L-xylo-3-hexulose reductase is the missing link in the oxidoreductive pathway for D-galactose catabolism in filamentous fungi

Article abstract of DOI:10.1074/jbc.M112.372755

In addition to the well established Leloir pathway for the catabolism of D-galactose in fungi, the oxidoreductive pathway has been recently identified. In this oxidoreductive pathway, D-galactose is converted via a series of NADPH-dependent reductions and NAD⁺-dependent oxidations into D-fructose. The pathway intermediates include galactitol, L-xylo-3-hexulose, and D-sorbitol. This study identified the missing link in the pathway, the L-xylo-3-hexulose reductase that catalyzes the conversion of L-xylo-3-hexulose to D-sorbitol. In Trichoderma reesei (Hypocrea jecorina) and Aspergillus niger, we identified the genes lxr4 and xhrA, respectively, that encode the L-xylo-3-hexulose reductases. The deletion of these genes resulted in no growth on galactitol and in reduced growth on D-galactose. The LXR4 was heterologously expressed, and the purified protein showed high specificity for L-xylo-3-hexulose with a K_m=2.0±0.5mM and a V _max=5.5±1.0 units/mg. We also confirmed that the product of the LXR4 reaction is D-sorbitol.

Full text of DOI:10.1074/jbc.M112.372755

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 287, NO. 31, pp. 26010–26018, July 27, 2012
© 2012 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.
L-xylo-3-Hexulose Reductase Is the Missing Link in the
Oxidoreductive Pathway for D-Galactose Catabolism in
□
S
Filamentous Fungi*
Received for publication, April 18, 2012, and in revised form, May 30, 2012 Published, JBC Papers in Press, May 31, 2012, DOI 10.1074/jbc.M112.372755
Dominik Mojzita‡, Silvia Herold§1, Benjamin Metz§2, Bernhard Seiboth§, and Peter Richard‡3
From the ‡VTT Technical Research Centre of Finland, Espoo, 02044 VTT, Finland and the §Research Division Biotechnology and
Microbiology, Institute of Chemical Engineering, Vienna University of Technology, 1040 Vienna, Austria
Background: There is an oxidoreductive D-galactose pathway in filamentous fungi.
Results: We identified an L-xylo-3-hexulose reductase that produces D-sorbitol and that is part of this pathway.
Conclusion: This L-xylo-3-hexulose reductase is the missing link in the oxidoreductive D-galactose pathway.
Significance: The alternative pathway for D-galactose catabolism in filamentous fungi is elucidated.
In addition to the well established Leloir pathway for the
catabolism of D-galactose in fungi, the oxidoreductive pathway
has been recently identified. In this oxidoreductive pathway,
D-galactose is converted via a series of NADPH-dependent
An alternative pathway is the oxidative pathway that is some-
times referred to as the De Ley-Doudoroff pathway and was
identified in bacteria (3). In this pathway, D-galactose is first
oxidized to D-galactonolactone, which is then hydrolyzed by a
lactonase to D-galactonate followed by the removal of a water
molecule by a dehydratase to form D-threo-3-deoxy-hexu-
losonate (2-keto-3-deoxy-D-galactonate). D-threo-3-Deoxy-
hexulosonate is then phosphorylated to D-threo-3-deoxy hexu-
losonate 6-phosphate, which is subsequently split by an
aldolase, resulting in pyruvate and D-glyceraldehyde-3-phos-
phate. In a strain of the mold Aspergillus niger, a nonphos-
phorylated alternative of the De Ley-Doudoroff pathway was
described where the D-threo-3-deoxy-hexulosonate is split by
an aldolase to pyruvate and D-glyceraldehyde instead of being
phosphorylated (4).
؉
reductions and NAD -dependent oxidations into D-fructose.
The pathway intermediates include galactitol, L-xylo-3-hexu-
lose, and D-sorbitol. This study identified the missing link in the
pathway, the L-xylo-3-hexulose reductase that catalyzes the con-
version of L-xylo-3-hexulose to D-sorbitol. In Trichoderma reesei
(Hypocrea jecorina) and Aspergillus niger, we identified the
genes lxr4 and xhrA, respectively, that encode the L-xylo-3-hex-
ulose reductases. The deletion of these genes resulted in no
growth on galactitol and in reduced growth on D-galactose. The
LXR4 was heterologously expressed, and the purified protein
showed high specificity for L-xylo-3-hexulose with a Km ؍ 2.0 ؎
0.5 mM and a Vmax ؍ 5.5 ؎ 1.0 units/mg. We also confirmed that
the product of the LXR4 reaction is D-sorbitol.
Another pathway for D-galactose catabolism has also been
demonstrated in some filamentous fungi. It was observed that a
Trichoderma reesei (Hypocrea jecorina) strain with a mutation
in the galactokinase gene, gal1, is still able to catabolize D-ga-
lactose, indicating the existence of an alternative to the Leloir
pathway. Because galactitol accumulated in this strain, it was
suggested that a pathway exists in T. reesei where D-galactose is
reduced in the first step (5). In T. reesei, an aldose reductase,
XYL1, was shown to be responsible for the reduction of D-ga-
lactose to galactitol as well as for the reduction of D-xylose and
L-arabinose (6). A. niger has distinct L-arabinose and D-xylose
reductases, LarA and XyrA (7). XyrA had the highest activity
with D-galactose and was suggested to be involved in D-galac-
tose catabolism (8).
There are several pathways for the catabolism of D-galactose.
The most studied is the Leloir pathway, which exists in prokary-
otic and eukaryotic microorganisms. In this pathway, ␣-D-ga-
lactose is phosphorylated, and in the subsequent steps, con-
verted to D-glucose-6-phosphate in a redox-neutral way (1).
The genes of the Leloir pathway and their regulation have been
described in yeast and filamentous fungi (2).
* This work was supported by the Academy of Finland in the following
research programs: Finnish Centre of Excellence in White Biotechnology-
Green Chemistry (Grant 118573) and Sustainable Energy (Grant 131869).
The work was further supported by a from of the Austrian Science Foun-
dation (Grant P19421) (to B. S.).
It was also observed in T. reesei that a double mutant with
deletions in gal1 and lad1, coding for galactokinase and L-ara-
bitol-4-dehydrogenase, respectively, was not able to catabolize
D-galactose. This suggested that the L-arabitol-4-dehydrogen-
ase that is induced on L-arabitol (9) is also part of this alternative
reductive pathway. Pail et al. (10) showed that purified L-arabi-
tol 4-dehydrogenase, the product of lad1, was capable of con-
Thenucleotidesequence(s)reportedinthispaperhasbeensubmittedtotheGen-
BankTM/EBI Data Bank with accession number(s) BK008566 and BK008567.
□S
This article contains supplemental Figs. S1–S3.
1 A member of the Applied Bioscience Technologies (AB-Tec) Ph. D. program
financed by the Vienna University of Technology.
2 Present address: Dept. of Biotechnology, Delft University of Technology and
Kluyver Centre for Genomics of Industrial Fermentation, Julianalaan 67, verting galactitol to L-xylo-3-hexulose. In A. niger, it was shown
2628 BC Delft, The Netherlands.
that a distinct galactitol dehydrogenase, LadB, exists besides the
L-arabitol dehydrogenase, LadA, that produces L-xylo-3-hexu-
lose and that it is induced on D-galactose and galactitol (8).
3 To whom correspondence should be addressed: VTT Technical Research
Centre of Finland, Tietotie 2, Espoo, P.O. Box 1000, 02044 VTT, Finland. Tel.:
358-207227190; Fax: 358-20-722-7071; E-mail: Peter.Richard@vtt.fi.
26010 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 287•NUMBER 31•JULY 27, 2012

L-xylo-3-Hexulose Reductase in Fungal D-Galactose Catabolism
TABLE 1
taining the pyrG gene flanked by its native promoter and termi-
The transcription of the following genes was tested in A. niger using
qPCR
The carbon source was D-galactose or galactitol. The genes can be retrieved from the
Aspergillus niger homepage at the DOE Joint Genome Institute, JGI (genome.jgi-
.doe.gov/Aspni5/Aspni5.home.html) using the JGI identifiers or from the Aspergil-
lus genome database (AspGD) using the identifiers in parentheses.
nator. These fragments were obtained by PCR from the A. niger
ATCC 1015 genomic DNA using primers xhrA-5-F, xhrA-5-R,
xhrA-3-F, xhrA-3-R, pyrG-del-F_n, and pyrG-del-R_n (Table
2) and the proofreading DNA polymerase Phusion
(Finnzymes). The xhrA terminator fragment (xhrA-3) digested
with HindIII (New England Biolabs) was inserted into the plas-
mid pRSET-A (Invitrogen), which was digested with HindIII
and PvuII (both New England Biolabs). This intermediary con-
struct was digested with EcoRV and NheI (both New England
Biolabs). The resulting fragment was ligated to the NheI-di-
gested promoter fragment (xhrA-5). The resulting vector was
digested with EcoRV (New England Biolabs). The pyrG DNA
fragment, after digestion with SmaI, was inserted between the
two xhrA flanking regions. The resulting plasmid was verified
by restriction analysis and sequencing. The deletion cassette,
5097 bp, containing the xhrA flanking regions and the pyrG
gene, was released by MluI (New England Biolabs) digestion
and transformed into the A. niger ATCC 1015 ⌬pyrG strain.
Transformants were selected based on their ability to grow in
the absence of uracil. Strains with successful deletions were
verified by PCR using the primers xhrA_ORF_F and
xhrA_ORF_F (Table 2).
JGI: 177738 (An08g01930) lxrA
JGI: 184209 (An16g01650) xhrA
JGI: 40156 (An07g01830)
JGI: 174212 (An02g00220)
JGI: 177858 (An06g01980)
JGI: 184211 (An16g06440)
JGI: 56312 (An15g02280)
JGI: 212729 (An09g00620)
JGI: 55205 (An04g09990)
JGI: 212936 (An05g01210)
JGI: 52907 (An11g02460)
Seiboth and Metz (11) pointed out the possibility that the
L-xylo-3-hexulose is reduced to D-sorbitol in a reaction cata-
lyzed by an enzyme related to L-xylulose reductase or by the
L-xylulose reductase itself. The complete oxidoreductive D-
galactose pathway would then have the intermediates D-galac-
tose, galactitol, L-xylo-3-hexulose, D-sorbitol, and D-fructose
(see Fig. 1). D-Sorbitol was shown to be an intermediate in the
pathway of A. niger where the D-fructose-forming D-sorbitol
dehydrogenase, sdhA, was found to be induced on D-galactose
and galactitol and the sdhA deletion mutant had reduced
growth on galactitol and was unable to grow on D-sorbitol (12).
In T. reesei, xylitol dehydrogenase, xdh1, was proposed to be the
enzyme responsible for this reaction.4 Fekete et al. (13) sug-
gested that L-sorbose is produced in Aspergillus nidulans from
galactitol by L-arabitol dehydrogenase and that it could be fur-
ther converted to D-sorbitol. The reaction mechanism of the
galactitol to L-sorbose conversion, however, has not been pro-
posedandcurrentlyremainselusive. Herewesetouttoidentifythe
enzyme that catalyzes the conversion of L-xylo-3-hexulose to
D-sorbitol (L-gulitol), which is the missing link in the oxidoreduc-
tive D-galactose pathway in the molds T. reesei and A. niger.
Deletion of the lxr4 Gene in T. reesei—A T. reesei ⌬tku70
strain was used as the parental strain for transformation (14,
15). The cassette for deletion of the lxr4 gene (GenBankTM
accession number BK008566) contained 937 bp of the pro-
moter region, 1162 bp of the terminator region, and a fragment
containing the pyr4 encoding orotidine-5Ј-phosphate decar-
boxylase. The promoter and terminator regions were obtained
by PCR from the genomic DNA of the T. reesei strain QM9414
using primers Trire22771_XbaI-Ups-fw, Trire22771_XhoI-
Ups-rev, Trire22771_XhoI-Dws-fw, and Trire22771_Acc-
Dws-rev (Table 2) and the proofreading DNA polymerase Phu-
sion (Finnzymes). Both fragments were ligated into the vector
pBluescript SK(ϩ) (Stratagene) after digestion with XbaI and
XhoI (Fermentas) for the promoter fragment and with XhoI
and Acc65I (Fermentas) for the terminator fragment using liga-
tion mix III (Takara). The SalI fragment of pyr4 served as the
selection marker and was cloned via XhiI restriction between
the promoter and terminator regions of lxr4 in pBluescript
SK(ϩ). The resulting plasmid (verified by restriction analysis
and sequencing) was linearized using XbaI and Acc65I and
transformed into the T. reesei ⌬tku70 strain. Transformants
were selected based on their ability to grow in the absence of
uridine. Strains with successful deletions were verified by PCR
using the primers dlxr4_for3 and dlxr4_rev3 (Table 2).
MATERIALS AND METHODS
Strains and Chemicals—The A. niger strain ATCC 1015
(CBS 113.46) was obtained from the Centraalbureau voor
Schimmelcultures (Delft, The Netherlands). The T. reesei
strain QM9414 (ATCC 26921) was used in this study. For com-
parison of growth on agar plates, the spores of A. niger and
T. reesei strains were applied to agar plates containing 6.7 g of
yeast nitrogen base literϪ1 (YNB, BD Biosciences), 20 g of agar/
literϪ1, and 20 g liter of carbon source (see “Results” for
Ϫ1
details). The L-xylo-3-hexulose used for the in vitro tests was
produced as described previously (8).
Reintroduction of xhrA into the ⌬xhrA Strain—The xhrA
gene, with its native promoter and terminator (2496-bp
genomic fragment), was amplified from the A. niger ATCC
1015 genomic DNA using the primers xhrA-genomic_F and
xhrA-genomic_R (Table 2). The PCR product was transformed
into the ⌬xhrA strain, and the transformants were selected on
medium with galactitol as a sole carbon source. The resulting
strains were tested for the presence of the xhrA gene by PCR
and further analyzed for growth on selected carbon sources.
Expression of the Genes in Saccharomyces cerevisiae—For
heterologous expression in S. cerevisiae, the open reading
Transcriptional Analysis—The growth of strains, RNA isola-
tion, and qPCR5 were performed as described previously (12).
Deletion of the xhrA Gene in the A. niger ⌬pyrG Strain—Con-
struction of A. niger ATCC 1015 ⌬pyrG was described previ-
ously (7). The cassette for deletion of the xhrA gene (Table 1)
contained 1644 bp from the xhrA promoter region, 1563 bp
from the xhrA terminator region, and a 1928-bp fragment con-
4 B. Seiboth, unpublished observation.
5 The abbreviations used are: qPCR, quantitative PCR; TSP, 3-(trimethylsilyl)
propionic-2,2,3,3-d4 acid.
JULY 27, 2012•VOLUME 287•NUMBER 31
JOURNAL OF BIOLOGICAL CHEMISTRY 26011

L-xylo-3-Hexulose Reductase in Fungal D-Galactose Catabolism
TABLE 2
Primers
xhrA-genomic_F
xhrA-genomic_R
xhrA-ORF_F
GGCAAGACAACGGACTGAA
AATTCCTGGTGATTCGGGTT
ATATGAATTCACAATGTCCCTCAAAGGTAAAGTCG
ATATGTCGACCTAGATATACAACATCCCACCATT
ATATGAATTCACAATGCATCACCATCACCATCACGGGTCCCTCAAAGGTAAAGTCG
TATAGCTAGCAGCTGAACGCCTGATACAAA
ATATGATATCGATGGCTTTTGCAGATTGTTTG
ATATGATATCCAGAGCCGTGTTAAATAAGGAATAC
ATTAAAGCTTACGCGTACGAAGCCGCCGAAGATA
CAACATTGTCATGTCTGGTGG
GGAGGAGCAATGATCTTGAC
GATACAGATATGTACCAGGCAG
CTAGATATACAACATCCCACCA
CTGTGAAATGTTTGGGAAGTC
xhrA-ORF_R
xhrA-N-HIS_F
xhrA-5_F
xhrA-5_R
xhrA-3_F
xhrA-3_F
act_qPCR_F
act_qPCR_R
xhrA_qPCR_F
xhrA_qPCR_R
galX_qPCR_F
galX_qPCR_R
pyrG-del-F_n
pyrG-del-R_n
lxr4-HIS-N_F
lxr4_ORF_R
GTTTGTTGGTCGTTCGTAGG
TATACCCGGGTGATTGAGGTGATTGGCGAT
TATACCCGGGTTATCACGCGACGGACAT
ATATGAATTCACAATGCATCACCATCACCATCACGGGGCCCGTCCGTATGAAGGC
TAATGATATCCTACGCAATCGACATGCGCATCC
TCTAGACCATTGTCCCAGCCATCTT
Trire22771_XbaI-Ups-fw
Trire22771_XhoI-Ups-rev
Trire22771_XhoI-Dws-fw
Trire22771_Acc-Dws-rev
dlxr4_for3
CTCGAGCGACTTGAGCAATCACCAC
CTCGAGGATGTGTACTTGGTGGCTTG
GGTACCTCTCTGCTCGTTAAATCCCG
GGCGGAGTTTCTATGGAG
dlxr4_rev3
GGGATTGATATTGTTTGC
frames (ORFs) of xhrA (Table 1) and lxr4 (GenBank accession the supernatants were used in the enzyme assays. The protein
number BK008566) were amplified from the cDNA of A. niger
or T. reesei, respectively, grown in the presence of galactitol
with the primers xhrA-H-HIS_F, xhrA-ORF_R, lxr4-HIS-N_F,
and lxr4_ORF_R (Table 2). The genes were inserted into the
plasmid pYX212 (Ingenius, R&D Systems, Madison, WI)
between the EcoRI and SalI sites (in the case of xhrA) or the
EcoRI and SmaI sites (in the case of lxr4), allowing the expres-
sion to be controlled by the TPI1 promoter. All constructs were
verified by sequencing.
concentration was analyzed using the Bio-Rad protein assay kit.
In the tests performed with the A. niger protein extracts, 10 mM
L-xylo-3-hexulose, 0.5 mM NADPH, and 50 mM Tris-HCl (pH ϭ
7.5) were used. The enzymatic activity was measured at room
temperature by monitoring the NADPH disappearance at 340
nm in microtiter plates (Nunc) using the Varioskan spectro-
photometer (Thermo Electron). For the protein extractions
from S. cerevisiae and the purification of the His-tagged pro-
teins, the same methods were used as described previously (8).
For LXR4 sugar reductase activities, the reactions were set up
in 50 mM Tris-HCl (pH ϭ 7.5) with 0.5 mM NADPH and various
sugar concentrations (see “Results”). For the LXR4 polyol dehy-
drogenase activities, the reaction mixtures contained 100 mM
The S. cerevisiae strain CEN.PK2-1D was transformed with
the pYX212 plasmids containing the xhrA and lxr4 genes as
N-terminal His-tagged variants, and the transformants were
selected based on their ability to grow in the absence of uracil.
The expression of active reductases was tested in crude cell
extracts by enzymatic activity measurements. The xhrA was
also expressed without a His tag and as a gene that was codon-
optimized for expression in S. cerevisiae. The gene was also
expressed in the Escherichia coli strain BL21 (DH3) (Invitro-
gen) using the pBAT4 expression vector (16) and isopropyl-1-
thio-␤-D-galactopyranoside induction.
ϩ
Tris-HCl (pH ϭ 8.5), 1 mM NADP , and various concentra-
tions of polyols (see “Results”). The degradation of NADPH or
formation of NADPH was monitored as described above. The
Km and Vmax were estimated from the Michaelis-Menten equa-
tion fitted to the measured data.
The concentration of L-xylo-3-hexulose produced by E. coli
expressing ladB was determined by NMR spectroscopy. 480 ␮l
of D2O containing 0.05% of 3-(trimethylsilyl)propionic-
2,2,3,3-d4 acid (TSP, Aldrich) was added to 120 ␮l of the sam-
ple, and a one-dimensional 1H NMR spectrum was acquired on
a 600-MHz Bruker Avance III NMR spectrometer equipped
with a QCI CryoProbe (Bruker) using the one-dimensional
NOESY pulse sequence for presaturation of the water signal.
The concentration of the L-xylo-3-hexulose was obtained by
comparing the integral over a region of 4.27–4.40 ppm with the
integral of TSP.
Protein Extraction, Enzyme Activity Measurements, and
Analysis of the LXR4 Product—For L-xylo-3-hexulose-reduc-
tase activity measurements in A. niger extracts, the parent
strain ATCC 1015 and the ⌬xhrA strains were cultivated over-
night in YPG medium (1% yeast extract, 2% Bacto peptone; 3%
gelatin). The mycelia were filtered and transferred to fresh
medium containing 1% yeast extract, 2% Bacto peptone, and 2%
D-glucose, galactitol or L-arabinose and cultivated for 6 h. After
incubation in the inducing conditions, the mycelia were iso-
lated by filtration and washed with water, and ϳ200 mg of wet
mycelia was transferred into 2-ml tubes with 0.6 ml of acid-
washed glass beads (Sigma) and 1 ml of lysis buffer containing
50 mM Tris (pH ϭ 7.5) and protease inhibitors (Complete,
Roche Applied Science). The cells were disrupted in two 30-s
breaking sessions in the Precellys 24 instrument (Bertin Tech-
The in vitro reaction with purified LXR4 for the analysis of
the reaction product from D-sorbitol was carried out in 1 ml of
reaction mix containing 50 ␮g of the purified LXR4, 100 mM
ϩ
D-sorbitol, and 5 mM NADP in 100 mM Tris-HCl (pH ϭ 9.0).
The reaction mix was incubated at room temperature for 16 h.
nologies). The cell extracts were clarified by centrifugation, and The control reaction was terminated immediately after the
26012 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 287•NUMBER 31•JULY 27, 2012

L-xylo-3-Hexulose Reductase in Fungal D-Galactose Catabolism
FIGURE 1. The oxidoreductive D-galactose pathway (upper part) and the eukaryotic pathway for L-arabinose catabolism (lower part). The metabolites
are in Fischer projection except for the L-xylo-3-hexulose and L-xylulose, which are oriented so that the C6 and C5, respectively, are at the top to have all
molecules in the same orientation. The enzymes for the different reactions in A. niger (An) and T. reesei (Tr) are indicated.
components were mixed by incubation at 95 °C for 10 min. The LxrA has L-xylo-3-hexulose reductase activity, it is not the
reactions were analyzed by HPLC as described previously (8).
“true” L-xylo-3-hexulose reductase. Also, the ⌬lxrA strain does
not confer any growth defect in the presence of galactitol when
compared with the wild type strain (data not shown). We then
tested the transcription of several close homologues to lxrA on
galactitol or D-galactose, which are listed in Table 1. The closest
lxrA homologue (E-value ϭ 1.45 ϫ 10Ϫ31) JGI: 184209
(An16g01650) was found to be up-regulated on galactitol and
D-galactose (Fig. 2A). We called this gene xhrA for L-xylo-3-
hexulose reductase.
The xhrA gene was also up-regulated on galactitol and D-ga-
lactose in a strain where ladB was deleted with the up-regula-
tion being significantly higher (Fig. 2B). The LadB converts
galactitol to L-xylo-3-hexulose, and the ladB mutant cannot
grow on galactitol (8). This suggests that galactitol, which prob-
ably accumulates in the ⌬ladB strain and not L-xylo-3-hexulose,
is required for the induction of xhrA.
A homologue of galX is located next to xhrA on the chromo-
some. The galX gene was identified in A. nidulans as the gene
encoding a regulator that controls the D-galactose utilization,
and it was shown to be up-regulated in the presence of galactitol
and D-galactose (19). Likewise in A. niger, the transcription of
galX was up-regulated in the presence of galactitol and D-galac-
tose. In addition, galX transcription was further enhanced in
the ⌬ladB strain in a similar manner as observed in the case of
xhrA expression (Fig. 2, C and D).
Identification of the L-xylo-3-Hexulose Reductase in T. reesei—
In T. reesei, several homologues of L-xylulose reductase exist.
The product of the lxr1 gene tre74194 (www.jgi.doe.gov) that
was described to be active with L-xylulose (20) turned out to be
a D-mannitol dehydrogenase (21). Another candidate LXR3
RESULTS
Identification of the L-xylo-3-Hexulose Reductase in A. niger—
The suggested oxidoreductive pathway for D-galactose catabo-
lism has similarities with the eukaryotic L-arabinose pathway
(Fig. 1). The reductions require NADPH, and the oxidations
ϩ
require NAD . The reactions that were described are catalyzed
by identical or closely related enzymes. In T. reesei, the first and
second steps of both pathways are catalyzed by the same
enzymes. The T. reesei XYL1 is the major enzyme for L-arabi-
nose and D-galactose reduction (6), and LAD1 is the main
enzyme for galactitol and L-arabitol oxidation (9, 10). In
A. niger, close homologues of different enzymes are used; XyrA
is used for D-galactose reduction, and LarA is used for L-arabi-
nose reduction (7). Also, the second step uses close homologues
of different enzymes. Galactitol is oxidized in A. niger by LadB
(8), and L-arabitol is oxidized in A. niger by LadA (17). This
information suggested that a similar phenomenon may also
exist for the third step. Thus, the L-xylo-3-hexulose reductase
may be a homologue of the L-xylulose reductase or identical to
the L-xylulose reductase. Because LxrA was identified as the
L-xylulose reductase in A. niger (18), we examined whether this
enzyme could also be the L-xylo-3-hexulose reductase.
The LxrA was purified using the histidine tag as described pre-
viously (18). The activity was tested with L-xylo-3-hexulose and
ϩ
NADPH and in the reverse direction with D-sorbitol and NADP .
The enzyme had activity with these substrates, suggesting that this
enzyme could be the L-xylo-3-hexulose reductase.
We tested the transcription of this gene by qPCR during
growth on galactitol or D-galactose. The lxrA gene was not up-
regulated under these conditions, suggesting that although the (GenBank accession number BK008567), which was identified
JULY 27, 2012•VOLUME 287•NUMBER 31
JOURNAL OF BIOLOGICAL CHEMISTRY 26013

L-xylo-3-Hexulose Reductase in Fungal D-Galactose Catabolism
FIGURE 2. Transcription profiles of the xhrA and galX genes in A. niger. A, the xhrA gene is up-regulated in the presence of galactitol and to a lesser extent
and with a delay on D-galactose. The expression on L-arabinose and D-glucose is not affected. RU, response units. B, the transcriptional activation of xhrA is
further increased in the ⌬ladB strain on galactitol. C and D, the galX encoding the transcription factor responsible for control of the D-galactose catabolic genes
is up-regulated on galactitol (C), and its transcription is increased in the ⌬ladB strain (D).
and characterized as a gene encoding the true L-xylulose reduc- parent strain do not grow on D-galactose. Only when small
tase of T. reesei, showed only activity with L-xylulose but not
with L-xylo-3-hexulose in vitro.6 Moreover, none of these genes
are close homologues of xhrA. By searching the T. reesei genome,
we identified a gene that we called lxr4 (GenBank accession num-
ber BK008566) as the closest orthologue for lxrA.
amounts of D-xylose (0.025%) are supplemented does the par-
ent strain grow, and the ⌬xhrA strain showed reduced growth.
0.025% D-xylose alone does not result in significant growth as
described previously (8). The growth on D-glucose and L-arabi-
nose is not affected because the xhrA gene is not required for
the metabolism of these sugars.
The deletion of lxr4 in T. reesei resulted in no growth on
galactitol. The phenotype of this mutant is similar to the xhrA
deletion in A. niger (Fig. 3). Growth on galactitol was abolished,
but growth on D-glucose and L-arabinose was not affected.
Growth on D-galactose is significantly slower but not absent.
This is expected because it is established that T. reesei has a
functional Leloir pathway for D-galactose catabolism and
that the oxidoreductive pathway only partially contributes to
the D-galactose catabolism. The oxidoreductive pathway
only becomes essential if the Leloir pathway is disrupted, for
example, when the gene encoding the galactokinase is
deleted (5).
Deletion of the L-xylo-3-Hexulose Reductase Genes in A. niger
and T. reesei—To test whether the xhrA is essential for the
pathway, we deleted the gene in A. niger. The resulting strain
was then tested for growth on different carbon sources and
compared with the ATCC 1015 parent strain (Fig. 3). The
mutant showed no growth on galactitol, demonstrating that the
xhrA is an essential gene for its utilization. To prove that this
phenotype is only related to the deletion of the xhrA, we
retransformed the xhrA to the ⌬xhrA strain. In the strain
expressing the xhrA in the mutant background, growth on
galactitol is fully restored (data not shown). The mutant and
6 B. Metz, D. Mojzita, S. Herold, C. P. Kubicek, P. Richard, and B. Seiboth, man-
uscript in preparation.
26014 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 287•NUMBER 31•JULY 27, 2012

L-xylo-3-Hexulose Reductase in Fungal D-Galactose Catabolism
galactitol and L-arabinose, which is expected because xhrA and
lxrA, respectively, are up-regulated under these conditions. In
the xhrA deletion mutant, the activity is not increased on galac-
titol, indicating that the XhrA is mainly contributing to the
L-xylo-3-hexulose reductase activity under these conditions.
On L-arabinose, the activity is not decreased by the xhrA dele-
tion. This activity is likely due to lxrA, which is up-regulated on
L-arabinose and also has high L-xylo-3-hexulose reductase
activity (Table 3).
L-xylo-3-Hexulose Is Produced from D-Sorbitol in the Reverse
Reaction—To demonstrate that the L-xylo-3-hexulose reduc-
tase is catalyzing the conversion of L-xylo-3-hexulose to D-sor-
bitol, we tested the reverse reaction with D-sorbitol as the sub-
strate and analyzed the reaction product by HPLC. The product
ϩ
of the reverse reaction of LXR4 with D-sorbitol and NADP was
identified as L-xylo-3-hexulose. It had the same retention time
as the L-xylo-3-hexulose produced from galactitol using LadB
(8) (Fig. 5) or LAD1 (not shown). D-Fructose has a different
retention time and was not produced.
The L-xylo-3-hexulose that we had produced from galactitol
(8) still contained large amounts of galactitol, which overlaps
FIGURE 3. Growth of the A. niger (An) and T. reesei (Tr) strains with and
the D-sorbitol signal in the HPLC. This made it problematic to
test whether in the forward reaction D-sorbitol was indeed pro-
duced from L-xylo-3-hexulose.
without a deletion of the gene encoding L-xylo-3-hexulose reductase on
solidified medium containing different carbon sources. Equal amounts of
spores were applied and grown for 4 days at 28 °C.
DISCUSSION
Heterologous Expression of the L-xylo-3-Hexulose Reductase—
The xhrA of A. niger and the lxr4 of T. reesei were expressed in
In this study, we identified an enzyme with activity for the
S. cerevisiae from a multicopy plasmid with a strong constitu- conversion of L-xylo-3-hexulose to D-sorbitol using NADPH as
tive promoter. In the crude S. cerevisiae extracts, we could a cofactor. Such an enzyme activity has not, to the best of our
detect L-xylo-3-hexulose reductase activity when the lxr4 was knowledge, been described previously. The enzyme is encoded
expressed, but not when the xhrA was expressed. We also tested by xhrA in A. niger and by lxr4 in T. reesei, and deletion mutants
the expression of a yeast codon-optimized version of the xhrA are unable to grow on galactitol. This enzyme activity is the
gene in yeast as well as the expression of cDNA in E. coli using missing link in the oxidoreductive pathway for D-galactose
the lac promoter and isopropyl-1-thio-␤-D-galactopyranoside catabolism that had been demonstrated to exist in filamentous
induction, but we were not able to detect L-xylo-3-hexulose fungi.
reductase activity (data not shown).
The oxidoreductive D-galactose pathway and the fungal L-ar-
Therefore, we used the T. reesei enzyme for the in vitro char- abinose pathway are very similar (Fig. 1). In both cases, the
acterization of L-xylo-3-hexulose reductase. LXR4 was pro- sequence of reactions is reduction, oxidation, reduction and
duced in S. cerevisiae as a recombinant N-terminally His6- oxidation. In both cases, the reductions are NADPH-linked,
ϩ
tagged protein and subsequently purified. The purified enzyme and the oxidations are NAD -linked. In A. niger, D-galactose is
was NADP(H)-specific and conferred high and specific activity reduced by XyrA, and L-arabinose is reduced by LarA. In
with L-xylo-3-hexulose with a Km ϭ 2.0 Ϯ 0.5 mM and a Vmax ϭ T. reesei, the same enzyme, XYL1, is used for the reduction of
5.5 Ϯ 1.0 units/mg (Fig. 4A). The enzyme was also active with D-galactose and L-arabinose. In A. niger, the second step con-
D-ribulose and L-xylulose, Km ϭ 47 Ϯ 3 mM and Vmax ϭ 14 Ϯ 2 sisting of the oxidation of galactitol and L-arabitol is carried out
units/mg and Km ϭ 22 Ϯ 3 mM and Vmax ϭ 4.2 Ϯ 1 units/mg, by two different enzymes, LadB and LadA, respectively. Again,
respectively. The enzyme also showed some activity with D-xy- the same enzyme in T. reesei, LAD1, oxidizes both galactitol
lulose and very low activity with D-fructose and L- and D-sor- and L-arabitol. So far, it seems that in A. niger, two different
bose (Fig. 4, B and D). In the reverse reaction, LXR4 showed pathways exist for D-galactose and L-arabinose, whereas in
activity with D-sorbitol and D-mannitol, low activity with xyli- T. reesei, the enzymes of the L-arabinose pathway are also the
tol, and no activity with galactitol, ribitol, and L- and D-arabitol enzymes of the D-galactose pathway. However, this pattern is
(Fig. 4, C and D).
different in the third step.
L-xylo-3-Hexulose Reductase Activity in Crude Extracts of
In A. niger, the oxidation of L-xylo-3-hexulose or L-xylulose is
A. niger—Because we were not able to produce an active XhrA performed by two different but highly homologous enzymes,
in a heterologous host, we tested whether this activity could be XhrA and LxrA, respectively. However, in this case, T. reesei
detected in A. niger. We made a crude cell extract from mycelia also uses two different enzymes, LXR4 for the L-xylo-3-hexu-
that were shifted to different carbon sources. Extracts from lose reduction and LXR3 for the L-xylulose reduction.6 The
mycelia on D-glucose showed the lowest L-xylo-3-hexulose LXR4 has the closest sequence similarity of the A. niger
reductase activity. The activity was significantly higher on enzymes LxrA and XhrA in T. reesei. The LXR3, however, is
JULY 27, 2012•VOLUME 287•NUMBER 31
JOURNAL OF BIOLOGICAL CHEMISTRY 26015

L-xylo-3-Hexulose Reductase in Fungal D-Galactose Catabolism
FIGURE 4. In vitro activity of purified LXR4. A, initial reaction rate at different L-xylo-3-hexulose concentrations to obtain the Michaelis-Menten-constants:
K
V
m ϭ 2.0 Ϯ 0.5 mM and Vmax ϭ 5.5 Ϯ 1 units/mg. B, initial reaction rates of L-xylulose and D-ribulose. The Michaelis-Menten constants are: Km ϭ 22 Ϯ 3 mM and
max ϭ 4.2 Ϯ 1 units/mg for L-xylulose and Km ϭ 47 Ϯ 3 mM and Vmax ϭ 14 Ϯ 2 units/mg for D-ribulose. C, the reverse reaction with the polyols D-sorbitol and
xylitol. In the concentration range tested, the rate increased linearly with the substrate concentration, so the Michaelis-Menten-constants could not be
determined. D, activity with other substrates. The reactions were carried out at room temperature at pH ϭ 7.5 with 0.5 mM NADPH and 50 mM sugars unless
otherwise specified. In the reverse direction, 300 mM polyols, 1 mM NADPϩ, and pH ϭ 8.5 were used. Error bars in panels A–D indicate S.D.
TABLE 3
Surprisingly, we could not obtain an active XhrA after heter-
L-xylo-3-hexulose activity in crude extracts of A. niger
ologous expression, although the activity was detected in the
The activities of the crude extract are given in milliunits/mg of extracted protein.
A. niger crude extracts, and it was reduced in the xhrA deletion
The mycelia were pre-grown in YPG medium and then shifted for 6 h to YP medium
mutant. That we could not express the active XhrA in a heter-
supplemented with the 2% carbon sources indicated.
A. niger
A. niger
ologous host could be due to the protein instability, folding
problems, or other issues that we did not pursue as we were able
to analyze the T. reesei homologue (LXR4) in vitro.
(WT)
⌬xhrA
D-Glucose
Galactitol
L-Arabinose
7 Ϯ 0.2
7 Ϯ 0.8
9 Ϯ 1.0
60 Ϯ 2.3
25 Ϯ 0.8
42 Ϯ 3.4
The last step of the oxidoreductive D-galactose pathway is
catalyzed by the D-sorbitol dehydrogenase, SdhA, which was
identified in A. niger. This enzyme was shown to be part of the
pathway because it is up-regulated on D-galactose and galacti-
tol, and the ⌬sdhA strain showed reduced growth on galactitol
(12). In A. niger, the corresponding enzyme in the L-arabinose
pathway is the xylitol dehydrogenase XdhA (17). In T. reesei, it
is apparently a single enzyme, XDH1, that carries out the sor-
bitol dehydrogenase reaction and the xylitol dehydrogenase
reaction. The enzyme is active with D-sorbitol and xylitol, and
the xdh1 is up-regulated on the carbon sources L-arabinose and
more distant in terms of sequence similarity (supplemental Fig.
S1), and it also confers considerably different substrate speci-
ficity. For example, it shows no activity with L-xylo-3-hexulose,
unlike LxrA, whereas it is active with L-sorbose and D-fructose.
In the natural habitats of T. reesei and A. niger, D-galactose is
often accompanied by pentose sugars, which indicates that
both L-arabinose and D-galactose pathways are active simulta-
neously in such conditions. In T. reesei, only LXR4 is responsi-
ble for the conversion of L-xylo-3-hexulose, whereas in A. niger, D-galactose (22). Moreover, the ⌬xdh1 strain fails to grow on
XhrA and LxrA both contribute to the reaction.
galactitol.5
26016 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 287•NUMBER 31•JULY 27, 2012

L-xylo-3-Hexulose Reductase in Fungal D-Galactose Catabolism
FIGURE 5. HPLC elution profile of the reaction products of LadB and LXR4. The reaction product formed from galactitol by LadB is L-xylo-3-hexulose. The
reaction product that is formed from D-sorbitol by LXR4 has the same retention time, which is different from the retention time of D-fructose.
Although the regulation of the Leloir pathway has been stud-
Until recently, A. niger was considered unable to use D-galac-
ied and the regulation factors have been identified, not much is tose as a carbon source (25, 26). In the latest demonstrations of
known about the regulation of the oxidoreductive pathway. We D-galactose utilization in A. niger, the oxidoreductive, but not
have suggested previously that galactitol might be the inducing the Leloir pathway, was shown to be employed, and the D-ga-
compound for the genes of this pathway (8). There are four lactose utilization was enabled with the addition of a small
observations that support this. 1)The expression of ladB is up- amount of D-xylose (8, 12). Fekete et al. (27) recently suggested
regulated sooner and more strongly in the presence of galactitol that the reason for the inability of A. niger to germinate on
than in the presence of D-galactose (8). 2) The up-regulation of D-galactose is due to nonfunctional D-galactose uptake in the
the sdhA is still observed on galactitol in the ⌬ladB strain when conidiospores, whereas the uptake is active in the mycelium.
the pathway is blocked and the production of D-sorbitol, which The authors showed that once the spores germinated on a dif-
is the main inducer of sdhA, is reduced or even absent (12). 3) ferent carbon source, the mycelium continued to grow on D-ga-
The expression of the xhrA gene is significantly enhanced on lactose; however, it was unable to sporulate. In addition, evi-
galactitol in the ⌬ladB strain when compared with the wild type dence of a functional Leloir pathway was presented. In the work
strain (Fig. 2B). 4) The expression of the galX gene, which of Fekete et al. (27), the strain N402 (28) was used. The strain
encodes for the transcription factor involved in the regulation ATCC 1015 that we used in our current and previous studies,
of the Leloir pathways genes, and of the ladB gene (19) is sig- nonetheless, behaved differently. The pregrown mycelium was
nificantly more expressed on galactitol in the ⌬ladB strain (Fig. not able to continue growth on D-galactose, but the strain can
2C).
sporulate in its presence. In addition, the Leloir pathway is not
In A. nidulans, the D-galactose catabolism and its regulation active, and the growth on D-galactose is facilitated by the addi-
seem to be different from other filamentous fungi. In this fun- tion of a small amount of D-xylose but not D-glucose (8) (sup-
gus, the use of different D-galactose pathways is pH-dependent. plemental Fig. S3).
The Leloir pathway is used between pH 4.0 and 6.5 and via some
other route at pH ϭ 7.5 (23). This other route showed oxidation
to galactitol, but the subsequent steps were unidentified. It was
suggested that the pathway proceeds via L-sorbose and D-sorbi-
tol or even via sorbose 6-phosphate and D-tagatose 1,6-bispho-
sphate (24). A. nidulans has, in addition to GalX, an additional
transcriptional regulator, GalR, which is unique among asco-
mycetes (19). When comparing the different Aspergillus species
using the comparative analysis tool on the JGI A. niger v3.0
database (supplemental Fig. S2), A. nidulans does not have a
close homologue of xhrA in the same location as the other
Aspergillus species. However, it has a close homologue in a dif-
ferent place. The closest homologue to the xhrA is the gene
with the identifier ANID_03400.1 (E-value ϭ 2.93 ϫ 10Ϫ41).
Acknowledgments—We thank Dr. Hannu Maaheimo for the quanti-
fication of L-xylo-3-hexulose by NMR and Dr. Andrew Conley for
critical reading of the manuscript.
REFERENCES
1. Holden, H. M., Rayment, I., and Thoden, J. B. (2003) Structure and func-
tion of enzymes of the Leloir pathway for galactose metabolism. J. Biol.
Chem. 278, 43885–43888
2. Seiboth, B., Pakdaman, B. S., Hartl, L., and Kubicek, C. P. (2007) Lactose
metabolism in filamentous fungi: how to deal with an unknown substrate.
Fungal Biol. Rev. 21, 42–48
3. De Ley, J., and Doudoroff, M. (1957) The metabolism of D-galactose in
Pseudomonas saccharophila. J. Biol. Chem. 227, 745–757
JULY 27, 2012•VOLUME 287•NUMBER 31
JOURNAL OF BIOLOGICAL CHEMISTRY 26017

L-xylo-3-Hexulose Reductase in Fungal D-Galactose Catabolism
4. Elshafei, A. M., and Abdel-Fatah, O. M. (2001) Evidence for a non-phos-
erichia coli. Anal. Biochem. 236, 371–373
phorylated route of galactose breakdown in cell-free extracts of Aspergil- 17. de Groot, M. J., van den Dool, C., Wösten, H. A., Levisson, M., vanKuyk,
lus niger. Enzyme Microb. Technol. 29, 76–83
P. A., Ruijter, G. J., and de Vries, R. P. (2007) Regulation of pentose cata-
bolic pathway genes of Aspergillus niger. Food Technol. Biotechnol. 45,
134–138
5. Seiboth, B., Hartl, L., Pail, M., Fekete, E., Karaffa, L., and Kubicek, C. P.
(2004) The galactokinase of Hypocrea jecorina is essential for cellulase
induction by lactose but dispensable for growth on D-galactose. Mol. Mi- 18. Mojzita, D., Vuoristo, K., Koivistoinen, O. M., Penttilä, M., and Richard, P.
crobiol. 51, 1015–1025
(2010) The “true” L-xylulose reductase of filamentous fungi identified in
Aspergillus niger. FEBS Lett. 584, 3540–3544
6. Seiboth, B., Gamauf, C., Pail, M., Hartl, L., and Kubicek, C. P. (2007) The
D-xylose reductase of Hypocrea jecorina is the major aldose reductase in
pentose and D-galactose catabolism and necessary for ␤-galactosidase and
cellulase induction by lactose. Mol. Microbiol. 66, 890–900
19. Christensen, U., Gruben, B. S., Madrid, S., Mulder, H., Nikolaev, I., and de
Vries, R. P. (2011) Unique regulatory mechanism for D-galactose utiliza-
tion in Aspergillus nidulans. Appl. Environ. Microbiol. 77, 7084–7087
7. Mojzita, D., Penttilä, M., and Richard, P. (2010) Identification of an L-ar- 20. Richard, P., Putkonen, M., Väänänen, R., Londesborough, J., and Penttilä,
abinose reductase gene in Aspergillus niger and its role in L-arabinose
catabolism. J. Biol. Chem. 285, 23622–23628
M. (2002) The missing link in the fungal L-arabinose catabolic pathway,
identification of the L-xylulose reductase gene. Biochemistry 41,
6432–6437
8. Mojzita, D., Koivistoinen, O. M., Maaheimo, H., Penttilä, M., Ruohonen,
L., and Richard, P. (2012) Identification of the galactitol dehydrogenase,
LadB, that is part of the oxidoreductive D-galactose catabolic pathway in
Aspergillus niger. Fungal Genet. Biol. 49, 152–159
21. Metz, B., de Vries, R. P., Polak, S., Seidl, V., and Seiboth, B. (2009) The
Hypocrea jecorina (syn. Trichoderma reesei) lxr1 gene encodes a D-man-
nitol dehydrogenase and is not involved in L-arabinose catabolism. FEBS
Lett. 583, 1309–1313
9. Richard, P., Londesborough, J., Putkonen, M., Kalkkinen, N., and Penttilä,
M. (2001) Cloning and expression of a fungal L-arabinitol 4-dehydrogen- 22. Seiboth, B., Hartl, L., Pail, M., and Kubicek, C. P. (2003) D-Xylose metab-
ase gene. J. Biol. Chem. 276, 40631–40637
olism in Hypocrea jecorina: loss of the xylitol dehydrogenase step can be
partially compensated for by lad1-encoded L-arabinitol-4-dehydrogenase.
Eukaryot Cell 2, 867–875
10. Pail, M., Peterbauer, T., Seiboth, B., Hametner, C., Druzhinina, I., and
Kubicek, C. P. (2004) The metabolic role and evolution of L-arabinitol
4-dehydrogenase of Hypocrea jecorina. Eur. J. Biochem. 271, 1864–1872
11. Seiboth, B., and Metz, B. (2011) Fungal arabinan and L-arabinose metab-
olism. Appl. Microbiol. Biotechnol. 89, 1665–1673
23. Roberts, C. F. (1970) Enzyme lesions in galactose non-utilizing mutants of
Aspergillus nidulans. Biochim. Biophys. Acta 201, 267–283
24. Flipphi, M., Sun, J., Robellet, X., Karaffa, L., Fekete, E., Zeng, A. P., and
Kubicek, C. P. (2009) Biodiversity and evolution of primary carbon me-
tabolism in Aspergillus nidulans and other Aspergillus spp. Fungal Genet.
Biol. 46, Suppl. 1, S19–S44
12. Koivistoinen, O. M., Richard, P., Penttilä, M., Ruohonen, L., and Mojzita,
D. (2012) Sorbitol dehydrogenase of Aspergillus niger, SdhA, is part of the
oxidoreductive D-galactose pathway and essential for D-sorbitol catabo-
lism. FEBS Lett. 586, 378–383
25. de Vries, R. P. (2008) in Aspergillus in the Genomic Era (Vargas, J., and
Samson, R. A., eds), pp. 87–106, Wageningen Academic Publishers,
Wageningen
13. Fekete, E., Karaffa, L., Sándor, E., Bányai, I., Seiboth, B., Gyémánt, G., Sepsi,
A., Szentirmai, A., and Kubicek, C. P. (2004) The alternative D-galactose
degrading pathway of Aspergillus nidulans proceeds via L-sorbose. Arch. 26. Fekete, E., Padra, J., Szentirmai, A., and Karaffa, L. (2008) Lactose and
Microbiol. 181, 35–44
D-galactose catabolism in the filamentous fungus Aspergillus nidulans.
Acta Microbiol. Immunol. Hung. 55, 119–124
14. Guangtao, Z., Hartl, L., Schuster, A., Polak, S., Schmoll, M., Wang, T.,
Seidl, V., and Seiboth, B. (2009) Gene targeting in a nonhomologous end 27. Fekete, E., de Vries, R. P., Seiboth, B., vanKuyk, P. A., Sándor, E., Fekete, E.,
joining-deficient Hypocrea jecorina. J. Biotechnol. 139, 146–151
15. Gruber, F., Visser, J., Kubicek, C. P., and de Graaff, L. H. (1990) The
development of a heterologous transformation system for the cellulolytic
Metz, B., Kubicek, C. P., and Karaffa, L. (2012) D-Galactose uptake is
nonfunctional in the conidiospores of Aspergillus niger. FEMS Microbiol
Lett. 329, 198–203
fungus Trichoderma reesei based on a pyrG-negative mutant strain. Curr. 28. Bos, C. J., Debets, A. J., Swart, K., Huybers, A., Kobus, G., and Slakhorst,
Genet. 18, 71–76
S. M. (1988) Genetic analysis and the construction of master strains for
assignment of genes to six linkage groups in Aspergillus niger. Curr. Genet.
14, 437–443
16. Peränen, J., Rikkonen, M., Hyvönen, M., and Kääriäinen, L. (1996) T7
vectors with modified T7lac promoter for expression of proteins in Esch-
26018 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 287•NUMBER 31•JULY 27, 2012

Enzymology:
l-xylo-3-Hexulose Reductase Is the Missing
Link in the Oxidoreductive Pathway for
d-Galactose Catabolism in Filamentous
Fungi
Dominik Mojzita, Silvia Herold, Benjamin
Metz, Bernhard Seiboth and Peter Richard
J. Biol. Chem. 2012, 287:26010-26018.
doi: 10.1074/jbc.M112.372755 originally published online May 31, 2012
Access the most updated version of this article at doi: 10.1074/jbc.M112.372755
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
Supplemental material:
http://www.jbc.org/content/suppl/2012/06/08/M112.372755.DC1.html
This article cites 27 references, 7 of which can be accessed free at
http://www.jbc.org/content/287/31/26010.full.html#ref-list-1