Full text of DOI:10.1038/labinvest.3780409

0023-6837/02/8202-167$03.00/0
LABORATORY INVESTIGATION
Vol. 82, No. 2, p. 167, 2002
Copyright © 2002 by The United States and Canadian Academy of Pathology, Inc.
Printed in U.S.A.
Preclinical Evaluation of a Phosphorothioate
Oligonucleotide in the Retina of Rhesus Monkey
Wei-Yong Shen, Kerryn L. Garrett, Chang-Guan Wang, Kun Zhang, Zhi-Zhong Ma,
Ian J. Constable, and P. Elizabeth Rakoczy
Centre for Ophthalmology and Visual Sciences (WYS, IJC, PER), University of Western Australia, and Department
of Molecular Ophthalmology (KLG), Lions Eye Institute, Perth, Western Australia; and Department of Ophthalmology
(CGW, KZ, ZZM), General Hospital of Chinese People’s Liberation Army, Beijing, People’s Republic of China
SUMMARY: Overexpression of vascular endothelial growth factor (VEGF) has been strongly implicated in the development of
choroidal neovascularization (CNV) in patients with age-related macular degeneration. In this study, a phosphorothioate
oligonucleotide (PS-oligo) targeting both human and rat VEGF165 genes upstream of the translation initiation code, named DS135
in this study, was evaluated for its uptake dynamics and retinal tolerance after intravitreal (IV) and subretinal (SR) injections in the
rhesus monkey. Intravitreal and SR injections of a fluorescent-labeled DS135 (FL-DS135) resulted in both dose- and
time-dependent uptake and persistence, and FL-DS135 remained detectable in the retina for at least 3 weeks after injection.
Ophthalmic examination showed transient vitreous haze after IV delivery of a high dose but not with a low dose of FL-DS135.
Histologic examination showed no evidence of retinal degeneration with respect to IV delivery. After SR delivery, however,
dose-related cellular infiltration, transient residual fluid, and slight distortion of the neuroretina were observed. The biologic
efficacy of DS135 was further assessed in a laser-induced CNV model, and development of CNV was determined by fluorescein
angiography and histologic examination. Incomplete inhibition of CNV formation was observed after IV and SR injection of DS135,
but no statistically significant difference was achieved when compared with dose-matched control of PS-oligo. Analysis of
fluorescein angiogram and histologic examination showed less than 30% incidence of CNV development in this monkey model.
Our study demonstrated that PS-oligos can be successfully introduced into the retina, although with potential limitations, after
SR delivery. DS135, a PS-oligo targeting the VEGF gene upstream of the translation initiation code, partially inhibited CNV
formation. An improved CNV model is necessary for further confirmation of the full therapeutic potency of DS135 before clinical
application. (Lab Invest 2002, 82:167–182).
ge-related macular degeneration is the leading
cause of visual loss in people more than 65 years
and irreversible damage to the RPE cells (Shiraga et al,
1998; Submacular Surgery Trials Pilot Study, 2000a
and b). Alternatively, photodynamic therapy has been
introduced with the aim of occluding the subfoveal
CNV with minimal effect on the sensory retina and the
RPE (Husain et al, 1999). A recent report from Oph-
thalmic Technology Assessments showed that photo-
dynamic therapy is effective at reducing the rate of
visual loss from predominantly classic CNV at 1 year
after treatment; however, this benefit is not significant
after 2 years of treatment (Fong, 2000).
During the past five decades researchers have
hypothesized that a “vasoformative factor” is respon-
sible for the development of ocular neovascularization
(Michaelson, 1948). In recent years there has been
extensive research on a specific cytokine, vascular
endothelial growth factor (VEGF), as a candidate for
this vasoformative factor (Campochiaro, 2000). VEGF
is an endothelial cell-specific mitogen that plays a
primary role in the angiogenic process. It is expressed
before the onset of neovascularization in animal mod-
els of proliferative retinopathy and laser-induced CNV
(Ishibashi et al, 1997; Shen et al, 1998; Sone et al,
1999). Overexpression of VEGF is also detected in
surgically removed samples from patients with dia-
betic retinopathy and subfoveal CNV (Lip et al, 2000;
Lopez et al, 1996). Recent data have demonstrated
A
old (Young, 1987). The vascular form of age-related
macular degeneration is characterized by choroidal
neovascularization (CNV) that develops underneath
the retina and disrupts the retinal pigment epithelium
(RPE) and neurosensory retina, resulting in severe
visual loss in a majority of cases (Bressler et al, 1988;
Young, 1987). According to the Macular Photocoagu-
lation Study Group guideline, laser photocoagulation
is currently the only accepted method to treat CNV but
is beneficial for only a small minority of patients with
well-demarcated “classic” CNV (Submacular Surgery
Trials Pilot Study, 2000a and b). Laser photocoagula-
tion is less dramatic in eyes with new subfoveal CNV,
associated with a high rate of CNV persistence and
recurrence, and also complicated with marked visual
loss because of the inevitable destruction of normal
retina by direct or delayed expansion of laser energy
Received September 27, 2001.
This project was partially supported by Meditech Research Ltd. (Australia)
and the Dora Lush Postgraduate Research Scholarship, Australian Na-
tional Health and Medical Research Council (WYS).
Address reprint requests to: Prof. Piroska E. Rakoczy, Department of
Molecular Ophthalmology, Lions Eye Institute, Perth, 2 Verdun Street,
Nedlands, Western Australia 6009. E-mail: rakoczy@cyllene.uwa.edu.au
Laboratory Investigation • February 2002 • Volume 82 • Number 2 167

Shen et al
that sole overexpression of VEGF by the RPE cells is
sufficient to induce CNV and that suppression of
VEGF inhibits the development of neovascularization,
indicating that VEGF is the major stimulator for the
development of CNV (Kwak et al, 2000; Ozaki et al,
2000; Schwesinger et al, 2001; Spilsbury et al, 2000).
Oligonucleotides are designed to hybridize in a
sequence-specific manner to the targeted comple-
mentary nucleic acid sequence, thereby inhibiting
protein expression (Stein and Cheng, 1993). Almost all
oligonucleotides currently being evaluated in clinical
trials are phosphorothioate oligonucleotides (PS-
oligos), in which a single nonbridging oxygen of DNA
molecules has been replaced by a sulfur to increase its
in vivo stability. Our preliminary experiments have
shown successful uptake and persistence of PS-
oligos in the retina after intravitreal (IV) injection (Ra-
koczy et al, 1996; Shen et al, 1999). Recently, a series
of sequences of the VEGF gene were assessed in an in
vitro screening system, and a PS-oligo targeting both
human and rat VEGF165 genes upstream of the trans-
lation initiation code, named DS135 in this project,
was selected (Garrett et al, 2001). This PS-oligo has
been demonstrated to suppress 35% levels of VEGF
production under hypoxic condition in vitro and inhibit
a laser-induced CNV via IV injection in the rat (Garrett
et al, 2001). In this article, we provide further preclin-
ical information on DS135 using the rhesus monkey,
aiming to evaluate its intraocular safety and biologic
efficacy in human-like retina, with a further direction to
achieve therapeutic inhibition of CNV in humans.
was observed in all five eyes that received the high
dose (50 ␮l, 0.75 nmol/␮l) of DS135 and in two of four
eyes the received the low dose (50 ␮l, 0.075 nmol/␮l)
of DS135 (Fig. 2, A and C; Table 2). Although the SR
fluid had apparently been absorbed at 3 weeks after
injection, the area of the macula that was elevated by
the SR injection was still visible, and also the neuro-
retina and RPE were slightly disturbed by the injected
DS135 solution (Fig. 2, B and D).
Uptake Dynamics of DS135 in the Retina
Considering the fact that the retinal lipofuscin-like
autofluorescence usually complicates the use of fluo-
rescent techniques (Fig. 3, A and C), we successfully
eliminated the lipofuscin-like autofluorescence by in-
cubation of sections with Sudan Black B 0.5% solu-
tion (Fig. 3, B and D). Treatment with Sudan Black B
slightly reduced the intensity of FL-DS135, however,
the reduction of labeled fluorophore was far less
dramatic than that for the lipofuscin-like compound.
Reduction of autofluorescence provides a reasonable
compromise between lipofuscin-like autofluorescence
and clearer interpretation of distribution and persis-
tence of FL-DS135 in the retina (Fig. 3, B and D).
The uptake dynamics of FL-DS135 after IV and SR
injections have been summarized in Table 3. Intraoc-
ular delivery of high doses of FL-DS135 (50 ␮l, 7.5
nmol/␮l for IV and 0.75 nmol/␮l for SR injections,
respectively) resulted in a high intensity of fluorescent
signal across the retina at 1 week after injection,
demonstrated as fluorescent signal in the RPE and
throughout all neural layers of the retina (Fig. 4, A and
E). Injections of lower doses of DS135 led to much
weaker fluorescent signal in the retina, however, pos-
itive signal was consistently detected in the RPE layer
(Fig. 4, C and G). The uptake of FL-DS135 was both
dose and time dependent. At 3 weeks after injection,
time-matched photographic exposures indicated that
the fluorescent signal in eyes that received high doses
of FL-DS135 became weaker and speckled when
compared with that at 1 week after injection (Fig. 4, B
and F). With low doses of oligos, only a very faint and
irregular fluorescent signal was detected (Fig. 4, D and
H).
Results
Ophthalmic Examinations
This study involved 56 eyes of 28 rhesus monkeys
(Table 1). The first step of this project was to investi-
gate the intraocular safety of DS135 after IV and
subretinal (SR) injections with varying doses (Table 2).
There was no apparent complication directly related to
IV and SR surgeries. Transient conjunctival irritation
was noted on the day after operation, but this usually
cleared within 2 to 3 days. All injected eyes demon-
strated clear corneas and lenses. However, vitreous
opacity was observed in two of four eyes that received
a high dose of fluorescent-labeled DS135 (FL-DS135),
demonstrated as a greenish vitreous cavity by indirect
ophthalmoscopy (Fig. 1A, Table 2). When re-examined
at 3 weeks after injection, however, the vitreous opac-
ity disappeared and translucence was restored in one
eye (Fig. 1B), whereas another one still showed vitre-
ous haze (Table 2). The vitreous opacity was not
observed in the eyes injected with a low dose of
FL-DS135 (Fig. 1, C and D; Table 2).
Toxicology by Light Microscopy
Evaluation of toxicology was concentrated at the
levels of the neuroretina, the SR space, and the RPE
layer, aiming to look for evidence of cellular infiltration,
neuroretinal degeneration, and disturbed RPE cells.
The results are summarized in Table 4. Histologic
examination, either from frozen or paraffin-embedded
sections, revealed no abnormality in the retina after IV
injection (Fig. 5, A, C, and E; Table 4). SR injection of
BSS slightly disturbed the RPE cells, demonstrated as
enlarged and hyperpigment RPE cells at the site of
injection. Cellular infiltration was minor and infrequent
(Fig. 5B, Table 4). SR administration of DS135, how-
ever, induced dose-dependent cellular infiltration in
the SR space (Fig. 5, D and F; Table 4). Disruption of
SR injection of 50 ␮l of solution induced a local
retinal detachment involving the fovea, which ex-
tended evenly out to the temporal vascular arcade
with a size of about 6000 ␮m in diameter (Fig. 2, A and
C). At 1 week after injection, none of the three eyes
injected with balanced salt solution (BSS) demon-
strated residual SR fluid. However, residual SR fluid
168 Laboratory Investigation • February 2002 • Volume 82 • Number 2

PS-Oligo in the Retina of Rhesus Monkey
␮
␮
␮
Laboratory Investigation • February 2002 • Volume 82 • Number 2 169

Shen et al
Table 2. Ophthalmic Examinations After IV and SR Injections in the Rhesus Monkey
Ophthalmic examinations
Disturbed RPE Disturbed RPE
Dose
Eyes
Haze
and retina
and retina
(off site)
Injection Solution (nmol/␮l ϫ 50 ␮l) (n) vitreous
Residual SR fluid
(on site)
IV
BSS
FL-DS135
DS135
FL-DS135
DS135
BSS
FL-DS135
DS135
Nil
7.5
7.5
0.75
0.75
Nil
0.75
0.75
0.075
1
4
2
4
2
3
3
2
4
—
2/4* 1/2†
—
Nil
Nil
Nil
Nil
Nil
Nil
Nil
Nil
Nil
Nil
—
—
—
—
—
—
—
—
—
—
—
SR
0/3*
3/3 (ϩ, ϩ, ϩ)
0/3
1/3 (ϩϩ)
1/2 (ϩ)
3/3* (ϩϩ, ϩϩ, ϩϩ); 0/1† 3/3 (ϩ, ϩ, ϩ)
2/2* (ϩ, ϩ)
1/2 (ϩ)
FL-DS135
2/4* (ϩ, ϩ); 0/2†
4/4 (ϩ, ϩ, ϩ, ϩ) 2/4 (ϩ, ϩ)
BSS, balanced salt solution; FL-, fluorescently labeled; DS135, a PS-oligo targeting VEGF. RPE, retinal pigment epithelium. The terms “on site” and “off site” are
defined as at the site of injection and at an area away from the needle penetration site, respectively. The subretinal residual fluid and disturbed RPE were graded as
follows: — no residual fluid (or no RPE and retinal disturbance); ϩ minor subretinal fluid, visible by 3-dimensional observation (or slightly disturbed RPE and retina);
ϩϩ moderate subretinal fluid, easily recognized by direct observation (or moderately disturbed RPE and retina).
The asterisks (*) indicate that the eyes were examined at 1 week, and the daggers (†) indicate that the eyes were examined continuously at 1 and 2 weeks after
injection.
Figure 1.
Fundus photographs after intravitreal (IV) injection of 50 ␮l of fluorescent-labeled DS135 (FL-DS135) at 1 week (A and C) and 3 weeks (B and D) after injection. A
and B, 7.5 nmol/␮l; C and D, 0.75 nmol/␮l. Transient vitreous haze was observed at 1 week after the high-dose injection (A).
the photoreceptor outer segments and slight distor-
tion of the neuroretina were also observed (Fig. 5F,
Table 4).
(FA), CNV formation was observed at 2 weeks and
remained for at least 8 weeks after photocoagulation.
Intraocular manipulation, either IV or SR injection of
BSS, did not affect the development of CNV (data not
shown). However, less than 30% of laser spots
showed CNV-related fluorescein leakage in this mon-
key model (23%, 26.5%, 28.6%, and 27% at 2, 4, 6,
and 8 weeks after laser photocoagulation, respective-
Development of CNV After Intense Laser
Photocoagulation
Determined by the presence of fluorescein leakage or
pooling at the late phase of fluorescein angiography
170 Laboratory Investigation • February 2002 • Volume 82 • Number 2

PS-Oligo in the Retina of Rhesus Monkey
Figure 2.
Fundus photographs after subretinal (SR) injection of 50 ␮l of FL-DS135 at 1 week (A and C) and 3 weeks (B and D) after injection. A and B, 0.75 nmol/␮l; C and
D, 0.075 nmol/␮l. Residual SR fluid existed at 1 week after injection (A and C). Although the SR fluid had apparently been absorbed at 3 weeks after injection, the
area of the macula that was elevated by the SR injection was still visible, and the neuroretina and retinal pigment epithelium (RPE) cells were slightly disturbed by
the injected DS135 solution (B and D). The plus symbols indicate the central fovea, and the arrows point to the pinpoints of glass-pipette penetration demonstrated
as minor depigmentation, respectively.
ly). Although all laser spots were delivered by the same
ophthalmologists using the same protocol, CNV for-
mation varied dramatically among individual eyes. Of
the eight eyes used to generate the CNV model, four
eyes showed no sign of CNV at any laser lesion during
the period from 2 to 8 weeks after photocoagulation.
CNV formation was finally examined histologically,
showing that new vessels developed between the
Bruch’s membrane and RPE layer or extending into
the SR space. However, 41.7% of laser lesions
showed an intact Bruch’s membrane and most of
these lesions failed to develop CNV (Fig. 6, A and B).
Generally, only 22.1% of lesions had histologic CNV.
These new vessels originated from choriocapillaries
and extended in the SR space, forming SR neovascu-
lar membrane networks (Fig. 6C).
detachment. A macular hole occurred in two of these
six eyes after SR delivery of PS-oligos, and these six
eyes were excluded from data analysis (Table 1). In the
other 12 eyes that underwent laser photocoagulation
and IV/SR injection of PS-oligos (Table 1), ophthalmic
assessment showed no abnormalities on the cornea
and lens, nor in the regions of retina away from the
injected area (data not shown).
The effect of DS135 on the development of CNV
was determined by fluorescein leakage or pooling at
the late phase of FA (Figs. 7 and 9). The data obtained
from FA were also correlated with the results of
histologic examination at 8 weeks, when the project
was terminated (Figs. 8 and 10). Intravitreal delivery of
DS135 (50 ␮l, 0.75 nmol/␮l) partially inhibited CNV
formation in certain eyes. This was mostly demon-
strated as decreased intensity of CNV-related fluores-
cein leakage during FA. However, this inhibition was
incomplete and moderate fluorescein-leaking laser
spots were still detectable, indicating slight develop-
ment of CNV networks in these eyes (Fig. 7, B, D, and
Effect of DS135 on the Development of CNV
After laser photocoagulation, six eyes showed mas-
sive SR hemorrhage that further created macular
Laboratory Investigation • February 2002 • Volume 82 • Number 2 171

Shen et al
Figure 3.
Reduction of retinal lipofuscin-like autofluorescence. Confocal laser scanning photomicrographs were taken before (A and C) and after (B and D) incubation of
cryosections in 0.5% Sudan Black B solution. Cryosections were obtained from eyes that received IV injection of high-dose FL-DS135 (A and B) or balanced salt
solution (C and D) at 1 week after injection. RPE ϭ retinal pigment epithelium; ONL ϭ outer nuclear layer; INL ϭ inner nuclear layer; GCL ϭ ganglion cell layer.
Original magnifications (A to D), ϫ50.
Table 3. Distribution and Persistence of a Fluorescently Labeled DS135 in the Retina After IV and SR Injections in the
Rhesus Monkey
Fluorescent Signal
Dose
(nmol/␮l ϫ 50 ␮l)
Time
(wk)
Eyes
(n)
Injection
IV
GCL
INL
ONL
RPE
7.5
7.5
1
3
1
3
1
3
1
3
2
2
2
2
2
1
2
2
ϩϩ
ϩ
ϩ
ϩ
ϩϩ
ϩ
ϩϩϩϩ
ϩϩϩ
ϩ
ϩ
Ϫ
ϩϩϩϩ
ϩ
ϩϩϩϩ
ϩϩ
ϩϩ
ϩ
ϩ
Ϫ
ϩϩϩ
ϩ
ϩ
0.75
0.75
0.75
0.75
0.075
0.075
ϩ
SR
ϩϩϩϩ
ϩϩ
ϩϩ
ϩ
Ϫ
ϩ
ϩ
Ϫ
ϩ
Lipofuscin-like autofluorescence was blocked by incubation of cryosections in a 0.5% Sudan Black B solution for 17 minutes. GCL, ganglion cell layer; INL, inner
nuclear layer; ONL, outer nuclear layer. The fluorescent signal was graded by the density and patterns of distribution as follows: Ϫ no signal; ϩ weak or moderate
but scattered; ϩϩ moderate and evenly distributed; ϩϩϩ strong and evenly distributed; ϩϩϩϩ very strong and evenly distributed.
F). To compare the effect of DS135 with control
PS-oligo DS131, the intensity of fluorescein leakage
was graded by semiquantification. Only the laser
lesions showing ϩ2 or higher than ϩ2 scores of
fluorescein leakage during FA were considered as
CNV related (Fig. 8A). After IV injection, no laser lesion
showed ϩ3 scores, but 34.4% of the lesions demon-
strated ϩ2 scores of CNV-related fluorescein leakage
in the DS135-treated group (n ϭ 4). The percentages
of laser lesions showing ϩ2 and ϩ3 scores in the
DS131-treated group were 20.8% and 12.5%, respec-
tively (n ϭ 3). By semiquantification, no statistically
significant difference was achieved between the
DS135 and dose-matched control DS131-treated
groups when comparing either individual scores (ϩ2
or ϩ3) or taking scores together (ϩ2 and ϩ3 scores),
as a result of dramatically individual variations in CNV
formation and the limited numbers in each group (Fig.
8A). This tendency was further supported by data
obtained from histologic examination, showing that
23.8% and 21.1% of laser lesions developed histo-
logic CNV in the DS135- and DS131-treated groups,
respectively (Fig. 8B).
In the eyes that received SR injection of PS-oligos,
the injected solution covered all laser spots, and the
SR fluid was completely absorbed at 2 weeks after
injection (data not shown). Similar to the results of IV
injection, incomplete inhibition of CNV formation was
observed in DS135-treated eyes. This was mostly
demonstrated as fewer lesions showing ϩ2 and ϩ3
scores of fluorescein leakage in the DS135-treated
group (Fig. 9, B, D, and F, and Fig. 10). The percent-
ages of leaking lesions with ϩ2 and ϩ3 scores were
12.5% and 18.8% in the DS135-treated group (n ϭ 2)
and 25% and 20.8% in the DS131-treated group (n ϭ
3), respectively (Fig. 10A). By termination of the project
172 Laboratory Investigation • February 2002 • Volume 82 • Number 2

PS-Oligo in the Retina of Rhesus Monkey
Figure 4.
Uptake dynamics of FL-DS135 after IV (A to D) and SR (E to H) delivery of 50 ␮l of FL-DS135 at 1 week (A, C, E, and G) and 3 weeks (B, D, F, and H) after injection.
A and B, 7.5 nmol/␮l; C to F, 0.75 nmol/␮l; G and H, 0.075 nmol/␮l. Delivery of FL-DS135 resulted in dose- and time-dependent distribution in the RPE and
neuroretina. ONL ϭ outer nuclear layer; INL ϭ inner nuclear layer; GCL ϭ ganglion cell layer. Original magnifications (A to H), ϫ50.
at 8 weeks after treatment, histologic examination
showed that 25% and 31.3% of laser lesions devel-
oped CNV in the DS135- and DS131-treated groups,
respectively (Fig. 10B). Again, analysis of the data
obtained from FA and histologic examination did not
show a statistically significant difference between the
DS135- and DS131-treated groups after SR injection
(p Ͼ 0.41; Fig. 10).
et al, 1999), we have injected 6-carboxyfluorescein
amidite (6-FAM), the fluorescent molecule conjugated
to the 5' terminal nucleotide for labeling DS135. Flu-
orescent signal in 6-FAM injected eyes completely
disappeared at 24 hours after injection. However,
fluorescence remained strong for at least 4 weeks in
the eyes injected with the labeled PS-oligo, indicating
that the fluorescence observed in the eyes that re-
ceived the labeled PS-oligos is associated with oligo-
nucleotide itself rather than the fluorescent molecule
that was used for the labeling (Shen et al, 1999). Using
Genescan electrophoresis, we were also able to re-
solve single nucleotide differences in length, and our
results have shown that the oligonucleotide extracted
from injected eyes was full length during the period of
2 to 6 weeks, except for minor amounts of N-1
degradation products at 8 and 12 weeks after injection
(Shen et al, 1999).
Discussion
In this study, we used FL-DS135 to monitor oligonu-
cleotide distribution, persistence, and stability in the
retina after IV and SR injections. The retinal lipofuscin-
like autofluorescence has been eliminated by incuba-
tion of sections with Sudan Black B, thus allowing for
an accurate interpretation of the uptake dynamics of
FL-DS135 in the eye. In a previous investigation (Shen
Laboratory Investigation • February 2002 • Volume 82 • Number 2 173

Shen et al
Table 4. Histologic Examination of the Eyes that Received IV or SR Injection in the Rhesus Monkey
Cellular Infiltration
Dose
Eyes
Disturbed
RPE
Retinal
Injection
IV
Solution
(nmol/␮l ϫ 50 ␮l) (n) Vitreous Retina
SR space
distortiona
BSS
FL-DS135
DS135
FL-DS135
DS135
BSS
FL-DS135
DS135
FL-DS135
DS135
Nil
7.5
7.5
0.75
0.75
Nil
0.75
0.75
0.075
0.075
1
4
2
4
2
3
3
2
4
2
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
SR
1/3 (ϩ)
1/3 (ϩϩ)
2/2 (ϩ, ϩϩ)
1/2 (ϩϩ)
2/4 (ϩ, ϩ)
0/2
0/3
2/2* (ϩ, ϩϩ)
2/2 (ϩϩϩ, ϩϩϩϩ)
2/4 (ϩ, ϩ)
1/2 (ϩ)
1/2 (ϩ)
1/2 (ϩϩ)
1/4 (ϩ)
1/2 (ϩ)
BSS, balanced salt solution; FL-, fluorescently labeled; DS135, a PS-oligo targeting VEGF; DS131, a scrambled PS-oligo. Cellular infiltration was graded according
to the number of inflammatory cells per field (ϫ 140) as follows: — no cellular infiltration; ϩ 1 to 5 cells; ϩϩ 6 to 10 cells; ϩϩϩ 11 to 20 cells; and ϩϩϩϩ
Ͼ20 cells. The disturbed RPE was graded as follows: — no RPE disturbance; ϩ proliferating RPE cells but remain one single layer; ϩϩ proliferating RPE cells, two
layers; and ϩϩϩ proliferating RPE cells, more than two layers. The asterisk (*) indicates that the maculae was visible microscopically in two of three eyes that
received subretinal injection of FL-DS135.
a Retinal distortion was evaluated in areas off the pinpoint of SR penetration and graded as — normal, ϩ minor, ϩϩ moderate, and ϩϩϩ severe changes.
Figure 5.
Histologic examination of eyes that received IV (A, C, and E) and SR (B, D, and F) injections of 50 ␮l of test solution. Photomicrographs were taken at the macula
(A, B, and D), far from the macula (C), and the central fovea (E and F), respectively. The arrows in B indicate disturbed RPE and the arrows in D and F indicate
inflammatory cells in the subretinal space (SRs). Slight disruption of the photoreceptor outer segments and distortion of the neuroretina were observed in F. A, DS135,
7.5 nmol/␮l, 3 weeks after injection. B, BSS, 1 week after injection. C-E, DS135, 0.75 nmol/␮l, 1 week after injection. F, DS135, 0.075 nmol/␮l, 1 week after injection.
ONL ϭ outer nuclear layer; INL ϭ inner nuclear layer; GCL ϭ ganglion cell layer. A to F, Hematoxylin and eosin staining. Original magnifications (A to C, E and F),
ϫ70; D, ϫ140.
In this study, IV injection of a high dose of FL-DS135
(50 ␮l, 7.5 nmol/␮l) resulted in strong fluorescence
distribution in the RPE and all neural layers at 1 week
after injection, and the uptake dynamics were both
dose and time dependent. Although the intensity of
the fluorescent signal dramatically declined in the
174 Laboratory Investigation • February 2002 • Volume 82 • Number 2

PS-Oligo in the Retina of Rhesus Monkey
the feasibility of SR administration of DS135 for the
treatment of CNV. To our knowledge, this is the first
study to demonstrate successful delivery of PS-oligos
through SR injection in the monkey. In this study, the
dosages used for SR injection (50 ␮l, 0.75 or 0.075
nmol/␮l) were 10 times lower than those used for IV
injection (50 ␮l, 7.5 or 0.75 nmol/␮l), however, similar
or even better uptake dynamics were achieved. Inter-
estingly, comparing SR delivery with IV injection, the
actual residence time of FL-DS135 in the retina was
not remarkably different. The delivered FL-DS135 re-
mained detectable for up to 3 weeks with both situa-
tions, indicating a much slower rate of PS-oligo clear-
ance from the retina when compared with the vitreous.
This opens up a real opportunity in the use of SR
delivery of small doses of PS-oligos to introduce direct
delivery and avoid the short half-life of PS-oligos in the
vitreous, thus reducing the global risk of retinal toxicity
and minimizing the cost of molecular products.
An important concern before efficacy study is to
investigate the intraocular safety. The monkey has a
vascularized retina and vitreous volume very similar to
those in humans. More importantly, the monkey is the
only species of experimental animal who possesses a
macula, which is a particularly important issue for
evaluation of intraocular safety when the treatment
strategy targets this confined area. With the highest
dose for IV injection (50 ␮l, 7.5 nmol/␮l), the final
concentration in the vitreous cavity is close to those in
the rat eye where 2.0 ␮l of 5.0 to 10 nmol/␮l PS-oligos
were injected but without showing pathogenicity
(Shen et al, 1999). This calculation was based on the
assumption that the vitreous volume in monkey eye is
1.5 ml and the vitreous volume of rat eye is 50 ␮l. After
IV delivery in this study, data from histologic exami-
nation did not show toxicity to the retina. However,
indirect ophthalmoscopy revealed transient vitreous
haze with a high dosage (50 ␮l, 7.5 nmol/␮l) of DS135,
indicating a possibly transient inflammatory response
in the vitreous cavity. To date, most studies have
involved IV administration of PS-oligo into the eye
(Dvorchik and Marquis, 2000; Flores-Aguilar et al,
1997; Hangai et al, 1998; Leeds et al, 1997, 1998;
Ogata et al, 1999; Rakoczy et al, 1996; Robinson et al,
1996; Shen et al, 1999; Stone and Jaffe, 2000). It has
been reported that high doses of PS-oligos after IV
injection induce cataract, severe inflammatory re-
sponse, increased intraocular pressure, maculopathy,
and permanent retinal damage (Detrick, 2001;
Dvorchik and Marquis, 2000; Flores-Aguilar et al,
1997; Stone and Jaffe, 2000). These adverse effects
could be serious limitations to the potential use of high
doses of PS-oligos by IV injection in humans.
Figure 6.
Development of choroidal neovascularization (CNV) after laser photocoagula-
tion. A, photomicrograph showing SR scar tissue formation of one laser spot
and the surrounding retina. B, higher magnification of A showing the intact
Bruch’s membrane (arrows). C, SR neovascular membrane networks originate
from the choriocapillaries passing through the broken Bruch’s membrane. BM
ϭ Bruch’s membrane.
neuroretina at 3 weeks after injection, a relatively
stronger signal was consistently detected in the RPE
layer. This is consistent with previous data obtained
from the rat study (Rakoczy et al, 1996; Shen et al,
1999) and also very similar to a previous report that
PS-oligos remained detectable for up to 14 days after
IV injection in the monkey (Leeds et al, 1998). Although
IV injection is a well-established technique and deliv-
ery of high doses of PS-oligos resulted in a wide
distribution throughout the retina, in the clinical reality,
it might be more practical to deliver small doses of
PS-oligo into a confined area where the diseased
condition exists. In this study, we also investigated the
uptake dynamics after SR injection, aiming to explore
We also investigated the SR administration route,
with the aim of introducing direct delivery with re-
duced doses of DS135. SR injection is a basic and
essential procedure during complicated macular sur-
geries (Submacular Surgery Trials Pilot Study, 2000a
and b). This procedure requires only a pinpoint of
retinotomy. A single procedure of SR injection is
clinically acceptable provided the delivered DS135 is
nontoxic and efficacious. In the present study, al-
Laboratory Investigation • February 2002 • Volume 82 • Number 2 175

Shen et al
Figure 7.
Fundus photographs (A and B) and fluorescein angiograms (C to F) after IV delivery of 50 ␮l of 0.75 nmol/␮l DS131 (A, C, and E) and DS135 (B, D, and F). DS131
is a random control phosphorothioate oligonucleotide (PS-oligo) for DS135. DS135 is a PS-oligo targeting VEGF165 mRNA upstream of the translation initiation codon.
Photographs were taken at early (C and D) and late (E and F) phases of angiography at 8 weeks after injection. Incomplete inhibition of CNV formation was observed
in DS135-treated eyes (B, D, and F). The plus symbols in A and B indicate the central fovea.
though no serious complication was directly attributed
to the SR surgery itself, dose-dependent residual fluid
and cellular infiltration in the SR space and slight
distortion of the neuroretina have been observed.
These adverse effects were particularly evident with
the highest dose (50 ␮l, 0.75 nmol/␮l), indicating that
the volume and concentration of DS135 needs to be
further adjusted. Although the cellular infiltration could
be minimized by IV use of certain amounts of anti-
inflammatory drugs (Danis et al, 2000; Flores-Aguilar
et al, 1997; Shen et al, 2000), our results may also
imply that the undesired side effects of DS135 are
associated with the biochemical structure of PS-oligo
(Black et al, 1994; Dvorchik and Marquis, 2000). It has
been reported that chimeric oligonucleotides consist-
ing of a mixed phosphodiester-phosphorothioate
backbone and having 2-methoxyrobonucleotides
modification, dramatically eliminated the side effects
of PS-oligos but retained the effective potency in the
central nerve system (Ho et al, 1998). Further modifi-
cation of the PS-oligos is particularly important for SR
delivery because minor cellular inflammation in the
central fovea could dramatically impair vision.
Effective inhibition of CNV depends on careful
choice of the genes targeted. The VEGF gene was
chosen because it is currently the most prominent
angiogenic factor associated with the development of
CNV (Mousa et al, 1999; Okamoto et al, 1997; Ozaki et
al, 1998; Spilsbury et al, 2000). It has been reported
that sole overexpression of VEGF by the RPE cells is
176 Laboratory Investigation • February 2002 • Volume 82 • Number 2

PS-Oligo in the Retina of Rhesus Monkey
Figure 8.
Effects of DS135 on the development of CNV after IV injection. The development of CNV was quantified by scoring the appearance of laser lesions during fluorescein
angiography (FA) (see “Materials and Methods”). Laser spots scoring 2ϩ or higher were considered as CNV-related lesions. No laser lesions in the DS135-treated
group showed strong fluorescein leakage (scores ϩ3), but statistical analysis showed no significant difference between the DS135- and DS131-treated groups (Fig.
8A, p ϭ 0.09, n ϭ 4 and 3, respectively). Nor was significant difference achieved when analyzing ϩ2 scores (p ϭ 0.35) or taking scores ϩ2 and ϩ3 together (p
ϭ 0.93). This tendency was also supported by data obtained from histologic examination (Fig. 8B, p ϭ 0.91). ST ϭ scar tissue.
sufficient to induce CNV, and suppression of VEGF
inhibits the development of neovascularization (Kwak
et al, 2000; Ozaki et al, 2000; Schwesinger et al, 2001;
Spilsbury et al, 2000). The sequence of DS135 is
targeted to the 5'-untranslated region of the VEGF
gene, a region defined as an internal ribosome entry
site (IRES) (Huez et al, 1998). These large sequences
(more than 1000 base pairs) have been identified in a
number of proteins and are thought to regulate trans-
lation initiation as an alternate mechanism to the
cap-dependent process mediated by elements in the
3'-untranslated region. An IRES containing 132 bases
immediately upstream of the AUG showed substan-
tially greater efficiency (between 4.4 and 40 times)
than the full length of the IRES in VEGF mRNA
translation (Stein et al, 1998). The DS135 corresponds
to nucleotides 30 to 50 upstream of the AUG start
codon and coincides with this region. It is assumed
that DS135 binds to the IRES sequence and prevents
the complex folding patterns required for efficient
ribosome entry (Huez et al, 1998), therefore preventing
translation of up-regulated VEGF mRNA. In our own
hands, the ability of DS135 to down-regulate VEGF
has been demonstrated by Western analysis, ELISA,
and quantitative Taqman RT-PCR techniques using
the D407 RPE cell line before the efficacy study in the
monkey (Garrett et al, 2001). By semiquantified West-
ern blot analysis, DS135 showed a dose-dependent
inhibition of VEGF protein production, with 66% and
93% reduction of VEGF levels when treated with 1.0
and 5.0 ␮M DS135 in vitro. Furthermore, analysis by
ELISA demonstrated a statistically significant reduc-
tion in VEGF protein levels with 0.5 ␮M DS135 treat-
ment to approximately 65% of levels in controls (35%
inhibition) under hypoxic condition, and DS135 signif-
icantly suppressed CNV formation in the laser-
induced rat CNV model (Garrett et al, 2001). Although
DS135 has shown a reduction of CNV formation in the
laser-induced CNV model, the inhibitory effect of
DS135 on VEGF production in the monkey eye would
need to be fully assessed before clinical trial
consideration.
The laser-induced CNV has been considered as a
reproducible and clinically relevant model, and cur-
rently it is the most commonly used CNV model in eye
research. Previous investigations have demonstrated
a preferential distribution of PS-oligo at laser lesions
(Ogata et al, 1999; Shen et al, 1999). The accumulation
of PS-oligos at laser lesions might be associated with
altered cell membranes with a higher affinity for fusion
but most likely reflects the activity of the cells during
the development of CNV (Zhang et al, 1993). It has
been confirmed that the majority of cells that take up
PS-oligo at laser lesions are proliferating RPE, macro-
phages, and activated choroidal cells, which are also
the main sources of overexpression of VEGF in the
laser-induced CNV (Ishibashi et al, 1997; Shen et al,
1998; Yi et al, 1997) and in neovascular membranes of
humans (Lopez et al, 1996). This coincidentally allows
us to specifically deliver DS135 into the cells overex-
pressing VEGF during the development of CNV.
Despite a promising inhibitory effect of DS135 in the
rat (Garrett et al, 2001), the inhibition was incomplete
and lacked a statistically significant difference in this
particular study in the monkey. There have been
several investigations in the use of antisense PS-
oligos targeting VEGF to inhibit retinal and choroidal
neovascularization (Ogata et al, 1999; Robinson et al,
1996). However, data from all previous investigations
demonstrated either incomplete or ineffective inhibi-
tion (Ogata et al, 1999; Robinson et al, 1996). Incom-
plete inhibition of CNV by DS135 might indicate that
other angiogenic factors are involved in the process of
CNV, implying the complexity regarding the pathogen-
esis of CNV (Mousa et al, 1999; Takahashi et al, 2000).
From our own data, we cannot rule out that there is a
Laboratory Investigation • February 2002 • Volume 82 • Number 2 177

Shen et al
Figure 9.
Fundus photographs (A and B) and fluorescein angiograms (C to F) after SR delivery of 50 ␮l of 0.075 nmol/␮l DS131 (A, C, and E) and DS135 (B, D, and F),
respectively. Fluorescent photographs were taken at early (C and D) and late (E and F) phases of angiography at 8 weeks after injection. Incomplete inhibition of CNV
formation was observed in the DS135-treated eye (B, D, and F). The arrows in A and B indicate the area contacted by the injected solution, and the plus symbols
indicate the central fovea, respectively.
species difference in drug reaction between the rat
and monkey. However, incomplete inhibition might
also indicate a low therapeutic index of DS135, sug-
gesting that the targeted sequence and chemistry
need further optimization. It would seem that no group
to date has been successful in defining an oligonucle-
otide sequence that completely inhibits VEGF mRNA
translation and new vessel formation in the eye or any
other system. Although intraocular injection of DS135
at high doses resulted in a high intensity of PS-oligo
distribution, the actual therapeutic concentration re-
quired in situ is unknown. In addition, our study lacked
administration of high doses of DS135 (50 ␮l, 7.5 nmol/␮l
for IV delivery and 0.75 nmol/␮l for SR injection) for the
efficacy test because of the risks of cellular infiltration,
vitreous haze, and prolonged iatrogenic macular detach-
ment. Administration of high doses of DS135 might
improve the inhibitory effect but might also further com-
plicate the issue of retinal safety.
The predominant methods of determining CNV for-
mation are FA and histologic examination. Since the
location of laser lesions is difficult to control on sample
embedding and sectioning, direct correlation of the
status of individual laser lesions during FA with their
histologic changes is extremely labor intensive and
technically difficult. In the CNV model of the present
study, FA has demonstrated 23% to 28.6% of laser
lesions showing 2ϩ grades or higher of fluorescein
leakage during FA in the interval from 2 to 8 weeks
after photocoagulation; this corresponded to 22.1% of
178 Laboratory Investigation • February 2002 • Volume 82 • Number 2

PS-Oligo in the Retina of Rhesus Monkey
Figure 10.
Effects of DS135 on the development of CNV after SR injection. The development of CNV was quantified by scoring the appearance of laser lesions during FA (see
“Materials and Methods”). Laser spots scoring 2ϩ or higher were considered as CNV-related lesions. Analysis of the data obtained from FA (A) and histologic
examination (B) did not show significant differences between the DS135-treated (n ϭ 2) and the DS131-treated (n ϭ 3) groups (p Ͼ 0.41). ST ϭ scar tissue.
histologic CNV by termination at 8 weeks after photo-
coagulation. After intraocular delivery of DS135 or
DS131, 25% to 42% of lesions showed 2ϩ grades or
higher of fluorescein leakage by FA, corresponding to
21.1% to 31.3% histologic CNV at termination. Gen-
erally, the percentages of CNV determined by FA were
higher than those confirmed by histologic examina-
tion, indicating that the lesions with ϩ2 or higher
scores of fluorescein leakage actually involved certain
laser spots that formed scar tissue rather than CNV
development (Figs. 8 and 10). The protocol used in
this study has been reported to result in 40% inci-
dence of CNV-related fluorescein leakage (Ryan,
1979). In our particular case, in addition to a lower rate
(around 30%) of CNV formation, our data also dem-
onstrated dramatic variations in CNV development
among individual eyes, indicating a potential limitation
of this monkey model for statistical evaluation of
antiangiogenic therapy. According to a previous inves-
tigation, the rate of laser-induced CNV in the monkey
also varied dramatically, with the highest rate when
laser spots were delivered around the macula (Ryan,
1979). Data from our histologic examination revealed
that up to 41.7% of laser lesions had an intact Bruch’s
membrane, indicating a higher laser energy damage is
required to improve the success rate of CNV. With the
current protocol for laser photocoagulation, however,
23% (6 of 26 eyes) of eyes have been excluded from
the data analysis because of massive SR hemorrhage
induced by laser photocoagulation. The massive SR
hemorrhage usually resulted in scar tissue formation
rather than the development of CNV. In addition, the
SR hemorrhage or excessive exudation after photo-
coagulation made SR injection extremely difficult, with
the result that a macular hole was usually induced and
the injected solution leaked into the vitreous cavity.
After intense laser photocoagulation, around 50%
to 80% of lesions developed CNV in the rat model
(Garrett et al, 2001; Shen et al, 1998). Intravitreal
administration of DS135 has shown 50% inhibition of
CNV formation in the rat eye when approximately 20
eyes per group were used to achieve a statistically
significant difference (p Ͻ 0.002, Garrett et al, 2001).
Comparing the relative volume of the vitreous, the
effective DS135 concentration after IV injection of a
high dose of DS135 in the present study is very close
to that used in the rat experiment. Based on the 30%
to 40% success rate in the monkey CNV model, a
computerized power calculation indicates that at least
25 eyes per group would be required to satisfy a statis-
tically significant difference (Mendoza and Stafford,
2001; Dr. Jorge L. Mendoza, University of Oklahoma,
personal communication, 2001). This sample size esti-
mation was based on the assumption that VEGF is the
sole angiogenic factor responsible for the development
of CNV in the eye. In the future, the monkey CNV model
could be improved by using higher laser energy. Laser
spots should be delivered around the macula with an
increased distance from the central fovea, thus decreas-
ing the occurrence of SR hemorrhage. The fixed laser
protocol should be replaced by adjusting the laser en-
ergy (power density and duration) to achieve SR heating
bleb formation (indicating a break of the Bruch’s mem-
brane). Considering the similarity between human and
monkey eyes, this study has presented essential infor-
mation for clinical trial consideration. There might be
hope for a statistically significant inhibition provided the
monkey CNV model is improved and the targeted oligo-
nucleotide sequence as well as the in vivo doses are
further optimized.
Materials and Methods
Oligonucleotide Design and Synthesis
Two PS-oligos, DS135 (5'GAGCCGGAGAGG-
GAGCGCGA; targeting both human and rat VEGF165
Laboratory Investigation • February 2002 • Volume 82 • Number 2 179

Shen et al
genes upstream of the translation initiation codon) and
DS131 (5'AGGACCTGTCAATTCCGGTG; a random
control with no known homology to any sequence
currently available in the genome database), were
synthesized commercially by Proligo (Boulder, Colo-
rado), purified with HPLC, and tested for toxicology.
The DS135 has the same oligonucleotide sequence as
that used in a rat experiment (DS085; Garrett et al,
2001). To assess cellular uptake and persistence of
PS-oligo in the retina, a fluorescent-labeled DS135
compound was synthesized on an ABI Model 392
DNA synthesizer (ABI, Foster City, California) with
6-FAM (ABI-Foster City) conjugated to the 5' terminal
nucleotide. The FL-DS135 was purified by anion ex-
change, and the concentrations of all PS-oligos were
determined by optical density at 260 nm as reported
previously (Garrett et al, 2001; Shen et al, 1999).
retina, the second assistant slowly injected 10 to 20 ␮l
of solution to achieve a SR bleb of about 1000-␮m
diameter. Then the tip of the glass pipette was ad-
vanced to the edge of the precreated SR bleb, and the
second assistant slowly finished the injection. After
delivery of 50 ␮l of solution, the microdelivery system
and the fiberoptic tube were withdrawn and the scle-
rotomies immediately plugged. The sclerotomies were
closed by 7-0 nylon sutures and the conjunctival flaps
repositioned. A mixture of gentamicin (2 mg) and
dexamethasone (2.5 mg) was injected under the infe-
rior conjunctiva. Atropine (1% ointment) and tetracy-
cline (0.5% ointment) were applied to the conjunctival
sac and the eyelids taped closed.
Model of CNV and Intraocular Delivery of PS-Oligos
Intense argon laser photocoagulation was performed
to create a model of CNV as previously described
(Ryan, 1979). Briefly, eight laser spots were applied
around the macula of each eye in the manner of a grid
with a protocol of 700 mW power intensity, 100 ␮m
spot size, and 0.1s duration. The distance from each
laser spot to the central fovea was 0.5 to 1.0 disc
diameter size. Care was taken to avoid damaging the
fovea. On the day after laser photocoagulation, 50 ␮l
of test solution was injected intravitreally or subreti-
nally to cover the photocoagulated area using the
techniques described above.
Animal Preparation and Anesthesia
Twenty-eight rhesus monkeys ranging in age from 4 to
6 years and weighing between 6 and 8 kg were used
in accordance with the ARVO Statement on the Use of
Animals in Vision and Ophthalmic Research. The ani-
mals were anesthetized with intravenous thiopantlum
natricum at a concentration of 25 mg/ml, with a first
dose of 15 mg/kg. A trained anesthetic technician
monitored the airway, respiration, and pulse during the
injection. Anesthesia was maintained by intermittent
intravenous supplements. Topical anesthesia was
supplemented by 0.5% Decaine drops. Pupils were
dilated with 2.5% phenylephrine and 1% tropicamide
drops.
Ophthalmic Examinations and FA
For the eyes used in toxicity study (Table 1), fundus
photography was taken at 1 and 3 weeks to monitor
changes of the retina. For those animals treated by
laser photocoagulation that subsequently underwent
IV or SR injection, fundus photography and FA were
performed at 8 weeks after treatment to monitor the
fundus changes and the CNV development. FA was
performed by intravenous injection of 10% fluorescein
sodium, 0.1 ml/kg of body weight. Identification of
CNV was based on fluorescein behavior through the
phases of angiogram from 20 seconds to 10 minutes
after dye injection. The status of laser spots during FA
was graded in a masked fashion by two examiners
using reference angiograms, and the scores were
recorded as follows: 0, no fluorescein staining; 1ϩ,
slight fluorescein staining; 2ϩ, moderate fluorescein
leakage; and 3ϩ, prominent fluorescein leakage or
pooling. When two scores for a lesion did not coin-
cide, the higher score was used. The appearance of
CNV was characterized by continuous fluorescein
leakage or pooling during FA. Laser spots scored 2ϩ
or higher were considered to be related to the devel-
opment of CNV.
Microdelivery System and Intravitreal and Subretinal
Injections
A custom-made microdelivery system consisted of a
100-␮l Hamilton syringe, a 10-cm connecting thick-
walled silicon tube with external and internal diame-
ters of 1.0 and 0.5 mm, respectively, and a 20-gauge
glass pipette of 8-cm length drawn out to a tip
diameter of 120 ␮m. The tip was curved at 120
degrees and beveled to facilitate penetration of the
retina. All surgical procedures were performed under
full aseptic conditions. The conjunctiva was opened
from superior nasal to inferior temporal for intraocular
injection. After careful cautery of blood vessels on the
scleral surface, two ports were made with a 20-gauge
V-lance at clock locations 1:30 and 10:30 through the
pars plana. A 20-gauge fiberoptic probe was inserted
into one port for endoillumination and another port
was used for glass micropipette insertion. Intravitreal
injection was a one-stage procedure. The tip of the
glass pipette was gently and slowly advanced to the
macular surface, and the solution was injected as
close to the retinal surface as possible. For SR injec-
tion, a site was selected 500 ␮m superior to the fovea,
avoiding visible retinal blood vessels. The tip of the
micropipette was gently advanced at an oblique angle
through the retina, trying not to disturb the underlying
pigment epithelium. Once the tip was visible under the
Reduction of Lipofuscin-Like Autofluorescence and
Confocal Laser Scanning Microscopy
After fundus photography, eyes receiving FL-DS135
and BSS were enucleated at 1 and 3 weeks after
injection (Table 1) and the macula was marked with
India ink. Eyes were snap-frozen in optimal cutting
180 Laboratory Investigation • February 2002 • Volume 82 • Number 2

PS-Oligo in the Retina of Rhesus Monkey
Danis RP, Ciulla TA, Pratt LM, and Anliker W (2000). Intrav-
itreal triamcinolone acetonide in exudative age-related mac-
ular degeneration. Retina 20:244–250.
temperature compound using a 50-ml centrifuge tube
and stored at Ϫ80° C for cryosectioning. Cryosections
of 12- to 14-␮m thickness were cut at Ϫ20° C (Jung
Frigocut 2800N Cryostat, Leica, Germany). Consider-
ing that the presence of lipofuscin-like autofluores-
cence in the retina complicates the use of fluorescent
microscopy, autofluorescence (mainly caused by lipo-
fuscin granules in the RPE) was blocked by a specially
developed procedure consisting of incubating the
cryosections with 0.5% Sudan Black B in 70% ethanol
for 17 minutes before confocal laser scanning
microscopy.
Detrick B (2001). Inhibition of human cytomegalovirus repli-
cation in a human retinal epithelial cell model by antisense
oligonucleotides. Invest Ophthalmol Vis Sci 42:163–169.
Dvorchik BH and Marquis JK (2000). Disposition and toxicity
of a mixed backbone antisense oligonucleotide, targeted
against human cytomegalovirus, after intravitreal injection of
escalating single doses in the rabbit. Drug Metab Dispos
28:1255–1261.
Flores-Aguilar M, Besen G, Vuong C, Tatebayashi M, Mun-
guia D, Gangan P, Wiley CA, and Freeman WR (1997).
Evaluation of retinal toxicity and efficacy of anti-
cytomegalovirus and anti-herpes simplex virus antiviral
phosphorothioate oligonucleotides ISIS 2922 and ISIS 4015.
J Infect Dis 175:1308–1316.
Histologic Evaluation
At 3 and 8 weeks after oligo delivery, followed by
fundus photography and FA, the animals that received
unlabeled PS-oligos were euthanized and their eyes
were enucleated and processed for paraffin embed-
ding (Table 1). These eyes were fixed in 4%
paraformaldehyde-0.25% glutaraldehyde in 0.1 M PBS
for 3 days. Paraffin-embedded sections of 5-␮m thick-
ness were cut to assess the retinal toxicology after IV
or SR injection of DS135. For the eyes used for
efficacy study, serial sections were collected when the
first laser lesion was recognized. This resulted in 100
to 120 slides from each eye, with three sections on
each slide. Hematoxylin and eosin staining was per-
formed every 20 slides to determine the development
of CNV after laser photocoagulation and PS-oligo
treatment (DS135 or DS131).
Fong DS (2000). Photodynamic therapy with verteporfin for
age-related macular degeneration. Ophthalmology 107:
2314–2317.
Garrett KL, Shen WY, and Rakoczy PE (2001). In vivo use of
oligonucleotides to inhibit choroidal neovascularisation in the
eye. J Gene Med 3:373–383.
Hangai M, Tanihara H, Honda Y, and Kaneda Y (1998). In vivo
delivery of phosphorothioate oligonucleotides into murine
retina. Arch Ophthalmol 116:342–348.
Ho SP, Livanov V, Zhang W, Li JH, and Lesher T (1998).
Modification of phosphorothioate oligonucleotides yields po-
tent analogs with minimal toxicity for antisense experiments
in the CNS. Mol Brain Res 62:1–11.
Huez I, Creancier L, Audigier S, Gensac MC, Prats AC, and
Prats H (1998). Two independent internal ribosome entry
sites are involved in translation initiation of vascular endothe-
lial growth factor mRNA. Mol Cell Biol 18:6178–6190.
Statistical Evaluation
Independent sample t tests were used to compare
mean score and percentage of CNV-related fluores-
cein leaking laser spots (scores 2ϩ or higher) and the
rate of histologic CNV in DS135 and the dose control
DS131-treated eyes. Statistical significance was de-
fined as p Ͻ 0.05.
Husain D, Kramer M, Kenny AG, Michaud N, Flotte TJ,
Gragoudas ES, and Miller JW (1999). Effects of photody-
namic therapy using verteporfin on experimental choroidal
neovascularization and normal retina and choroid up to 7
weeks after treatment. Invest Ophthalmol Vis Sci 40:2322–
2331.
Ishibashi T, Hata Y, Yoshikawa H, Nakagawa K, Sueishi K,
and Inomata H (1997). Expression of vascular endothelial
growth factor in experimental choroidal neovascularization.
Graefes Arch Clin Exp Ophthalmol 235:159–167.
Acknowledgements
The authors thank Miss Tammy Zaknich for histo-
logic preparations, Ms. Shu-Yi Han for fundus photog-
raphy, and Dr. Anthony Kicic for proofreading of this
manuscript. Also, the authors acknowledge Dr. Jorge
L. Mendoza, Psychology Department, University of
Oklahoma, Norman, Oklahoma, for the power calcu-
lation using a customer-designed computer package.
Kwak N, Okamoto N, Wood JM, and Campochiaro PA (2000).
VEGF is major stimulator in model of choroidal neovascular-
ization. Invest Ophthalmol Vis Sci 41:3158–3164.
Leeds JM, Henry SP, Bistner S, Scherrill S, Williams K, and
Levin AA (1998). Pharmacokinetics of an antisense oligonu-
cleotide injected intravitreally in monkeys. Drug Metab Dis-
pos 26:670–675.
References
Leeds JM, Henry SP, Truong L, Zutshi A, Levin AA, and
Kornbrust D (1997). Pharmacokinetics of a potential human
cytomegalovirus therapeutic, a phosphorothioate oligonucle-
otide, after intravitreal injection in the rabbit. Drug Metab
Dispos 25:921–926.
Black LE, Farrelly JG, Cavagnaro JA, Ahn CH, Degeorge JJ,
Taylor AS, Defelice AF, and Jordan A (1994). Regulatory
considerations for oligonucleotide drugs: Updated recom-
mendations for pharmacology and toxicology studies. Anti-
sense Res Dev 4:299–301.
Lip PL, Belgore F, Blann AD, Hope-Ross MW, Gibson JM,
and Lip GYH (2000). Plasma VEGF and soluble VEGF recep-
tor FLT-1 in proliferative retinopathy: Relationship to endo-
thelial dysfunction and laser treatment. Invest Ophthalmol Vis
Sci 41:2115–2119.
Bressler NM, Bressler SB, and Fine SL (1988). Age-related
macular degeneration. Surv Ophthalmol 32:375–413.
Campochiaro PA (2000). Retinal and choroidal neovascular-
ization. J Cell Physiol 184:301–310.
Laboratory Investigation • February 2002 • Volume 82 • Number 2 181

Shen et al
Lopez PF, Sippy BD, Lambert HM, Thach AB, and Hinton DR
(1996). Transdifferentiated retinal pigment epithelial cells are
immunoreactive for vascular endothelial growth factor in
surgically excised age-related macular degeneration-related
choroidal neovascular membranes. Invest Ophthalmol Vis
Sci 37:855–868.
Shen WY, Garrett KL, Da Cruz L, Constable IJ, and Rakoczy
PE (1999). Dynamics of phosphorothioate oligonucleotides in
normal and laser photocoagulated retina. Br J Ophthalmol
83:852–861.
Shen WY, Yu MJT, Barry CJ, Constable IJ, and Rakoczy PE
(1998). Expression of cell adhesion molecules and vascular
endothelial growth factor in experimental choroidal neovas-
cularisation in the rat. Br J Ophthalmol 82:1063–1071.
Mendoza JL and Stafford KL (2001). Confidence intervals,
power calculation, and sample size estimation for the
squared multiple correlation coefficient under the fixed and
random regression models: A computer program and useful
standard tables. Educ Psychol Meas 61:650–667.
Shiraga F, Takasu I, and Shiragami C (1998). Treatment
options in subfoveal choroidal neovascularization secondary
to age-related macular degeneration. Sem Ophthalmol 13:
31–39.
Michaelson IC (1948). The model of development of vascular
system of the retina, with some observation on its signifi-
cance for certain retinal disease. Trans Ophthalmol Soc UK
68:137–180.
Sone H, Kawakami Y, Kumagai AK, Oduka Y, Sekine Y,
Honmura S, Segawa T, Suzuki H, Yamashita K, and Yamada
N (1999). Effects of intraocular or systemic administration of
neutralizing antibody against vascular endothelial growth
factor on the murine experimental model of retinopathy. Life
Sci 65:2573–2580.
Mousa SA, Lorelli W, and Campochiaro PA (1999). Role of
hypoxia and extracellular matrix-integrin binding in the mod-
ulation of angiogenic growth factors secretion by retinal
pigmented epithelial cells. J Cell Biochem 74:135–143.
Spilsbury K, Garrett KL, Shen WY, Constable IJ, and Rakoczy
PE (2000). Overexpression of vascular endothelial growth
factor (VEGF) in the retinal pigment epithelium leads to the
development of choroidal neovascularization. Am J Pathol
157:135–144.
Ogata N, Otsuji T, Matsushima M, Kimoto T, Yamanaka R,
Takahashi K, Wada M, Uyama M, and Kaneda Y (1999).
Phosphorothioate oligonucleotides induction into experi-
mental choroidal neovascularization by HVJ-liposome sys-
tem. Curr Eye Res 18:261–269.
Stein CA and Cheng YC (1993). Antisense oligonucleotides
as therapeutic agents: Is the bullet really magical? Science
261:1004–1012.
Okamoto N, Tobe T, Hackett SF, Ozaki H, Vinores MA,
Larochelle W, Zack DJ, and Campochiaro PA (1997). Trans-
genic mice with increased expression of vascular endothelial
growth factor in the retina: a new model of intraretinal and
subretinal neovascularization. Am J Pathol 151:281–291.
Stein I, Itin A, Einat P, Slaliter R, Grossman Z, and Keshet E
(1998). Translation of vascular endothelial growth factor
mRNA by internal ribosome entry: Implications for translation
under hypoxia. Mol Cell Biol 18:3112–3119.
Ozaki H, Okamoto N, Ortega S, Chang M, Ozaki K, Sadda S,
Vinores MA, Derevjanik N, Zack DJ, Basilico C, and Cam-
pochiaro PA (1998). Basic fibroblast growth factor is neither
necessary nor sufficient for the development of retinal neo-
vascularization. Am J Pathol 153:757–765.
Stone TW and Jaffe GJ (2000). Reversible bull’s-eye macu-
lopathy associated with intravitreal fomivirsen therapy for
cytomegalovirus retinitis. Am J Ophthalmol 130:242–243.
Submacular Surgery Trials Pilot Study (2000a). Submacular
surgery trials randomized pilot trial of laser photocoagulation
versus surgery for recurrent choroidal neovascularization
secondary to age-related macular degeneration: I. Ophthal-
mic outcomes: Submacular surgery trials pilot study report
number 1. Am J Ophthalmol 130:387–407.
Ozaki H, Okamoto N, Ortega S, Chang M, Ozaki K, Sadda S,
Vinores MA, Ozaki H, Seo MS, Ozaki K, Yamada H, Yamada
E, Okamoto N, Hofmann F, Wood JM, and Campochiaro PA
(2000). Blockade of vascular endothelial cell growth factor
receptor signaling is sufficient to completely prevent retinal
neovascularization. Am J Pathol 156:697–707.
Submacular Surgery Trials Pilot Study (2000b). Submacular
Surgery Trials randomized pilot trial of laser photocoagula-
tion versus surgery for recurrent choroidal neovascularization
secondary to age-related macular degeneration: II. Quality of
life outcomes: Submacular Surgery Trials Pilot Study Report
Number 2. Am J Ophthalmol 130:408–418.
Rakoczy PE, Lai MC, Watson M, Seydel U, and Constable IJ
(1996). Targeted delivery of an antisense oligonucleotide in
the retina: Uptake, distribution, stability, and effect. Anti-
sense Nucleic Acid Drug Dev 6:207–213.
Robinson GS, Pierce EA, Rook SL, Foley E, Webb R, and
Smith LEH (1996). Oligodeoxynucleotides inhibit retinal neo-
vascularization in a murine model of proliferative retinopathy.
Proc Nat Acad Sci USA 93:4851–4856.
Takahashi T, Nakamura T, Hayashi A, Kamei M, Nakabayashi
M, Okada AA, Tomita N, Kaneda Y, and Tano Y (2000).
Inhibition of experimental choroidal neovascularization by over-
expression of tissue inhibitor of metalloproteinases-3 in retinal
pigment epithelium cells. Am J Ophthalmol 130:774–781.
Ryan SJ (1979). The development of an experimental model
of subretinal neovascularization in disciform macular degen-
eration. Trans Am Ophthalmol Soc 77:707–745.
Yi X, Ogata N, Komada M, Yamamoto C, Takahashi K, Omori
K, and Uyama M (1997). Vascular endothelial growth factor
expression in choroidal neovascularisation in rats. Graefe’s
Arch Clin Exp Ophthalmol 235:313–319.
Schwesinger C, Yee C, Rohan RM, Joussen AM, Fernandez
A, Meyer TN, Poulaki V, Ma JJK, Redmond TM, Liu SY,
Adamis AP, and D’Amato RJ (2001). Intrachoroidal neovas-
cularization in transgenic mice overexpressing vascular en-
dothelial growth factor in the retinal pigment epithelium. Am J
Pathol 158:1161–1172.
Young RW (1987). Pathophysiology of age-related macular
degeneration. Surv Ophthalmol 31:291–306.
Zhang NL, Samadani EE, and Frank RN (1993). Mitogenesis
and retinal pigment epithelial cell antigen expression in the
rat after krypton laser photocoagulation. Invest Ophthalmol
Vis Sci 34:2412–2424.
Shen WY, Constable IJ, Chelva E, and Rakoczy PE (2000).
Inhibition of diclofenac formulated in hyaluronan on angio-
genesis in vitro and its intraocular tolerance in the rabbit eye.
Graefes Arch Clin Exp Ophthalmol 238:273–282.
182 Laboratory Investigation • February 2002 • Volume 82 • Number 2