Anti-dormant mycobacterial activity and target analysis of nybomycin produced by a marine-derived Streptomyces sp.

Article abstract of DOI:10.1016/j.bmc.2015.04.033

Abstract In the course of our search for anti-dormant Mycobacterial substances, nybomycin (1) was re-discovered from the culture broth of a marine-derived Streptomyces sp. on the bioassay-guided separation. Compound 1 showed anti-microbial activity against Mycobacterium smegmatis and Mycobacterium bovis BCG with the MIC of 1.0 μg/mL under both actively growing aerobic conditions and dormancy inducing hypoxic conditions. Compound 1 is also effective to Mycobacterium tuberculosis including the clinically isolated strains. The mechanistic analysis indicated that 1 bound to DNA and induces a unique morphological change to mycobacterial bacilli leading the bacterial cell death.

Full text of DOI:10.1016/j.bmc.2015.04.033

Bioorganic & Medicinal Chemistry 23 (2015) 3534–3541
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Anti-dormant mycobacterial activity and target analysis of
nybomycin produced by a marine-derived Streptomyces sp.
a
a
a
a
Masayoshi Arai a, , Kentaro Kamiya , Patamaporn Pruksakorn , Yuji Sumii , Naoyuki Kotoku ,
⇑
Jean-Pierre Joubert b, Prashini Moodley b, Chisu Han a, Dayoung Shin a, Motomasa Kobayashi a,
⇑
a Graduate School of Pharmaceutical Sciences, Osaka University, Yamada-oka 1-6, Suita, Osaka 565-0871, Japan
b Nelson R. Mandela School of Medicine, University of KwaZulu Natal, 719 Umbilo Road, Congella, Durban 4013, South Africa
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 10 February 2015
Revised 7 April 2015
Accepted 9 April 2015
Available online 17 April 2015
In the course of our search for anti-dormant Mycobacterial substances, nybomycin (1) was re-discovered
from the culture broth of a marine-derived Streptomyces sp. on the bioassay-guided separation.
Compound 1 showed anti-microbial activity against Mycobacterium smegmatis and Mycobacterium bovis
BCG with the MIC of 1.0 lg/mL under both actively growing aerobic conditions and dormancy inducing
hypoxic conditions. Compound 1 is also effective to Mycobacterium tuberculosis including the clinically
isolated strains. The mechanistic analysis indicated that 1 bound to DNA and induces a unique morpho-
logical change to mycobacterial bacilli leading the bacterial cell death.
Keywords:
Nybomycin
Antibiotic
Ó 2015 Elsevier Ltd. All rights reserved.
Tuberculosis
Dormant
Target identification
1. Introduction
sp., and 2-methoxy-3-oxoaaptamine8 (new aaptamine class
alkaloid) from a marine sponge of Aaptos sp. on the basis of bioas-
Tuberculosis (TB) is one of the most common causes of morbid-
ity and mortality in HIV-positive adults living in poverty.1 8.9 mil-
lion new TB cases and 1.5 million deaths by TB are estimated each
year.2 In addition, the requirement of long-term therapy for cure is
a serious problem in the treatment of TB. Then, one of the major
reasons for the extended chemotherapeutic regimens and wide
epidemicity of TB is that the causative agent Mycobacterium tuber-
culosis has an ability to become dormant. Therefore, new lead com-
pounds, which are effective against M. tuberculosis in both active
and dormant states, are urgently needed. Although physiology of
the latent M. tuberculosis infection is still unclear, hypoxic condi-
tion was found to induce dormant state of Mycobacterium sp.,
which has a drug susceptibility profile resembling that of the latent
M. tuberculosis infection.3–5 Based on these findings, we have estab-
lished a screening system to search for substances that have anti-
microbial activity against dormant mycobacteria and have isolated
trichoderins6 (new aminolipopeptides) from the culture broth of a
marine sponge-derived fungus of Trichoderma sp., neamphamide
B7 (new cyclic depsipeptide) from a marine sponge of Neamphius
say-guided separation. In the continuous screening from marine
organisms and marine-derived microorganisms, nybomycin (1)
was re-discovered as an anti-dormant mycobacterial substance
from the culture broth of a marine-derived Streptomyces sp.
MS44. Nybomycin (1) was originally isolated from the terrestrial
Streptomyces A717 by Strelitz et al. and demonstrated to show
anti-phage activity and anti-microbial activity against Gram-
negative and Gram-positive bacteria including Mycobacterium
smegmatis under actively growing conditions.9 However, the
detailed anti-mycobacterial activity, especially under dormant
state, and mode of action of 1 were remained unclear. In this paper,
we studied in detail anti-microbial activity and mode of action of
nybomycin (1).
2. Result and discussion
2.1. Anti-mycobacterial activity of nybomycin (1)
Dormant M. tuberculosis exists in the granulomas, where are
known to be hypoxic environments. Wayne et al. clarified that oxy-
gen depletion triggers the dormancy response such as resistance to
isoniazid of anti-TB drug.3,10 Based on these observations, we have
established a screening system to search substances that have
anti-microbial activity against dormant mycobacteria. In this assay
⇑
Corresponding authors. Tel./fax: +81 66879 8217 (M.A.); tel.: +81 66879 8215;
fax: +81 66879 8219 (M.K.).
E-mail addresses: araim@phs.osaka-u.ac.jp (M. Arai), kobayasi@phs.osaka-u.ac.jp
(M. Kobayashi).
http://dx.doi.org/10.1016/j.bmc.2015.04.033
0968-0896/Ó 2015 Elsevier Ltd. All rights reserved.

M. Arai et al. / Bioorg. Med. Chem. 23 (2015) 3534–3541
3535
system, the minimum inhibitory concentration (MIC) values of iso-
niazid against M. smegmatis and Mycobacterium bovis BCG were
2.5 g/mL and 0.05 g/mL under aerobic conditions respectively,
whereas the MIC values of isoniazid against these strains were
more than 25 g/mL under hypoxic conditions as shown in
l
l
l
Table 1. In the course of our screening from marine organisms
and marine-derived microorganisms, nybomycin (1)9,11 was
re-discovered as an anti-dormant mycobacterial substance from
the culture broth of a marine-derived Streptomyces sp. on the
bioassay-guided separation (Fig. 1). Compound 1 exhibited potent
anti-microbial activity against M. smegmatis and M. bovis BCG
under both aerobic and hypoxic conditions with MIC of 1.0 lg/mL
(Table 1). This result indicated that compound 1 is effective against
M. smegmatis and M. bovis BCG in the both actively growing aerobic
conditions and dormancy inducing hypoxic conditions. In addition,
1 was also effective against pathogenic strains of M. tuberculosis
including clinically isolated strains with MIC ranging 4.2–6.3 lg/mL
(Table 2). Thus, this result suggested that compound 1 would have
a potent potential as anti-Tuberculosis drug.
2.2. Morphological change of nybomycin (1)-treated M.
smegmatis
During bioassay, a unique morphological change was observed
in the nybomycin (1)-treated M. smegmatis bacilli. As shown in
Figure 2, the M. smegmatis bacilli treated with 1 elongated their cell
bodies. Until now, a similar morphological change has been
reported in the studies of several microorganisms.12–14 For exam-
ple, (a) the partial depletion of pkn A and pkn B of Ser/Thr protein
kinases in M. tuberculosis induces elongation of their cell bodies;12
(b) the deficiency of cell division gene whmD in M. smegmatis
shows filamentous and aseptate morphology;13 (c) The six-fold
overexpression or reduction of cell division gene ftsZ in M. smegma-
tis results in an increase in cell length and a significant decrease in
viability.14 Furthermore, the inhibitors of DNA replication and
transcription such as daunorubicin, nalidixic acid, mitomycin C,
novobiocin, and ciprofloxacin also induce similar morphological
change to Escherichia coli.15 Therefore, we speculated that nybomy-
cin (1) might bind to the molecules, which relate Ser/Thr protein
kinases, cell division or DNA replication and transcription.
Figure 1. Chemical structures of nybomycin (1) and probes (2 and 3).
Table 2
MICs of nybomycin (1) against M. tuberculosis strains under aerobic conditions
Strains
MICs (lg/mL)
1
M. tuberculosis H37Rv
M. tuberculosis T1413
M. tuberculosis T1538
4.2
6.3
5.2
2.3. Analysis of target molecule of nybomycin (1)
Sequencing analyses of the cosmids isolated from each resistant
transformant revealed that the cosmids of pYUB415_2012 and
2015, which were extracted from the ICHO2012 and 2015
transformants respectively, contained 29.9 kb (coordinates from
686.465 kb to 716.464 kb) of the same genome fragment. Then,
the cosmid of pYUB415_2013 extracted from the ICHO2013 trans-
formant included 34.5 kb (coordinates from 674.538 kb to
709.074 kb) of genome fragment (Fig. 4A). On the other hand, the
cosmid pYUB415_2014 extracted from the ICHO2014 transformant
contained 29.7 kb (coordinates from 4101.265 kb to 4130.915 kb)
(Fig. 4B). Therefore, this result indicated that the gene giving resis-
tance to compound 1 would be contained in the genome fragment
of M. bovis BCG from 686.465 kb to 709.074 kb (22.6 kb, region 1)
and in that from 4101.265 kb to 4130.915 (29.7 kb, region 2).
However, there was no homologously and functionally similar
gene between region 1 and region 2. Moreover, these regions did
not include the gene encoding the multidrug resistance (MDR) pro-
tein, which reduced intracellular concentration of nybomycin (1).
We then selected three gene regions (S1–S3) and two genes (S4
and S5) at random (Fig. 4) and investigated whether the transfor-
mants, which over-expresses each gene region or gene, shows
resistance to compound 1 or not. As shown in Figure 3B, the
ICHO1034 and ICHO1036 transformants, which overexpressed S1
region and S3 region respectively, grew on the agar plate
In general, the transformant that overexpresses target protein
for an anti-microbial compound shows resistance to the com-
pound. On the basis of this concept, we have been identified the
target molecules of several anti-microbial natural products by
using 4000 strains of M. smegmatis transformed with genomic
DNA library, which randomly overexpress the genome fragment
of M. bovis BCG.16–18 Then, we first applied this method for identi-
fying target molecule of nybomycin (1), and four transformants,
named ICHO2012–2015, were found to exhibit resistance to
4.0
l
g/mL (4ꢀ MIC) concentration of compound 1 (Fig. 3A).
Table 1
MICs of compounds 1–3 against M. smegmatis and M. bovis BCG under aerobic and
hypoxic conditions
Compounds
MIC (lg/mL)
M. smegmatis
Aerobic Hypoxic
M. bovis BCG
Aerobic Hypoxic
1.0
1
1.0
1.0
1.0
2
3
25
>200
2.5
6.25
>200
25
12.5
>200
0.05
6.25
>200
>100
Isoniazid

3536
M. Arai et al. / Bioorg. Med. Chem. 23 (2015) 3534–3541
Figure 2. Morphology of nybomycin-treated mycobacterial bacilli. The phase-contrast microscopy (upper) and the scanning electron microscopy (lower) of M. smegmatis
treated with or without 1.0 g/mL of nybomycin (1) for 48 h.
l
Figure 3. Growth of various transformants on the 7H10 agar containing nybomycin (1). Growth of the nybomycin-resistant M. smegmatis transformed with the genomic DNA
library of M. bovis BCG (A) and the transformants of M. smegmatis over-expressing candidate regions or genes conferring resistance to nybomycin (1) (B) on the 7H10 agar
plate containing nybomycin (1). Each strain was cultured in the 7H9 broth, and cell number then was adjusted to 1 ꢀ 107 CFU/mL. The 10
spread on the 7H10 agar plate in the presence or absence of indicated concentration of nybomycin (1).
lL aliquots of each culture were
containing 2.0
l
g/mL (2ꢀ MIC) concentration of compound 1
on the agar plate containing compound 1. In addition, the five
transformants, ICHO1034–1038, did not grow on the agar plate
similar to the ICHO2012 transformant overexpressing region 1.
The ICHO1037 and ICHO1038 transformants, which overexpresses
S4 gene and S5 gene respectively, exhibited a weak resistance to
compound 1 as compared with ICHO2012 strain, whereas the
ICHO1035 transformant overexpressing S2 region did not grow
containing
4
l
g/mL (4ꢀ MIC) of compound 1, while the
ICHO2012 strain grew under this conditions (Data not shown).
Recently, Hiramatsu et al. reported that nybomycin (1) was
effective to the quinolone-resistant Staphylococcus aureus having

M. Arai et al. / Bioorg. Med. Chem. 23 (2015) 3534–3541
3537
Figure 4. Gene regions of cosmids isolated from nybomycin-resistant transformants.
mutation in gyrA (type II topoisomerase) gene, whereas 1 was inac-
tive against the strain having intact gyrA gene. Then, they supposed
that compound 1 inhibited the DNA gyrase with altered GyrA sub-
unit.19 On the other hand, we isolated a spontaneous nybomycin
in the case for addition of isoniazid, which targeted enoyl-ACP
reductase (Fig. 5A, lanes 7 and 8). The avidin beads itself (Fig. 5A,
lanes 1 and 2) and dummy probe (3) (Fig. 5A, lanes 9 and 10) did
not bind to plasmid DNA. Interestingly, the plasmid pMV206 itself
(Fig. 5B, lanes 7 and 8) and the pMV206 plasmid inserted the S2
region, which was contained in the non-resistant transformant
(ICHO1035) (Fig. 5B, lanes 9 and 10. Fig. 3B), exhibited weak affin-
ity to probe 2 in comparison with the pMV206 inserted the S3
region, which gives the resistance against compound 1 to M. smeg-
matis (Fig. 5B, lanes 11 and 12. Fig. 3B). This result indicated that
nybomycin (1) directly binds to DNA. Moreover, nybomycin (1)
basically has a DNA binding property, and its binding amount
and affinity to DNA would be altered depending on DNA sequence.
(1)-resistant of M. smegmatis (MIC = 10 lg/mL), and analyzed gene
mutation by whole genome sequencing. Our preliminary result
indicated that the analyzed strain have the following two muta-
tions in amino acid levels; L59P in MSMEG_6223 (tetR family tran-
scriptional repressor) and A23V in MSMEG_6471 (glycine/D-amino
acid oxidase). In addition, no mutation was observed in pknA
gene (MSMEG_0006), pknB gene (MSMEG_5437), ftsZ gene
(MSMEG_4222), whmD gene (MSMEG_1831), and two gyrA genes
(MSMEG_0006 and _0456) in the spontaneous 1-resistant strain
(data not shown). From these results, we hypothesized that nybo-
mycin (1) targets mycobacterial genome instead of particular
protein.
3. Conclusion
In order to confirm this hypothesis, we synthesized nybomycin
probe (2) and dummy probe (3) and investigated binding affinity of
the probes 2 and 3 to several plasmid DNA (Fig. 1). As shown in
Table 1, the probe 2 retained moderate anti-microbial activity
against M. smegmatis and M. bovis BCG under both aerobic
conditions and hypoxic conditions with MIC values ranging 6.25–
Nybomycin (1) isolated from the culture broth of a marine-
derived Streptomyces sp. showed potent anti-microbial activity
against Mycobacterium sp. in both actively growing aerobic condi-
tions and dormancy induced hypoxic conditions. In addition, com-
pound 1 was also effective to pathogenic strains of M. tuberculosis
including clinically isolated strains. This result proved the validity
of nybomycin (1) as a new drug lead for Tuberculosis. The further
study of target identification for compound 1 clarified that com-
pound 1 directly binds to plasmid DNA with some selectivity.
Nybomycin (1) might bind to mycobacterial genome to cause
inhibition of DNA replication and transcription, so that the unique
25 lg/mL, whereas probe 3 did not show the activity. Then, the
probe 2 bound to the plasmid DNA, which cloned S3 region into
pMV206 (Fig. 5A, lanes 3 and 4), and this binding was partially
inhibited by the addition of nybomycin (1) as a competitive
inhibitor (Fig. 5A, lanes 5 and 6). Whereas no effect was observed

3538
M. Arai et al. / Bioorg. Med. Chem. 23 (2015) 3534–3541
Figure 5. Binding of nybomycin probes 2 and 3 to DNA. (A) The probe 2 or 3 conjugated or unconjugated Dynabeads were suspended with the solution of the plasmid DNA
(300 ng/0.1 mL) that cloned S3 region into pMV206, in the presence or absence of nybomycin (1, 60 M) or isoniazid (60 M) as competitive inhibitors. The each reaction
l
l
mixture was then incubated at room temperature for 1 h, and the beads were separated by centrifugation. The resulting beads and supernatants were subjected to agarose gel
electrophoresis, and the resolved DNAs were visualized after ethidium bromide staining. (B) The binding of probe 2 to the various kinds of plasmids was investigated using
same protocol of the experiment A. The following is the meaning of abbreviations: M; Marker, S; Supernatant, B; Beads, 206; Mock plasmid pMV206, S2 and S3; pMV206
cloned S2 region or S3 region, respectively, as shown in Figure 4 and Table 3.
morphological change leading the bacterial cell death is induced.
The further analysis of mode of action of nybomycin (1) is cur-
rently under way.
a Waters Q-Tof Ultima API mass spectrometer for ESI-TOF MS;
HPLC was performed using a Hitachi L-6000 pump equipped with
Hitachi L-4000H UV detector. Silica gel (Kanto, 40–100 lm) and
pre-coated thin layer chromatography (TLC) plates (Merck,
60F254) were used for column chromatography and TLC. Spots on
TLC plates were detected by spraying acidic p-anisaldehyde solu-
tion (p-anisaldehyde: 25 mL, c-H2SO4: 25 mL, AcOH: 5 mL, EtOH:
425 mL) or phosphomolybdic acid solution (phosphomolybdic
acid: 25 g, EtOH: 500 mL) with subsequent heating.
4. Experimental
4.1. General materials
Middlebrook 7H9 broth, Middlebrook 7H10 agar, Middlebrook
OADC Enrichment, and Luria–Bertani (LB) broth were obtained
from BD (Franklin Lakes, NJ). DNA restriction enzymes and T4
DNA ligase were obtained from New England BioLabs Inc.
(Ipswich, MA). Expand High Fidelity PCR System (Roche Applied
Science, Mannheim, Germany) was used for PCR. Streptavidin-
conjugated Dynabeads (M-280) was purchased from Invitrogen
(Carlsbad, CA). Isoniazid, hygromycin B, kanamycin, 3-(4,5-
dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT),
and other chemicals were purchased from Sigma (St. Louis, MO)
or Kishida Chemical Co., Ltd (Osaka, Japan).
The following instruments were used to obtain physical data: a
JASCO P-2200 digital polarimeter (L = 50 mm) for specific rota-
tions; a JEOL ECS-300 (1H NMR: 300 MHz, 13C NMR: 75 MHz),
ECA-500 (1H NMR: 500 MHz, 13C NMR: 125 MHz) and a Varian
NMR system (1H NMR: 600 MHz, 13C NMR: 150 MHz) spectrome-
ter for 1H and 13C NMR data using tetramethylsilane as an internal
standard; a JASCO FT/IR-5300 infrared spectrometer for IR spectra;
4.2. Isolation of nybomycin (1) from
a marine-derived
Streptomyces sp.
The marine-derived Streptomyces sp. MS44 was isolated from
the marine sediment, which was collected at Maizuru, Kyoto pre-
fecture, Japan in 2000. The MS44 strain was cultured in the
ISP1 + glucose medium (totally 10 L) consisting of 0.5% bacto tryp-
tone, 0.3% yeast extract, and 0.5% glucose under shaking condition
for 2 weeks at 30 °C. The 2 weeks old culture broth was extracted
with 2-butanone twice to obtain a crude extract. The crude extract
(4.0 g, MIC = 200 lg/mL against M. smegmatis under aerobic and
hypoxic conditions) was partitioned with n-hexane (1 L) and 90%
methanol (1 L). The resulting insoluble material (100 mg), which
showed most potent anti-microbial activity against M. smegmatis
under both aerobic and hypoxic conditions with MIC of
12.5 lg/mL, was washed several times with methanol. After

M. Arai et al. / Bioorg. Med. Chem. 23 (2015) 3534–3541
3539
further partitioned with chloroform–methanol (ratio 3:1, 300 mL)
4.6. Syntheses of probes 2 and 3
4.6.1. Nybomycin probe (2)
and water (150 mL), the organic layer was concentrated in vacuo
and finally recrystallized with TFA-water to obtain 14 mg of
nybomycin (1) as white needle-like crystals. Nybomycin (1) was
identified by ESI-TOF-MS and 2D-NMR analyses and comparison
with authentic spectral data.9,11,20
White solid. 1H NMR (500 MHz, CDCl3) d: 7.55 (1H, s), 7.38 (1H,
s), 6.82 (1H, s), 6.71 (1H, s), 6.48 (1H, s), 6.40 (2H, s), 5.88 (1H, s),
5.37 (2H, s), 5.18 (1H, s), 4.51 (3H, t-like), 4.35 (1H, t, J = 6.0 Hz),
3.95 (3H, s), 3.86 (2H, t, J = 5.2 Hz), 3.66–3.62 (36H, m), 3.55 (2H,
t, J = 5.2 Hz), 3.44 (2H, t, J = 4.3 Hz), 3.17–3.13 (1H, m), 2.92 (1H,
dd, J = 13.5, 5.4 Hz), 2.80–2.73 (3H, m), 2.54 (2H, t, J = 7.7 Hz),
2.50 (3H, s), 2.26–2.22 (2H, m), 2.10–2.04 (2H, m), 1.76–1.63 (4H,
m), 1.44 (2H, t, J = 7.4 Hz). IR (KBr): 3266, 2922, 1798, 1740,
1669, 1634, 1456, 1352, 1248, 1101 cmꢁ1. MS (ESI-TOF) m/z:
1167 [M+Na]+. HRMS (ESI-TOF) m/z: 1167.5260, calcd for
C54H80N8O17SNa [M+Na]+; Found: 1167.5293. Synthesis of nybo-
mycin probe (2) was described in detail at Supplementary data.
4.3. Bacterial strains and culture
Nonpathogenic strains of M. smegmatis mc2155 and M. bovis
BCG Pasteur are kindly provided from Dr. William R. Jacobs, Jr.
(Albert Einstein College of Medicine, New York, USA). M. tuberculo-
sis T1413 and T1538 strains were clinically isolated at University of
KwaZulu Natal as drug susceptible strains, while M. tuberculosis
H37Rv is standard laboratory strain.
Escherichia coli DH5
a was used for cloning and maintaining
4.6.2. Dummy probe (3)
plasmid and was grown in LB liquid medium. Mycobacterial strains
were grown in the Middlebrook 7H9 broth containing 10% OADC,
0.5% glycerol and 0.05% Tween 80 or on the Middlebrook 7H10
agar containing 10% OADC and 0.5% glycerol. M. smegmatis was
grown in the LB liquid medium with 0.05% Tween 80 for compe-
tent cell preparation. The concentrations of antibiotics used were
White solid. 1H NMR (500 MHz, CDCl3) d: 7.49 (1H, s), 6.79 (1H,
s), 6.27 (1H, s), 5.39 (1H, s), 4.50 (3H, t, J = 5.2 Hz), 4.31 (1H, t,
J = 6.1 Hz), 3.84 (2H, t, J = 5.2 Hz), 3.66 (3H, s), 3.66–3.63 (32H,
m), 3.60 (4H, s), 3.55 (2H, t, J = 5.2 Hz), 3.47–3.38 (3H, m), 3.15–
3.12 (1H, m), 2.89 (1H, dd, J = 12.8, 4.9 Hz), 2.75–2.74 (3H, m),
2.38 (2H, t, J = 7.4 Hz), 2.22 (2H, td, J = 7.3, 3.1 Hz), 2.00 (2H, quint,
J = 7.4 Hz), 1.76–1.63 (4H, m), 1.46–1.41 (2H, m). IR (KBr): 3285,
2922, 2872, 1701, 1452, 1352, 1246, 1111 cmꢁ1. MS (ESI-TOF)
m/z: 901 [M+Na]+. HRMS (ESI-TOF) m/z: 901.4568, calcd for
150
strains, and 50
for Mycobacterium strains.
lg/mL (hygromycin B), and 40
lg/mL (kanamycin) for E. coli
l
g/mL (hygromycin B) and 20
l
g/mL (kanamycin)
C
39H70N6O14SNa [M+Na]+; Found: 901.4604. Synthesis of dummy
4.4. Anti-microbial activity of compounds under aerobic and
hypoxic conditions
probe (3) was described in detail at Supplementary data.
4.7. Binding affinity of probe 2 to DNA
MIC values against M. smegmatis of a fast growing strain and M.
bovis BCG and M. tuberculosis of slow growing strains were deter-
mined using the established MTT method.21 Mid-log phase bacilli
[M. smegmatis (1 ꢀ 104 CFU/0.1 mL) or M. bovis BCG and M. tuber-
culosis (1 ꢀ 105 CFU/0.1 mL)] were inoculated in a 96-well plate,
and then, serially diluted sample was added to the 96-well plate.
In the case of aerobic condition, the bacteria were incubated at
37 °C for 36 h (for M. smegmatis) or for 7 days (for M. bovis BCG
and M. tuberculosis). Alternatively, the hypoxic model was per-
formed based on the protocol of Rustad et al. with minor modifica-
tion.22 The mycobacterial bacilli were grown in Middlebrook 7H9
broth at 37 °C under nitrogen atmosphere containing 0.2% oxygen
until optical density reached 0.8 at 600 nm. Subsequently, the
bacilli were inoculated to the 96-well plate at the same density
under aerobic condition and incubated at 37 °C under nitrogen
atmosphere containing 0.2% oxygen for 96 h (for M. smegmatis)
The 150
l
g of streptavidin conjugated Dynabeads (M-280) were
L of
mixed with probe 2 or probe 3 (260 pmol each) in the 100
l
5 mM Tris–HCl buffer (pH 7.5) supplement with 0.5 mM EDTA
and 1 M NaCl (Binding buffer), and were incubated at room tem-
perature for 30 min to form a probe 2 (or probe 3) conjugated
Dynabeads. After washing the beads with binding buffer, the probe
2 (or probe 3) conjugated beads were re-suspended with the DNA
solutions (300 ng/0.1 mL) in binding buffer in the presence or
absence of nybomycin (1, 60 lM) or isoniazid (60 lM) as compet-
itive inhibitors. The each reaction mixture was then incubated at rt
for 1 h. After centrifugation (1500ꢀg, 5 min), the supernatant was
transferred to a new test tube, and the beads were washed with
binding buffer 3 times. Next, the washed solutions were combined
with the corresponding supernatant. The beads was mixed with
DNA loading dye, boiled for 3 min, and cooled down at room tem-
perature. The DNA in the supernatant was precipitated by the
method of ethanol precipitation. Then, the resulting DNA was dis-
solved in the DNA loading dye. The samples from the beads or
supernatants were subjected to agarose gel electrophoresis, and
the resolved DNAs were visualized by ImageQuant LAS4010
Digital Imaging System (GE Healthcare Life Sciences) after ethid-
ium bromide staining.
or for 14 days (for M. bovis BCG). After incubation, 50 lL of MTT
solution (0.5 mg/mL) was added to each well and incubated at
37 °C for additional 12 h under aerobic or hypoxic conditions.
The optical density at 560 nm was measured to determine the
MIC value.
4.5. Electron microscopic analysis of nybomycin-treated M.
smegmatis
4.8. Construction of genomic DNA Library and transformation
of M. smegmatis
10 mL of M. smegmatis (1 ꢀ 106 CFU/mL) was incubated for
48 h at 37 °C in the presence or absence of 1.0 lg/mL nybomycin
(1). The bacilli were collected by centrifugation and washed with
10 mL of PBS. The bacilli were re-suspended with 10 mL of PBS
The chromosomal DNA of M. bovis BCG was prepared using
the hexadecyltrimethylammonium bromide (CTAB) method.23
Chromosomal DNA was then digested with restriction endonucle-
ase Sau3AI to produce approximately 30 kb DNA fragments. A
genomic DNA library was constructed in the E. coli-
Mycobacterium shuttle cosmid pYUB415 by using the double cos
vector strategy as previously described.24 Briefly, the left and right
arms of pYUB415 were generated by digestion with restriction
endonucleases of XbaI and BamHI. The fragments of the genome
and diluted 256 times with PBS. The 100
transferred on the membrane (MILLIPORE, ISOPORE membrane
filters 0.2 m) using vacuum pump. The bacilli on the membrane
lL of portion were
l
were fixed with 2% osmium tetraoxide solution, and were
applied to a silicon wafer slide and sputter-coated with gold
before examination by an electronic microscope (JSM-5200,
JEOL, Japan).

3540
M. Arai et al. / Bioorg. Med. Chem. 23 (2015) 3534–3541
Table 3
List of the transformants of M. smegmatis and description of plasmids
Strains
Vectors
Description of plasmids
Sequence of primers (50 to 30)
F: Forward primer, R: Reverse primer
ICHO1034
ICHO1035
ICHO1036
ICHO1037
ICHO1038
ICHO2012
ICHO2013
ICHO2014
ICHO2015
pMV206
pMV206
pMV206
pMV261
pMV261
pYUB415
pYUB415
pYUB415
pYUB415
Cloned S1 areaa (685769–689308 bp of M. bovis BCG genome)b
Cloned S2 areaa (696695–700844 bp of M. bovis BCG genome)b
Cloned S3 areaa (700476–702854 bp of M. bovis BCG genome)b
Cloned S4 area (BCG3753c gene)a (4109204–4110235 bp of M. bovis BCG genome)b
Cloned S5 area (BCG3770 gene)a (4126836–4129396 bp of M. bovis BCG genome)b
Cloned genome fragment of M. bovis BCG (686465–716464 bp)b
Cloned genome fragment of M. bovis BCG (674538–709074 bp)b
Cloned genome fragment of M. bovis BCG (4101265–4130915 bp)b
Cloned genome fragment of M. bovis BCG (686465–716464 bp)b
F: GGTACCGTTCGGTGAACAGCCCAAG
R: AAGCTTCGTTGTGCGGACATCACC
F: GGTACCAACGGGTGACCGTGAACTG
R: ATCGATTCGATGCGTCGGCAGTC
F: TCTAGACGTTTGGCCACCTGGTAGC
R: ATCGATCCGGGATGCTCCCTATTGC
F: AAGCTTTGCGCAGGGTGGAC
R: GTTAACGTCGTGTCGCGAGTTTC
F: AAGCTTACCATCCCGGAGCAAC
R: GTTAACTCATGCCGCGGACC
N/A
Direct cloning of genome fragment
N/A
Direct cloning of genome fragment
N/A
Direct cloning of genome fragment
N/A
Direct cloning of genome fragment
a
Name of area corresponds to Figure 4.
Coordinate of M. bovis BCG genome is based on the database of BCGList (http://genolist.pasteur.fr/BCGList).
b
were ligated to both arms of pYUB415. The mixture of ligations
were in vitro packaged with packaging mix of MaxPlax Lambda
Packaging (Epicentre), and the resulting recombinant cosmids
were transduced to E. coli HB101. The transformants of E. coli
HB101 were selected on LB agar plates containing carbenicillin.
Over 3 ꢀ 105 independent clones were pooled, and cosmids for
transformation of M. smegmatis were obtained by large-scale
DNA preparation by using a standard alkaline lysis method.
The generation of transformants of M. smegmatis with geno-
mic DNA library as previously described.16 Briefly, M. smegmatis
were grown at 37 °C as described above until the optical density
reached 0.8–1.0 at 600 nm. The cultures were centrifuged, and
the resulting pellets were washed with 10% glycerol twice and
re-suspended in the same solution (1/10th of the initial culture
volume). The cell suspensions were mixed with the gnomic
Comprehensive Microbial Resource in J. Craig Venter Institute
(http://cmr.tigr.org/cgi-bin/CMR/CmrHomePage.cgi).
4.10. Preparation of M. smegmatis over-expressing candidate
genes that confer resistance to nybomycin (1)
The candidate gene regions or genes (Fig. 4) that confer resis-
tance to nybomycin (1) were PCR amplified from the cosmid
pYUB415_2013 or _2014 by using the primer pairs as shown in
Table 3. PCR was performed using a program of 30 cycles of
94 °C for 15 s, 57 °C for 30 s, and 68 °C for 1 min/kb. Following
cloning into pCR2.1-TOPO (Life Technologies, Carlsbad CA) and
sequencing, the cloned PCR fragment was excised using the pri-
mer-introduced restriction sites and cloned into the mycobacterial
expression vector pMV261 with a hsp60 promoter and kanamycin-
resistant gene or promoter-less shuttle vector pMV206 containing
the hygromycin B-resistant gene. Description of plasmids and
name of transformants are shown in Table 3. M. smegmatis was
transformed with the constructed plasmids, and the transformants
were investigated susceptibility against nybomycin (1) using the
above-mentioned methods.
DNA library and electroporated (2500 V, 25
lF, 1000 X). The
resulting suspensions were incubated at 37 °C for 4 h and then
plated on Middlebrook 7H10 agar containing 50
hygromycin B.
lg/mL of
4.9. Isolation of nybomycin-resistant clones from M. smegmatis
transformed with the genomic DNA library and end sequencing
of cosmids
4.11. Isolation of spontaneous nybomycin-resistant strain
Nybomycin-resistant clones were screened from over the
M. smegmatis (1 ꢀ 107 CFU/mL) was incubated in Middlebrook
4 ꢀ 103 M. smegmatis transformed with the genomic DNA library
7H9 broth containing 5.0
l
g/mL nybomycin (1, 5ꢀ MIC) at 37 °C
by cultivating on the 7H10 agar containing 4.0
l
g/mL concentra-
for 3 days. The culture broth was plated on Middlebrook 7H10 agar
tion of nybomycin (1, 4ꢀ MIC). Subsequently, the resistant clones
against nybomycin (1) were grown in the 7H9 broth containing
hygromycin B, and the cosmids for end sequencing were isolated
using the standard alkaline lysis method. The cosmids extracted
from the nybomycin-resistant transformants were subjected to
end sequencing (MACROGEN Japan, Tokyo, Japan). The primers
P1 (50-GTACGCCACCGCCTGGTTC-30) and P2 (50-GTGCCACCTGA
CGTCTAAG-30), which were designed based on the sequence of
cosmid vector pYUB415, were used for end sequences of the cos-
mids. The obtained sequences were analyzed by BLAST search
using the database of BCGList (http://genolist.pasteur.fr/BCGList/),
containing 10 g/mL nybomycin (1) and incubated at 37 °C for
3 days. Strains showing resistant against nybomycin (1) were
picked up and incubated on Middlebrook 7H10 agar containing
10 lg/mL nybomycin (1) for further 3 days. The obtained strains
were used for the experiments as spontaneous mutants. The anal-
ysis of whole genome sequencing was done by Hokkaido System
Science Co., Ltd (Hokkaido, Japan) using Illumina MiSeq.
l
Acknowledgments
The authors are grateful to Drs. William R. Jacobs, Jr. and
Catherine Vilchèze (Albert Einstein College of Medicine, New
TubercuList
(http://genolist.pasteur.fr/TubercuList/),
and

M. Arai et al. / Bioorg. Med. Chem. 23 (2015) 3534–3541
3541
York, USA) for kindly providing the M. smegmatis mc2155 and M.
bovis BCG Pasteur strains, the pMV206, pMV261 and pYUB415 vec-
tors, and for their support concerning the genomic DNA library.
The authors also thank to Drs. Osamu Muraoka and Junji
Fujimori (Kinki University, Osaka, Japan) for supporting the analy-
sis using a scanning electron microscopy. This study was finan-
cially supported by assistance from the Hoansha Foundation, and
a Grant-in-Aid for Scientific Research B (22241053) from JSPS
(Japan) to M.A., and by assistance from the Platform for Drug
Discovery, Informatics, and Structural Life Science from MEXT
(Japan), and Japan (JSPS)-South Africa (NRF) Joint Research
Program to M.A. and M.K., and by a Grant-in-Aid for Scientific
Research on Innovative Areas (23102005) from MEXT to M.K.
4. Lim, A.; Eleuterio, M.; Hutter, B.; Murugasu-Oei, B.; Dick, T. J. Bacteriol. 1999,
181, 2252.
5. Dick, T.; Lee, B. H.; Murugasu-Oei, B. FEMS Microbiol. Lett. 1998, 163, 159.
6. Pruksakorn, P.; Arai, M.; Kotoku, N.; Vilchèze, C.; Baughn, A. D.; Moodley, P.;
Jacobs, W. R., Jr.; Kobayashi, M. Bioorg. Med. Chem. Lett. 2010, 20, 3658.
7. Yamano, Y.; Arai, M.; Kobayashi, M. Bioorg. Med. Chem. Lett. 2012, 22, 4877.
8. Arai, M.; Han, C.; Yamano, Y.; Setiawan, A.; Kobayashi, M. J. Nat. Med. 2014, 68,
372.
9. Strelitz, F.; Flon, H.; Asheshov, I. N. Proc. Natl. Acad. Sci. U.S.A. 1955, 41, 620.
10. Wayne, L. G.; Hayes, L. G. Infect. Immun. 1996, 64, 2062.
11. Rinehart, K. L., Jr.; Leadbetter, G.; Larson, R. A.; Forbis, R. M. J. Am. Chem. Soc.
1970, 92, 6994.
12. Kang, C. M.; Abbott, D. W.; Park, S. T.; Dascher, C. C.; Cantley, L. C.; Husson, R. N.
Genes Dev. 2005, 19, 1692.
13. Gomez, J. E.; Bishai, W. R. Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 8554.
14. Dziadek, J.; Rutherford, S. A.; Madiraju, M. V.; Atkinson, M. A. L.; Rajagopalan,
M. Microbiology 2003, 149, 1593.
15. Nonejuie, P.; Burkart, M.; Pogliano, K.; Pogliano, J. Proc. Natl. Acad. Sci. U.S.A.
2013, 110, 16169.
16. Arai, M.; Liu, L.; Fujimoto, T.; Setiawan, A.; Kobayashi, M. Mar. Drugs 2011, 9,
984.
Supplementary data
17. Pruksakorn, P.; Arai, M.; Liu, L.; Moodley, P.; Jacobs, W. R., Jr.; Kobayashi, M.
Biol. Pharm. Bull. 2011, 34, 1287.
18. Arai, M.; Yamano, Y.; Setiawan, A.; Kobayashi, M. ChemBioChem 2014, 15, 117.
19. Hiramatsu, K.; Igarashi, M.; Morimoto, Y.; Baba, T.; Umekita, M.; Akamatsu, Y.
Int. J. Antimicrob. Agents 2012, 39, 478.
20. Forbis, R. M.; Rinehart, K. L., Jr. J. Am. Chem. Soc. 1972, 95, 5003.
21. Abate, G.; Aseffa, A.; Selassie, A.; Goshu, S.; Fekade, B.; WoldeMeskal, D.;
Miörner, H. J. Clin. Microbiol. 2004, 42, 871.
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.bmc.2015.04.033.
References and notes
1. Idemyor, V. J. Natl Med. Assoc. 2007, 99, 1414.
2. Global Tuberculosis report 2014 World Health Organization: Geneva,
Switzerland. Available online: http://www.who.int/tb/publications/global_
report/en/. (Accessed on 22 December 2014).
22. Rustad, T. R.; Harrell, M. I.; Liao, R.; Sherman, D. R. PLoS ONE 2008, 3, e1502.
23. Connell, N. D. Methods Cell Biol. 1995, 45, 107.
24. Balasubramanian, V.; Pavelka, M. S., Jr.; Bardarov, S. S.; Martin, J.; Weisbrod, T.
R.; McAdam, R. A.; Bloom, B. R.; Jacobs, W. R., Jr. J. Bacteriol. 1996, 178, 273.
3. Wayne, L. G.; Sohaskey, C. D. Annu. Rev. Microbiol. 2001, 55, 139.