustego 4, 44-101 Gliwice, Poland
c Department of Virus Molecular Biology, Intercollegiate Faculty of Biotechnology, University of Gdansk and Medical University of Gdansk, Kladki 24, 80-822 Gdansk, Poland
d Pharmaceutical Research Institute, Rydygiera 8, 01-793 Warsaw, Poland
a r t i c l e i n f o
a b s t r a c t
A novel compound—200,300,400,600-tetra-O-acetyl-b- -galactopyranosyl-(1?4)-20,30,60-tri-O-acetyl-1-thio-b-
D
Article history:
Received 5 December 2013
Revised 21 February 2014
Accepted 16 March 2014
Available online 27 March 2014
D
-glucopyranosyl-(5-nitro-2-pyridyl) sulfoxide—designated GP6 was synthesized and assayed for
cytotoxicity and in vitro antiviral properties against classical swine fever virus (CSFV) in this study.
We showed that the examined compound effectively arrested CSFV growth in swine kidney cells (SK6)
at a 50% inhibitory concentration (IC50) of 5 0.12 lg/ml without significant toxicity for mammalian
cells. Moreover, GP6 reduced the viral E2 and Erns glycoproteins expression in a dose-dependent manner.
We have excluded the possibility that the inhibitor acts at the replication step of virus life cycle as
assessed by monitoring of RNA level in cells and culture medium of SK6 cells after single round of infec-
tion as a function of GP6 treatment. Using recombinant Erns and E2 proteins of classical swine fever virus
produced in baculovirus expression system we have demonstrated that GP6 did not influence glycopro-
tein production and maturation in insect cells. In contrast to mammalian glycosylation pathway, insect
cells support only the ER-dependent early steps of this process. Therefore, we concluded that the late
steps of glycosylation process are probably the main targets of GP6. Due to the observed antiviral effect
accompanied by low cytotoxicity, this inhibitor represents potential candidate for the development of
antiviral agents for anti-flavivirus therapy. Further experiments are needed for investigating whether this
compound can be used as a safe antiviral agent against other viruses from unrelated groups.
Ó 2014 Elsevier Ltd. All rights reserved.
Keywords:
Classical swine fever virus
Glycoproteins
Sulfoxides
1. Introduction
conventional vaccines does not allow for discrimination between
vaccinated and infected pigs and is banned in the European Union,
Classical swine fever virus (CSFV), belongs to the family of
Flaviviridae, genus Pestivirus.1 CSFV is the causative agent of clas-
sical swine fever (CSF) and can cause an acute, highly infectious
and economically damaging disease in swine and wild boars.2,3
Several vaccines against CSF have been developed. These are live
attenuated vaccines, subunit marker vaccines or DNA vaccines.
Each of these vaccines have some disadvantages. Vaccination with
others are less potent and more expensive.4–6 CSF is present in
many parts of the world, however since the 1980s, it is eradicated
from the domestic pig population in most countries of the
European Union. Nevertheless, the virus is still circulating in some
populations of wild boars and the pig population is continuously at
risk for virus introduction. Present outbreaks are controlled by
culling of infected animals or those in contact with infected herds
and the restriction of animal movements which are very costly and
ethically questionable. Therefore, new strategies have to be imple-
mented to control CSF. Few drugs against CSFV infections have
been developed recently.7–9 The use of antiviral agents could be a
good control strategy to prevent transmission of the virus in case
of an outbreak.
Abbreviations: CC50, concentration of the compound required to reduce cell
viability by 50%; CSF, classical swine fever; CSFV, classical swine fever virus; Ct,
cycle threshold; ER, endoplasmic reticulum; GTs, glycosyltransferases; IC50
,
concentration of the compound required to reduce virus plaque formation by
50%; IPMA, immunoperoxidase monolayer assay; MOI, multiplicity of infection;
PRV, pseudorabies virus; Sf9, Spodoptera frugiperda insect cell line; SD, standard
deviations; S.I., selectivity index; SK6, swine kidney cells.
CSFV is an enveloped virus with a single-stranded positive sense
RNA genome of 12.5 kb that contains a single open reading frame
⇑
Corresponding author. Tel.: +48 58 523 63 36; fax: +48 58 305 73 12.
E-mail address: ewelina@biotech.ug.gda.pl (E. Krol).
http://dx.doi.org/10.1016/j.bmc.2014.03.027
0968-0896/Ó 2014 Elsevier Ltd. All rights reserved.

E. Krol et al. / Bioorg. Med. Chem. 22 (2014) 2662–2670
2663
encoding a polyprotein of approximately 4000 amino acids. The
polyprotein is processed into mature structural and non-structural
proteins by host and viral proteases. Structural components of the
virion include the capsid (C) protein and three envelope glycopro-
teins: Erns, E1 and E2.10 Erns and E2 glycoproteins are present in viri-
ons as disulfide-linked homodimers: an Erns homodimer with a size
of about 97 kDa and an E2 homodimer with a size of about 100 kDa.
E2 is also present as a heterodimer with E1 (75 kDa).11 Both E1 and
E2 are type I transmembrane proteins with an N-terminal ectodo-
main and a C-terminal anchor.10 Erns lacks a typical membrane
anchor. Apart from being a virion protein, Erns is secreted from
virus-infected cells as a soluble protein.11,12 Moreover, Erns has
RNase activity, which is the unique feature for a viral surface protein,
and is classified as a member of RNase T2 family.13,14 E2 glycoprotein
is essential for virus attachment and entry into target cells as well as
for cell tropism.15,16 It is the major immunodominant protein induc-
ing the production of neutralizing antibodies and protection against
lethal challenge.17 Both Erns and E2 glycoproteins are highly glycos-
ylated with 7 and 6 glycosylation sites, respectively.18,19
protecting groups) and varying aromatic substituents at sulfur
atom were synthesized in order to evaluate their potential biolog-
ical activity. Here, we describe the synthesis and the in vitro anti-
viral evaluation of a lead compound—designated GP6, which was
found to have significant antiviral activity and the lowest toxicity
out of all synthesized compounds. We further investigated the po-
tential mechanism of action by which GP6 exerts its anti-CSFV
activity. Further experiments are needed for investigating whether
this compound can be used as a safe antiviral agent against other
viruses from Flaviviridae family and other viral families.
2. Materials and methods
2.1. Chemistry
2.1.1. General methods
Melting points were determined on a SRS OptiMelt melting
point apparatus and are uncorrected. Optical rotations were mea-
sured with
a JASCO P2000 polarimeter using sodium lamp
N-glycans of enveloped virus glycoproteins have been shown to
be important not only for the correct folding and stability, but also
for various functions such as host cell receptor binding, membrane
fusion, penetration into host cells.16,20 Lack of N-glycan chains can
lead to protein misfolding causing aggregation and protein reten-
tion in the endoplasmic reticulum or proteasome degradation.21,22
It has been observed that changes in the glycosylation patterns of
viral glycoproteins can influence infectivity, virulence and host im-
mune response.
Glycosyltransferases (GTs) are a large class of enzymes involved
in the biosynthesis of oligosaccharides, polysaccharides and glyco-
conjugates, such as glycoproteins and glycolipids.23 GTs catalyze
glycosidic bond formation by the transfer of a saccharide, typically
a monosaccharide, from an activated nucleotide sugar donor to an
acceptor substrate.24 GTs are involved in many fundamental bio-
logical processes and modulation of their activities by efficient
inhibitors has potential for the control of certain cellular functions.
Since the 3D structures of several GTs have been proposed, a large
number of potent inhibitors have been identified. Structures of
these compounds are based on analogies between donor
substrates, acceptor substrates as well as transition state.
(589 nm) at room temperature. Mass spectra were recorded with
a WATERS LCT Premier XE system (high resolution mass spectrom-
eter with TOF analyzer) using electrospray-ionization (ESI) tech-
nique. FT-IR spectra were recorded using ATR method with a
Thermo Scientific NICOLET 6700 spectrophotometer. UV–vis spec-
tra were recorded with a JASCO V-650 spectrophotometer with the
use of 1.0 cm quartz cell and methyl alcohol as a solvent. NMR
spectra were recorded on an Agilent spectrometer (400 MHz).
Deuterochloroform 98.8% (code 209561000) of isotopic purity
(ACROS) with 0.03 v/v% TMS as internal standard was used as a
solvent. Column chromatography was performed on silica gel 60
(Merck; 70–230 mesh, code 1.07734.5000) column. All compounds
were routinely checked by TLC by using aluminium-baked silica
gel plates (Merck TLC Silica gel 60 F254, code 1.05554.0001).
Developed plates were visualized by UV light and by charring after
spraying with 10% H2SO4 in EtOH. Solvents were reagent grade
and, when necessary, were purified and dried by standard meth-
ods. Concentration of solutions after reactions, extractions and
column chromatography involved the use of rotary evaporator
(Heidolph, Germany) operating at a reduced pressure (ca. 40 Torr).
Organic solutions were dried over anhydrous magnesium sulfate
(POCH Gliwice, Poland).
Glycosyl sulfoxides have been found to possess a wide applica-
tion in the field of complex oligosaccharides synthesis as powerful
glycosyl donors.25 Many chiral sulfoxides were reported to exhibit
broad spectrum biological activities including inhibition of many
different enzymes.26–28 According to the literature phenyl sulfinyl
2.1.2. 200,300,400,600-Tetra-O-acetyl-b-
D
-galactopyranosyl-(1?4)-
20,30,60-tri-O-acetyl-1-thio-b-
D-glucopyranosyl-(5-nitro-2-
pyridyl) sulfoxide GP6
To
a solution of (5-nitro-2-pyridyl) per-O-acetyl-1-thio-b-
b-D-galactopyranosides were cleaved in the diastereoselective
D
-lactoside (1.4 mmol) in a dry dichloromethane (30 mL) cooled
manner in the presence of b-galactosidase from Escherichia coli. It
could be explained in such a way that only one diastereoisomer
orients its sulfinyl oxygen toward the activating amino acid of en-
zyme whilst second diastereoisomer behaves as inhibitor.29 On the
other hand, heterocyclic sulfoxides and sulfones proved to be
10–100 fold more potent inhibitor of fatty acid amide hydrolase
(FAAH) than corresponding sulfides.28 Also polyhydroxylated
cyclohexenyl sulfoxides demonstrated weak abilities to the inhibi-
down to 0 °C the m-CPBA (1.4 mmol) was added. The reaction
mixture was stirred at 0 °C and was monitored by TLC. The reaction
was stopped without full conversion of 1-thioglycoside in order
to limiting creating the sulfone. The reaction mixture was diluted
with CH2Cl2 and washed with water (3 ꢀ 15 mL). The organic layer
was dried over anhydrous MgSO4. The solid was filtered off and
the filtrate was concentrated to give crude product which was
purified by a column chromatography (toluene/AcOEt 20:1 to 2:1
[v/v]) to give diastereoisomeric mixture of sulfoxides GP6 (yield
59% or 68% when calculated on utilized 1-thioglycoside). The CPBA
oxidation of the sulfide substrate gave approximately equal
amounts of epimeric sulfoxides and no attempt was made to
control its stereoselectivity. Small amount (approximately 15 mg)
of each diastereoisomer was isolated by repeated column
chromatography and characterized separately.
tion of
a-D-glucosidase from Brewers yeast and b-D-glucosidase
from sweet almonds.27
On the basis of these data we decided to focus our attention on
sulfoxides derivatives of 5-nitro-2-pyridyl 1-thioglycosides as po-
tential GTs inhibitors. Most of GTs are usually metal ion dependent,
where manganese is the most typical metal found in active
sites.30,31 We expected, that heteroaryl sulfoxides, due to the pres-
ence of free electron pairs on sulfinyl oxygen and heterocyclic
nitrogen, could favourably interact with Mn2+ similarly to natural
GTs substrates.
Less polar, dextrorotatory sulfoxide had: mp 93–98 °C (with
decomposition); ½a D20
ꢁ
¼ 7:5ꢂ (CHCl3, c = 0.4); IR (ATR method)
m
1743 (C@O), 1361 (NO2), 1213 (C–O), 1043 (S@O) cmꢃ1; UV–vis
(MeOH) kmax 204.8, 237.5 and 291 nm; 1H NMR (CDCl3, 400 MHz)
Therefore, a number of glycosyl sufoxides containing different
sugar moieties (D-glucose, D-galactose or lactose with ester or ether

2664
E. Krol et al. / Bioorg. Med. Chem. 22 (2014) 2662–2670
d 1.96, 2.02, 2.04, 2.05, 2.06, 2.08, 2.14 (7s, 21H, CH3CO), 3.74 (m, 1H,
H50), 3.79.(ddꢄt, J = 9.8 Hz, 1H, H40), 3.86 (m, 1H, H500), 4.03–4.16 (m,
3H, H60a, H600a, H600b), 4.48 (d, J = 7.8 Hz, 1H, H100), 4.54 (dd, J = 1.6,
12.5 Hz, 1H, H60b), 4.96 (dd, J = 3.5, 10.5 Hz, 1H, H300), 5.03 (d,
J = 9.8 Hz, 1H, H10), 5.09 (dd, J = 7.8, 10.5 Hz, 1H, H200), 5.22 (ddꢄt,
J = 8.6 Hz, 1H, H30), 5.34 (d, J = 3.5 Hz, 1H, H400), 5.48 (ddꢄt,
J = 9.8 Hz, 1H, H20), 8.11 (d, J = 8.6 Hz, 1H, H3pyr), 8.71 (dd, J = 2.4,
8.6 Hz, 1H, H4pyr), 9.47 (d, J = 2.4 Hz, 1H, H6pyr); 13C NMR (CDCl3,
100 MHz) d 20.43, 20.46, 20.57, 20.59, 20.67, 20.69 (CH3CO), 60.74,
61.42 (C60, C600), 66.09, 66.56, 69.06, 70.75, 70.85, 74.00, 75.08,
77.74 (C20, C200, C30, C300, C40, C400, C50, C500), 94.38 (C10), 101.04
Bac-to-Bac baculovirus expression system of Invitrogen33 as de-
scribed previously.34
2.2.3. Cell viability assay
SK6 cell viability was measured by CellTiter 96 AQueous non-
radioactive cell proliferation assay (MTS) (Promega, USA) as de-
scribed previously.35 The cytotoxic concentration 50% (CC50) was
calculated as the compound concentration required to reduce cell
viability by 50%. To determine the number of viable cells for insect
Sf9 cell line, dye-exclusion method with trypan blue was per-
formed according to the procedure described previously.35 The
cytotoxic concentration 50% (CC50) was calculated as the concen-
tration of inhibitor that reduces cell viability by 50%.
(C100), 121.41, 132.65, 144.52, 144.86, 168.13 (C2pyr, C3pyr, C4pyr
C5pyr C6pyr), 169.05, 169.30, 169.96, 170.02, 170.04, 170.07,
170.35 (C@O).
,
,
The sulfoxide eluting second had: mp 91–96 °C (with decompo-
2.2.4. Evaluation of antiviral activity against CSFV
sition); ½a 2D0
ꢁ
¼ ꢃ59:3ꢂ (CHCl3, c = 0.5); IR (ATR method)
m
1742
Antiviral activity was evaluated in plaque reduction assay by
methods reported previously.35 Briefly, SK6 cell monolayers in 6
or 12-well plates were infected with CSFV for 1 h at 37 °C. After
adsorption unbound virus was removed by washing with serum-
free medium. Next fresh medium containing increasing amounts
of inhibitor was added. After 2 or 3 days, the medium containing
secreted virus was collected, centrifuged at low speed to remove
cellular debris and used for virus yield assay. For plaque reduction
assay cells were washed with phosphate buffered saline (PBS),
fixed with 40% acetone in 0, 5ꢀ PBS, dried and immunoperoxidase
monolayer assay (IPMA) was performed to detect CSFV plaques.
Rabbit polyclonal serum anti-Erns diluted 1:800 in PBS containing
1% Tween 20 and 5% FBS was used as primary antibody. Anti-rabbit
horseradish peroxidase (HRP)-conjugated antibody (Santa-Cruz
Biotechnology, USA) was used as secondary antibody (diluted
1:1000 in PBS containing 1% Tween 20 and 5% FBS). CSFV plaques
were detected using H2O2/AEC (3-amino-9-ethylcarbazole) and
counted. IC50 was calculated as the concentration at which the
number of plaques was reduced by 50% compared to untreated
infected control cells.
(C@O), 1366 (NO2), 1211 (C–O), 1043 (S@O) cmꢃ1; UV–vis (MeOH)
kmax 204.2, 238.8 and 287 nm; 1H NMR (CDCl3, 400 MHz) d 1.88,
1.95, 1.97, 2.08, 2.09, 2.14, 2.15 (7s, 21H, CH3CO), 3.45 (ddd,
J = 1.8, 5.5, 9.8 Hz, 1H, H50), 3.78.(ddꢄt, J = 9.6 Hz, 1H, H40), 3.82
(dd, J = 3.8, 12.3 Hz, 1H, H60a), 3.68 (m, 1H, H500), 4.04–4.18 (m,
2H, H600a, H600b), 4.27 (dd, J = 1.8, 12.2 Hz, 1H, H60b), 4.47 (d,
J = 7.8 Hz, 1H, H100), 4.61 (d, J = 10.1 Hz, 1H, H10), 4.95 (dd, J = 3.4,
10.4 Hz, 1H, H300), 5.07 (dd, J = 7.8, 10.4 Hz, 1H, H200), 5.30–5.40
(m, 2H, H-400, H30), 5.47 (ddꢄt, J = 9.5 Hz, 1H, H-20), 8.18 (d,
J = 8.6 Hz, 1H, H3pyr), 8.63 (dd, J = 2.4, J = 8.6 Hz, 1H, H4pyr), 9.41
(d, J = 2.4 Hz, 1H, H6pyr); 13C NMR (CDCl3, 100 MHz) d 20.42,
20.47, 20.55, 20.59, 20.69 (CH3CO), 60.88, 60.95 (C60, C600), 66.62,
66.81, 69.06, 70.81, 70.83, 73.52, 75.41, 77.59 (C20, C200, C30, C300,
C40, C400, C50, C500), 90.75 (C10), 101.02 (C100), 122.92, 132.56,
144.55, 144.72, 167.86 (C2pyr, C3pyr, C4pyr, C5pyr, C6pyr), 168.92,
169.08, 169.57, 169.83, 169.96, 170.03, 170.32 (C@O); HR-MS
(ESI): [M+H]+ calcd for C31H38N2O20S: 791.1811, found 791.1817;
[M+Na]+ calcd for C31H38N2O20SNa: 813.1631, found 813.1638.
2.2. Biological evaluation
To determine virus yield, different dilutions of collected med-
ium, obtained as described in a previous paragraph, were used to
infect fresh monolayer of SK6 cells in 12-well plates. After 3 days,
the cells were fixed and plaques after IPMA assay were counted as
described above.
2.2.1. Antiviral compounds
The glycosyl sulfoxide (Fig. 1–designated by us GP6) was syn-
thesized as described in this communication. Stock solutions of
GP6 were prepared by dissolving the reagent in dimethyl sulfoxide
(DMSO) and stored at ꢃ20 °C until future use. Tunicamycin was
purchased from Sigma–Aldrich, USA. Stock solutions were made
in DMSO.
2.2.5. SDS–PAGE and Western blot analysis
SK6 cells were grown in E-MEM medium with 2% FBS in
12-wells plates and infected with CSFV at an MOI of 0.01 or PRV
at an MOI of 1. After 1 h, the inoculum was removed and the cells
were washed with serum-free medium. Fresh medium containing
different concentrations of inhibitor was added and incubation
was carried out for 24 h for PRV and 48 h for CSFV. Cell lysis was
performed at 4 °C for 1 h in TNET buffer (20 mM Tris–HCl (pH
7.4), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100) and proteins
were separated by SDS–PAGE under reducing or non-reducing con-
ditions and transferred to PVDF membranes. Monoclonal anti-E2
CSFV (MAb V3 39.5; Cedi Diagnostic B.V., The Netherlands;
1:2000 dilution), anti-b-actin (Santa-Cruz Biotechnology, USA;
1:1000 dilution) rabbit polyclonal serum anti-Erns CSFV (1:250
dilution) or rabbit polyclonal serum anti-gE PRV (1:200 dilution)
were used as primary antibodies. Anti-rabbit alkaline phosphatase
(AP)-conjugated antibodies or anti-mouse peroxidase (HRP)-conju-
gated antibodies (Santa-Cruz Biotechnology, USA) were used as
secondary antibodies (diluted 1:2000). Nitrotetrazolium blue
(NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP) were
used as substrates for alkaline phosphatase (AP). In some experi-
ments, antigen-antibody complexes were detected using SuperSig-
nal West Pico Substrate system (Pierce, USA).
2.2.2. Cells and viruses
Swine kidney cells (SK6) were cultured in Eagle’s Minimum
Essential Medium (E-MEM) (Sigma–Aldrich, USA), supplemented
with 8% fetal bovine serum (FBS), at 37 °C under 5% CO2. The insect
cell line Spodoptera frugiperda (Sf9) was grown in HyQ-SFX med-
ium (HyClone, USA) at 27 °C. Classical swine fever virus Cellpest
strain32 and pseudorabies virus (PRV) NIA-3 strain were obtained
from the National Veterinary Institute in Pulawy, Poland. Autogra-
pha californica nuclear polyhedrosis virus (AcNPV) recombinants
expressing CSFV Erns or E2 glycoproteins were generated using
AcO
AcO
AcO
OAc
O
S
O
O
NO2
O
AcO
N
OAc
OAc
GP6
Sf9 cells were grown in HyQ medium in 12-wells plates and in-
Figure 1. Chemical structure of GP6.
fected with recombinant baculoviruses expressing Erns or E2 (MOI

E. Krol et al. / Bioorg. Med. Chem. 22 (2014) 2662–2670
2665
of 1). Two hours later, the inoculum was removed and replaced
with fresh medium containing inhibitor at specified concentra-
tions. At 48 h post infection, cells were lysed and proteins were
separated by SDS–PAGE under non-reducing conditions, and then
transferred to PVDF membranes. Monoclonal anti-E2 CSFV anti-
body (diluted 1:1000) and rabbit polyclonal serum anti-Erns CSFV
(diluted 1:250) were used as primary antibodies. Anti-mouse and
anti-rabbit alkaline phosphatase (AP)-conjugated antibodies were
used as secondary antibodies (diluted 1:2000). Antigen-antibody
complexes were detected using NBT and BCIP as substrates.
in these papers (very low temperatures from ꢃ78 °C to ꢃ30 °C),
the oxidation reaction were carried out at 0 °C in our experiment
(Scheme 2).
3.2. Biological activity
3.2.1. Antiviral activity of newly developed glycosyl sulfoxide
In the first set of experiments SK6 cell viability after GP6 treat-
ment was measured using MTS assay. This test as well as microscop-
ical examination demonstrated that tested compound produced a
dose-dependent toxic effect. We determined that GP6 reduced via-
2.2.6. Viral RNA isolation and cDNA synthesis
bility of SK6 cells with the CC50 value of 15 lg/ml, corresponding
SK6 cells cultured in 12-wells plates were infected with CSFV at
an MOI of 0.01 or 0.1 for 1 h. The inoculum was removed and the
cells were washed with serum-free medium. Fresh medium con-
taining inhibitor at the concentrations indicated was added and
incubation was carried out for 12 h for cells infected with CSFV
at an MOI of 0.1 and 48 h for cells infected with CSFV at an MOI
of 0.01. At 12 or 48 h p.i., the supernatants were harvested, centri-
fuged at 5000ꢀg for 5 min and used for viral RNA purification. Viral
RNA was also extracted from CSFV-infected cells. Total intracellu-
lar and secreted CSFV RNA was purified using the Total RNA Mini
purification kit (A&A Biotechnology, Poland) according to the man-
ufacturer’s instructions. RNA extracted from SK6 cells and culture
medium supernatants were reverse transcribed to cDNA by
RT-PCR using Transcriptor High Fidelity cDNA Synthesis Kit (Roche
Diagnostics, Mannheim, Germany) according the manufacturer’s
instructions. The reaction mixture containing: viral RNA, random
hexamer primers and water was incubated for 10 min at 65 °C.
Subsequently, the reaction buffer, RNase inhibitor [20 U], dNTPs
[1 mM each], DTT [5 mM] and reverse transcriptase [10 U] were
added and incubated for 10 min at 29 °C then 60 min at 48 °C, fol-
lowed by 5 min incubation at 85 °C and chilled on ice.
to a 50% cytotoxic effect after 48 h of inhibitor treatment. The mor-
phology and multiplication rates of SK6 cells untreated and treated
with selected working doses of GP6 were similar.
To further characterize the in vitro antiviral property of GP6, the
effect of the drug on virus propagation was evaluated using plaque
reduction assay in SK6 cells. The majority of isolates of CSFV do not
exhibit cytopathogenecity in tissue culture, therefore it is not pos-
sible to observe directly the foci of viral growth.42 Due to the lack
of cytopathic effect, accurate virus propagation measurement was
based on the visualization of the foci caused by CSFV (pseudopla-
ques) using immunoperoxidase monolayer assay (IPMA) which de-
tects the areas of maximum concentration of glycoproteins of the
viral outer layer. Cells were infected with CSFV at a low MOI of
0.0001 to visualize single plaques. After virus adsorption for 1 h,
cells were washed, replenished with fresh medium (positive control)
or medium containing varying amounts of GP6 (0–12 lg/ml), and
incubated for 2 days. The extent of CSFV infection was measured
using rabbit polyclonal serum anti-Erns to detect viral antigen.
The typical IPMA reactions for GP6 inhibitor are shown in Figure 2.
In non-infected cells, the viral antigen was undetectable (Fig. 2A),
the pseudoplaques observed in infected cells indicate the presence
of the virus (Fig. 2B). 10 lg/ml of GP6 nearly completely blocked
2.2.7. Real-time PCR assay
The assay was based on SYBR Green dye technology. Real-time
PCR was performed using the LightCycler 2.0™ (Roche Diagnostics,
pseudoplaque formation induced by CSFV. GP6 decreased CSFV
propagation in SK6 cells in a dose-dependent manner evidenced
by the reduction in the number and size of pseudoplaques,
suggesting that the drug inhibited proliferation and spread of the
virus (Fig. 2C–F). The IC50 value for inhibition of virus propagation,
corresponding to GP6 concentration required to reduce virus
Mannheim, Germany). A 10
10ꢀ LC DNA Master SYBR Green I buffer (Roche Diagnostics, Mann-
heim, Germany), 4.5 l H20, 1.5 l MgCl2 (25 mM), 1 l 5 M for-
ward primer (50—AGTACAGGACAGTCGTCAGTAGTTCG—30),
M reverse primer (50—CAACTCCATGTGCCATGTACAGCAG—30),
which amplify a 220-bp region of 50NCR region36,37 and 1
l of
ll reaction mixture contained: 1 ll
l
l
l
l
1
l
l
plaque formation by 50% in SK6 cells, was 5 0.12 lg/ml. The
selectivity index (SI), defined as the CC50/IC50 ratio, was 3.
5
l
l
Additionally, the amount of infectious virus released into the
culture medium after 72 h GP6 treatment was determined by yield
assay, where serial dilutions of media from untreated (positive
control) and GP6 treated cells were used to infect fresh monolayers
of SK6 cells. The relative infectivity of P1 supernatants was deter-
mined at 3 days p.i. by IPMA assay. As shown in Figure 3, virus titer
was dose-dependently inhibited by GP6 compound. In particular,
cDNA. A negative control lacking cDNA was also prepared. The
samples were initially denatured at 95 °C for 10 min., followed
by 45 cycles of: 95 °C (denaturation) for 10 s, 54 °C (annealing)
for 10 s, and 72 °C (extension) for 14 s. To confirm the specificity
of the amplified product, the melting curve analysis step was
included.
calculated titer of progeny virus was markedly reduced by 6
lg/
ml of GP6 (67% vs control), while the concentration of 12 g/ml
was able to nearly completely inhibit the infectivity of the virus,
l
3. Results
which confirmed the results of the previous experiment.
3.1. Synthesis
3.2.2. Inhibitory effect of GP6 on viral Erns and E2 glycoprotein
synthesis in SK6 cells
To understand the mechanism underlying GP6 inhibition of CSF
virus spread and production, we investigated the effect of GP6 on
(5-Nitro-2-pyridyl) per-O-acetyl-1-thio-b-D-lactoside was syn-
thesized as reported in literature38 (Scheme 1). For oxidation of
1-thioglycoside to sulfoxide the procedure described in literature
was adapted.39–41 In contrast to the reaction conditions described
Scheme 1. Synthetic procedure for the synthesis of (5-nitro-2-pyridyl) per-O-acetyl-1-thio-b-D-lactoside. Reagents and conditions: (i) acetic acid, sodium acetate, boiling
temp; (ii) 33% HBr/AcOH, 0 °C; (iii) thiourea, acetone, boiling temp; (iv) K2S2O5, CHCl3, boiling temp; (v) 2-chloro-5-nitropyridine, K2CO3, acetone, room temp.

2666
E. Krol et al. / Bioorg. Med. Chem. 22 (2014) 2662–2670
Scheme 2. Oxidation procedure for the synthesis of GP6. Reagents and conditions: (i) m-CPBA, CH2Cl2, 0 °C.
A
B
C
E
D
F
Figure 2. Effect of GP6 inhibitor on CSFV pseudoplaque formation in SK6 cells. SK6 cells were mock infected (A) or infected with CSFV at an MOI of 0.0001 (B–F). At 1 h p.i.,
cells were treated with different doses of GP6 (C—10 lg/ml, D—8 lg/ml, E—6 lg/ml, F—4 lg/ml) or left untreated (positive control—B). Two days post infection, cells were
fixed and IPMA was performed using rabbit polyclonal serum anti-Erns to detect CSFV pseudoplaques.
100
bands, corresponding to E2/E2, E2/E1 complexes and E2 monomer
80
60
40
20
0
in non-reducing conditions, were identified in the untreated, con-
trol samples (Fig. 4A and B). The GP6 treatment resulted in a dose-
dependent reduction in the amount of E2 glycoprotein compared
to the untreated control samples. Furthermore, after treatment
with the highest doses of GP6 (from 12–10 lg/ml), when the bands
representing E2–E2 homodimer, E2–E1 heterodimer and E2 mono-
mer were nearly undetectable, it was not possible to detect the
unglycosylated or underglycosylated forms of E2 viral glycoprotein
under both reducing (Fig. 4A) and non-reducing (Fig. 4B) condi-
tions. Also the ratio between E2–E2 homodimer, E2–E1 heterodi-
mer and E2 monomer after GP6 treatment was not changed.
These observations indicate that either viral glycoprotein accumu-
lation within infected cells is affected by the presence of inhibitor
or it is the consequence of inhibition of infectious virus particles
production which affects the total protein level in cell lysates after
48 h. These results are in agreement with the reduction in virus
production as assessed by monitoring the number and size of
pseudoplaques after GP6 treatment by plaque reduction assay
and virus yield assay, obtained in the previous experiments (Figs. 2
and 3).
0
4
6
8
10
12
GP6 [µg/ml]
Figure 3. Effect of GP6 inhibitor on the viral yield. SK6 cells were infected with
CSFV at an MOI of 0.005. At 1 h p.i., cells were treated with different doses of GP6
(12–4 lg/ml) or left untreated (positive control). Three days post infection, the
collected culture supernatants were harvested for virus yield assay. The amount of
infectious virus in all tested samples was determined by IPMA assay. Data represent
means from three independent experiments SD.
glycoprotein synthesis and oligomerization by SDS–PAGE in both
reducing and non-reducing conditions, followed by Western blot-
ting. E2 glycoprotein in SK6-infected cells is usually found as a
homodimer (100 kDa) or a heterodimer with E1 (75 kDa), while
Erns is present only as a homodimer (97 kDa). N-glycan chains have
a significant effect on protein folding and in consequence on
dimerization process. Lysates of SK6 CSFV-infected cells (MOI of
0.01) in the presence or absence of GP6 were analyzed for E2 and
Erns glycoprotein using MAb V3 39.5 and rabbit monospecific poly-
clonal serum, respectively. Two bands, corresponding to E2 and
underglycosylated E2 monomer in reducing conditions and three
Lack of glycans in a nascent peptide chain often causes the loss
of its immunodominant epitopes, what can result in weaker reac-
tivity of antibodies with unglycosylated product. The glycoproteins
synthesized in cell cultures without the addition of inhibitor and
deglycosylated with PNGase F and Endo H were detected in
Western blot using the same antibody (Fig. 4C), suggesting that

E. Krol et al. / Bioorg. Med. Chem. 22 (2014) 2662–2670
2667
A
B
C
Figure 4. Effect of GP6 inhibitor on the synthesis of viral E2 glycoprotein. CSFV-infected SK6 cells were treated with various concentrations of GP6 (0–12
l
g/ml) (A and B). At
48 h p.i., cells were lysed and proteins were separated by SDS–PAGE (10% polyacrylamide) under reducing (A) or non-reducing (B) conditions. Western blot analysis was
performed using the specific anti-E2 (V3 39.5) and anti-b-actin monoclonal antibodies. Positions of E2/E2 and E2/E1 complexes, E2 and underglycosylated E2 (uE2) monomers
are marked with arrows. The effect of deglycosylating enzymes is shown in panel (C). At 48 h p.i., CSFV-infected SK6 cells were lysed and digested with peptide/N-glycosidase
F (PNGase F), endoglycosidase H (Endo H), or left untreated. Samples were separated by SDS–PAGE (10% polyacrylamide) under non-reducing conditions. Western blot
analysis was performed using the anti-E2 (V3 39.5) monoclonal antibody. Positions of E2/E2, E2/E1 and deglycosylated E2/E1 (dE2–E1) complexes are marked with arrows.
the disappearance of E2 and Erns in the presence of GP6 was not re-
lated to the lack of reactivity with specific antibodies.
single round of infection, previous experiments showed that GP6
treatment affects virus production and spread after more than
12 h. This observation raised the possibility that CSFV virions
which arised during single cycle growth were secreted but they
were either less, or non-infectious in subsequent replication cycles.
This hypothesis was checked using real-time PCR method to deter-
mine the amount of viral RNA in SK6 cells and the culture medium
of cells after infection with a low MOI of CSFV (0.01) and 48 h
inhibitor treatment period to allow multi-cycle replication. Real-
3.2.3. GP6 does not affect the replication of CSFV RNA
Due to the fact that high concentrations of GP6 lead to the com-
plete loss of detectable glycoproteins when examined by Western
blot analysis, in the next experimental step we wanted to deter-
mine whether this is related to the decrease in viral RNA produc-
tion. Detection of CSFV RNA and its replication was performed by
real-time PCR method using SYBR Green dye technology.
time PCR assays after 48 h indicated that 12 and 10 lg/ml of GP6
Monolayers of SK6 cells were infected with CSFV and left un-
treated, or incubated with high concentrations of GP6 (12 and
10 lg/ml), which resulted in the complete arrest of glycoprotein
significantly reduced the RNA level in both cells and culture med-
ium. Ct values for positive controls, untreated cells and culture
medium, were 21.9 and 26.7, respectively. After GP6 treatment
accumulation in the previous experiment. High MOI (0.1) and a
short infection period (12 h) were employed to estimate the direct
effect of GP6 on virus replication during a single round of infection.
Viral RNA was extracted from CSFV-infected cells and real-time
PCR was performed. The expected 220-bp PCR product, corre-
sponding to the fragment of a highly conserved 50NCR region,
was detected on the same level in all tested samples. These results
indicate that viral RNA accumulation is not affected by treatment
with both doses of GP6 in infected cells after a single round of
infection (data not shown). Ct values for positive control (without
GP6 treatment) and GP6 treated samples were approximately 28.7
(Table 1). These results suggest that GP6 exerts its antiviral effect
at the other than RNA synthesis level of virus life cycle.
with 12 lg/ml Ct values were increased to 25.2 0.2 and
29.8 0.1 for cells and culture medium, respectively which corre-
sponds to about 90% and 88% reduction in viral RNA in cells and
culture medium, respectively. Additionally, 71–73% reduction of
viral RNA was observed after treatment with 10 lg/ml of GP6 (Ct
values for cells and medium were 23.7 0.2 and 28.6 0.2, respec-
tively) (Table 1).
Taken together, these data suggest that virus particles after GP6
treatment are produced but either they are less or non-infectious
most probably due to the changes in glycosylation status of viral
proteins and they are not able to infect new cells, which results
in the reduction of virus RNA in both infected cells and culture
medium of infected cells during secondary infections.
To check whether GP6 inhibitor prevents the secretion of viral
particles into the medium, we used culture medium from CSFV-in-
fected cells as described above to extract RNA for amplification.
Interestingly, no change in RNA level was observed in culture med-
ium either incubated or not incubated with GP6, suggesting that
the secretion of viral particles is not inhibited by tested compound.
Although GP6 inhibitor does not prevent viral RNA synthesis in
CSFV-infected cells and secretion into the culture medium after
3.2.4. GP6 inhibitor do not change glycosylation pattern of
recombinant CSFV Erns and E2 in insect Sf9 cells
The examination of RNA level after treatment with the inhibitor
showed that CSFV particles formed in the presence of GP6 are prob-
ably less infectious. To verify this hypothesis and get better insight
into the mechanism of action of GP6 we performed an experiment
using baculovirus expression system to test the influence of this

2668
E. Krol et al. / Bioorg. Med. Chem. 22 (2014) 2662–2670
Table 1
SYBR Green real-time PCR detection of viral cDNA after 12 and 48 h treatment with GP6
GP 6 12 h Incubation
48 h Incubation
SK6 cells
Ct % RNA decrease Ct
Culture medium
SK6 cells
Culture medium
Ct
D
D
Ct % RNA decrease Ct
D
Ct % RNA decrease Ct
D
Ct % RNA decrease
0
10
12
l
l
l
g/ml
g/ml
g/ml
28.7
28.7 0.2 0.0
28.7 0.2 0.0
0.0
0
0
0
—
34.2
34.2 0.1 0.0
34.2 0.2 0.0
0.0
0
0
0
—
21.9
23.7 0.2 1.8
25.2 0.2 3.3
0
0
26.7
0
28.6 0.2 1.9
29.8 0.1 3.1
0
71
90
—
73
88
—
Neg. control
—
—
—
—
—
—
—
—
Ct (cycle threshold) values are expressed as the mean SD. from three independent experiments.
Ct were calculated as a subtraction of Ct values of treated and untreated cells.
D
compound on the early steps of glycosylation process taking place in
the endoplasmic reticulum (ER). N-glycosylation process in insect
cells is much simpler than in mammalian cells and it is generally
of a high-mannose type. It was shown previously that the antibi-
otic—tunicamycin led to complete disappearance of E2 and Erns
glycoproteins in soluble (cytoplasmic) fraction expressed in insect
cells.34 For this purpose insect cells infected with recombinant bac-
uloviruses containing genes coding for E2 or Erns glycoproteins were
grown for 48 h in the presence of decreasing concentration of GP6
(12, 10 and 8 lg/ml) and tunicamycin (2 and 1 lg/ml) as a control.
At the concentrations used, no toxicity was observed in Sf9 cells,
as determined by trypan blue method.
No changes in molecular weight were observed for both E2
(Fig. 5A) and Erns (Fig. 5B) glycoproteins produced in insect cells
in the presence of GP6 inhibitor suggesting that glycosylation
pattern was not affected. As expected, in control experiment
tunicamycin treatment resulted in the complete disappearance of
both proteins. Therefore, we concluded that GP6 inhibitor is not
active on early ER-dependent steps of glycosylation process.
was previously reported that CSFV glycoproteins lacking N-glycans
after tunicamycin treatment are very unstable and very quickly
degraded.34 To check the hypothesis that GP6 may change the
glycosylation pattern of glycoproteins acting on the late, Golgi-
dependent, stages of glycosylation (which are unique only for
mammalian cells) we performed the experiment using pseudora-
bies virus (PRV). PRV is a pig virus belonging to Herpesviridae fam-
ily, very distant from Flaviviridae, but infecting swine kidney (SK6)
cells. For herpesviruses, glycan-free polypeptides are relatively sta-
ble and can be detected by classical protein detection methods.43,44
We investigated the impact of GP6 inhibitor on PRV gE glyco-
protein synthesis in SK6 cells in SDS–PAGE under reducing condi-
tions followed by Western blotting. Tunicamycin treatment was
used as a control for unglycosylated form of gE glycoprotein. The
band corresponding to fully glycosylated form of gE glycoprotein
was detected in both untreated and GP6 treated samples. Treat-
ment with GP6 did not result in visible reduction of the molecular
mass of gE protein (Fig. 6), which suggests that the tested inhibitor
is probably acting on the very late step of glycosylation and the dif-
ference in molecular mass of treated and untreated gE glycoprotein
is too small to be detected by this method. At the present stage we
have no direct proof of this hypothesis and further studies are in
progress to better characterize the molecular mechanism underly-
ing the GP6 anti-CSFV activity.
3.2.5. The influence of GP6 inhibitor on PRV gE glycoprotein
synthesis
Unglycosylated forms of E2 and Erns glycoproteins after GP6
treatment were not detected in CSFV-infected cells (Fig. 4). It
B
A
Tunicamycin
GP6
12 10 8
Tunicamycin
GP6
12 10
MW
MW
marker
µg/ml
µg/ml
Mock
0
2
1
8
Mock
0
2
1
marker
170
130
170
130
95
72
Erns- Erns
95
E2- E2
72
55
55
43
34
E2
E2
Erns
43
34
26
26
[kDa]
[kDa]
Figure 5. The influence of GP6 inhibitor on CSFV E2 and Erns glycoprotein synthesis in insect Sf9 cells. Sf9 cells were infected with recombinant baculovirus expressing CSFV
E2 (A) or Erns (B) glycoprotein at an MOI of 1 or mock infected. At 2 h p.i., cells were treated with tunicamycin or GP6 inhibitor or left untreated. At 48 h p.i., cells were lysed
and proteins were separated by SDS–PAGE under non-reducing conditions. Western blot analysis was performed using monoclonal anti-E2 antibody (V3 39.5) (A) or rabbit
polyclonal serum anti-Erns (B). Positions of E2/E2 and Erns/Erns complexes and Erns and E2 monomers (fully and low-glycosylated) are marked with arrows. The bands above
E2/E2 dimers represent higher molecular aggregates of E2 which are formed in non-reducing conditions. MW marker—molecular weight marker.

E. Krol et al. / Bioorg. Med. Chem. 22 (2014) 2662–2670
2669
48 h showed that treatment with GP6 leads to the reduction in the
amount of viral RNA extracted from the cells and medium. The lower
amount of virus particles in infected cells and in medium after 48 h
indicate that viral particles produced after one round of replication
cycle are less or not-infectious as the result of the incorporation of
non-functional glycoprotein complexes and they are not able to in-
fect other cells due to the inhibition of receptor binding.
The inhibition of N-glycosylation processes may be the cause of
reduced infectivity of secreted viral particles. The importance of
N-glycosylation and N-glycan processing of viral envelope proteins
in CSFV life cycle has been reported previously.16,20 As it was
shown, the CSF virus mutants missing partial or complete E2 gene
were unable to generate viable virus.55 Also, though a single muta-
tions of putative glycosylation sites of E256 and Erns57 did not affect
in vitro and in vivo replication, the multiple site mutations ren-
dered non-viable viruses. In previous studies, it has been observed
that changes in the glycosylation patterns of CSFV envelope pro-
teins affected virus virulence and viability.56,58,59 Moreover, it has
been shown that glycosylation plays a major role in the immuno-
genicity of CSFV envelope proteins, most likely an effect linked to
the correct conformation of Erns, E1 and E2 proteins.60
Figure 6. Analysis of PRV gE glycoprotein expressed in GP6-treated SK6 cells. SK6
cells were mock infected or infected with PRV at an MOI of 1 for 24 h in the absence
or presence of tunicamycin or GP6. Cells were lysed and proteins were separated by
SDS–PAGE (10% polyacrylamide) under reducing conditions. Western blot analysis
was performed using the specific anti-gE rabbit serum. MW marker—molecular
weight marker.
4. Discussion
Using baculovirus recombinants expressing full-length forms of
Erns and E2 glycoproteins of CSFV we have excluded the influence
of GP6 on first steps of glycosylation process taking place in insect
cells (Fig. 5). Furthermore, we used Pseudorabies virus, for which
glycan-free polypeptides are stable, to check whether the late steps
of polypeptides N-glycosylation process in the presence of GP6 is
arrested. However, the patterns of glycosylation of glycoprotein
gE for GP6-treated and untreated samples were the same (Fig. 6).
These results suggest that GP6 affects the very late steps of glyco-
sylation process.
In eukaryotes, most of the glycosylation reactions that generate
the diversity of oligosaccharide structures of eukaryotic cells occur
in the Golgi apparatus. The medial and trans Golgi apparatus is the
cellular site of action for many glycosyltansferases that decide this
branching patterns of N-glycans. GlcNAc-transferases I and II as
well as fucosyltransferases are present in medial Golgi, while gly-
cosyltansferases such as galactosyltransferases or sialyltransferas-
es regulate the synthesis of diverse structures in trans Golgi
elements. The results obtained during the presented study suggest
that one of these enzymes may be the target for GP6 compound.
Additional studies evaluating the precise mechanism of action
are underway. Furthermore, the interaction of the compound with
the indicated enzyme will be confirmed by molecular modeling to
predict GP6 binding mode.
Due to continuous risk for virus introduction from CSF-endemic
countries or wildlife reservoirs into pig population in European Un-
ion, the use of antiviral agents has been proposed as an acceptable
control strategy in case of an outbreak.45 In this report we have dem-
onstrated the synthesis and antiviral activity of the glycosyl sulfox-
ide—compound GP6. This compound inhibited classical swine fever
virus propagation in a dose-dependent manner without inducing
any cytotoxic effect (Fig. 2). The antiviral activity of GP6 inhibitor
is probably due to modifications in glycosylation process.
Several reports have shown that the arrest or alterations of the
glycosylation process of viral proteins by different inhibitors usu-
ally result in antiviral effects.46–50 The use of well-known glycosyl-
ation inhibitor—tunicamycin as an antiviral agent against different
viruses such as rotavirus,51 hepatitis delta virus,52 canine herpesvi-
rus44 and bovine herpesvirus-143 has been reported. For these
viruses glycan-free polypeptides in infected cells are accumulated
and can be detected by classical protein detection methods. It was
reported that blocking N-glycosylation of CSFV E2 and Erns glyco-
proteins with tunicamycin results in the disappearance of both gly-
coproteins synthesized in SK6 cells.34 The possible explanation for
the loss of CSFV glycoproteins is sorting out of the deglycosylated
proteins to rapid degradation. It was shown that the proteins that
do not pass the ER quality control are transported back to the cyto-
sol, where they are degraded by the proteosome system in a pro-
cess known as ER-associated degradation.53
We analyzed the synthesis and dimer formation of CSFV enve-
lope glycoproteins after GP6 treatment. The E1–E2 dimer is the
major component of mature virions and is thought to play a central
role in virus infection. Any conformational changes in the subunits
of the complex could affect the receptor binding. The GP6 treat-
ment resulted in a dose-dependent reduction of E2 and Erns glyco-
protein synthesis (Fig. 4). We were not able to detect
unglycosylated or less glycosylated forms of E2 or Erns in CSFV-in-
fected cells. Accordingly, the lack of glycoproteins may be due to a
rapid degradation of misfolded glycoproteins as it was shown for
tunicamycin.54 The specific reduction in viral glycoprotein level
might contribute to the arrest of viral infection.
Using real-time PCR method we demonstrated the effect of GP6
on virus replication and secretion during a single round of infection.
Our results show that GP6 does not reduce the RNA level in both
cases indicating that replication of the virus is not affected by GP6
(Table 1). The presence of RNA in medium of infected cells after a sin-
gle round of CSFV life cycle shows that the polyprotein formation
and processing is not blocked. However, the same experiment after
In conclusion, we report here on antiviral activity of GP6 inhib-
itor in arresting CSFV viral growth. This compound can serve as the
basis for further modification in the search for more potent candi-
dates for anti-CSFV therapy. Further experiments are needed for
testing whether this compound can be used as a safe antiviral
agent against other flaviviruses or viruses from other families.
Acknowledgments
We thank Dr T. Stadejek and Dr Z. Pejsak of National Veterinary
Institute, Pulawy, Poland for viral strains. This work was partially
funded by the Polish government’s budget for science in years
2012–2013 Grant no IP2011 027271 and by the Polish National
Science Centre on the basis of the decision number DEC-2011/03/
N/NZ6/00059.
Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.bmc.2014.03.027.

2670
E. Krol et al. / Bioorg. Med. Chem. 22 (2014) 2662–2670
30. Weijers, C. A. G. M.; Franssen, M. C. R.; Visser, G. M. Biotechnol. Adv. 2008, 26,
References and notes
436.
31. Seibel, J.; Beine, R.; Moraru, R.; Behringer, C.; Bucholz, K. Biocatal. Biotransform.
2006, 24, 157.
1. Becher, P.; Avalos Ramirez, R.; Orlich, M.; Cedillo Rosales, S.; Koning, M.;
Schweizer, M.; Stalder, H.; Schirrmeier, H.; Thiel, H. J. Virology 2003, 311, 94.
2. Laevens, H.; Koenen, F.; Deluyker, H.; Dekruif, A. Vet. Rec. 1999, 145, 243.
3. Edwards, S.; Fukusho, A.; Lefevre, P. C.; Lipowski, A.; Pejsak, Z.; Roehe, P.;
Westergaard, J. Vet. Microbiol. 2000, 73, 103.
4. Greiser-Wilke, I.; Moennig, V. Anim. Health Res. Rev. 2004, 5, 223.
5. Dong, X. N.; Chen, Y. H. Vaccine 2007, 25, 205.
6. Ganges, L.; Nunez, J. I.; Sobrino, F.; Borrego, B.; Fernandez-Borges, N.; Frias-
Lepoureau, M. T.; Rodriguez, F. Vet. J. 2008, 177, 169.
7. Paeshuyse, J.; Chezal, J. M.; Froeyen, M.; Leyssen, P.; Dutartre, H.; Vracken, R.;
Canard, B.; Letellier, C.; Li, T.; Mittendorfer, H.; Koenen, F.; Kerkhofs, P.; De
Clercq, E.; Herdewijn, P.; Puerstinger, G.; Gueiffier, A.; Chavignon, O.; Teulade, J.
C.; Neyts, J. J. Virol. 2007, 81, 11046.
8. Vracken, R.; Paeshuyse, J.; Haegeman, A.; Puerstinger, G.; Froeyen, M.;
Herdewijn, P.; Kerkhofs, P.; Neyts, J.; Koenen, F. Antiviral Res. 2008, 77, 114.
9. Vracken, R.; Haegeman, A.; Paeshuyse, J.; Puerstinger, G.; Rozenski, J.; Wright,
M.; Tignon, M.; Le Potier, M. F.; Neyts, J.; Koenen, F. J. Gen. Virol. 2009, 90, 1335.
10. Thiel, H. J.; Stark, R.; Weiland, E.; Rumenapf, T.; Meyers, G. J. Virol. 1991, 65,
4705.
11. Rumenapf, T.; Unger, G.; Strauss, J. H.; Thiel, H. J. J. Virol. 1993, 67, 3288.
12. Hausmann, Y.; Roman-Sosa, G.; Thiel, H. J.; Rumenapf, T. J. Virol. 2004, 78, 5507.
13. Schneider, R.; Unger, G.; Stark, R.; Schneider-Scherzer, E.; Thiel, H. J. Science
1993, 261, 1169.
14. Meyers, G.; Saalmuller, A.; Buttner, M. J. Virol. 1999, 73, 10224.
15. Reimann, I.; Depner, K.; Trapp, S.; Beer, M. Virology 2004, 322, 143.
16. Wang, Z.; Nie, Y.; Wang, P.; Ding, M.; Deng, H. Virology 2004, 330, 332.
17. Hulst, M. M.; Westra, D. F.; Wensvoort, G.; Moormann, R. J. J. Virol. 1993, 67,
5435.
32. Bjorklund, H. V.; Stadejek, T.; Vilcek, S.; Belak, S. Virus Genes 1998, 16, 307.
33. Luckow, V. A.; Lee, S. C.; Barry, G. F.; Olins, P. O. J. Virol. 1993, 67, 4566.
34. Tyborowska, J.; Zdunek, E.; Szewczyk, B. Acta Biochim. Pol. 2007, 54, 813.
35. Krol, E.; Wandzik, I.; Szeja, W.; Grynkiewicz, G.; Szewczyk, B. Antiviral Res.
2010, 86, 154.
36. McGoldrick, A.; Lowings, J. P.; Ibata, G.; Sands, J. J.; Belak, S.; Paton, D. J. J. Virol.
Methods 1998, 72, 125.
37. Drew, T. W.; Yapp, F.; Paton, D. J. Vet. Microbiol. 1999, 64, 145.
38. Pastuch, G.; Szeja, W. Carbohydr. Lett. 1997, 2, 281.
39. Sliedregt, L. A. J. M.; Van Der Marel, G. A.; Van Boom, J. H. Tetrahedron Lett.
1994, 35, 4015.
40. Noureddine, K.; Alonso, I.; Rodriguez, N.; Fernandez-Mayoralas, A.; Jimenez-
Barbero, J.; Nieto, O.; Cano, F.; Foces-Foces, C.; Martin- Lomas, M. Tetrahedron
Lett. 1997, 38, 8267.
41. Kahne, D.; Walker, S.; Cheng, Y.; Van Engen, D. J. Am. Chem. Soc. 1989, 111,
6881.
42. Meyers, G.; Thiel, H. J. Adv. Virus Res. 1996, 47, 53.
43. Yoshitake, N.; Xuan, X.; Otsuka, H. J. Gen. Virol. 1997, 78, 1399.
44. Nishikawa, Y.; Xuan, X.; Otsuka, H. Virus Res. 1999, 61, 11.
45. Goris, N.; Vandenbussche, F.; De Clercq, K. Antiviral Res. 2008, 78, 170.
46. Branza-Nichita, N.; Durantel, D.; Carrouee-Durantel, S.; Dwek, R. A.; Zitzmann,
N. J. Virol. 2001, 75, 3527.
47. Durantel, D.; Branza-Nichita, N.; Carrouee-Durantel, S.; Butters, T. D.; Dwek, R.
A.; Zitzmann, N. J. Virol. 2001, 75, 8987.
48. Asano, N. Glycobiology 2003, 13, 93R.
49. Chapel, C.; Garcia, C.; Bartosch, B.; Roingeard, P.; Zitzmann, N.; Cosset, F.-L.;
Dubuisson, J.; Dwek, R. A.; Trepo, C.; Zoulim, F.; Durantel, D. J. Gen. Virol. 2007,
88, 1133.
50. Lazar, C.; Durantel, D.; Macovei, A.; Zitzmann, N.; Zoulim, F.; Dwek, R. A.;
Branza-Nichita, N. Antiviral Res. 2007, 76, 30.
51. Sabara, M.; Babiuk, L. A.; Gilchrist, J.; Misra, V. J. Virol. 1982, 43, 1082.
52. Wang, C. J.; Sung, S. Y.; Chen, D. S.; Chen, P. J. Virology 1996, 220, 28.
53. Plemper, R. K.; Wolf, D. H. Trends Biochem. Sci. 1999, 24, 266.
54. Schroder, M. Cell. Mol. Life Sci. 2008, 65, 862.
55. van Gennip, H. G. P.; Bouma, A.; van Rijn, P. A.; Widjojoatmodjo, M. N.;
Moormann, R. J. M. Vaccine 2002, 20, 1544.
56. Risatti, G. R.; Holinka, L. G.; Fernandez Sainz, I.; Carrillo, C.; Lu, Z.; Borca, M. V. J.
Virol. 2007, 81, 924.
57. Fernandez Sainz, I.; Holinka, L. G.; Lu, Z.; Risatti, G. R.; Borca, M. V. Virology
2008, 370, 122.
18. Moormann, R. J.; Warmerdam, P. A.; van der Meer, B.; Hulst, M. M. Vet.
Microbiol. 1990, 23, 185.
19. Montesino, R.; Toledo, J. R.; Sanchez, O.; Zamora, Y.; Barrera, M.; Royle, L.;
Rudd, P. M.; Dwek, R. A.; Harvey, D. J.; Cremata, J. A. J. Proteome Res. 2008, 8,
546.
20. Pande, A.; Carr, B. V.; Wong, S. Y. C.; Dalton, K.; Jones, I. M.; McCauley, J. W.;
Charleston, B. Virus Res. 2005, 114, 54.
21. Parodi, A. J. Biochem. J. 2000, 348, 1.
22. Trombetta, E. S. Glycobiology 2003, 13, 77R.
23. Taniguchi, N.; Honke, K.; Fukuda, M. Handbook of Glycosyltransferases and
Related Genes In ; Springer Verlag: Tokyo, 2002; Vol. XVIII, p 670.
24. Breton, C.; Fournel-Gigleux, S.; Palcic, M. M. Curr. Opin. Struct. Biol. 2012, 22,
540.
25. Yan, L.; Taylor, C. M.; Goodnow, R., Jr.; Kahne, D. J. Am. Chem. Soc. 1994, 116,
6953.
58. Fernandez-Sainz, I.; Holinka, L. G.; Gavrilov, B. K.; Prarat, M. V.; Gladue, D.; Lu,
Z.; Jia, W.; Risatti, G. R.; Borca, M. V. Virology 2009, 386, 210.
59. Sainz, I. F.; Holinka, L. G.; Lu, Z.; Risatti, G. R.; Borca, M. V. Virology 2008, 370,
122.
60. Gavrilov, B. K.; Rogers, K.; Fernandez-Sainz, I. J.; Holinka, L. G.; Borca, M. V.;
Risatti, G. R. Virology 2011, 420, 135.
26. Cho, H.; Plapp, B. V. Biochemistry 1998, 37, 4482.
27. Lubineau, A.; Billault, I. Carbohydr. Res. 1999, 320, 49.
28. Du, W.; Hardouin, C.; Cheng, H.; Hwang, I.; Boger, D. L. Bioorg. Med. Chem. Lett.
2005, 15, 103.
29. Khiar, N.; Alonso, I.; Rodriguez, N.; Fernandez-Mayoralas, A.; Jimenez-Barbero,
J.; Nieto, O.; Cano, F.; Foces-Foces, C.; Martin-Lomas, M. Tetrahedron Lett. 1997,
38, 8267.