A novel cold-active β-D-galactosidase with transglycosylation activity from the Antarctic Arthrobacter sp. 32cB - Gene cloning, purification and characterization

Article abstract of DOI:10.1016/j.procbio.2014.09.018

A gene encoding a novel β-d-galactosidase from the psychrotolerant Antarctic bacterium Arthrobacter sp. 32cB was isolated, cloned and expressed in Escherichia coli. The active form of recombinant β-d-galactosidase consists of two subunits with a combined molecular weight of approximately 257 kDa. The enzyme's maximum activity towards o-nitrophenyl-β-d-galactopyranoside was determined as occurring at 28 °C and pH 8.0. However, it exhibited 42% of maximum activity at 10°C and was capable of hydrolyzing both lactose and o-nitrophenyl-β-d-galactopyranoside at that temperature, with K_m values of 1.52 and 16.56 mM, and k_cat values 30.55 and 31.84 s^-1, respectively. Two units of the enzyme hydrolyzed 90% of the lactose in 1 mL of milk at 10°C in 24 h. The transglycosylation activity of Arthrobacter sp. 32cB β-d-galactosidase was also examined. It synthesized galactooligosaccharides in a temperature range from 10 to 30°C. Moreover, it catalyzed the synthesis of heterooligosaccharides such as lactulose, galactosyl-xylose and galactosyl-arabinose, alkyl glycosides, and glycosylated salicin from lactose and the appropriate acceptor at 30°C. The properties of Arthrobacter sp. 32cB β-d-galactosidase make it a candidate for use in the industrial removal of lactose from milk and a promising tool for the glycosylation of various acceptors, especially those which are thermosensitive.

Full text of DOI:10.1016/j.procbio.2014.09.018

Process Biochemistry 49 (2014) 2122–2133
Contents lists available at ScienceDirect
Process Biochemistry
journal homepage: www.elsevier.com/locate/procbio
A novel cold-active ␤-d-galactosidase with transglycosylation activity
from the Antarctic Arthrobacter sp. 32cB – Gene cloning, purification
and characterization
Anna Pawlak-Szukalska1, Marta Wanarska∗,1, Arkadiusz Tomasz Popinigis, Józef Kur
Department of Molecular Biotechnology and Microbiology, Faculty of Chemistry, Gdan´sk University of Technology, Narutowicza 11/12, 80-233 Gdan´sk,
Poland
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 23 May 2014
Received in revised form 24 August 2014
Accepted 21 September 2014
Available online 28 September 2014
A gene encoding a novel ␤-d-galactosidase from the psychrotolerant Antarctic bacterium Arthrobacter
sp. 32cB was isolated, cloned and expressed in Escherichia coli. The active form of recombinant ␤-d-
galactosidase consists of two subunits with a combined molecular weight of approximately 257 kDa. The
enzyme’s maximum activity towards o-nitrophenyl-␤-d-galactopyranoside was determined as occur-
ring at 28 ◦C and pH 8.0. However, it exhibited 42% of maximum activity at 10 ◦C and was capable of
hydrolyzing both lactose and o-nitrophenyl-␤-d-galactopyranoside at that temperature, with Km val-
ues of 1.52 and 16.56 mM, and kcat values 30.55 and 31.84 s−1, respectively. Two units of the enzyme
hydrolyzed 90% of the lactose in 1 mL of milk at 10 ◦C in 24 h. The transglycosylation activity of Arthrobacter
sp. 32cB ␤-d-galactosidase was also examined. It synthesized galactooligosaccharides in a temperature
range from 10 to 30 ◦C. Moreover, it catalyzed the synthesis of heterooligosaccharides such as lactulose,
galactosyl-xylose and galactosyl-arabinose, alkyl glycosides, and glycosylated salicin from lactose and
the appropriate acceptor at 30 ◦C. The properties of Arthrobacter sp. 32cB ␤-d-galactosidase make it a
candidate for use in the industrial removal of lactose from milk and a promising tool for the glycosylation
of various acceptors, especially those which are thermosensitive.
Keywords:
␤-d-Galactosidase
Cold-active enzyme
Arthrobacter sp. 32cB
Lactose hydrolysis
Transglycosylation
© 2014 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND
license (http://creativecommons.org/licenses/by-nc-nd/3.0/).
1. Introduction
The cold-active ␤-d-galactosidases found in cold-adapted
microorganisms offer potential for the development of new indus-
Glycoside hydrolases (EC 3.2.1.-) are a widespread group of
enzymes which hydrolyze the glycosidic bond between two
or more carbohydrates or between a carbohydrate and a non-
carbohydrate moiety. These enzymes are currently classified
into 133 families (www.cazy.org/Glycoside-Hydrolases.html). ␤-
d-Galactosidases (␤-d-galactoside galactohydrolases, EC 3.2.1.23)
catalyze the hydrolysis of terminal non-reducing ␤-galactose
residues in ␤-d-galactosides and they are categorized within
the glycoside hydrolase (GH) families 1, 2, 35 and 42. ␤-d-
Galactosidases are widely distributed in nature and can be isolated
from various sources, such as plants, animal organs, archaea,
bacteria, yeasts, and fungi. Most of them are produced by microor-
ganisms, including mesophiles, thermophiles, hyperthermophiles
and psychrophiles.
trial applications and are therefore the subject of intensive
study. Some microorganisms harbor more than one gene encod-
ing enzyme with ␤-d-galactosidase activity. A psychrotolerant
Arthrobacter sp. B7 produces three ␤-d-galactosidase isozymes
belonging to the GH families 2, 35 and 42 [1–4]. Arthrobacter sp.
ON14 possess two genes encoding ␤-d-galactosidases belonging to
GH2 and GH42 [5]. Two different cold-active ␤-d-galactosidases,
members of GH35 and GH42, have been isolated from a lactic acid
bacterium, Carnobacterium piscicola BA [6,7]. ␤-d-Galactosidases
belonging to the GH family 42 have been obtained from psychro-
tolerant bacteria of the genus Planococcus and Arthrobacter [8–10].
Cold-active ␤-d-galactosidases classified into the GH2 family have
been produced by Arthrobacter sp., Pseudoalteromonas sp., Paracoc-
cus sp., Flavobacterium sp. and Alkalilactibacillus ikkense [11–21].
Moreover, cold-adapted ␤-d-galactosidase not assigned to any of
the known GH families was obtained from Halomonas sp. S62 [22].
It has been shown that cold-active ␤-d-galactosidases belonging
to the GH family 2 have the greatest potential for use in indus-
try, since they demonstrate the highest activity towards natural
substrate lactose.
∗
Corresponding author. Tel.: +48 58 348 64 29; fax: +48 58 347 18 22.
E-mail addresses: annpawla@student.pg.gda.pl (A. Pawlak-Szukalska),
marwanar@pg.gda.pl, martka.chem@wp.pl (M. Wanarska), apopinigis@wp.pl
(A.T. Popinigis), kur@pg.gda.pl (J. Kur).
1
These authors contributed equally to this paper.
http://dx.doi.org/10.1016/j.procbio.2014.09.018
1359-5113/© 2014 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).

A. Pawlak-Szukalska et al. / Process Biochemistry 49 (2014) 2122–2133
2123
The major industrial application of ␤-d-galactosidase is in the
production of low-lactose milk for people with lactose malab-
sorption. Lactose malabsorption and symptoms of milk product
intolerance are the most common alimentary tract disorders. How-
ever, dairy produce is the primary source of calcium for many
individuals, and a low intake of those products is thus associated
with a higher risk of fractures or even of osteoporosis in the pres-
ence of other risk factors for this disease [23]. New technologies to
produce lactose-reduced or lactose-free dairy products have there-
fore been developed, including lactose hydrolysis or separation
[24]. The process of enzymatic lactose hydrolysis in milk is sim-
ple and requires no special equipment in dairy plants. Generally,
it is conducted under refrigerated conditions for approximately
24 h using soluble ␤-d-galactosidase isolated from mesophilic yeast
Kluyveromyces lactis. The main disadvantage of this enzyme is its
low activity under process conditions, since it is optimally active at
approximately 50 ◦C and exhibits no more than 10% of its max-
imum activity at temperatures below 10 ◦C (Ha-Lactase product
information, Chr. Hansen A/S, Denmark). As a result, new ␤-d-
galactosidases displaying high activity at low temperatures are still
being sought.
Another important application of ␤-d-galactosidase is the
synthesis of galactooligosaccharides (GOS) from lactose. Many
different di-, tri-, tetra- and pentasaccharides have been identi-
fied as products of the enzymatic transgalactosylation of lactose
catalyzed by ␤-d-galactosidase [25]. Galactooligosaccharides are
non-digestible oligosaccharides (NDOs); they are not digested by
the enzymes of the small intestine, but are fermented by bacte-
ria in the large intestine. GOS are applied as functional food
ingredients which provide the host with many health benefits,
such as low cariogenicity, low caloric content, insulin indepen-
dent metabolism, and stimulation of the growth and metabolism of
beneficial colonic microorganisms of the genus Bifidobacterium and
Lactobacillus; in other words, prebiotic properties. These microor-
ganisms have been linked to increased resistance to infection and
diarrhoeal disease, and stimulation of immune system activity, as
well as protection against cancer. Bifidobacteria are also known to
excrete a range of water soluble vitamins [26,27]. In addition to
their prebiotic properties, the ability of GOS to inhibit the adher-
ence of enteropathogenic Escherichia coli and Salmonella enterica
serovar Typhimurium to tissue culture cells has also been described
[28,29]. The production of galactooligosaccharides from lactose
by means of microbial ␤-d-galactosidases has been conducted
with many enzymes originated from mesophiles, thermophiles
and hyperthermophiles, but studies on GOS synthesis catalyzed
by ␤-d-galactosidases from psychrophiles and psychrotolerant
microorganisms are scant [30]. The formation of GOS during lac-
tose hydrolysis has only been noted for cold-active enzymes from A.
psychrolactophilus F2 [31], Arthrobacter sp. C2-2 [14], and A. ikkense
[21]. Yet the low temperature of GOS synthesis offers some advan-
tages, such as the elimination of nonenzymatic browning products
formed at high temperatures, for instance, as well as its energy
saving potential.
temperatures of between 70 and 100 ◦C. The enzymatic synthesis
of lactulose offers much milder conditions and can be conducted in
crude lactose materials such as whey or whey permeate [32]. Het-
erologous galactosyl transfer catalyzed by ␤-d-galactosidase yields
a virtually unlimited diversity of oligosaccharides [33–39]. How-
ever, none of cold-active ␤-d-galactosidases have yet been used
for this purpose.
The biosynthesis of alkyl glycosides belonging to the group
of nonionic surfactants which can be used in the manufac-
ture of detergents, cosmetics, and pharmaceuticals has also been
conducted using microbial ␤-d-galactosidases [40,41]. Moreover,
␤-d-galactosidases have been shown to be capable of catalyzing
the transglycosylation of various chemicals such as antibiotics [42],
ergot alkaloids [43] and flavonol glycoside myricitrin [44].
This study was conducted with a view to obtaining a cold-active
␤-d-galactosidase exhibiting not only high hydrolytic activity
towards lactose, but also the capability of transferring glycosyl. To
this end, a psychrotolerant Arthrobacter sp. 32cB was isolated from
a sample of Antarctic soil and a gene encoding a ␤-d-galactosidase
of the GH family 2 was cloned, expressed in E. coli, purified and
characterized. The recombinant enzyme showed a high efficiency
in the hydrolysis of lactose in milk under refrigerated conditions.
It was also able to produce GOS at relatively low temperatures.
Moreover, it tolerated a wide range of acceptors and catalyzed the
transglycosylation of saccharides, alcohols and complex chemicals
such as salicin.
2. Materials and methods
2.1. Materials
Isopropyl-␤-d-thiogalactopyranoside (IPTG) and 5-bromo-
4-chloro-3-indolyl-␤-d-galactopyranoside
purchased from Biosynth AG (Switzerland). o-Nitrophenyl-
␤-d-galactopyranoside (ONPG), p-nitrophenyl-␤-d-galacto-
(X-gal)
were
pyranoside (PNPG), p-nitrophenyl-␤-d-glucopyranoside, p-nitro-
phenyl-␤-d-fucopyranoside, p-nitrophenyl-␤-d-xylopyranoside,
p-nitrophenyl-␤-d-glucouronide,
pyranoside, p-nitrophenyl-␤-d-cellobioside, p-nitrophenyl-␤-
l-arabinopyranoside, p-nitrophenyl-␣-d-galactopyranoside,
p-nitrophenyl-␤-d-manno
p-nitrophenyl-␣-d-glucopyranoside, l-arabinose, d-xylose, lactu-
lose, dithiothreitol (DTT), ethylenediaminetetraacetic acid sodium
salt (EDTA), N-(2-hydroxyethyl)piperazine-Nꢀ-(2-ethanesulfonic
acid) (HEPES) and tris(2-carboxyethyl)phosphine (TCEP) were
supplied by Sigma (USA). Salicin was obtained from AppliChem
GmbH (Germany). Peptone K, yeast extract and bacteriological
agar were purchased from BTL (Poland). All other chemicals were
supplied by POCH (Poland).
2.2. Isolation and characterization of bacterial strain exhibiting
ˇ-d-galactosidase activity
␤-d-Galactosidases have been also used to produce het-
erooligosaccharides (HOS) by way of the transfer of galactosyl
moiety to sugars other than lactose or its hydrolysis products,
glucose and galactose. The best-known heterooligosaccharide
is lactulose (4-O-␤-d-galactopyranosyl-␤-d-fructofuranose). It
exhibits prebiotic properties and, like GOS, it is applied as a func-
tional food ingredient. Lactulose is also used in the treatment of
constipation and hepatic encephalopathy, and is applied in the
diagnosis of colonic disorders by means of the hydrogen breath
test. Currently lactulose is industrially produced by means of alka-
line isomerization of lactose. However, this process leads to the
formation of a certain amount of by-products as a result of sugar
degradation under harsh conditions, namely a pH 10.5–11.5 and
A 5 g of Antarctic soil collected in the neighbourhood of the Hen-
ryk Arctowski Polish Antarctic Station on King George Island, in the
Southern Shetlands (62◦10ꢀ S, 58◦28ꢀ W) was dissolved in 45 mL of
water containing 0.5 g of marine salt. After decantation 100 ␮L of
the supernatant was spread out on LAS agar plates (0.5% peptone
K, 0.25% yeast extract, 1% marine salt, 1.5% bacteriological agar)
supplemented with X-gal (40 ␮g mL−1) and IPTG (24 ␮g mL−1). The
plates were incubated at 20 ◦C for 72–120 h. After incubation the
colonies producing ␤-d-galactosidase turned blue.
Growth properties of the analyzed strain were determined in an
LBS medium (0.5% peptone K, 0.25% yeast extract, 1% marine salt).
The proteolytic, lipolytic and amylolytic activities were examined

2124
A. Pawlak-Szukalska et al. / Process Biochemistry 49 (2014) 2122–2133
at 25 ◦C on LAS agar plates containing skimmed milk, tributyrin and
starch, respectively.
Arthrobacter sp. 32cB genomic DNA was first digested with the
EcoRV or Eco47III restriction endonuclease and ligated to the
GenomeWalker Adaptor. Two PCR amplifications were then per-
formed. The primary reaction was carried out using adaptor-ligated
genomic DNA fragments as a template and two primers; the outer
adaptor primer (AP1) provided in the kit and 32cBgN1 primer
5ꢀ GAGGATGCCTTCGCCTGTGATGATGTGGTCGTAGC 3ꢀ or 32cBgC1
primer 5ꢀ CCAGTGGGAGGATGCCCTGGTAGACCGCAT 3ꢀ, designed
on the basis of the partial sequence of Arthrobacter sp. 32cB ␤-d-
galactosidase gene previously obtained. The reaction mixture also
contained 200 ␮M dNTPs and 1 U of DNA polymerase Marathon
(A&A Biotechnology, Poland) in 1× Marathon buffer. DNA ampli-
fication was performed using the following parameters: (94 ◦C –
0.5 min, 72 ◦C – 3 min) 7 cycles, (94 ◦C – 0.5 min, 67 ◦C – 3 min)
32 cycles and 67 ◦C for 7 min after the final cycle. The primary
PCR mixture was then used as a template for a secondary PCR
with the nested adaptor primer (AP2) provided in the kit and
32cBgN2 primer 5ꢀ CCGGCGTGGACGAAGACGTCGTCAATGCCG 3ꢀ
or 32cBgC2 primer 5ꢀ GCATGCGCCGCACGGTTGAGCGCGACAAGA
3ꢀ. The nested PCR mixture also contained 200 ␮M dNTPs and
1 U of DNA polymerase Marathon in 1× Marathon buffer. DNA
amplification was performed using the following parameters:
(94 ◦C – 0.5 min, 72 ◦C – 3 min) 5 cycles, (94 ◦C – 0.5 min, 67 ◦C
– 3 min) 20 cycles and 67 ◦C for 7 min after the final cycle.
In the third step the nested PCR products were purified from
an agarose gel bands, cloned into the pZErO-2 vector (Invi-
trogen, USA) and sequenced. Following this, three fragments
of Arthrobacter sp. 32cB genomic DNA sequences were align-
ment and the full sequence of the ␤-d-galactosidase gene was
obtained.
The ␤-d-galactosidase activity towards lactose was determined
by HPLC. The bacterial strain was grown in an LBS medium supple-
mented with 1 mM IPTG at 25 ◦C for 48 h with agitation (200 rpm).
The cells were then harvested by centrifugation (10,000 × g, 20 min,
4 ◦C) and the cell pellet was washed with a 20 mM potassium
phosphate buffer with a pH of 7.0. Cell lysis was achieved by grind-
ing with aluminium oxide (Sigma, USA). After grinding, a 20 mM
potassium phosphate buffer with a pH of 7.0 was added and the
sample was centrifuged (10,000 × g, 30 min, 4 ◦C) to remove cell
debris and aluminium oxide. The supernatant thus obtained was
mixed with milk (UHT, 2% fat) in a ratio of 2 to 8 and incubated
at 10 ◦C for 24 h. 20% H2SO4 was then added at a ratio of 17 ␮L
to 1 mL and the sample was centrifuged (10,000 × g, 30 min, 4 ◦C)
to remove denatured proteins. The quantities of lactose, d-glucose
and d-galactose were determined using an Aminex HPX-87H col-
umn (Bio-Rad, USA), 5 mM H2SO4 as a mobile phase and the Agilent
1200 Series chromatograph with Refractive Index Detector.
2.3. Identification of the 32cB strain
Genomic DNA from strain 32cB was used as a template
to amplify the 16S rDNA gene with the primers fD2 5ꢀ
CCGAATTCGTCGACAACACGGCTACCTTGTTACGACTT 3ꢀ and rP1 5ꢀ
CCCGGGATCCAAGCTTAGAGTTTGATCCTGGCTCAG 3ꢀ [45]. A PCR
reaction was performed in a mixture containing 0.2 ␮M of each
primer, 0.2 ␮g of genomic DNA, 200 ␮M of each dNTP, and 1 U of
DNA polymerase Hypernova (DNA-Gdan´ sk II, Poland) in 1× PCR
buffer (10 mM Tris–HCl pH 8.8, 50 mM KCl, 3 mM MgCl2, 0.15% Tri-
ton X-100). The reaction mixture was incubated for 3 min at 94 ◦C,
followed by 30 cycles at 94 ◦C for 1 min, 72 ◦C for 2.5 min, and a
final incubation of 5 min at 72 ◦C, using a thermal cycler TGradi-
ent (Biometra, Germany). The PCR product was purified from an
agarose gel band using a DNA Gel-Out kit (A&A Biotechnology,
Poland), cloned into a pJET1.2/blunt vector (Fermentas, Lithuania)
and sequenced (Genomed, Poland).
2.5. Construction of the E. coli expression system for the
production of Arthrobacter sp. 32cB ˇ-d-galactosidase
On the basis of the known sequence of the ␤-d-galactosidase
gene from Arthrobacter sp. 32cB (GenBank accession no. KJ439699),
the specific primers for PCR amplification were designed and syn-
thesized. The gene was amplified using forward primer F232cBNco
5ꢀ TCTACCATGGCTGTCGAAACACCGTCCGCGCTGGCGGAT 3ꢀ, and
reverse primer R32cBHind 5ꢀ TGACAAGCTTCAGCTGCGCACCTTCA-
GGGTCAGTATGAAG 3ꢀ (containing NcoI and HindIII recognition
sites, underlined). The start and stop codons are given in bold. The
PCR reaction mixture contained 0.2 ␮M of each primer, 0.2 ␮g of
Arthrobacter sp. 32cB genomic DNA, 200 ␮M of each dNTP, and 5 U
of DNA polymerase Taq (EURx, Poland) in 1× PCR buffer (50 mM
Tris–HCl pH 9.0, 50 mM NaCl, 1.5 mM MgCl2). The reaction mix-
ture was incubated for 3 min at 95 ◦C, followed by 5 cycles at 95 ◦C
for 1 min, 65 ◦C for 1 min, 72 ◦C for 3 min and 20 cycles at 94 ◦C
for 30 s, 72 ◦C for 4 min, and a final incubation of 5 min at 72 ◦C
using a thermal cycler TGradient (Biometra, Germany). The PCR
product was then purified and digested with EcoRI endonuclease
(Fermentas, Lithuania). The restriction fragments were separated
by electrophoresis, purified from an agarose gel bands using
a DNA Gel-Out kit (A&A Biotechnology, Poland), digested with
NcoI or HindIII endonucleases (Fermentas, Lithuania) and cloned
into a pBAD/Myc-His A vector (Invitrogen, USA) digested with
NcoI and HindIII restriction enzymes. The resulting recombinant
plasmid pBAD-Bgal 32cB containing the Arthrobacter sp. 32cB ␤-
d-galactosidase gene under the control of the PBAD promoter was
used to transform chemically competent E. coli TOP10 cells (Invi-
trogen, USA). The clones were selected on Luria-Bertani agar plates
2.4. Isolation and sequencing of the ˇ-d-galactosidase gene from
Arthrobacter sp. 32cB
The gene encoding the ␤-d-galactosidase from Arthrobacter sp.
32cB was isolated using the PCR technique. In order to obtain a
partial sequence of the ␤-d-galactosidase gene from Arthrobacter
sp. 32cB, sequences encoding ␤-d-galactosidases of Arthrobacter
chlorophenolicus A6 [GenBank: CP001341], Arthrobacter psychrolac-
tophilus F2 [GenBank: AB243756], Arthrobacter sp. FB24 [GenBank:
CP000454], Arthrobacter sp. 20B [GenBank: FJ217701], Arthrobac-
ter sp. SB [GenBank: AY327444], Arthrobacter sp. C2-2 [GenBank:
AJ457162] and Arthrobacter sp. ON14 [GenBank: HM178943]
obtained from the GenBank database, were aligned using the
ClustalX program, version 1.8. On the basis of the alignment,
degenerated primers ArthrBgF 5ꢀ GTGGTGGCTSCCBGGSATCTTCCG
3ꢀ and RBgalIn 5ꢀ TCRTTGCCSAGSGACCACAT 3ꢀ were designed
and synthesized. The PCR reaction was performed in a mix-
ture containing 0.2 ␮M of each primer, 0.2 ␮g of Arthrobacter sp.
32cB genomic DNA, 200 ␮M of each dNTP, and 5 U of DNA poly-
merase Taq (EURx, Poland) in 1× PCR buffer (50 mM Tris–HCl
pH 9.0, 50 mM NaCl, 1.5 mM MgCl2). The reaction mixture was
incubated for 3 min at 95 ◦C, followed by 30 cycles at 95 ◦C
for 1 min, 64 ◦C for 1 min, 72 ◦C for 1 min, and a final incu-
bation of 5 min at 72 ◦C. The PCR product thus obtained was
then purified, cloned into the pJET1.2/blunt vector (Fermentas,
Lithuania) and sequenced. The GenomeWalkerTM Universal Kit
(Clontech Laboratories, USA) was then used to obtain the 5ꢀ
and 3ꢀ ends of Arthrobacter sp. 32cB ␤-d-galactosidase gene. The
supplemented with ampicillin (100 ␮g mL−1), X-Gal (40 ␮g mL−1
)
and l-arabinose (200 ␮g mL−1). The plates were incubated at 37 ◦C
for 12 h and then transferred to 22 ◦C. After 10–12 h of incuba-
tion at 22 ◦C the recombinant colonies producing ␤-d-galactosidase
turned blue. Plasmid DNA from positive transformants was isolated

A. Pawlak-Szukalska et al. / Process Biochemistry 49 (2014) 2122–2133
2125
using the Plasmid Miniprep DNA Purification Kit (EURx, Poland)
and sequenced (Genomed, Poland).
of the reaction mixtures at 95 ◦C for 5 min and the absorbance was
measured at 405 nm.
For the thermal stability studies, the enzyme was incubated at
various temperatures for different periods of time and the residual
␤-d-galactosidase activity was then measured at 28 ◦C and pH 8.0.
For pH-activity studies, hydrolysis of ONPG (1 mg mL−1) was
performed in 20 mM citrate-sodium phosphate buffer pH 4.0–6.5,
20 mM potassium phosphate buffer pH 6.0–8.0 and 20 mM
glycine–sodium hydroxide buffer pH 7.8–10.0 at 28 ◦C for 5 min.
The hydrolysis was halted by the addition of 1.5 M Na2CO3 to the
final concentration of 450 mM and the absorbance was measured
at 405 nm.
The effects of various metal ions and EDTA on recombi-
nant enzyme activity were measured by assaying the enzyme in
20 mM HEPES pH 8.0 containing 5 mM CaCl2·2H2O, CoCl2·6H2O,
MgCl2·6H2O, MnCl2·4H2O, NiCl2·6H2O or EDTA at 28 ◦C for 5 min.
The hydrolysis of ONPG was halted by heating of the reaction
mixtures at 95 ◦C for 5 min and the absorbance was measured at
405 nm.
2.6. Production and purification of the recombinant Arthrobacter
sp. 32cB ˇ-d-galactosidase
Expression of the Arthrobacter sp. 32cB ␤-d-galactosidase gene
was performed in the E. coli LMG194 cells carrying the pBAD-Bgal
32cB plasmid.
The cells were grown for 18 h at 37 ◦C in LB medium (1% peptone
K, 0.5% yeast extract, 1% NaCl) containing 100 ␮g mL−1 ampicillin.
Then 20 mL of culture was added to 1 L of LB medium containing
100 ␮g mL−1 ampicillin and cultivated at 30 ◦C to OD600 of 0.5. 20%
l-arabinose solution was then added to the final concentration of
0.02% and cultivation was continued for 15 h to OD600 of 3.8 0.2.
The culture was then centrifuged (6000 × g, 15 min, 4 ◦C), the cell
pellet was resuspended in 50 mL of buffer A (20 mM potassium
phosphate buffer pH 6.0 containing 50 mM KCl), and the cells were
disrupted by sonication.
After centrifugation (12,000 × g, 35 min, 4 ◦C), the supernatant
was applied onto a Fractogel EMD DEAE weak anion exchanger pur-
chased from Merck (Germany) (60 mL column) equilibrated with
four volumes of buffer A. The column was washed with three
volumes of buffer A and the recombinant ␤-d-galactosidase was
eluted with a linear gradient of potassium chloride (50–1050 mM)
in the same buffer (four volumes of the column). Fractions contain-
ing ␤-d-galactosidase were pooled, dialyzed against buffer A and
loaded onto a Resource Q strong anion exchanger purchased from
GE Healthcare Life Sciences (Sweden). The 6 mL column had pre-
viously been equilibrated with four volumes of buffer A and the
elution was performed with a linear gradient of potassium chlo-
ride (50–850 mM) in the same buffer (four volumes of the column).
Fractions containing Arthrobacter sp. 32cB ␤-d-galactosidase were
pooled, dialyzed against 20 mM potassium phosphate buffer pH 7.5
containing 150 mM KCl and loaded onto a SuperdexTM 200 10/300
GL column (GE Healthcare Life Sciences, Sweden). The elution was
performed using the same buffer. The purified protein was dialyzed
against 40 mM potassium phosphate buffer pH 7.5 and concen-
trated using Amicon Ultra-15 30K Centrifugal Filter Device (Merck
Millipore Ltd., Ireland). Glycerol was then added to the final con-
centration of 50% and the enzyme was stored at −20 ◦C until used.
The enzyme can be stored without loss of activity for at least two
years.
The effects of selected reagents on the ␤-d-galactosidase activity
were measured by assaying the enzyme in 20 mM potassium phos-
phate buffer pH 8.0 containing 10 mM cysteine, DTT, glutathione or
TCEP at 28 ◦C for 5 min. The hydrolysis of ONPG was halted by the
addition of 1.5 M Na2CO3 to the final concentration of 450 mM and
the absorbance was measured at 405 nm.
Substrate specificity was estimated using p-nitrophenyl-
␤-d-galactopyranoside,
p-nitrophenyl-␤-d-fucopyranoside,
pyranoside,
p-nitrophenyl-␤-d-glucopyranoside,
p-nitrophenyl-␤-d-xylo-
p-nitrophenyl-
p-nitrophenyl-␤-d-glucouronide,
␤-d-mannopyranoside, p-nitrophenyl-␤-d-cellobioside, p-nitro-
phenyl-␤-l-arabinopyranoside, p-nitrophenyl-␣-d-galacto-
pyranoside and p-nitrophenyl-␣-d-glucopyranoside. Activity
determination was carried out under standard conditions in
20 mM potassium phosphate buffer pH 8.0 at 28 ◦C. Reactions
stopped after 5 min by the addition of 1.5 M Na2CO3 to the final
concentration of 450 mM.
To determine the kinetic parameters, the hydrolysis of ONPG
and lactose was performed in 20 mM potassium phosphate buffer
pH 8.0 containing 1–5 mM ONPG and 1–20 mM lactose at 10, 20
and 30 ◦C. To estimate the amount of glucose released during lac-
tose hydrolysis the Glucose oxidase/peroxidase reagent (Sigma,
USA) was used. The Km and Vmax values were obtained using the
Lineweaver–Burk equation.
The concentration of purified protein was determined by the
Bradford method [46] using bovine serum albumin (BSA) as a
standard.
The effects of d-glucose and d-galactose on the ␤-d-
galactosidase activity were measured by assaying the enzyme in
20 mM potassium phosphate buffer pH 8.0 containing 5 mM ONPG
and 5–150 mM d-glucose or 5–50 mM d-galactose at 20 ◦C for 5 min.
The hydrolysis of ONPG was halted by the addition of 1.5 M Na2CO3
to the final concentration of 450 mM and the absorbance was mea-
sured at 405 nm. The Ki values were determined at 20 ◦C using 20
and 50 mM concentrations of the inhibitor d-galactose with lactose
and ONPG as substrates.
Analysis of the hydrolysis of lactose in milk by the Arthrobacter
sp. 32cB ␤-d-galactosidase was performed using 1 or 2 U of the
enzyme per 1 mL of milk (UHT, 2% fat). The reaction mixtures were
incubated at 10 ◦C for 24 h. After each 2-h period for 12 h and after
24 h, 1 mL samples were collected and the hydrolysis was halted
by the addition of 20% H2SO4. Lactose, d-glucose and d-galactose
concentrations were determined by HPLC.
The molecular mass of the native Arthrobacter sp. 32cB ␤-d-
galactosidase was estimated by gel filtration using a SuperdexTM
200 10/300 GL column (GE Healthcare Life Science, Sweden),
and bovine thyroglobulin (669 kDa), apoferritin from horse spleen
(443 kDa), ␤-amylase from sweet potato (200 kDa), alcohol dehy-
drogenase from yeast (150 kDa), bovine serum albumin (66 kDa)
and carbonic anhydrase from bovine erythrocytes (29 kDa) pur-
chased from Sigma (USA) as standards.
2.7. Characterization of the Arthrobacter sp. 32cB
ˇ-d-galactosidase hydrolytic activity
The activity of purified Arthrobacter sp. 32cB ␤-d-galactosidase
was determined using ONPG as a substrate. One unit of ␤-d-
galactosidase activity was defined as being the quantity of enzyme
releasing of 1 ␮mol o-nitrophenol per min at 28 ◦C and pH 8.0.
To determine the effect of temperature on the ␤-d-
galactosidase’s activity, the enzyme (0.8 U mL−1) was incubated in
20 mM potassium phosphate buffer pH 8.0 containing 1 mg mL−1
ONPG at 5–55 ◦C for 10 min. The hydrolysis was halted by heating
2.8. Characterization of the Arthrobacter sp. 32cB
ˇ-d-galactosidase transglycosylation activity
GOS synthesis was performed using 1 or 2 U of the Arthrobacter
sp. 32cB ␤-d-galactosidase per 1 mL of 20 mM potassium phos-
phate buffer pH 8.0 containing 29–584 mM lactose. The reaction

2126
A. Pawlak-Szukalska et al. / Process Biochemistry 49 (2014) 2122–2133
mixtures were incubated at 10, 20 and 30 ◦C for 24 h. After each
2-h period for 10 h and after 24 h, 0.1 mL samples were col-
lected and the enzyme was inactivated by incubation at 95 ◦C
for 5 min. Afterwards samples were diluted and products were
separated by thin layer chromatography. Aliquots of 1 ␮L were
applied on TLC plates (Merck, Germany) and separated using 1-
butanol:ethanol:2-propanol:water (2:3:3:2) as a mobile phase.
Detection was achieved by spraying with cerium-molybdate stain
(sodium molybdate 3.74 g, cerium sulfate 1.21 g, sulfuric acid
6.3 mL, distilled water 83.5 mL) and heating at 100 ◦C.
Lactulose, galactosyl-xylose and galactosyl-arabinose were syn-
thesized using 1 or 2 U of the enzyme per 1 mL of 20 mM potassium
phosphate buffer pH 8.0 containing 29–438 mM lactose and the
same concentrations of d-fructose, d-xylose and l-arabinose,
respectively. The reaction mixtures were incubated at 30 ◦C for
24 h with intensive shaking. Transgalactosylation reactions were
terminated by thermal denaturation of the ␤-d-galactosidase. Sam-
ples were then diluted, applied on TLC plates modified by spraying
with 30 mM boric acid and two times resolved in a system acetoni-
trile:water (7:2). Detection was achieved using cerium-molybdate
stain.
The synthesis of alkyl glycosides was performed using 1 or 2 U
of purified ␤-d-galactosidase per 1 mL of 20 mM potassium phos-
phate buffer pH 8.0 containing 29–438 mM lactose and the same
concentrations of 2-propanol, 1-butanol and 1-hexanol, respec-
tively. The reaction mixtures were incubated at 30 ◦C for 24 h
with intensive shaking. Transgalactosylation reactions were ter-
minated by thermal denaturation of the enzyme. Samples were
diluted, applied on TLC plates and resolved in a system A 1-
butanol:acetone:water (4:1:1). Plates were then dried and resolved
in a system B 2-propanol:ethyl acetate:water (2:2:1). Detection
was achieved using cerium-molybdate stain.
Table 1
Comparison of the amino acid sequence of Arthrobacter sp. 32cB ␤-d-galactosidase
with amino acid sequences of GH2 ␤-d-galactosidases from bacteria of the genus
Arthrobacter and Escherichia coli.
Organism
GenBank
accession no.
Identity (%)
Similarity
(%)
Arthrobacter
phenanthrenivorans
Sphe3
ADX74853
ACL41674
82.4
93.0
Arthrobacter
77.1
89.6
chlorophenolicus A6
Arthrobacter sp. FB24
Arthrobacter sp. C2-2
Arthrobacter sp. B7
Arthrobacter sp. ON14
Arthrobacter
psychrolactophilus F2
Arthrobacter sp. 20B
Arthrobacter sp. SB
Escherichia coli
ABK05292
CAD29775
AAA69907
ADJ18283
BAF33372
70.7
46.1
46.0
46.2
45.2
84.8
69.6
69.6
69.1
68.9
ACI41243
AAQ19029
ABN72582
44.3
43.8
36.0
67.3
67.4
60.4
A homology search was performed using version 3 of the FASTA program at the EBI.
isolate 32cB (GenBank, accession no. KJ439698) with the sequences
available in the GenBank database demonstrated that the strain
32cB should be classified as an Arthrobacter sp., and that its closest
relative is Arthrobacter oxydans DSM 20119 (99.9% identity, 100%
query coverage).
3.2. Cloning, expression and purification of Arthrobacter sp. 32cB
ˇ-d-galactosidase
The degenerated primers ArthrBgF and RBgalIn were designed
on the basis of the sequences encoding ␤-d-galactosidases belong-
ing to the glycoside hydrolase family 2 from A. chlorophenolicus
A6, A. psychrolactophilus F2, Arthrobacter sp. FB24, Arthrobacter
sp. 20B, Arthrobacter sp. SB, Arthrobacter sp. C2-2, and Arthrobac-
ter sp. ON14. The 699 bp DNA fragment obtained by conducting
a PCR using those primers was a putative internal fragment of
Arthrobacter sp. 32cB ␤-d-galactosidase gene. The unknown parts
of the ␤-d-galactosidase gene adjacent to the known sequence
were found using the GenomeWalkerTM Universal Kit (Clontech
Laboratories, USA). Analysis of the sequences obtained revealed
an open reading frame consisting of 3033 bp, which encoded a
1010 amino acid protein with a calculated molecular mass of
109,648.4 Da and a theoretical pI of 4.92 (ProtParam; ExPASy Pro-
teomics Server). A homology search, performed using version 3
of the FASTA program at the European Bioinformatics Institute,
displayed an 82.4% amino acid identity and a 93.0% similarity
with ␤-galactosidase/␤-glucuronidase from Arthrobacter phenan-
threnivorans Sphe3. The Arthrobacter sp. 32cB ␤-d-galactosidase
also showed a high homology with ␤-d-galactosidases from A.
chlorophenolicus A6 and Arthrobacter sp. FB24 (Table 1). A conserved
domain search found three classical domains in the Arthrobacter
sp. 32cB ␤-d-galactosidase. The first is a GH family 2 sugar binding
domain (Glyco hydro 2 N, residues 54–224). The second is a GH
family 2 TIM barrel domain (Glyco hydro 2 C, residues 312–609).
The third is a ␤-galactosidase small chain (Bgal small N, residues
730–1006) [47]. The multiple sequence alignment of Arthrobacter
sp. 32cB ␤-d-galactosidase (32cB-B-gal) with its counterparts from
psychrotolerant Arthrobacter sp. C2-2 (C221-B-gal) and mesophilic
E. coli (EC-B-gal) revealed some conserved regions and two essen-
tial catalytic residues, namely E441 and E517, corresponding to the
E442 and E461 of Arthrobacter sp. C2-2 ␤-d-galactosidase and the
E521 and E537 of E. coli ␤-d-galactosidase (Fig. 1) [48].
Glycosylated cyclohexanol and salicin were synthesized
under standard conditions. Products were separated using
butanol:ethanol:water(5:3:2) as a mobile phase and detected using
cerium-molybdate stain.
All the measurements were taken and the experiments carried
out in triplicate.
2.9. Nucleotide sequences accession numbers
The 16S rDNA and ␤-d-galactosidase gene sequences reported
in this article have been deposited in the GenBank database and
assigned Accession Nos. KJ439698 and KJ439699, respectively.
3. Results
3.1. Isolation, characterization and identification of strain 32cB
Two bacterial strains exhibiting ␤-d-galactosidase activity on
agar plates containing isopropyl-␤-d-thiogalactopyranoside (IPTG)
and 5-bromo-4-chloro-3-indolyl-␤-d-galactopyranoside (X-Gal)
were isolated from Antarctic soil sample, and named 20 and 32cB.
The activity of the enzyme in the cell extracts was confirmed using
milk as a substrate. After 24 h of incubation at 10 ◦C, the yields of
lactose hydrolysis were 1 and 25% for isolate 20 and 32cB, respec-
tively. Thus the 32cB strain was selected for further studies. It also
exhibited amylase activity, but lipase/esterase and protease activ-
ities were absent. The cells were Gram-positive and displayed a
rod-coccus life cycle. The agar colonies were circular, smooth and
creamy in colour. The optimum growth of strain 32cB was observed
at 24–26 ◦C and no growth occurred at 37 ◦C. Hence, isolate 32cB
can be categorized as a psychrotolerant microorganism.
In order to produce and investigate the biochemical properties
of Arthrobacter sp. 32cB ␤-d-galactosidase, a recombinant pBAD-
Bgal 32cB plasmid was constructed and used for the expression
of the ␤-d-galactosidase gene in the E. coli LMG194 strain, which
The genus of strain 32cB was assessed on the basis of the 16S
ribosomal DNA gene sequence. Alignment of the 16S rDNA gene of

A. Pawlak-Szukalska et al. / Process Biochemistry 49 (2014) 2122–2133
2127
Fig. 1. Multiple sequence alignment of Arthrobacter sp. 32cB ␤-d-galactosidase with ␤-d-galactosidases from Arthrobacter sp. C2-2 and E. coli. 32cB-B-gal–␤-d-galactosidase
from Arthrobacter sp. 32cB, C221-B-gal–␤-d-galactosidase from Arthrobacter sp. C2-2, EC-B-gal–␤-d-galactosidase from E. coli. Three levels of conserved residues are indicated
by black (100%), blue (80%) and green (60%) backgrounds. Catalytic residues are shaded red. The alignment was performed using Clustalx 2.0.11 program. (For interpretation
of the references to colour in this figure legend, the reader is referred to the web version of the article.)
is lacZ deficient. The recombinant enzyme was purified by means
of ion exchange chromatography, using weak and strong anion
exchangers, and by gel filtration. After the purification, the sodium
dodecyl sulfate-polyacrylamide gel electrophoresis and staining
with Coomassie blue, a protein band was observed migrating
near 116 kDa (Fig. 2, lane 4). This concurred with the molecular
mass of Arthrobacter sp. 32cB ␤-d-galactosidase deduced from the
nucleotide sequence of the gene (109.6 kDa). The overexpression
system and purification method applied were quite efficient, yield-
ing 18 mg (Table 2) of Arthrobacter sp. 32cB ␤-d-galactosidase from
1 L of E. coli culture. The molecular mass of the native enzyme,
as estimated by gel filtration, was 256.6 kDa. It has thus been
assumed that the Arthrobacter sp. 32cB ␤-d-galactosidase is prob-
ably a dimeric protein.
Fig. 2. SDS-PAGE analysis of the fractions obtained by expression and purification
of Arthrobacter sp. 32cB ␤-d-galactosidase. Lane M – Unstained Protein Molecular
Weight Marker (Fermentas): 116, 66.2, 45, 35, 25, 18.4 and 14.4 kDa, lane 1 – cell
extract of E. coli LMG194 + pBAD-Bgal 32cB after ␤-d-galactosidase gene expression,
lane 2 – purified ␤-d-galactosidase after ion exchange chromatography on Fractogel
EMD DEAE column, lane 3 – purified ␤-d-galactosidase after ion exchange chro-
matography on Resource Q column, and lane 4 – purified ␤-d-galactosidase after
gel filtration.
3.3. Properties of Arthrobacter sp. 32cB ˇ-d-galactosidase
The investigation into the effect of temperature on Arthrobac-
ter sp. 32cB ␤-d-galactosidase showed that the highest hydrolytic
activity during 10 min of incubation with o-nitrophenyl-␤-d-
galactopyranoside (ONPG) as a substrate occurred at 28 ◦C. The
enzyme exhibited over 95% of maximum activity in a temperature
range of 26–31 ◦C, and maintained 31–42% of maximum activity at
5–10 ◦C (Fig. 3A).
Table 2
Summary of the purification of recombinant Arthrobacter sp. 32cB ␤-d-galactosidase obtained from 1 L of E. coli LMG194 culture.
Purification step
Protein (mg)
Total activity (U)
Specific activity (U mg−1
)
Purification (fold)
Recovery (%)
Cell extract
Fractogel EMD DEAE
Resource Q
510.0
63.0
35.0
18.0
7490.0
6800.0
5600.0
3840.0
14.7
107.9
160.0
213.3
1.0
7.3
10.9
14.5
100
12.4
6.9
Gel filtration
3.5
The enzyme activity was measured with ONPG as a substrate.

2128
A. Pawlak-Szukalska et al. / Process Biochemistry 49 (2014) 2122–2133
Fig. 3. Effects of temperature (A) and pH (B) on activity of recombinant Arthrobacter sp. 32cB ␤-d-galactosidase. Panel A: reaction mixtures containing 0.8 U mL−1 32cB-B-gal
and 1 mg mL−1 ONPG in 20 mM potassium phosphate buffer pH 8.0 were incubated at temperatures from 5 to 55 ◦C for 10 min. Panel B: reaction mixtures containing 0.8 U mL−1
32cB-B-gal and 1 mg mL−1 ONPG in 20 mM citrate-sodium phosphate buffer pH 4.0–6.5 (ꢀ), 20 mM potassium phosphate buffer pH 6.0–8.0 (ꢁ) and 20 mM glycine–sodium
hydroxide buffer pH 7.8–10.0 (ꢂ) were incubated at 28 ◦C for 5 min.
The Arthrobacter sp. 32cB ␤-d-galactosidase exhibited high
stability at a temperature of 30 ◦C and a pH of 8.0, given that approx-
imately 80% of its initial activity was retained after 8 h of incubation
(Fig. 4A). At 42 ◦C, over 50% of initial activity was lost in an incu-
bation period of 5 min and the enzyme was inactivated by 5 min at
44 ◦C (Fig. 4B).
by the strong reducing agent tris(2-carboxyethyl)phosphine (TCEP)
(Table 3).
The substrate specificity studies demonstrated that Arthrobacter
sp. 32cB ␤-d-galactosidase hydrolyzed only two chromogenic sub-
strates out of the ten tested. The enzyme exhibited a high activity
In order to determine the optimum pH for recombinant ␤-d-
galactosidase activity, the hydrolysis of ONPG was performed at
various pH values and at 28 ◦C. The enzyme exhibited maximum
activity at a pH of 8.0 and maintained over 95% of maximum activity
in a pH range of 7.5–8.5 (Fig. 3B).
Table 3
Effects of metal ions and selected reagents on Arthrobacter sp. 32cB ␤-d-
galactosidase activity.
Metal ion/EDTA (5 mM)
Relative
activity (%)
Reducing agent
(10 mM)
Relative
activity (%)
For examination of the metal ion requirements, the purified
32cB-B-gal was assayed in the presence of 5 mM Ca2+, Co2+, Mg2+
,
None
Mg2+
Ca2+
100
162 6.3
77 2.5
36 2.1
22 1.8
17 1.4
37 2.0
None
DTT
Cysteine
Glutathione
TCEP
100
117 5.1
65 2.7
30 2.2
0
Mn2+ and Ni2+ ions. The enzyme was strongly activated by Mg2+ and
strongly inhibited by Co2+, Ni2+, and Mn2+ ions. It was also inhibited
by a chelator of divalent cations ethylenediaminetetraacetic acid
sodium salt (EDTA). It is important to note is that the activity of the
Arthrobacter sp. 32cB ␤-d-galactosidase was only partially inhibited
by Ca2+ ions. Moreover, the enzyme was completely inactivated
Co2+
Ni2+
Mn2+
EDTA
The enzyme activity was measured with ONPG as a substrate.

A. Pawlak-Szukalska et al. / Process Biochemistry 49 (2014) 2122–2133
2129
Fig. 4. Effect of temperature on stability of recombinant Arthrobacter sp. 32cB ␤-d-galactosidase. Panel A: the enzyme was incubated at 30 (ꢁ) or 35 ◦C (ꢂ) for 1–8 h and then
assayed at 28 ◦C. Panel B: the enzyme was incubated at 42 (ꢁ), 43 (ꢂ) or 44 ◦C (ꢀ) for 5–15 min and then assayed at 28 ◦C.
towards p-nitrophenyl-␤-d-galactopyranoside (PNPG) and a very
weak activity towards p-nitrophenyl-␤-d-fucopyranoside (about
4% of the PNPG activity). It showed less than 1% of the PNPG activity
with p-nitrophenyl-␤-d-glucopyranoside, p-nitrophenyl-␤-d-
xylopyranoside, p-nitrophenyl-␤-d-glucouronide, p-nitrophenyl-
␤-d-mannopyranoside, p-nitrophenyl-␤-d-cellobioside, p-nitro-
was a competitive inhibitor given that Vmax values for ONPG and
lactose were unchanged, while Km values increased from 1.58 to
5.00 mM for ONPG and from 14.67 to 32.86 mM for lactose.
Experiments on the hydrolysis of lactose in milk by Arthrobacter
sp. 32cB ␤-d-galactosidase revealed that 70 or 90% of lactose was
digested by 1 or 2 U of the enzyme per 1 mL of milk over 24 h at a
temperature of 10 ◦C, respectively.
phenyl-␤-l-arabinopyranoside,
p-nitrophenyl-␣-d-galacto-
pyranoside and p-nitrophenyl-␣-d-glucopyranoside.
The transglycosylation activity of Arthrobacter sp. 32cB ␤-d-
galactosidase was tested using lactose as a substrate. GOS synthesis
was conducted at 10, 20 and 30 ◦C in reaction mixtures contain-
ing up to 584 mM of lactose. The efficient synthesis of tri- and
tetrasaccharides was achieved in 292–584 mM of lactose solutions
containing 2 U mL−1 ␤-d-galactosidase after an incubation period
of 24 h at 10 and 20 ◦C or of 6 h at 30 ◦C. Moreover, in the reaction
mixtures incubated at 20 and 30 ◦C, some quantities of pentasac-
charides were also detected (Fig. 5).
The kinetic parameters of Arthrobacter sp. 32cB ␤-d-
galactosidase for ONPG and lactose as substrates were determined
at 10, 20 and 30 ◦C. The enzyme exhibited an one order of mag-
nitude higher catalytic efficiency (kcat/Km) towards synthetic
substrate (Table 4).
The Arthrobacter sp. 32cB ␤-d-galactosidase activity towards
ONPG (5 mM) was not inhibited by d-glucose in concentrations up
to 150 mM, but it was inhibited by d-galactose. The activity was
reduced twofold in the presence of 50 mM monosaccharide. The Ki
values for d-galactose determined at 20 ◦C using ONPG and lactose
as substrates were 24.12 and 14.80 mM, respectively. d-Galactose
Arthrobacter sp. 32cB ␤-d-galactosidase was used to catalyze
the synthesis of heterooligosaccharides from lactose and different
monosaccharides, namely, d-fructose, d-xylose and l-arabinose.

2130
A. Pawlak-Szukalska et al. / Process Biochemistry 49 (2014) 2122–2133
Table 4
Kinetic parameters of Arthrobacter sp. 32cB ␤-d-galactosidase.
Substrate
Temperature (◦C)
Km (mM)
Vmax (U mg−1
)
kcat (s−1
)
kcat/Km (s−1 mM−1
)
10
20
30
1.52 0.12
1.58 0.31
1.51 0.15
16.74 1.05
31.20 1.91
50.38 2.70
30.55 2.12
56.95 2.41
91.95 2.70
20.16
35.98
60.74
ONPG
10
20
30
16.56 0.55
14.67 0.88
16.18 1.05
17.44 1.20
31.58 1.55
42.04 2.10
31.84 2.04
57.64 2.58
76.74 2.72
1.92
3.93
4.74
Lactose
Fig. 5. TLC of products of GOS synthesis catalyzed by Arthrobacter sp. 32cB ␤-d-galactosidase. Reaction mixtures containing lactose as a substrate and 2 U mL−1 Arthrobacter
sp. 32cB ␤-d-galactosidase were incubated at 10 and 20 ◦C for 24 h (A and B) or 30 ◦C for 6 h (C). Lane 1 – d-galactose, lane 2 – d-glucose, lane 3 – lactose, lane 4 – reaction
mixture containing 29 mM lactose, lane 5 – reaction mixture containing 58 mM lactose, lane 6 – reaction mixture containing 146 mM lactose, lane 7 – reaction mixture
containing 292 mM lactose, lane 8 – reaction mixture containing 438 mM lactose, and lane 9 – reaction mixture containing 584 mM lactose.
The highest yield of lactulose (galactosyl-fructose) was achieved
after 8 h incubation at 30 ◦C (Fig. 6). The similar results were
obtained during synthesis of galactosyl-arabinose and galactosyl-
xylose.
as evidenced by the low quantities of lactose hydrolysis products
at higher concentrations of this alcohol in the reaction mixtures.
As a result, the transglycosylation product was barely detectable
(Fig. 7D).
In addition, it was found that the Antarctic Arthrobacter sp. 32 cB
␤-d-galactosidase catalyzes the synthesis of alkyl glycosides from
lactose and alcohols such as 2-propanol, 1-butanol, 1-hexanol and
cyclohexanol. The enzyme showed the highest transferase activ-
ity towards 1-butanol (Fig. 7A). Yields of other derivatives were
lower, owing to steric hindrance by bulky groups in 2-propanol
(Fig. 7B) and the relatively low solubility in water of 1-hexanol
(Fig. 7C). Cyclohexanol was found to be an inhibitor for the enzyme,
To
investigate
the
transglycosylation
activity
of
Arthrobacter sp. 32cB ␤-d-galactosidase further, a salicin (2-
(hydroxymethyl)phenyl-␤-d-glucopyranoside) was used as an
acceptor of galactosyl moiety. The enzyme was active towards
salicin as a substrate and large quantities of the product were
obtained after 8 h of transglycosylation at 30 ◦C in the reaction
mixtures containing 146–292 mM concentrations of lactose and
salicin (Fig. 8).
4. Discussion
The article has described the cloning, purification and char-
acterization of ␤-d-galactosidase belonging to the GH family 2
from the psychrotolerant Antarctic bacterium Arthrobacter sp.
32cB. This enzyme exists in the solution as a dimer, similarly to
the ␤-d-galactosidase from Paracoccus sp. 32d, although most of
the cold-active GH2 ␤-d-galactosidases characterized to date are
tetramers (Table 5). The main industrial ␤-d-galactosidase from K.
lactis is active in both dimeric and tetrameric form; however, the
dominant active form of the enzyme is dimeric [49].
The Arthrobacter sp. 32cB ␤-d-galactosidase is optimally active
at relatively low temperatures ranging from 26 to 31 ◦C, with
maximum activity at 28 ◦C, and it exhibits over 40% of maximum
activity at 10 ◦C. Moreover, it can be easily inactivated by incuba-
tion at moderate temperature, namely 5 min at 44 ◦C. Almost all
the cold-active ␤-d-galactosidases of the GH2 family are optimally
active at temperatures above 10 ◦C and only one enzyme, which
was isolated from psychrophilic bacterium A. psychrolactophilus F2,
exhibits maximum activity at 10 ◦C (Table 5). On the other hand,
the Arthrobacter sp. 32cB ␤-d-galactosidase is stable at 30 ◦C and
below for at least 8 h and it can be purified, transported and stored
Fig. 6. TLC of products of lactulose synthesis catalyzed by Arthrobacter sp. 32cB ␤-
d-galactosidase. Reaction mixtures containing lactose and d-fructose as substrates,
and 2 U mL−1 Arthrobacter sp. 32cB ␤-d-galactosidase were incubated at 30 ◦C for
8 h. Lane 1 – d-galactose, lane 2 – d-glucose, lane 3 – d-fructose, lane 4 – lactose,
lane 5 – lactulose, lane 6 – reaction mixture containing 29 mM of each substrate,
lane 7 – reaction mixture containing 58 mM of each substrate, lane 8 – reaction
mixture containing 146 mM of each substrate, lane 9 – reaction mixture containing
292 mM of each substrate, and lane 10 – reaction mixture containing 438 mM of
each substrate.

A. Pawlak-Szukalska et al. / Process Biochemistry 49 (2014) 2122–2133
2131
Fig. 7. TLC of products of alkyl glycosides synthesis catalyzed by Arthrobacter sp. 32cB ␤-d-galactosidase. Reaction mixtures containing lactose and 1-butanol (A), 2-propanol
(B), 1-hexanol (C) or cyclohexanol (D) as substrates, and 2 U mL−1 Arthrobacter sp. 32cB ␤-d-galactosidase were incubated at 30 ◦C for 8 h. Lane 1 – d-galactose, lane 2 –
d-glucose, lane 3 – lactose, lane 4 – GOS, lane 5 – reaction mixture containing 29 mM of each substrate, lane 6 – reaction mixture containing 58 mM of each substrate, lane 7
– reaction mixture containing 146 mM of each substrate, lane 8 – reaction mixture containing 292 mM of each substrate, and lane 9 – reaction mixture containing 438 mM
of each substrate.
Like other cold-active ␤-d-galactosidases from GH family 2, the
enzyme from Arthrobacter sp. 32cB shows high specificity towards
␤-d-galactopyranosides including lactose. It exhibits higher cat-
alytic efficiency (kcat/Km) towards lactose than ␤-d-galactosidases
from A. psychrolactophilus F2, Arthrobacter sp. SB and Arthrobac-
ter sp. C2-2 (Table 5). The Arthrobacter sp. 32cB ␤-d-galactosidase
is inhibited by d-galactose, which is the competitive inhibitor
of many microbial ␤-d-galactosidases, but it is not inhibited by
d-glucose. The similar behaviour was reported for the enzyme
from Kluyveromyces fragilis (commercial Lactozym, Novo Nordisk,
Denmark) [50,51]. d-Galactose was also a competitive inhibitor of
cold-active ␤-d-galactosidase from Arthrobacter sp. SB [15]. In con-
trast, the enzyme from Pseudoalteromonas sp. 22b was inhibited
by d-glucose, but not by d-galactose [52]. The Paracoccus sp. 32d
Fig. 8. TLC of products of salicin glycosylation catalyzed by Arthrobacter sp. 32cB
␤-d-galactosidase. Reaction mixtures containing lactose and salicin as substrates
␤-d-galactosidase was inhibited by both monosaccharides [19],
whereas neither d-glucose nor d-galactose had any effect on the
Arthrobacter sp. C2-2 ␤-d-galactosidase activity [14]. Thus 32cB-B-
gal has the potential for use in the removal of lactose from milk
under refrigeration. Two units of this enzyme (9.4 ␮g) are capa-
ble of digesting 90% of the lactose in 1 mL of milk in 24 h at 10 ◦C.
For comparison, 1 U of A. psychrolactophilus F2 ␤-d-galactosidase
(30.0 ␮g) hydrolyzes about 80%, while 1 U of Paracossus sp. 32d ␤-d-
galactosidase (24.4 ␮g) removes approximately 97% of lactose from
1 mL of milk under the same conditions [12,19]. The advantage of
Arthrobacter sp. 32cB ␤-d-galactosidase is its high specific activity,
which allows the use of small quantities of protein and thus reduces
the cost of the process.
and 2 U mL−1 Arthrobacter sp. 32cB ␤-d-galactosidase were incubated at 30 ◦C for
8 h. Lane 1 – d-galactose, lane 2 – d-glucose, lane 3 – lactose, lane 4 – salicin, lane 5 –
GOS, lane 6 – reaction mixture containing 29 mM of each substrate, lane 7 – reaction
mixture containing 58 mM of each substrate, lane 8 – reaction mixture containing
146 mM of each substrate, lane 9 – reaction mixture containing 292 mM of each
substrate, and lane 10 – reaction mixture containing 438 mM of each substrate.
for a short time at room temperature without significant loss of
activity, which is important for industrial enzymes. In contrast, the
Arthrobacter sp. SB ␤-d-galactosidase irreversibly dissociates into
inactive monomers at 25 ◦C [15].
Table 5
Biochemical properties of cold-active GH2 ␤-d-galactosidases from various microorganisms.
Organism
Molecular mass
(kDa)
Oligomeric
state
Topt (◦C)
pHopt
Thermal
inactivation
Kinetic parameters in lactose
hydrolysis
References
Km (mM)
kcat (s−1
)
kcat/Km (s−1 mM−1
)
Arthrobacter sp. 32cB
Arthrobacter
257 (109.6)a
548 (111.7)a
2
4
28
10
8.0
8.0
5 min at 44 ◦
5 min at 50 ◦
C
C
16.56 (10 ◦C)
50 (10 ◦C)
31.84
18.0
1.92
0.36
This study
[12]
psychrolactophilus F2
Arthrobacter sp. ON14
Arthrobacter sp. SB
Arthrobacter sp. 20B
Arthrobacter sp. B7
Arthrobacter sp. C2-2
Alkalilactibacillus ikkense
Paracoccus sp. 32d
Pseudoalteromonas sp. 22b
Flavobacterium sp. 4214
Pseudoalteromonas
haloplanktis TAE79
NR (111.4)a
463 (114.0)a
460 (113.7)a
NR (111.0)a
550 (110.8)a
NR (119.1)a
161 (81.7)a
490 (117.1)a
<66 (114.3)a
>300 (118.1)a
NR
4
4
NR
4
NR
2
4
1
4
15
18
25
40
40
20–30
40
40
42
8.0
7.0
6.0–8.0
7.2
7.5
8.0
7.5
6.0–8.0
7.5
8.5
20 min at 50 ◦
10 min at 37 ◦
C
C
NR
NR
5.2
NR
NR
324
NR
43.23
157
NR
NR
0.53
NR
NR
0.9
[5]
11.5 (20 ◦C)
NR
[15]
[13]
[2]
[14]
[21]
[19]
[17,18]
[20]
[16]
1 min at 60 ◦
C
10 min at 50 ◦
10 min at 50 ◦
C
C
16 (30 ◦C)
344.2 (10 ◦C)
NR
5 min at 50 ◦
C
NR
15 min at 50 ◦
C
2.94 (10 ◦C)
3.3 (20 ◦C)
NR
15.06
47.5
NR
2 min at 50 ◦
C
NR
NR
45
2.4 (25 ◦C)
33
13.7
NR, not reported.
a
Molecular mass of the monomer, calculated from the amino acid sequence.

2132
A. Pawlak-Szukalska et al. / Process Biochemistry 49 (2014) 2122–2133
The article also presents a study carried out on the transg-
the latter temperature, it also catalyzes glycosyl transfer from lac-
tose to various chemicals such as sugars (d-fructose, d-xylose and
l-arabinose), alcohols (1-butanol, 1-hexanol, 2-propanol and cyclo-
hexanol), and aromatic glycoside salicin. The Arthrobacter sp. 32cB
␤-d-galactosidase thus has the potential of being an interesting
biocatalyst for the production of food additives, cosmetics, and
pharmaceuticals, and can be particularly useful in the glycosylation
of thermosensitive chemicals.
lycosylation activity of Arthrobacter sp. 32cB ␤-d-galactosidase.
The enzyme was capable of synthesizing galactooligosaccharides,
namely tri-, tetra- and even pentasaccharides, at relatively low
temperatures ranging from 10 to 30 ◦C. The formation of GOS during
lactose hydrolysis has previously been noted for cold-active ␤-d-
galactosidases from A. psychrolactophilus F2 [31], Arthrobacter sp.
C2-2 [14] and A. ikkense [21]. In the case of recombinant Arthrobac-
ter sp. C2-2 ␤-d-galactosidase, the formation of trisaccharides
reached a plateau after approximately 10 h at 15 ◦C; however the
concentration of tetrasaccharides was much lower than that of tri-
saccharides [14]. Similar results were obtained for recombinant A.
psychrolactophilus F2 ␤-d-galactosidase. The product correspond-
ing to trisaccharide was detected during the lactose hydrolysis in
milk catalyzed by this enzyme, and its formation reached a plateau
after around 10 h at 10 ◦C [31].
Acknowledgement
The authors would like to thank Professor Marianna Turkiewicz
of the Institute of Technical Biochemistry at the Technical Univer-
sity of Łódz´ for providing the Antarctic soil samples.
The Arthrobacter sp. 32cB ␤-d-galactosidase was also tested as a
tool for the synthesis of alkyl glycosides. Like the ␤-d-galactosidase
from the psychrotolerant Pseudoalteromonas sp. 22b [40], it was
capable of catalyzing the formation of 2-propyl, 1-butyl, 1-hexyl
and cyclohexyl galactopyranosides at 30 ◦C. The disadvantage of
32cB-B-gal is the relatively low yields of transglycosylation prod-
ucts. However, the authors suppose that the quantities of alkyl
glycosides can be increased by optimization of the reaction con-
ditions, for example by the addition of selected organic solvents, as
in the case of Pseudoalteromonas sp. 22b ␤-d-galactosidase [40].
Moreover, it was found that, like some enzymes from mesophilic
microorganisms, the recombinant Arthrobacter sp. 32cB ␤-d-
galactosidase catalyzed the synthesis of heterooligosaccharides,
namely lactulose, galactosyl-xylose or galactosyl-arabinose, and
glycosylated salicin. ␤-d-Galactosidases from Enetrobacter agglom-
erans B1 and E. cloacae B5 catalyze glycosyl transfer from
ONPG to various acceptors such as hexoses (glucose, galactose,
mannose, fructose, sorbose), pentoses (arabinose, xylose), dis-
accharides (cellobiose, sucrose, trehalose), hexahydroxyalcohols
(mannitol, sorbitol), cyclitol (inositol) and aromatic glycoside
(salicin) [33,34]. The enzymatic synthesis, by Aspergillus oryzae
␤-d-galactosidase, of galactosyl-xylose from ONPG and xylose as
substrates has been also reported [35]. Nevertheless, synthetic
␤-d-galactosidase substrate ONPG is useless as galactosyl donor
in industrial processes. Hence, in our study the natural, plen-
tiful and inexpensive ␤-d-galactosidase substrate lactose was
used as the glycosyl donor in the synthesis of glycoconjugates.
The production of lactulose from lactose and fructose has previ-
ously been investigated with several commercial enzymes such as
E. coli ␤-d-galactosidase, A. oryzae ␤-d-galactosidase, S. fragilis ␤-
d-galactosidase, and K. lactis ␤-d-galactosidase, with the enzyme
from K. lactis exhibiting the highest lactulose productivity of the
␤-d-galactosidases tested [53].
References
[1] Loveland J, Gutshall K, Kasmir J, Prema P, Brenchley JE. Characterization
of psychrotrophic microorganisms producing ␤-galactosidase activities. Appl
Environ Microbiol 1994;60:12–8.
[2] Trimbur DE, Gutshall KR, Prema P, Brenchley JE. Characterization of a psy-
chrotrophic Arthrobacter gene and its cold-active ␤-galactosidase. Appl Environ
Microbiol 1994;60:4544–52.
[3] Gutshall K, Wang K, Brenchley JE. A novel Arthrobacter ␤-galactosidase with
homology to eukaryotic ␤-galactosidases. J Bacteriol 1997;179:3064–7.
[4] Gutshall KR, Trimbur DE, Kasmir JJ, Brenchley JE. Analysis of a novel gene and
␤-galactosidase isozyme from psychrotrophic Arthrobacter isolate. J Bacteriol
1995;177:1981–8.
[5] Ke X, Tang X, Gai Y, Mehmood MA, Xiao X, Wang F. Molecular characteriza-
tion of cold-inducible ␤-galactosidase from Arthrobacter sp. ON14 isolated from
Antarctica. J Microbiol Biotechnol 2011;21:236–42.
[6] Coombs J, Brenchley JE. Characterization of two new glycosyl hydrolases from
the lactic acid bacterium Carnobacterium piscicola strain BA. Appl Environ
Microbiol 2001;67:5094–9.
[7] Coombs JM, Brenchley JE. Biochemical and phylogenetic analyses of a cold-
active ␤-galactosidase from the lactic acid bacterium Carnobacterium piscicola
BA. Appl Environ Microbiol 1999;65:5443–50.
[8] Sheridan PP, Brenchley JE. Characterization of a salt-tolerant family 42 ␤-
galactosidase from a psychrophilic Antarctic Planococcus isolate. Appl Environ
Microbiol 2000;66:2438–44.
[9] Hu JM, Li H, Cao LX, Wu PC, Zhang CT, Sang SL, et al. Molecular cloning
and characterization of the gene encoding cold-active ␤-galactosidase from
a psychrotrophic and halotolerant Planococcus sp. L4. J Agric Food Chem
2007;55:2217–24.
[10] Hildebrandt P, Wanarska M, Kur J. A new cold-adapted ␤-d-galactosidase from
the Antarctic Arthrobacter sp. 32c – gene cloning, overexpression, purification
and properties. BMC Microbiol 2009;9:151.
[11] Nakagawa T, Fujimoto Y, Uchino M, Tiyaji T, Takano K, Tomizuka N. Isolation
and characterization of psychrophiles producing cold-active ␤-galactosidase.
Lett Appl Microbiol 2003;37:154–7.
[12] Nakagawa T, Fujimoto Y, Ikehata R, Miyaji T, Tomizuka N. Purification and
molecular characterization of cold-active ␤-galactosidase from Arthrobacter
psychrolactophilus strain F2. Appl Microbiol Biotechnol 2006;72:720–5.
[13] Białkowska AM, Cies´lin´ ski H, Nowakowska KM, Kur J, Turkiewicz M. A new
␤-galactosidase with a low temperature optimum isolated from the Antarc-
tic Arthrobacter sp. 20B: gene cloning, purification and characterization. Arch
Microbiol 2009;191:825–35.
ˇ
[14] Karasová-Lipovová P, Strnad H, Spiwok V, Malá S, Králová B, Russell NJ. The
cloning, purification and characterization of a cold-active ␤-galactosidase from
the psychrotolerant Antarctic bacterium Arthrobacter sp. C2-2. Enzyme Microb
Technol 2003;33:836–44.
5. Conclusions
[15] Coker JA, Sheridan PP, Loveland-Curtze J, Gutshall KR, Auman AJ, Brenchley
JE. Biochemical characterization of a ␤-galactosidase with a low tempera-
ture optimum obtained from an Antarctic Arthrobacter isolate. J Bacteriol
2003;185:5473–82.
[16] Hoyoux A, Jennes I, Dubois P, Genicot S, Dubail F, Franc¸ ois JM, et al. Cold-
adapted ␤-galactosidase from the Antarctic psychrophile Pseudoalteromonas
haloplanktis. Appl Environ Microbiol 2001;67:1529–35.
[17] Turkiewicz M, Kur J, Białkowska A, Cies´lin´ ski H, Kalinowska H, Bielecki S.
Antarctic marine bacterium Pseudoalteromonas sp. 22b as a source of cold-
adapted ␤-galactosidase. Biomol Eng 2003;20:317–24.
[18] Cies´lin´ ski H, Kur J, Białkowska A, Baran I, Makowski K, Turkiewicz M. Cloning,
expression, and purification of a recombinant cold-adapted ␤-galactosidase
from Antarctic bacterium Pseudoalteromonas sp. 22b. Protein Expr Purif
2005;39:27–34.
The new ␤-d-galactosidase from psychrotolerant Arthrobacter
sp. 32cB obtained and characterized in this study has interesting
properties. It exhibits maximum activity towards the synthetic sub-
strate ONPG at a temperature of 28 ◦C and a pH of 8.0, but retains
over 40% of its maximum activity at 10 ◦C. It is highly active towards
not only synthetic ␤-d-galactopyranosides, but also natural sub-
strate lactose, and is only partially inhibited by calcium ions and
d-galactose, one of the end products of lactose hydrolysis. These
features make it an attractive proposition for the production of
low-lactose dairy products under refrigerated conditions.
[19] Wierzbicka-Wos´ A, Cies´lin´ ski H, Wanarska M, Kozłowska-Tylingo K, Hilde-
brandt P, Kur J. A novel cold-active ␤-d-galactosidase from the Paracoccus
sp. 32d – gene cloning, purification and characterization. Microb Cell Fact
2011;10:108.
Furthermore, the enzyme shows transglycosylation activity at
relatively low temperatures. It is capable of synthesizing galac-
tooligosaccharides at temperatures ranging from 10 to 30 ◦C. At

A. Pawlak-Szukalska et al. / Process Biochemistry 49 (2014) 2122–2133
2133
[20] Sørensen HP, Porsgaard TK, Kahn RA, Stougaard P, Mortensen KK, Johnsen
MG. Secreted ␤-galactosidase from a Flavobacterium sp. isolated from a low-
temperature environment. Appl Microbiol Biotechnol 2006;70:548–57.
[21] Schmidt M, Stougaard P. Identification, cloning and expression of a cold-active
␤-galactosidase from a novel Arctic bacterium, Alkalilactibacillus ikkense. Envi-
ron Technol 2010;31:1107–14.
[22] Wang G, Gao Y, Hu B, Lu X, Liu X, Jiao B. A novel cold-adapted ␤-galactosidase
isolated from Halomonas sp. S62: gene cloning, purification and enzymatic
characterization. World J Microbiol Biotechnol 2013;29:1473–80.
[38] Usui T, Morimoto S, Hayakawa Y, Kawaguchi M, Murata T, Matahira Y,
et al. Regioselectivity of ␤-d-galactosyl-disaccharide formation using the ␤-
d-galactosidase from Bacillus circulans. Carbohydr Res 1996;285:29–39.
[39] Yoon J-H, Ajisaka K. The synthesis of galactopyranosyl derivatives with ␤-
galactosidases of different origins. Carbohydr Res 1996;292:153–63.
[40] Makowski K, Białkowska A, Olczak J, Kur J, Turkiewicz M. Antarctic, cold-
adapted ␤-galactosidase of Pseudoalteromonas sp. 22b as an effective tool
for alkyl galactopyranosides synthesis. Enzyme Microb Technol 2009;44:
59–64.
[23] Misselwitz B, Pohl D, Frühauf H, Fried M, Vavricka SR, Fox M. Lactose malabsorp-
tion and intolerance: pathogenesis, diagnosis and treatment. UEG J 2013;1:151.
[24] Harju M, Kallioinen H, Tossavainen O. Lactose hydrolysis and other conversions
in dairy products: technological aspects. Int Dairy J 2012;22:104–9.
[25] Mahoney RR. Galactosyl-oligosaccharide formation during lactose hydrolysis:
a review. Food Chem 1998;63:147–54.
[41] Kouptsova OS, Klyachko NL, Levashov AV. Synthesis of alkyl glycosides cat-
alyzed by ␤-glycosidases in a system of reverse micelles. Russ J Bioorg Chem
2001;27:380–4.
[42] Scheckermann C, Wagner F, Fischer L. Galactosylation of antibiotics
using the ␤-galactosidase from Aspergillus oryzae. Enzyme Microb Technol
1997;20:629–34.
[26] Gänzle MG. Enzymatic synthesis of galacto-oligosaccharides and lactose
derivatives (hetero-oligosaccharides) from lactose. Int Dairy J 2012;22:116–22.
[27] Macfarlane GT, Steed H, Macfarlane S. Bacterial metabolism and health-related
[43] Kren V, Sedmera P, Havlicek V, Fiserova A. Enzymatic galactosylation of ergot
alkaloids. Tetrahedron Lett 1992;47:7233–6.
[44] Shimizu R, Shimabayashi H, Moriwaki M. Enzymatic production of highly sol-
uble myricitrin glycosides using ␤-galactosidase. Biosci Biotechnol Biochem
2006;70:940–8.
effects of galacto-oligosaccharides and other prebiotics.
2008;104:305–44.
J Appl Microbiol
[28] Shoaf K, Mulvey GL, Armstrong GD, Hutkins RW. Prebiotic galactooligosaccha-
rides reduce adherence of enteropathogenic Escherichia coli to tissue culture
cells. Infect Immun 2006;74:6920–8.
[45] Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 16S ribosomal DNA amplification
for phylogenetic study. J Bacteriol 1991;173:697–703.
[46] Bradford MM. A rapid and sensitive method for the quantitation of micro-
gram quantities of protein utilizing the principle of protein–dye binding. Anal
Biochem 1976;72:248–54.
[29] Searle LEJ, Cooley WA, Jones G, Nunez A, Crudgington B, Weyer U, et al.
Purified galactooligosaccharide, derived from
a mixture produced by the
enzymic activity of Bifidobacterium bifidum, reduces Salmonella enterica serovar
Typhimurium adhesion and invasion in vitro and in vivo. J Med Microbiol
2010;59:1428–39.
[47] Marchler-Bauer A, Zheng C, Chitsaz F, Derbyshire MK, Geer LY, Geer RC, et al.
CDD: conserved domains and protein three-dimensional structure. Nucleic
Acids Res 2013;41:D348–52.
[30] Park A-R, Oh D-K. Galacto-oligosaccharide production using microbial ␤-
galactosidase: current state and perspectives. Appl Microbiol Biotechnol
2010;85:1279–86.
[48] Skálová T, Dohnálek J, Spiwok V, Lipovová P, Vondrácˇková E, Petroková H,
et al. Cold-active ␤-galactosidase from Arthrobacter sp. C2-2 forms compact
˚
660 kDa hexamers: crystal structure at 1.9 A resolution. J Mol Biol 2005;353:
[31] Nakagawa T, Ikehata R, Myoda T, Miyaji T, Tomizuka N. Overexpression and
functional analysis of cold-active ␤-galactosidase from Arthrobacter psychro-
lactophilus strain F2. Protein Expr Purif 2007;54:295–9.
[32] Schuster-Wolff-Bühring R, Fischer L, Hinrichs J. Production and physiological
action of the disaccharide lactulose. Int Dairy J 2010;20:731–41.
[33] Lu L, Xiao M, Xu X, Li Z, Li Y. A novel ␤-galactosidase capable of glycosyl
transfer from Enterobacter agglomerans B1. Biochem Biophys Res Commun
2007;356:78–84.
282–94.
[49] Becerra M, Cerdán E, González Siso MI. Micro-scale purification of ␤-
galactosidase from Kluyveromyces lactis reveals that dimeric and tetrameric
forms are active. Biotechnol Tech 1998;12:253–6.
[50] Santos A, Ladero M, Garcia-Ochoa F. Kinetic modeling of lactose hydroly-
sis by a ␤-galactosidase from Kluyveromices fragilis. Enzyme Microb Technol
1998;22:558–67.
[51] Jurado E, Camacho F, Luzón G, Vicaria JM. A new kinetic model proposed for
enzymatic hydrolysis of lactose by a ␤-galactosidase from Kluyveromyces frag-
ilis. Enzyme Microb Technol 2002;31:300–9.
[34] Lu L, Xiao M, Li Z, Li Y, Wang F. A novel transglycosylating ␤-galactosidase from
Enterobacter cloacae B5. Process Biochem 2009;44:232–6.
[35] Giacomini C, Irazoqui G, Gonzalez P, Batista-Viera F, Brena BM. Enzymatic syn-
thesis of galactosyl-xylose by Aspergillus oryzae ␤-galactosidase. J Mol Catal B:
Enzym 2002;19/20:159–65.
[36] Miyasato M, Ajisaka K. Regioselectivity in ␤-galactosidase-catalyzed trans-
glycosylation for the enzymatic assembly of d-galactosyl-d-mannose. Biosci
Biotechnol Biochem 2004;68:2086–90.
[37] Kim B-G, Lee K-J, Han N-S, Park K-H, Lee S-B. Enzymatic synthesis and
characterization of galactosyl-trehalose trisaccharides. Food Sci Biotechnol
2007;16:127–32.
[52] Makowski K, Białkowska A, Szcze˛sna-Antczak M, Kalinowska H, Kur J, Cies´lin´ ski
H, et al. Immobilized preparation of cold-adapted and halotolerant Antarctic ␤-
galactosidase as a highly stable catalyst in lactose hydrolysis. FEMS Microbiol
Ecol 2007;59:535–42.
[53] Lee Y-J, Kim CS, Oh D-K. Lactulose production by ␤-galactosidase in per-
meabilized cells of Kluyveromyces lactis. Appl Microbiol Biotechnol 2004;64:
787–93.