Inhibition of dengue virus by curcuminoids

Article abstract of DOI:10.1016/j.antiviral.2018.12.002

The dengue virus is considered to be a globally important human pathogen prevalent in tropical and subtropical regions of the world. According to a recent estimate, the disease burden due to DENV infections is ～390 million infections per year globally in ～100 countries including the southern US, Puerto Rico and Hawaii, resulting in nearly ～25,000 deaths mostly among children. Despite the significant morbidity and mortality that results from DENV infections, there is currently no effective chemotherapeutic treatment for DENV infections. We identified curcumin as an inhibitor of DENV2 NS2B/NS3protease in a previous high-throughput screening (HTS) campaign. We synthesized four analogues of curcumin (curcuminoids) and tested the in vitro protease inhibition activity and inhibition of replication by cell-based assays. The results revealed that curcumin is a weak inhibitor of the viral protease. However, the analogues exhibited more potent inhibition of DENV infectivity in plaque assays suggesting that the cellular pathway(s) required for viral replication and/or assembly are targeted by these compounds. Further analysis shows that inhibition of genes involved in lipid biosynthesis, and of actin polymerization by curcuminoids, are likely to be involved as their mode of action in DENV2-infected cells. Three of the curcumin derivatives possess good selectivity indices (SI) (>10) when compared to the parent curcumin.

Full text of DOI:10.1016/j.antiviral.2018.12.002

Accepted Manuscript
Inhibition of dengue virus by curcuminoids
Anuradha Balasubramanian, Rajendra Pilankatta, Tadahisa Teramoto, Ayyiliath M.
Sajith, Evaristus Nwulia, Amol Kulkarni, Radhakrishnan Padmanabhan
PII:
S0166-3542(18)30387-5
https://doi.org/10.1016/j.antiviral.2018.12.002
AVR 4426
DOI:
Reference:
To appear in: Antiviral Research
Received Date: 22 June 2018
Revised Date: 21 November 2018
Accepted Date: 2 December 2018
Please cite this article as: Balasubramanian, A., Pilankatta, R., Teramoto, T., Sajith, A.M., Nwulia, E.,
Kulkarni, A., Padmanabhan, R., Inhibition of dengue virus by curcuminoids, Antiviral Research (2019),
doi: https://doi.org/10.1016/j.antiviral.2018.12.002.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

Inhibition of Dengue Virus by Curcuminoids
ACCEPTED MANUSCRIPT
Anuradha Balasubramanian1, Rajendra Pilankatta1, Tadahisa Teramoto1, Ayyiliath M. Sajith3, Evaristus
Nwulia3, Amol Kulkarni*2 and Radhakrishnan Padmanabhan*1
1Department of Microbiology and Immunology, Georgetown University, Washington, D.C, USA
2Department of Pharmaceutical Sciences, College of Pharmacy, Howard University, Washington, D.C, USA
3Department of Psychiatry and Behavioral Sciences, College of Medicine, Howard University, Washington,
D.C, USA
Corresponding authors:
*Amol Kulkarni, Ph.D. (for chemical synthesis of curcuminoids; amol.kulkarni@howard.edu)
*Radhakrishnan Padmanabhan, Ph.D. (for dengue viral assays; rp55@georgetown.edu)
Department of Microbiology & Immunology, Georgetown University School of Medicine, Washington DC
USA; Tel 1-202-687-2092; Fax 1-202-687-1800

1
ACCEPTED MANUSCRIPT
Abstract
The dengue virus is considered to be a globally important human pathogen prevalent in tropical and
subtropical regions of the world. According to a recent estimate, the disease burden due to DENV
infections is ~390 million infections per year globally in ~100 countries including the southern US, Puerto
Rico and Hawaii, resulting in nearly ~25,000 deaths mostly among children. Despite the significant
morbidity and mortality that results from DENV infections, there is currently no effective chemotherapeutic
treatment for DENV infections. We identified curcumin as an inhibitor of DENV2 NS2B/NS3protease in a
previous high-throughput screening (HTS) campaign. We synthesized four analogues of curcumin
(curcuminoids) and tested the in vitro protease activity and inhibition of replication by cell-based assays.
The results revealed that curcumin is a weak inhibitor of the viral protease. However, the analogues
exhibited more potent inhibition of DENV infectivity in plaque assays suggesting that the cellular pathway(s)
required for viral replication and/or assembly are targeted by these compounds. Further analysis shows
that inhibition of genes involved in lipid biosynthesis, and of actin polymerization by curcuminoids, are likely
to be involved as their mode of action in DENV2-infected cells. Three of the curcumin derivatives possess
good selectivity indices (SI) (>10) when compared to the parent curcumin.

2
ACCEPTED MANUSCRIPT
1. Introduction:
Dengue virus (DENV) is a member of mosquito-borne flavivirus genus of Flaviviridae family which
consists of > 70 human pathogens causing considerable morbidity and mortality in tropical and subtropical
regions of the world (for reviews, see (Beasley, 2005; Gould and Solomon, 2008; Lindenbach et al., 2007)).
There are four serotypes of dengue virus (DENV1-4) that together cause 390 million infections annually
(Bhatt et al., 2013). DENV is primarily transmitted by the Aedes aegypti and Aedes albopictus mosquitos.
Currently, there is no FDA-approved vaccine or antiviral drug available for control or treatment of dengue
infections. Primary DENV infection by a single serotype causes self-limiting disease known as dengue fever
with symptoms including fever, headache, joint pain and a skin rash, whereas a secondary infection by
another serotype results in severe dengue disease through antibody dependent enhancement with
symptoms including thrombocytopenia, hemoconcentration due to capillary leak leading to hemorrhage in
internal organs and shock syndrome (Garcia et al., 2010; Halstead et al., 2005).
Flaviviruses have a single positive strand RNA genome flanked by highly structured 5′ and 3′
untranslated regions (UTRs) which play important roles in translation and replication of viral RNA
(Lindenbach et al., 2007). RNA encodes a single polyprotein that is cleaved by viral and host proteases to
produce three structural proteins (C, prM and E) and eight nonstructural proteins including the cleavage
product of NS4A (NS1, NS2A, NS2B, NS3, NS4A, NS4A-2K, NS4B and NS5) (for a review, (Padmanabhan
and Strongin, 2010)). Previous HTS campaign using purified DENV2 NS2B-NS3pro as a target and
subsequent cherry picks for validation by secondary assays identified curcumin as a potential hit that
inhibited the purified viral protease NS2B-NS3pro (unpublished results; see also (Balasubramanian et al.,
2016)). Subsequently, four curcuminoids were synthesized and characterized for their antiviral activity.
Here we report the antiviral activities of curcumin and the four analogues against purified DENV2
NS2B-NS3pro as well as in stable DENV2 BHK-21/Renilla luciferase reporter replicon expressing cells and
DENV2-infected BHK-21 cells. Our results indicate that curcumin and the four analogues were more potent

3
ACCEPTED MANUSCRIPT
in inhibition of viral replication and infectivity (plaque) assays than their inhibition of protease activity in vitro.
The cyclopentanone analogue of curcumin (CC4) was the most active and less toxic compared to
curcumin. These results suggested that curcumin and analogues might target cellular pathways required for
viral replication. A previous study reported that cellular pathways, actin polymerization and fatty acid
biosynthesis, are involved in endoplasmic membrane expansion and formation of viral replication factories
in the infected cells (Heaton and Randall, 2011b) (Padilla et al., 2014). Curcumin inhibits hepatitis C virus
replication via suppression of the transcription factor, AKt- Sterol regulatory element binding protein -1
(SREBP-1) (Kim et al., 2010). Since SREBP-1 is required for lipid biosynthesis and its downregulation
affects downstream genes such as fatty acid synthase (FASN) and acetyl CoA carboxylase (ACC), in this
study, we examined the role of curcuminoids on FASN and ACC gene expression by qRT-PCR in DENV2-
infected cells. Our results indicate that the curcuminoids inhibit lipogenesis and thereby inhibiting DENV
replication. The curcuminoids tested in this study also lead to actin depolymerization similar to curcumin
(Dhar et al., 2015) in DENV2-infected cells. Actin plays important roles in entry, viral replication and
assembly.
2. Materials and methods:
2.1. Curcuminoids:
Curcumin was purchased from Alfa Aesar (part of Thermo Fisher, Inc) which contained 95% total
curcuminoid from turmeric, (botanical name, Rhizome) (CC1; Table 1; CAS number 458-37-7; Stock No.
B21573-09). Bisdemethoxycurcumin (CC2; Table 1) was purchased from TCI America (Cat No B3347).
Derivatives CC3, CC4 and CC5 (Table 1) were synthesized using the protocol described in Section 2.2.
2.2. General procedure for the chemical synthesis of curcuminoids CC3, CC4, and CC5

4
ACCEPTED MANUSCRIPT
The chemical synthesis of curcuminoids was accomplished by a slight modification of the previously
reported procedure (Du et al., 2006). Glacial acetic acid (50 mL) was saturated with hydrogen chloride gas
for 1 h at 0 °C. A mixture of vanillin (3.04 g, 20 mmole, 2.0 equivalent) and the appropriate ketone (acetone,
580 mg, for CC3, cyclopentanone, 841 mg, for CC4, and cyclohexanone, 981 mg, for CC5, each containing
10 mmole (1.0 equivalent) was slowly added. The reaction mixture was stirred at 0 °C for 15 min, it wa s
slowly brought to ambient temperature and stirred at ambient temperature for 48 h. The reaction mixture
was poured into ice-cold water (200 mL). The precipitate was filtered using vacuum filtration, washed with
ice-cold water (200 mL) and dried. The crude product was purified using silica gel flash column
chromatography. Gradient elution (from 30% to 60% ethyl acetate in hexanes) resulted in the isolation of
the desired curcuminoids as bright yellow solids in yields of 1.59 g (59%), 3.02 g (79%), 3.24 g (82%) for
1
CC3, CC4, and CC5 (for more details on synthesis refer Supporting information). H-, 13C-NMR and IR
spectra of CC3, CC4, and CC5 (Fig. S1-S6) were consistent with the proposed structure and previously
reported literature. The spectroscopic as well as chromatographic analysis revealed that the synthetic
curcuminoids were >95% pure.
2.3. In Vitro Protease Assay:
The DENV2 NS2B-NS3pro expression plasmid encoding the protease precursor used in this study
contains the hydrophilic domain of NS2B cofactor (48 amino acids) and the NS3pro domain (185 residues)
(Yon et al., 2005). The cloning, expression and purification of the viral NS2B-NS3pro were reported
previously (Lai et al., 2014; Mueller et al., 2007; Yusof et al., 2000). In this study, we evaluated the efficacy
of curcumin and four curcuminoids. Standard reaction mixture (100 µl) containing 200 mM Tris·HCl (pH
9.5), 6 mM NaCl, 30 % glycerol, 25 nM DENV2 protease, 10 µM or 25 µM inhibitors in DMSO (final DMSO
concentration 1%) were incubated 15 min at 25 °C fo llowed by addition of 25 µM protease substrate (Bz)-
Nle-Lys-Arg-Arg-AMC. The amount of AMC (7-Amino-4-methylcoumarin) released from the peptide

5
ACCEPTED MANUSCRIPT
substrate was quantified by measuring the fluorescence (λex.=380 nm, λem.=460 nm) in a monochromater
based spectrofluorometer (SpectroMax Gemini EM Microplate reader from Molecular Devices). A potent
serine protease inhibitor, aprotinin, was used as a positive control and1% DMSO (no inhibitor; 100%
activity) served as a negative control. For determination of IC50 values, standard protease assays were
performed with in the presence of different inhibitor concentrations (1.56, 3.12, 6.25, 12.5, 25, 50, 75, 100,
200 µM). The percent activities after 30 min in the presence of various inhibitor concentrations were plotted
using the GraphPad Prism v5.04 using the four-parameter nonlinear regression analysis (Hill slope
method).
2.4. BHK/DENV2 Replicon Assay:
The replicon-based assay covers the stages of viral life cycle including viral translation, viral
replication consisting of both plus- and minus-sense RNA synthesis. The assay does not include stages
such as viral entry, assembly, and maturation due to the absence of genes encoding the structural proteins,
C, prM, and E, which are replaced by Renilla luciferase (Rluc) reporter gene (Alvarez et al., 2005;
Boonyasuppayakorn et al., 2014; Ng et al., 2007). This assay uses a Baby Hamster Kidney (BHK) cell line
that stably expresses a DENV2 replicon with Rluc reporter gene (Boonyasuppayakorn et al., 2014). The
replicating RNA can be quantified by measuring the luciferase activity using a kit (Promega) and a
luminometer (Berthold Technologies., LB-960) (Boonyasuppayakorn et al., 2014) and the viral RNA can be
quantified by quantitative reverse transcriptase-PCR (qRT-PCR).
BHK-21/DENV2 replicon-expressing cells were maintained in Minimal Essential Medium (MEM)
supplemented with 10% fetal bovine serum (FBS), 100 I.U./ml penicillin, 100 µg/ml streptomycin (Penicillin
+ Streptomycin), and 300 µg/ml G418 (Fisher Scientific, Pittsburgh, PA). Briefly, BHK-21/DENV2 replicon
expressing cells (~5 x103 in 100 µl) were seeded onto 96-well plates and incubated at 37oC for 24 h in a

6
ACCEPTED MANUSCRIPT
humidified incubator with 5% CO2. Curcuminoids (CC1- CC5) were added at 0, 0.78, 1.56, 3.12, 6.25, 12.5,
25, 50,100 and 200 µM in 1% DMSO in triplicate wells. Cells were incubated at 37 °C for 24 h, washed,
lysed, and Rluc activities were measured as described (Boonyasuppayakorn et al., 2014; Manzano et al.,
2011). The results were confirmed by two independent experiments. The Rluc activities were reported as
percent inhibition relative to 1% DMSO (0% inhibition) and mycophenolic acid (100% inhibition) as controls
(Diamond et al., 2002; Takhampunya et al., 2006).
2.5. Cell-based Cytotoxicity Assay:
The viability of cells in the presence of varying concentration of curcuminoids was measured using
the Cell Counting Kit-8 (Dojindo, Rockville, MD) and the concentration at which the cell viability was
reduced by 50% (CC50) was determined. The assay is based on a highly soluble, non-toxic tetrazolium salt
(WST-8), which is reduced by dehydrogenase activities in cells to give a yellow-colored formazan dye. Briefly,
BHK-21 (5× 103) cells (100 µL) in wells of a 96-well plates were treated with varying concentrations (200,
100, 50, 25, 12.5, 6.25, 3.12, 1.56 and 0.78 µM) of curcuminoids (CC1-CC5). After incubation for ~24 h at
37° C under 5 % CO 2, 10 µL of 1X CCK-8 solution was directly added to all the wells. The plates were
incubated further at 37° C under 5 % CO 2 for 4 h and the absorbance at 450 nm was read using a
spectrophotometer (Molecular Devices). The results were confirmed by two independent experiments. CC50
values were calculated using the GraphPad Prism v5 software. Selectivity index (SI) values were calculated
as the ratio of CC50/EC50.
2.6. Plaque assays
Briefly, BHK-21 cells (1 x 105) in MEM-α medium with 10 % FBS were seeded onto each well of 24-
well cell culture plates. After the cells were about 80% confluent, they were infected with DENV2 in MEM-α
medium supplemented with 2% FBS (multiplicity of infection, MOI of 1 for 1 h. After infection, OPTI-MEM
with various drug concentrations (0.07-10 ꢀΜ) was added to the wells. BHK-21 cells treated with only 1%

7
ACCEPTED MANUSCRIPT
DMSO served as negative control (100% infectivity) and cells treated with 1 µM mycophenolic acid (0%
infectivity) served as the positive control. After 24 h the supernatants were collected and analyzed by
plaque assays as described below.
LLC-MK2 cells, plated (1x 105 cells/ml/ well) in 24-well plates, were incubated at 37 °C until
reaching 90% confluence. Supernatants collected as described above were serially diluted in OPTI-MEM
and used for infecting duplicate wells for 2 h. Cells were overlaid with l X DMEM supplemented with 10 %
FBS containing 1.5% carboxymethyl cellulose (CMC) and were incubated for 7 days at 37°C under 5 %
CO2. Plaques were visually examined after fixing the cells with 4% paraformaldehyde and staining with 1%
crystal violet for 30 min. The number of plaque forming units (PFU) per ml was determined
(Balasubramanian et al., 2016; Boonyasuppayakorn et al., 2014). The EC50(PFU) was calculated from two
independent experiments.
2.7. qRT-PCR
Human hepatocarcinoma (Huh 7.5) cells were infected with DENV2 (MOI of 1) and treated with 5
µM of a curcuminoid (CC1-CC5) for 24 h at 37° C und er 5% CO2. Uninfected Huh 7.5 cells were also
treated similarly with 5 µM curcuminoids. The total RNAs were extracted using TRIzol reagent (Life
technologies) according to the manufacturer’s protocol. DMSO (1%)- treated cells served as negative
control. RNA concentrations were determined using BioSpec-nano (Shimadzu Corporation, Japan).
Reverse transcription reaction was carried out in 20 µL containing 1µg RNA. Each qRT-PCR carried out in
duplicate contained 12.5ꢁꢀL of the SYBR Green Master Mix reagent (iQ supermix-Biorad), 0.5ꢁꢀL of primers
(20ꢁnM) specifically designed to anneal to the in vitro transcripts (2ꢁꢀL) from DENV2 NS5 (Manzano et al.,
2011), human fatty acid synthase (FASN) and human acetyl-CoA carboxylase (ACC) cDNAs in 9.5ꢁꢀL of
diethylpyrocarbonate-treated water to a final volume of 25ꢁꢀL. The PCR primers used for human ACC were:
forward, CTGTTGGCTCAGATACACTC, and reverse, GCCACAGTGAAATCTCGTT. The PCR primers for

8
ACCEPTED MANUSCRIPT
human FASN were: forward, GTGGGAAGGTGTACCAGTG, and reverse, GGATGCCCTGGAAATGAG.
The amplification protocol consisted of the following steps: 95°C for 2 ꢁmin, followed by 50 cycles at 95°C for
10 sec, 50°C for 30 sec and 72°C for 30 sec and the melt curve analysis was carried out as described
(Balasubramanian et al., 2016; Boonyasuppayakorn et al., 2014). The glyceraldehyde-3-phosphate
dehydrogenase gene (GAPDH) was used as a reference control. The primer sequences for human GAPDH
were: forward, AGGGCTGCTTTTAACTCTGGT and reverse, CCCCACTTGATTTTGGAGGGA.
2.7. Oil Red O staining of lipid droplets
BHK-21 cells were maintained in MEM containing 10% FBS. The cells were infected with DENV2 at
a MOI of 1 for an hour followed by incubation with MEM containing 0.1 mM oleic acid-BSA (03008, Millipore
Sigma) and various concentrations of curcumin for 24 h. Cells treated with 1% DMSO were used as
negative controls. The cultures were washed 3 times with phosphate-buffered saline (PBS) and fixed with
4% paraformaldehyde for 10 min. Oil Red O (ORO) working solution was made by mixing 2.4 ml of ORO (
0.3% in isopropanol) with 1.6 ml of distilled water and it was filtered (Cui et al., 2010). Cells were incubated
with 0.5 mL of the ORO for 15 min, the solution was removed and rinsed three times with PBS. The images
were photographed at 40× magnification. The ORO was extracted from the stained cells using 500 µl of
100% isopropanol from each well, and two aliquots of 200 µl were transferred to black-walled 96-well
microtiter plates. The absorbance of the dye was measured at 405 nm using a plate reader. All tests were
performed in duplicate and the means were calculated (Cui et al., 2010),
2.8. Actin Staining with Phalloidin:
BHK-21 cells were grown in MEM containing 10% FBS. Cells were seeded in 24-well plates (5 X
104/well) and incubated in a humidified CO2 incubator for 24 h. Cells were infected with DENV2 at a MOI of
1 and then treated with 5 µM of curcuminoids dissolved in DMSO (1%) for 24 h. DMSO (1%) alone treated

9
ACCEPTED MANUSCRIPT
cells were used as controls. The cultures were washed 3 times with PBS and were fixed with 4%
formaldehyde for 10 min. Alexa Fluor 488 Phalloidin (Thermo Fischer Scientific) was used to stain the F-
actin and the nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI). The stained cells were
visualized under a fluorescent microscope and images were photographed.
3. Results and Discussion:
Curcumin (1,7-bis(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione) is derived from the spice
turmeric, Curcuma longa, which is a member of the ginger family and it is a yellow- colored compound
primarily found in the roots of turmeric plant (Goel et al., 2008; Jacob et al., 2007; Moghadamtousi et al.,
2014). Curcumin is reported to contain various medicinal properties some of which are against cancer,
diabetes, microbial infections including those caused by viruses. Curcumin has already been shown to be
effective against several enveloped viruses (such as HIV, influenza A virus, herpes simplex virus, hepatitis
B virus, Japanese encephalitis virus and DENV) (Chen et al., 2013) and on non-enveloped viruses,
coxsackievirus B3 and enterovirus 71 (Chen et al., 2013; Qin et al., 2014). Recently curcumin has also
been shown to inhibit Zika and Chikungunya viruses by inhibiting cell binding (Mounce et al., 2017).
Curcumin is known to be an inhibitor of DENV2 with pre-treatment or co-treatment with the virus but failed
to inhibit when added post entry (Chen et al., 2013). However, it exhibits poor stability at the plasma pH
and undergoes a facile retro-aldol decomposition into ferulic acid (Equation 1) (Anand et al., 2007; Wang et
al., 1997). Conversion of the β-diketone moiety in curcumin into monoketone analogues is known to
minimize retro-aldol decomposition. We designed curcuminoids CC3, CC4, and CC5 in order to improve
their stability at plasma pH.
Equation 1

10
ACCEPTED MANUSCRIPT
Using an in vitro protease assay, we confirmed that curcumin and its analogues show modest inhibition
of protease activity. The IC50 values for the curcuminoids mean ± SD of two replicates were as follows:
66.01 ± 13.12 (CC1), 36.23 ± 9.67 (CC2), 39.17 ± 6.69 (CC3), 43.88 ± 10.14 (CC4) and 60.98 ± 8.7 (CC5)
(Fig 1A), consistent with the finding of the parent compound as an HTS hit. The results show that the
inhibitory activity of the parent compound, CC1, is less compared to CC2, CC3, CC4 and CC5 analogues.
We analyzed the potency of the curcuminoids using the DENV2 Rluc reporter replicon-based assay as
described under Materials and Methods. The EC50 values for the curcuminoids mean ± SD of three
replicates each from two independent experiments were as follows: 13.91 ± 2.08 (CC1), 26.45 ± 3.67
(CC2), 8.61 ± 0.79 (CC3), 29.25 ± 4.46 (CC4) and 8.07 ± 1.52 (CC5) (Fig 1B). The CC50 values of the
curcuminoids mean ± SD of three replicates each from two independent experiments were: 49.01 ± 8.24
(CC1), 43.37 ± 5.19 (CC2), 32.34 ± 4.72 (CC3), 87.40 ± 9.03 (CC4) and 25.50 ± 2.64 (CC5) (Fig 1C). Thus,
in replicon assays, curcuminoids show only modest inhibition of viral replication.
Next, we analyzed the ability of the curcuminoids to inhibit DENV2 infectivity in the formation of
infectious particles measured by plaque assays as the concentrations causing 50% reduction in PFU
(EC50(PFU)). The EC50(PFU) of curcuminoids were: 13.95 ± 2.57 (CC1), 6.49 ± 0.33 (CC2), 2.68 ± 0.51 (CC3),
5.37 ± 0.49 (CC4) and 2.34 ± 0.22 (CC5). All analogues showed greater inhibition in formation of infectious
particles as determined by plaque assays when compared to native curcumin. But only one analogue, CC4,
was less toxic than native curcumin. The selectivity indices (SI) were greater than 10 for three analogues
(Fig 2A, Table 2). Next, we analysed the RNA copy number by qRT-PCR using RNAs isolated from control
DENV2 infected cells in the presence of 1% DMSO alone, and DENV2-infected and curcuminoid (5 µM)-
treated cells. The results indicated that in the drug-treated and DENV2-infected cells, the viral RNA copy

11
ACCEPTED MANUSCRIPT
numbers were reduced when compared to DENV2-infected control in the presence of 1% DMSO alone (Fig
2B).
These results, taken together, suggested that curcuminoids inhibit DENV by targeting a host pathway
essential for viral life cycle. Previous studies indicated that curcumin has broad spectrum antiviral activities
against both RNA and DNA viruses targeting diverse pathways. For example, in one study, curcumin was
shown to inhibit the hepatitis C virus entry of all genotypes (Barbosa et al., 2015) by affecting the
membrane fluidity, virus binding and fusion. However, it had no effect on RNA replication. In this study, we
sought to examine whether curcumin and its analogues exerted their antiviral activity through key step(s) in
lipid biosynthesis and metabolism. Several studies previously indicated that HCV and DENV replication and
assembly are intimately linked to lipid metabolism (Heaton and Randall, 2010, 2011b). We analyzed the
gene expression of acetyl-CoA carboxylase (ACC) and fatty acid synthase (FASN) in DENV2-infected and
curcuminoids-treated or untreated BHK-21 cells. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
gene was used as a reference gene (Fig 3). The inhibition of gene expression of ACC and FASN was
shown as fold reduction of the control in the absence of curcuminoid treatment. The reduction of DENV2
titers corresponded to the reduction in FASN and ACC. Uninfected control cells showed similar reduction in
ACC and FASN (Fig S7 & S8).
Flavivirus replication and assembly into immature virus particles occur in the membrane compartments
of ER which undergo proliferation in infected cells to meet the demand for viral replication and assembly.
Lipid droplets (LD), ER-derived lipid-rich cellular organelle, play an important role in storage of excess fatty
acids and hydrolysis of neutral lipids for membrane formation and maintenance.
LD’s have been best described in adipocytes, they are present in all cell types and their formation can
be induced by oleic acid treatment (Pol et al., 2004). Oleic acid has been shown to enhance the effects of
DENV2 virus infection (Ramphan et al., 2017). Here we performed LD staining of DENV2 infected cells

12
ACCEPTED MANUSCRIPT
treated with oleic acid and with curcuminoids and showed that the curcuminoids were able to suppress the
oleic acid-induced LD (Fig 4), the results from two independent experiments were plotted and were found to
be statistically significant (pValue < 0.05, Turkey’s test). The LD staining was quantified as described under
Materials and Methods and results indicated that curcumin affected LD levels in DENV- infected cells (Fig
4). Curcumin has also been previously shown to suppress FASN expression in adipocytes (Zhao et al.,
2011) and reduce the oleic acid-induced lipid accumulation in hepatocytes (Kang et al., 2013).
Flavivirus infection influences the host cell lipids profoundly. Results from lipidomic analysis of
membrane fractions associated with DENV replication revealed that 85% of lipids were significantly
modified as compared to uninfected control (Perera et al., 2012). DENV infection is highly sensitive to block
in the fatty acid synthesis through inhibition of FASN (Heaton et al., 2010). The inhibition of key enzymes in
cholesterol synthesis pathway mevalonate diphospho decarboxylase, HMG-CoA synthase and squalene
synthetase interfered with DENV replication (Rothwell et al., 2009) indicating the importance of cholesterol
in DENV infection. DENV capsid has been previously shown to interact with lipid droplets (Carvalho et al.,
2012). DENV virus infection triggers autophagy which release free fatty acids required to maintain high
intracellular ATP favoring viral replication (Heaton and Randall, 2010). Host cell lipids have been found to
regulate viral entry into cell and replication (Heaton and Randall, 2011a, b; Mazzon and Mercer, 2014).
Curcumin has been demonstrated to reduce lipogenesis in high-fat diet mouse model through regulating
SREBP pathway (Ding et al., 2016). Here we show that curcuminoids similarly downregulate the
lipogenesis which could affect DENV infection.
Previous studies reported that curcumin alters the actin cytoskeleton and causes disorganization of
actin microfilaments concomitant with apoptosis of treated cells (Padilla et al., 2014). DENV have been
shown to have close interaction with cytoskeleton elements in the replication cycle (Foo and Chee, 2015;
Jitoboam et al., 2016; Kanlaya et al., 2009). Actin filament has been shown to contribute in the DENV2

13
ACCEPTED MANUSCRIPT
entry via interaction with DENV E protein (Kanlaya et al., 2009; Yang et al., 2013). A reduction in viral
replication of DENV and WNV was also observed by blocking the actin function (Ang et al., 2010; Colpitts
et al., 2011). Native curcumin has been shown to inhibit actin polymerization with an IC50 of 16 µM (Dhar
et al., 2015) in DENV2-infected cells. To test if the curcuminoids caused actin disorganization, phalloidin
staining method was used to image F-actin (Fig 5) and the results indicate that the curcuminoids caused
actin disorganization similar to the parent curcumin in DENV2 infected cells. No significant actin
disorganization was observed in mock infected and curcuminoid treated cells (Fig. S9)
Thus, we conclude that curcuminoids exhibit their anti-viral activities through a variety of ways on the
host cells, but with modest effect in DENV protease. Modulation of host actin and lipids may be involved in
regulating the viral binding and entry. Recent studies on DENV mouse models indicated that curcumin
treatment reduced the DENV viremia effectively (Ichsyani et al., 2017) indicating that these analogues
might be promising in antiviral therapy against DENV.
Acknowledgments
This work was supported in whole or in part by National Institutes of Health grants R21AI109185, (to R.P.),
and Raman fellowship from University Grants Commission, Govt of India, to R. Pilankatta. This project has
been funded in part with Federal funds (UL1TR000101, previously UL1RR031975) from the National
Center for Advancing Translational Sciences, National Institutes of Health, through the Georgetown-
Howard Universities Clinical and Translational Science Awards Program (CTSA), a trademark of DHHS,
part of the Roadmap Initiative, “Re-Engineering the Clinical Research Enterprise” Center for AIDS
Research (D , District of Columbia C CFAR; AI117970) and Research Centers in Minority Institutions
(RCMI), Howard University.
Figure Legends.

14
ACCEPTED MANUSCRIPT
Figure 1. Inhibition of DENV2 replicon replication by curcuminoids (A) BHK-21/DENV2 replicon expressing
cells (~5 x103 in 100 µl) were seeded onto 96-well plates and incubated at 37oC for 24 h in a humidified
incubator with 5% CO2. Compounds were added at 0, 0.78, 1.56, 3.12, 6.25, 12.5, 25, 50,100 and 200 µM
in 1% DMSO in triplicate wells. Cells were incubated at 37 °C for 24 h, washed, lysed, and Rluc activi ties
were measured. The results were confirmed by two independent experiments. (B) Cytotoxicity was
measured in the same replicon expressing cells treated with the various concentrations of compounds at 24
h using the Cell Counting Kit -8 following the manufacturer’s instructions.
Figure 2. Inhibition of DENV2 replication analyzed by plaque assays and qRT-PCR. (A) EC50(PFU) values for
inhibition of DENV2 infectivity by curcuminoids. BHK-21 cells were infected with DENV2 (MOI, of 1) and
treated with varying concentrations of compounds. Incubation was done at 37 °C and the supernatants
were collected at 48 h. The virus titers were determined by plaque assays using LLC- MK2 cells. EC50
values were calculated using GraphPad Prism v5 software. (B) qRT-PCR was performed as described in
the Materials and Methods. The fold reduction of viral RNA copy number in DENV2-infected and drug-
treated cells as compared to control DENV2-infected cells was determined.
Figure 3. qRT-PCR to evaluate the effect of curcuminoids on lipogenesis: (A) qRT-PCR was performed as
described in the Materials and Methods. The fold reduction of acetyl-CoA carboxylase (ACC) mRNA copy
number in DENV2-infected and drug-treated cells versus the control DENV2-infected cells was determined.
(B). The fold reduction of fatty acid synthase (FASN) mRNA copy number in DENV2-infected and drug -
treated cells versus the control DENV2 infected cells was determined.
Figure 4. LD staining using Oil Red O (ORO). ORO staining protocol described under Materials and
Methods was followed. The paraformaldehyde (4%)-fixed cells were stained with ORO, followed by DAPI,
and were visualized by fluorescent microscopy. (A) Control oleic acid-treated cells; (B-F): 5 µM curcumioids
(CC1- CC5)-treated cells; (G) Quantification of LD after extraction by absorbance at 405 nm.

15
ACCEPTED MANUSCRIPT
Figure 5. Actin staining with Alexa Fluor 488 Phalloidin. Actin staining using Alexa Fluor 488 Phalloidin and
DAPI staining were performed as described under Materials and Methods and visualized under fluorescent
microscope. (A): Control DMSO treated cells; (B-F): 5 µM Curcuminoid (CC1- CC5)-treated cells.
References
Alvarez, D.E., De Lella Ezcurra, A.L., Fucito, S., Gamarnik, A.V., 2005. Role of RNA structures present at the 3'UTR of
dengue virus on translation, RNA synthesis, and viral replication. Virology 339, 200-212.
Anand, P., Kunnumakkara, A.B., Newman, R.A., Aggarwal, B.B., 2007. Bioavailability of curcumin: problems and
promises. Molecular pharmaceutics 4, 807-818.
Ang, F., Wong, A.P., Ng, M.M., Chu, J.J., 2010. Small interference RNA profiling reveals the essential role of human
membrane trafficking genes in mediating the infectious entry of dengue virus. Virology journal 7, 24.
Balasubramanian, A., Manzano, M., Teramoto, T., Pilankatta, R., Padmanabhan, R., 2016. High-throughput screening
for the identification of small-molecule inhibitors of the flaviviral protease. Antiviral research 134, 6-16.
Barbosa, A.D., Savage, D.B., Siniossoglou, S., 2015. Lipid droplet-organelle interactions: emerging roles in lipid
metabolism. Current opinion in cell biology 35, 91-97.
Beasley, D.W., 2005. Recent advances in the molecular biology of west nile virus. Curr Mol Med 5, 835-850.
Bhatt, S., Gething, P.W., Brady, O.J., Messina, J.P., Farlow, A.W., Moyes, C.L., Drake, J.M., Brownstein, J.S., Hoen,
A.G., Sankoh, O., Myers, M.F., George, D.B., Jaenisch, T., Wint, G.R., Simmons, C.P., Scott, T.W., Farrar, J.J., Hay, S.I.,
2013. The global distribution and burden of dengue. Nature 496, 504-507.
Boonyasuppayakorn, S., Reichert, E.D., Manzano, M., Nagarajan, K., Padmanabhan, R., 2014. Amodiaquine, an
antimalarial drug, inhibits dengue virus type 2 replication and infectivity. Antiviral research 106, 125-134.
Carvalho, F.A., Carneiro, F.A., Martins, I.C., Assuncao-Miranda, I., Faustino, A.F., Pereira, R.M., Bozza, P.T., Castanho,
M.A., Mohana-Borges, R., Da Poian, A.T., Santos, N.C., 2012. Dengue virus capsid protein binding to hepatic lipid
droplets (LD) is potassium ion dependent and is mediated by LD surface proteins. Journal of virology 86, 2096-2108.
Chen, T.Y., Chen, D.Y., Wen, H.W., Ou, J.L., Chiou, S.S., Chen, J.M., Wong, M.L., Hsu, W.L., 2013. Inhibition of
enveloped viruses infectivity by curcumin. PloS one 8, e62482.
Colpitts, T.M., Cox, J., Nguyen, A., Feitosa, F., Krishnan, M.N., Fikrig, E., 2011. Use of a tandem affinity purification
assay to detect interactions between West Nile and dengue viral proteins and proteins of the mosquito vector.
Virology 417, 179-187.
Cui, W., Chen, S.L., Hu, K.Q., 2010. Quantification and mechanisms of oleic acid-induced steatosis in HepG2 cells.
American journal of translational research 2, 95-104.
Dhar, G., Chakravarty, D., Hazra, J., Dhar, J., Poddar, A., Pal, M., Chakrabarti, P., Surolia, A., Bhattacharyya, B., 2015.
Actin-curcumin interaction: insights into the mechanism of actin polymerization inhibition. Biochemistry 54, 1132-
1143.

16
ACCEPTED MANUSCRIPT
Diamond, M.S., Zachariah, M., Harris, E., 2002. Mycophenolic acid inhibits dengue virus infection by preventing
replication of viral RNA. Virology 304, 211-221.
Ding, L., Li, J., Song, B., Xiao, X., Zhang, B., Qi, M., Huang, W., Yang, L., Wang, Z., 2016. Curcumin rescues high fat diet-
induced obesity and insulin sensitivity in mice through regulating SREBP pathway. Toxicology and applied
pharmacology 304, 99-109.
Du, Z.Y., Liu, R.R., Shao, W.Y., Mao, X.P., Ma, L., Gu, L.Q., Huang, Z.S., Chan, A.S., 2006. Alpha-glucosidase inhibition
of natural curcuminoids and curcumin analogs. European journal of medicinal chemistry 41, 213-218.
Foo, K.Y., Chee, H.-Y., 2015. Interaction between Flavivirus and Cytoskeleton during Virus Replication. BioMed
research international 2015, 427814.
Garcia, G., Sierra, B., Perez, A.B., Aguirre, E., Rosado, I., Gonzalez, N., Izquierdo, A., Pupo, M., Danay Diaz, D.R.,
Sanchez, L., Marcheco, B., Hirayama, K., Guzman, M.G., 2010. Asymptomatic dengue infection in a Cuban population
confirms the protective role of the RR variant of the FcgammaRIIa polymorphism. The American journal of tropical
medicine and hygiene 82, 1153-1156.
Goel, A., Kunnumakkara, A.B., Aggarwal, B.B., 2008. Curcumin as "Curecumin": from kitchen to clinic. Biochemical
pharmacology 75, 787-809.
Gould, E.A., Solomon, T., 2008. Pathogenic flaviviruses. Lancet 371, 500-509.
Halstead, S.B., Heinz, F.X., Barrett, A.D., Roehrig, J.T., 2005. Dengue virus: molecular basis of cell entry and
pathogenesis, 25-27 June 2003, Vienna, Austria. Vaccine 23, 849-856.
Heaton, N.S., Perera, R., Berger, K.L., Khadka, S., Lacount, D.J., Kuhn, R.J., Randall, G., 2010. Dengue virus
nonstructural protein 3 redistributes fatty acid synthase to sites of viral replication and increases cellular fatty acid
synthesis. Proceedings of the National Academy of Sciences of the United States of America 107, 17345-17350.
Heaton, N.S., Randall, G., 2010. Dengue virus-induced autophagy regulates lipid metabolism. Cell host & microbe 8,
422-432.
Heaton, N.S., Randall, G., 2011a. Dengue virus and autophagy. Viruses 3, 1332-1341.
Heaton, N.S., Randall, G., 2011b. Multifaceted roles for lipids in viral infection. Trends in microbiology 19, 368-375.
Ichsyani, M., Ridhanya, A., Risanti, M., Desti, H., Ceria, R., Putri, D.H., Sudiro, T.M., Dewi, B.E., 2017. Antiviral effects
of Curcuma longa L. against dengue virus in vitro and in vivo. IOP Conference Series: Earth and Environmental
Science 101, 012005.
Jacob, A., Wu, R., Zhou, M., Wang, P., 2007. Mechanism of the Anti-inflammatory Effect of Curcumin: PPAR-gamma
Activation. PPAR research 2007, 89369.
Jitoboam, K., Phaonakrop, N., Libsittikul, S., Thepparit, C., Roytrakul, S., Smith, D.R., 2016. Actin Interacts with
Dengue Virus 2 and 4 Envelope Proteins. PloS one 11, e0151951.
Kang, O.H., Kim, S.B., Seo, Y.S., Joung, D.K., Mun, S.H., Choi, J.G., Lee, Y.M., Kang, D.G., Lee, H.S., Kwon, D.Y., 2013.
Curcumin decreases oleic acid-induced lipid accumulation via AMPK phosphorylation in hepatocarcinoma cells.
European review for medical and pharmacological sciences 17, 2578-2586.
Kanlaya, R., Pattanakitsakul, S.N., Sinchaikul, S., Chen, S.T., Thongboonkerd, V., 2009. Alterations in actin cytoskeletal
assembly and junctional protein complexes in human endothelial cells induced by dengue virus infection and
mimicry of leukocyte transendothelial migration. Journal of proteome research 8, 2551-2562.
Kim, K., Kim, K.H., Kim, H.Y., Cho, H.K., Sakamoto, N., Cheong, J., 2010. Curcumin inhibits hepatitis C virus replication
via suppressing the Akt-SREBP-1 pathway. FEBS letters 584, 707-712.
Lai, H., Teramoto, T., Padmanabhan, R., 2014. Construction of dengue virus protease expression plasmid and in vitro
protease assay for screening antiviral inhibitors. Methods Mol Biol 1138, 345-360.
Lindenbach, D., Thiel, H.J., Rice, C., 2007. Flaviviridae: The viruses and their replication, in: Knipe, D.M., Howley, P.M.
(Eds.), Field's Virology, 5 ed. Lippincott-Raven Publishers, Philadelphia, pp. 1101-1152.
Manzano, M., Reichert, E.D., Polo, S., Falgout, B., Kasprzak, W., Shapiro, B.A., Padmanabhan, R., 2011. Identification
of cis-acting elements in the 3'-untranslated region of the dengue virus type 2 RNA that modulate translation and
replication. The Journal of biological chemistry 286, 22521-22534.

17
ACCEPTED MANUSCRIPT
Mazzon, M., Mercer, J., 2014. Lipid interactions during virus entry and infection. Cellular microbiology 16, 1493-
1502.
Moghadamtousi, S.Z., Kadir, H.A., Hassandarvish, P., Tajik, H., Abubakar, S., Zandi, K., 2014. A review on antibacterial,
antiviral, and antifungal activity of curcumin. BioMed research international 2014, 186864.
Mounce, B.C., Cesaro, T., Carrau, L., Vallet, T., Vignuzzi, M., 2017. Curcumin inhibits Zika and chikungunya virus
infection by inhibiting cell binding. Antiviral research 142, 148-157.
Mueller, N.H., Yon, C., Ganesh, V.K., Padmanabhan, R., 2007. Characterization of the West Nile virus protease
substrate specificity and inhibitors. Int J Biochem Cell Biol 39, 606-614.
Ng, C.Y., Gu, F., Phong, W.Y., Chen, Y.L., Lim, S.P., Davidson, A., Vasudevan, S.G., 2007. Construction and
characterization of a stable subgenomic dengue virus type 2 replicon system for antiviral compound and siRNA
testing. Antiviral research 76, 222-231.
Padilla, S.L., Rodriguez, A., Gonzales, M.M., Gallego, G.J., Castano, O.J., 2014. Inhibitory effects of curcumin on
dengue virus type 2-infected cells in vitro. Archives of virology 159, 573-579.
Padmanabhan, R., Strongin, A.Y., 2010. Translation and processing of the dengue virus
polyprotein, in: Hanley, K.A., Weaver, S.C. (Eds.), Frontiers in Dengue Virus Research. Caister Academic Press,
Norfolk, U.K., pp. 14-33.
Perera, R., Riley, C., Isaac, G., Hopf-Jannasch, A.S., Moore, R.J., Weitz, K.W., Pasa-Tolic, L., Metz, T.O., Adamec, J.,
Kuhn, R.J., 2012. Dengue virus infection perturbs lipid homeostasis in infected mosquito cells. PLoS pathogens 8,
e1002584.
Pol, A., Martin, S., Fernandez, M.A., Ferguson, C., Carozzi, A., Luetterforst, R., Enrich, C., Parton, R.G., 2004. Dynamic
and regulated association of caveolin with lipid bodies: modulation of lipid body motility and function by a dominant
negative mutant. Molecular biology of the cell 15, 99-110.
Qin, Y., Lin, L., Chen, Y., Wu, S., Si, X., Wu, H., Zhai, X., Wang, Y., Tong, L., Pan, B., Zhong, X., Wang, T., Zhao, W.,
Zhong, Z., 2014. Curcumin inhibits the replication of enterovirus 71 in vitro. Acta pharmaceutica Sinica. B 4, 284-294.
Ramphan, S., Suksathan, S., Wikan, N., Ounjai, P., Boonthaworn, K., Rimthong, P., Kanjanapruthipong, T.,
Worawichawong, S., Jongkaewwattana, A., Wongsiriroj, N., Smith, D.R., 2017. Oleic acid Enhances Dengue Virus But
Not Dengue Virus-Like Particle Production from Mammalian Cells. Mol Biotechnol 59, 385-393.
Rothwell, C., Lebreton, A., Young Ng, C., Lim, J.Y., Liu, W., Vasudevan, S., Labow, M., Gu, F., Gaither, L.A., 2009.
Cholesterol biosynthesis modulation regulates dengue viral replication. Virology 389, 8-19.
Takhampunya, R., Ubol, S., Houng, H.S., Cameron, C.E., Padmanabhan, R., 2006. Inhibition of dengue virus replication
by mycophenolic acid and ribavirin. The Journal of general virology 87, 1947-1952.
Wang, Y.J., Pan, M.H., Cheng, A.L., Lin, L.I., Ho, Y.S., Hsieh, C.Y., Lin, J.K., 1997. Stability of curcumin in buffer
solutions and characterization of its degradation products. Journal of pharmaceutical and biomedical analysis 15,
1867-1876.
Yang, J., Zou, L., Hu, Z., Chen, W., Zhang, J., Zhu, J., Fang, X., Yuan, W., Hu, X., Hu, F., Rao, X., 2013. Identification and
characterization of a 43 kDa actin protein involved in the DENV-2 binding and infection of ECV304 cells. Microbes
and infection / Institut Pasteur 15, 310-318.
Yon, C., Teramoto, T., Mueller, N., Phelan, J., Ganesh, V.K., Murthy, K.H., Padmanabhan, R., 2005. Modulation of the
nucleoside triphosphatase/RNA helicase and 5'-RNA triphosphatase activities of dengue virus type 2 nonstructural
protein 3 (NS3) by interaction with NS5, the RNA-dependent RNA polymerase. The Journal of biological chemistry
280, 27412-27419.
Yusof, R., Clum, S., Wetzel, M., Murthy, H.M., Padmanabhan, R., 2000. Purified NS2B/NS3 serine protease of dengue
virus type 2 exhibits cofactor NS2B dependence for cleavage of substrates with dibasic amino acids in vitro. The
Journal of biological chemistry 275, 9963-9969.
Zhao, J., Sun, X.B., Ye, F., Tian, W.X., 2011. Suppression of fatty acid synthase, differentiation and lipid accumulation
in adipocytes by curcumin. Molecular and cellular biochemistry 351, 19-28.

18
ACCEPTED MANUSCRIPT
Figure 1.
A
100
80
60
40
20
0
CC1
CC2
CC3
CC4
CC5
-1
0
1
2
3
Log [Drug Conc] (µM)
100
80
60
40
20
0
B
CC1
CC2
CC3
CC4
CC5
-0.5
0.0
0.5
1.0
1.5
2.0
Log [Drug Conc] (µM)

19
ACCEPTED MANUSCRIPT
C
100
80
60
40
20
0
CC1
CC2
CC3
CC4
CC5
-1
0
1
2
3
Log [Drug Conc] (µM)
Figure 2:
A
150
100
50
CC1
CC2
CC3
CC4
CC5
0
-0.5
0.0
0.5
1.0
1.5
B

20
ACCEPTED MANUSCRIPT
1.0
0.8
0.6
0.4
0.2
0.0
CC1 CC2 CC3 CC4
CC5 Control
Figure 3:
A
1.0
0.8
0.6
0.4
0.2
0.0
CC1 CC2 CC3 CC4
CC5 Control
B

21
ACCEPTED MANUSCRIPT
1.0
0.8
0.6
0.4
0.2
0.0
CC1 CC2 CC3 CC4
CC5 Control
Figure 4:

22
ACCEPTED MANUSCRIPT
G
0.4
0.3
0.2
0.1
0.0
CC1 CC2 CC3 CC4
CC5 Control
Figure 5:

23
ACCEPTED MANUSCRIPT

24
ACCEPTED MANUSCRIPT
Table 1. Chemical structures and molecular weights of compounds used in this study.
Label Name
Curcumin
(CC1)
Chemical Structure
Molecular Weight
C21H20O6
Mol. Wt. = 368.3
Bis-demethoxy
curcumin (CC2)
C19H16O4
Mol. Wt. = 308.3
Acyclic
C19H18O5
analogue
Mol. Wt. = 326.35
(CC3)
Cyclopentanone
analogue
C21H20O5
Mol. Wt. = 352.39
(CC4)
Cyclohexanone
analogue
C22H22O5
Mol. Wt. = 366.41
(CC5)
Table 2. Inhibition of DENV2 infectivity and DENV2 subgenomic replicon by curcuminoids

25
ACCEPTED MANUSCRIPT
Compound
CC1
EC50 (PFU)
CC50
SI (PFU)
3.51
EC50 (replicon)
SI (replicon)
3.52
13.95±4.62
49.01 ± 8.24
13.91 ± 2.08
CC2
6.49±0.22
43.37 ± 5.19
6.68
26.45 ± 3.67
1.63
CC3
2.68±0.64
32.34 ± 4.72
87.40 ± 9.03
25.50 ± 2.64
12.06
16.27
10.89
8.61 ± 0.79
29.25 ± 4.46
8.07 ± 1.52
3.75
2.98
2.34
CC4
5.37±0.62
CC5
2.34±0.21
The EC50
, CC50 and EC50
values were determined as described under
(replicon)
(PFU)
Materials and Methods.
The SI values represent the ratios of CC50/EC50
and the SI values
(replicon)
(PFU)
(PFU)
represent the ratios of CC50/EC50 (replicon)
.
Supporting Information
Table of Contents

26
ACCEPTED MANUSCRIPT
1. General information........................................................................................................................ S1
2. General procedure for preparation of Curcumin analogues.............................................................S2
1. General information
Reactions were set-up on fume hoods and carried out under nitrogen atmosphere in Schlenk tubes unless
otherwise noted. Compounds were purified by flash chromatography using silica gel (60-120 mesh). All the reagents
and solvents were used as received from commercial sources, unless otherwise specified. 1H NMR, 13C NMR data
were recorded on Bruker 400MHz AVANCE series or Bruker300 MHz DPX Spectrometer with DMSO-d6 as solvent. 1H
chemical shifts were referenced to DMSO-d6 at 2.51 and 3.20 ppm. 13C chemical shifts were referenced to DMSO-d6
at 39.8 ppm and obtained with 1H decoupling. Multiplicities are abbreviated as follows: singlet (s), doublet (d), triplet
(t), quartet (q), doublet-doublet (dd), quintet (quint), sextet (sextet), septet (septet), multiplet (m), and broad (br). IR
spectra were obtained on a Thermo Scientific ATR Nicolet 7200 FT-IR spectrometer. MS was measured on Agilent
7890A/5975C Series Agilent 1100 Series LC/MSD mass spectrometer.
Scheme 1: Synthesis of acyclic curcumin analogue (CC-3)

27
ACCEPTED MANUSCRIPT
Scheme 2: Synthesis of cyclic curcumin analogues (CC-4 & CC-5)
2. General procedure for the synthesis of analogues CC-3, CC-4 & CC-5.
Acetic acid was saturated with hydrogen chloride for a period of 1hour at 0°C. A mixture of vanillin (20
mmol, 2 equiv.) and ketone (10 mmol, 1 equiv.) was slowly added at the same temperature. The reaction mixture
was slowly brought to room temperature and stirred for 48 hours. The crude reaction mass was poured into ice-cold
water, solids precipitated were filtered off, dried and purified by silica gel flash column chromatography. Gradient
elution with 30-60% ethyl acetate in hexanes resulted in the isolation of products in 50-60% yield as yellow solids.
O
O
O
CC-3
HO
OH
(1E,4E)-1,5-bis(4-hydroxy-3-methoxyphenyl)penta-1,4-dien-3-one (CC-3): Compound CC-3 was synthesized as
described in the general procedure. It resulted in the isolation of the desired product as a yellow solid in 56% yield.
1H NMR (400 MHz, DMSO-d6): δ 9.77 (bs, 2H), 7.66-7.62 (d, 2H), 7.36 (s, 2H), 7.21-7.18 (m, 3H), 7.12 (s, 1H), 6.84-
13
6.82 (d, J=8 Hz, 2H), 3.97 (s, 6H). C NMR (100 MHz, DMSO-d6): 188.48, 153.50, 149.89, 148.63, 143.21, 129.19,
126.83, 126.51, 116.15, 115.87, 56.20. IR cm-1: 3391, 1735, 1617, 1582, 1509, 1445, 1424.05, 1377.87, 1261.77,
1213.82, 1161.19, 1028.47, 982. HRMS (ESI) calculated for C
H
O [M+H]+ m/z 327.1232, found: 327.1221.
19 18 5
O
O
O
HO
OH
CC-4

28
ACCEPTED MANUSCRIPT
2,5-bis((E)-4-hydroxy-3-methoxybenzylidene)cyclopentan-1-one (CC-4): Compound CC-4 was synthesized as
described in the general procedure. It resulted in the isolation of the desired product as a brownish yellow solid in 49
1
% yield. H NMR (400 MHz, DMSO-d6): δ 9.64 (s, 2H), 7.35 (s, 2H), 7.23 (m, 2H), 7.15-7.13 (d, 2H), 6.90-6.88 (d, J= 8
13
Hz, 2H), 3.83 (s, 6H), 3.04 (bs, 4H). C NMR (100 MHz, ): 195.21, 148.97, 148.15, 135.18, 133.23, 127.63, 125.20,
116.36, 115.01, 56.04, 26.34. IR cm-1: 3291.61, 2923.19, 2835.33, 1667.08, 1616.46, 1580.83, 1559.66, 1516.73,
1445.34, 1421.24, 1359.12, 1281.17, 1243.20, 1220.36, 1163.67, 1025.04, 1036.89, 994. HRMS (ESI) calculated for
C
H
O [M+H]+ m/z 353.1389, found: 353.1379.
21 20 5
O
O
O
HO
OH
CC-5
2,6-bis((E)-4-hydroxy-3-methoxybenzylidene)cyclohexan-1-one (CC-5): Compound CC-5 was synthesized as
described in the general procedure. It resulted in the isolation of the desired product as a brownish yellow solid in 59
% yield. 1H NMR (400 MHz, DMSO-d6): δ 9.50 (s, 2H), 7.55 (s, 2H), 7.11 (m, 2H), 7.04-7.01 (m, 2H), 6.85-6.83 (d, J= 8
13
Hz, 2H), 3.81 (s, 6H), 2.90-2.88 (m, 4H), 1.74-1.71 (m, 2H). C NMR (100 MHz, ): 188.95, 148.29, 147.91, 136.60,
133,97, 127.41, 124.68, 116.02, 115.29, 56.12, 28.42, 23.04. IR cm-1: 3355.44, 2929.00, 1639.40, 1575.57, 1512.47,
1467.65, 1418.14, 1358.14, 1317.95, 1283.95, 1254.76, 1203.62, 1161.96, 1068.99, 1038.35, 991.06. HRMS (ESI)
calculated
for
C
H
O
[M+H]+
m/z
367.1545,
found:
367.1532
22 22 5