Selective photo-cross-linking of 2′-O-psoralen-conjugated oligonucleotide with RNAs having point mutations

Article abstract of DOI:10.1080/15257770701257434

It has been reported that point mutations in genes are responsible for various cancers and the selective regulation of the gene expression is an important issue to develop a new type of anticancer drugs. In this report, we present a new type of antisense

Full text of DOI:10.1080/15257770701257434

This article was downloaded by: [New York University]
On: 22 June 2015, At: 05:50
Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered
office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Nucleosides, Nucleotides and Nucleic
Acids
Publication details, including instructions for authors and
subscription information:
http://www.tandfonline.com/loi/lncn20
Selective Photo-Cross-Linking of 2′-O-
Psoralen-Conjugated Oligonucleotide
with Rnas Having Point Mutations
Maiko Higuchi a , Asako Yamayoshi b , Takasei Yamaguchi a , Reiko
Iwase c , Tetsuji Yamaoka d , Akio Kobori a & Akira Murakami a
a Department of Biomolecular Engineering , Kyoto Institute of
Technology , Matsugasaki, Kyoto, Japan
b Institute for Materials Chemistry and Engineering, Kyushu
University , Fukuoka, Japan
c Department of Bioscience , Teikyo University of Science and
Technology , Yamanash, Japan
d Department of Biomedical Engineering , Advanced Medical
Engineering Center, National Cardiovascular Center Research
Institute , Osaka, Japan
Published online: 04 Apr 2007.
To cite this article: Maiko Higuchi , Asako Yamayoshi , Takasei Yamaguchi , Reiko Iwase , Tetsuji
Yamaoka , Akio Kobori & Akira Murakami (2007) Selective Photo-Cross-Linking of 2′-O-Psoralen-
Conjugated Oligonucleotide with Rnas Having Point Mutations, Nucleosides, Nucleotides and Nucleic
Acids, 26:3, 277-290, DOI: 10.1080/15257770701257434
To link to this article: http://dx.doi.org/10.1080/15257770701257434
PLEASE SCROLL DOWN FOR ARTICLE
Taylor & Francis makes every effort to ensure the accuracy of all the information (the
“Content”) contained in the publications on our platform. However, Taylor & Francis,
our agents, and our licensors make no representations or warranties whatsoever as to
the accuracy, completeness, or suitability for any purpose of the Content. Any opinions
and views expressed in this publication are the opinions and views of the authors,
and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content
should not be relied upon and should be independently verified with primary sources
of information. Taylor and Francis shall not be liable for any losses, actions, claims,
proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or
howsoever caused arising directly or indirectly in connection with, in relation to or arising
out of the use of the Content.

This article may be used for research, teaching, and private study purposes. Any
substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,
systematic supply, or distribution in any form to anyone is expressly forbidden. Terms &
Conditions of access and use can be found at http://www.tandfonline.com/page/terms-
and-conditions

Nucleosides, Nucleotides, and Nucleic Acids, 26:277–290, 2007
Copyright ꢀC Taylor & Francis Group, LLC
ISSN: 1525-7770 print / 1532-2335 online
DOI: 10.1080/15257770701257434
SELECTIVE PHOTO-CROSS-LINKING OF
2 ꢀ-O-PSORALEN-CONJUGATED OLIGONUCLEOTIDE WITH RNAS
HAVING POINT MUTATIONS
Maiko Higuchi
Department of Biomolecular Engineering, Kyoto Institute of
2
Technology, Matsugasaki, Kyoto, Japan
Asako Yamayoshi Institute for Materials Chemistry and Engineering, Kyushu
2
University, Fukuoka, Japan
Takasei Yamaguchi
Department of Biomolecular Engineering, Kyoto Institute of
2
Technology, Matsugasaki, Kyoto, Japan
Reiko Iwase Department of Bioscience, Teikyo University of Science and Technology,
2
Yamanash, Japan
Tetsuji Yamaoka
Department of Biomedical Engineering, Advanced Medical
2
Engineering Center, National Cardiovascular Center Research Institute, Osaka, Japan
Akio Kobori and Akira Murakami Department of Biomolecular Engineering,
2
Kyoto Institute of Technology, Matsugasaki, Kyoto, Japan
It has been reported that point mutations in genes are responsible for various cancers and
2
the selective regulation of the gene expression is an important issue to develop a new type of
anticancer drugs. In this report, we present a new type of antisense molecule that photo-cross-links
to an oligoribonucleotide having a point mutation site in a sequence specific manner. 2 ꢁ-O-
psoralen-conjugated adenosine was synthesized in four steps from adenosine and introduced in
the middle of an oligodeoxyribonucleotide (2 ꢁ-Ps-oligo). Compared with 5ꢁ-O-psoralen-conjugated
oligodeoxyribonucleotide (5ꢁ-Ps-oligo), which has a psoralen at the 5ꢁ-end, 2 ꢁ-Ps-oligo more selectively
photo-cross-linked to a pyrimidine base of the site of alteration from purine to pyrimidine in the
oligoribonucleotide.
Keywords
Antisense oligonucleotide; psoralen; photo-cross-linking; ras; Point
mutation
Received 18 May 2006; accepted 12 December 2006.
This research was partly supported by Grants for Regional Science and Technology Promotion
(AM) from the Ministry of Education, Science, Sports and Culture of Japan and by a Grant for Feasibility
Study from Innovation Plaza Kyoto. The authors are also indebted to Otsuka Pharmaceutical Co., Ltd.
for their financial support.
Address correspondence to Akira Murakami, Department of Biomolecular Engineering, Kyoto
Institute of Technology, Matsugasaki, Kyoto 606–8585, Japan. E-mail: akiram@kit.ac.jp
277

278
M. Higuchi et al.
INTRODUCTION
The first stage of the human genome project has reached its completion
and has reported that the number of genes could be ca. 30,000.[1] Recently,
the FANTOM consortium has reported drastic facts.[2,3] Non-coding RNAs
(ncRNAs) have been transcribed and shown to possibly participate in the
regulation of gene expression. Reports suggest that more than 70% regions
of the genome transcribe RNAs which play important roles in the cell
survival, and moreover, more than 50% of transcribed RNAs are ncRNAs.
Clarification of the function of ncRNAs becomes an urgent theme of life
science and plays an important part of second stage of the human genome
project, which is focused on clarifying the functions of genes. Among several
strategies for studying the functions, an antisense strategy[4] is a certainly
suitable choice.[5–9]
The antisense strategy has acquired the reliance on its potential in
regulating gene expression and has been deployed into clinical trials of
various diseases such as cancers and viral infections[10] Vitravene of ISIS
Pharmaceuticals Inc. obtained the approval of the United States Food and
Drug Administration for cytomegalovirus retinitis in AIDS patients is the
first antisense drug.[11]
In our previous study concerning the antisense strategy, we designed
a photo-cross-linking reagent conjugated at 5ꢁ-end of oligo(nucleoside
phosphorothioate)s (psoralen-conjugated S-oligo).[12] Psoralen derivatives
have an ability to cross-link covalently to pyrimidine bases, favorably
with thymine and uracil, upon UV irradiation (320∼400 nm).[13] As S-
oligos (oligo(nucleoside phosphorothioate)s) are so far the most effective
antisense molecule[14,15] and have fairly long half-lives in cell culture
conditions,[16] we used them as the mother antisense oligonucleotide. We
demonstrated the regulatory effects of psoralen-conjugated S-oligo on cer-
vical carcinoma cells. Psoralen-conjugated S-oligo drastically inhibited the
cellular proliferation of the cancer cells in a sequence specific manner only
upon UVA irradiation (IC50 = 16 nM) without any drug delivery systems.[17]
Among the target genes of the antisense molecules studied to date, it is
still difficult to discriminate the sites of point mutations. The point mutation
of K-ras gene is the typical example, which is reportedly responsible for
various cancers including pancreas cancer and colorectal cancer.[18–20] The
point mutation in the ras gene occurs at codon 12, where G is changed to
T. The transversion causes the alternation of an amino acid from Gly-12 to
Val-12; this mutation eliminates GTPase activity from K-Ras protein. Some
groups reported the suppression of the functions of ras-mRNA with a point
mutation using an antisense S-oligo in a sequence-specific manner.[21–25]
However, the report has not been well verified to date. This might be due
to the difficulty in discriminating the site of the point mutation by antisense
oligonucleotides under physiological conditions. It is necessary to regulate
such a site in a strictly sequence-specific manner. In this report, we present

2 ꢁ-O-Psoralen-Conjugated Oligonucleotide
279
a new type of antisense molecule that photo-cross-links to mRNAs having
point mutation sites in a sequence-specific manner with the maximum
strictness. The molecule is 2 ꢁ-O-psoralen-conjugated oligonucleotide (2 ꢁ-
Ps-oligo). The psoralen of 5ꢁ-O-psoralen-conjugated oligonucleotide (5ꢁ-Ps-
oligo) in our previous study could interact with a pyrimidine base in the
vicinity of the psoralen even if the pyrimidine base is not the target base.
This might be due to the flexible tether. 2 ꢁ-Ps-oligo exhibited even more
strict sequence specificity than 5ꢁ-Ps-oligo.
MATERIALS AND METHODS
1. Materials
,5ꢁ,8-Trimethylpsoralen was purchased from Sigma-Aldrich Co. (St.
Louis, MO, USA). Reagents for the oligonucleotide synthesis were
purchased from Glen Research, Inc. (Sterling, VA, USA) Reagents for
the gel electrophoresis were purchased from Nacalai Tesque Co. (Kyoto,
Japan). 5ꢁ-Ps-oligo was synthesized according to the reported procedure.[26]
Oligodeoxyribonucleotides (ODNs) and oligoribonucleotides (ORNs) were
synthesized via the conventional procedure using a 391 DNA synthesizer
(Applied Biosystems, Foster City, CA, USA). The other reagents were
purchased from Wako Pure Chemicals Inc. (Osaka, Japan) and used without
further purification. Silica gel column chromatography and thin-layer chro-
matography (TLC) were carried out on Wako gel C-200 and Merck 60 F254
.
2. Synthesis of 2 ꢁ-O-Psoralen-Conjugated Oligonucleotide
2.1. Synthesis of 2 ꢁ-O-[(4,5ꢁ,8-trimethyl)psoralen-4ꢁ-ylmethyl]adenosine (II)
4ꢁ-Chloromethyl-4,5ꢁ,8-trimethylpsoralen (I) was synthesized according
to the reported procedure.[27] Adenosine (1.4 g, 5.4 mmol) was stirred with
NaH (259 mg, 6.5 mmol) in dry DMF (10 ml) at room temperature for 1
hour prior to the addition of I (500 mg, 1.8 mmol) in dry DMF (25 ml).
The mixture was stirred at 0◦C for 12 hours. Phosphate buffer (1.0 ml, 100
mM sodium phosphate, pH 7.0) was added to the reaction mixture and
the solution was evaporated to dryness; then the residue was resolved in
CH2Cl2. The resulting solution was washed with aqueous 5% NaHCO3 (20
ml × 3). The organic solution was dried over Na2SO4 and the solution was
concentrated to dryness. The residue was dissolved in MeOH followed by
silica gel column chromatography. Elution with CH2Cl2-MeOH (25:1, v/v)
gave fractions of 2 ꢁ-O-[(4,5ꢁ,8-trimethyl)psoralen-4ꢁ-ylmethyl]adenosine (II)
1
(208 mg, 23% yield). TLC (CH2Cl2-MeOH 4:1, v/v) Rf 0.60; H-NMR
(DMSO-d6) δ2.2–2.5(m, 9H, 4,5ꢁ8-trimethyls of psoralen), 3.5–3.7(m, 2H,
5ꢁ-H), 4.0(s, 1H, 4ꢁ-H), 4.4(t, 1H, 3ꢁ-H), 4.0(s, 1H, 4ꢁ-H), 4.6–4.8(m, 2H, 4ꢁ-
CH2 of psoralen), 4.7(m, 1H, 2 ꢁ-H), 5.4(d, 1H, 3ꢁ-OH), 5.6(m, 1H, 5ꢁ-OH),
5.9(d, 1H, 1ꢁ-H), 6.3(s, 1H, 3-H of psoralen), 7.0(bs, 2H, NH2), 7.3(s, 1H,
5ꢁ-H of psoralen), 7.8(s, 1H, 2-H), 8.0(s, 1H, 8-H).

280
M. Higuchi et al.
ꢁ
2.2. Synthesisof6-N-Bz-2ꢁ-O-[(4,5,8-trimethyl)psoralen-4ꢁ-ylmethyl]adenosine(V)
The title compound was synthesized according to the general procedure
of Ti et al.[28] Compound II (100 mg, 0.2 mmol) in dry pyridine (2.5 ml)
was allowed to react with trimethylchlorosilane (130 µl, 1.0 mmol)
and was stirred at room temperature for 2 hours to give 2 ꢁ-O-[(4,5ꢁ,8-
trimethyl)psoralen-4ꢁ-ylmethyl]-3ꢁ,5ꢁ-O-bis(trimethylsilyl)adenosine
(III).
To the reaction mixture of III, benzoyl chloride (100 µl, 0.8 mmol)
was added and the resulting solution was stirred at room temperature
for 4 hours to give 6-N ,N -dibenzoyl-2 ꢁ-O-[(4,5ꢁ,8-trimethyl)psoralen-4ꢁ-
ylmethyl]-3ꢁ,5ꢁ-O-bis(trimethylsilyl)adenosine (IV). Concentrated ammon-
ium hydroxide (1.0 ml) was added to the reaction mixture of IV, and the
solution was stirred at room temperature for 1 hour, followed by evaporation
to dryness. The residue was resolved in CH2Cl2, and the resulting solution
was washed with aqueous 5% NaHCO3 (20 ml × 3). The organic solution
was dried over Na2SO4, and the solution was concentrated to dryness.
The residue was dissolved in CH2Cl2, followed by a silica gel column
chromatography. The eluting with CH2Cl2-MeOH (50:1, v/v) gave 6-N -
benzoyl-2 ꢁ-O-[(4,5ꢁ,8-trimethyl)psoralen-4ꢁ-ylmethyl]adenosine (V) (79.4
mg, 66% yield). TLC (CH2Cl2-MeOH 9:1, v/v) Rf 0.6 (III), 0.8 (IV), 0.4 (V);
1H-NMR (CDCl3) δ2.4–2.5(m, 9H, 4,5ꢁ8-trimethyls of psoralen), 2.8(bs, 1H,
3ꢁ-OH), 3.7–4.0(m, 2H, 5ꢁ-H), 4.3(s, 1H, 4ꢁ-H), 4.6(t, 1H, 3ꢁ-H), 4.5–4.9(m,
2H, 4ꢁ-CH2 of psoralen), 5.1(m, 1H, 2 ꢁ-H), 5.6(m, 1H, 5ꢁ-OH), 5.8(d, 1H,
1ꢁ-H), 6.2(s, 1H, 3-H of psoralen), 7.1(s, 1H, 5ꢁ-H of psoralen), 7.5–8.1(m,
5H, Ar), 7.6(s, 1H, 2-H), 8.5(s, 1H, 8-H), 8.7(bs, 1H NH).
2.3. Synthesis of 6-N-Bz-5ꢁ-O-DMTr-2 ꢁ-O-[(4,5 ꢁ,8-trimethyl)psoralen-4ꢁ-ylmet-
hyl] adenosine (VI)
Compound V (79.6 mg, 0.13 mmol) in dry pyridine and THF(1:1, v/v,
4.0 ml) was allowed to react with 4,4ꢁ-Dimethoxytrityl chloride (220 mg, 0.65
mmol) in the presence of AgNO3 (110 mg, 0.65 mmol), and the mixture
was stirred at room temperature for 1.5 hours. The reaction was quenched
by adding ice-water, and the solution was evaporated to dryness. The residue
was dissolved in CH2Cl2 (50 ml), and the resulting solution was washed with
aqueous 5% NaHCO3 (20 ml × 3). The organic solution was dried over
Na2SO4, and the solution was concentrated to dryness. The residue was
dissolved in CH2Cl2, followed by silica gel column chromatography. Elu-
tion with CH2Cl2-MeOH (500:1, v/v) gave 6-N -Bz-5ꢁ-O-DMTr-2 ꢁ-O-[(4,5ꢁ,8-
trimethyl)psoralen-4ꢁ-ylmethyl]adenosine (VI) (91.1 mg, 77% yield). TLC
1
(CH2Cl2-MeOH 9:1, v/v) Rf 0.5 (VI); H-NMR (CDCl3) δ2.4–2.6(m, 9H,
4,5ꢁ8-methyls of psoralen), 2.7(bs, 1H, 3ꢁ-OH), 3.4–3.5(m, 2H, 5ꢁ-H), 3.8(s,
6H, methoxy), 4.3(s, 1H, 4ꢁ-H), 4.5(t, 1H, 3ꢁ-H), 4.8–4.9(m, 2H, 4ꢁ-CH2 of
psoralen), 4.8(m, 1H, 2 ꢁ-H), 6.1(d, 1H, 1ꢁ-H), 6.2(s, 1H, 3-H of psoralen),

2 ꢁ-O-Psoralen-Conjugated Oligonucleotide
281
TABLE 1 Sequence of Ps-oligos and oligo-RNAs
Name
Sequence
2 ꢁ-Ps-oligo
ODN1
cORN1
5ꢁd(TACGCCAAPsCAGCTCC)3ꢁ∗
5ꢁd(TACGCCAACAGCTCC)3ꢁ
5ꢁ r(GGAGCUGUUGGCGUA)3ꢁ
5ꢁ r(GGAGCUGGUGGCGUA)3ꢁ
Mismatch-ORN1
5ꢁ-Ps-oligo
cORN2
Mismatch-ORN 2
5ꢁ d(Ps-ACAGCTCCAACTACC)3ꢁ
5ꢁ r(GGUAGUUGGAGCUGUUGGCG)3ꢁ
5ꢁ r(GGUAGUUGGAGCUGGUGGCG)3ꢁ
∗APs = 2 ꢁ-O-psoralen-conjugated adenosine.
6.8–7.4(m, 13H, Ar of DMTr), 7.3(s, 1H, 5ꢁ-H of psoralen), 7.5–8.1(m, 5H,
Ar), 7.9(s, 1H, 2-H), 8.6(s, 1H, 8-H), 8.9(bs, 1H NH).
2.4. Synthesis of 6-N-Bz-5ꢁ-O-DMTr-2 ꢁ-O-[(4,5ꢁ,8-trimethyl)psoralen-
4ꢁ-ylmethyl] adenosine 3ꢁ-(2-cyanoethyl-N, Nꢁ-diisopropylphosphoramidite)
(VII) and introduction it to oligonucleotide
The sequence of 2 ꢁ-Ps-oligo was complementary to that of K-ras mRNA
containing codon12 region (Table 1).
The fully protected 5ꢁ-O-DMTr-ACCGCAT-CPG (1.0 µmol) was syn-
thesized using a DNA synthesizer. Compound VI (9.1 mg, 10 µmol) in
dry acetonitrile (72 µl) was allowed to react with 2-cyanoethyl N,N,Nꢁ,Nꢁ-
tetraisopropylphosphorodiamidite (3.5 µl, 11 µmol) in the presence of
0.5 M 1H-tetrazole (24 µl, 11 µmol), and the mixture was stirred at room
temperature for 1 hour. Without purification, the reaction mixture was
added to 5ꢁ-detritylated ACCGCAT-CPG in the presence of 1 equiv. of 1H-
tetrazole in dry acetonitrile and the mixture was allowed to react at room
temperature for 4 hours.
The DMTr cations released from the CPG were quantified by UV
spectroscopy and the coupling yield was 23%. After capping, the CPG
support was then set to the DNA synthesizer and the oligonucleotide
synthesis was continued. The CPG support was treated with concentrated
ammonium hydroxide at 55◦C for 11 hours, and the ammonium hydroxide
solution was evaporated in vacuo. Purification of 2 ꢁ-Ps-oligo was performed
with a reverse-phase HPLC with an acetonitrile gradient in TEAA (pH 7.0).
Column: CAPCELL PAK C18, 5 µm, 4.6φ × 150 mm, (Shiseido, Co. Ltd.,
Tokyo, Japan); Mobile phase: (A) 0.1 M triethylammonium acetate (TEAA,
pH 7.0) and (B) 50% CH3CN in 0.1 M TEAA at the flow rate of 0.8 ml/min
(gradient: 7.5% to 15% for 15 minutes, 15–40% for 10 minutes, 40% for 5
minutes). The fractions containing the oligonucleotides with DMTr groups
were concentrated; then the DMTr groups were removed with treatment by
80% acetic acid for 30 minutes.

282
M. Higuchi et al.
3. Measurements of UV-Melting Profiles of 2 ꢁ-Ps-Oligo and ORN
Hybrid Duplexes
UV melting profiles of the hybrid between 2 ꢁ-Ps-oligo and ORN were
obtained by a UV spectrophotometer (U2000 A, Hitachi Co., Tokyo, Japan)
equipped with a programmed thermo-controller with the increase rate of
1.0◦C/minute. The sample solutions were prepared in 100 mM phosphate
buffer (pH 7.0) containing 0.1 M NaCl, and the concentration of the
oligonucleotides was fixed at 5.0 µM.
4. Fluorescence Spectra of 2 ꢁ-Ps-Oligo and ORN Duplexes
Fluorescence spectra were obtained by a spectrophotometer (RF-5300
PC, Shimadzu Co., Kyoto, Japan) equipped with a thermal controller. An
equimolar solution of 2 ꢁ-Ps-oligo and ORN (5.0 µM each) in 100 mM
phosphate buffer (pH 7.0) containing 0.1 M NaCl was denatured at 85◦C
for 5 minutes and slowly cooled to the designated temperature prior to
measurement. No attempt was made to eliminate dissolved oxygen in the
buffer.
5. CD Spectra of 2 ꢁ-Ps-Oligo and ORN Hybrid Duplexes
Circular dichroism (CD) spectra were obtained on a CD spectropho-
tometer (J-720, JASCO, Tokyo, Japan) equipped with a thermo controller
(RET-100, Neslab, Portsmouth, NH, USA). An equimolar solution of 2 ꢁ-Ps-
oligo and ORN (5.0 µM each) was prepared in a buffer containing 100 mM
sodium phosphate (pH 7.0) and 0.1M NaCl.
6. Photo-Cross-Linking Reaction of Psoralen-Conjugated
Oligonucleotide (Ps-Oligo) and ORN
The equimolar solution of Ps-oligo and ORN (5.0 µM each) was
denatured at 85◦C for 5 minutes and slowly cooled to 37◦C in a buffer
containing 100 mM sodium phosphate (pH 7.0) and 0.1 M NaCl for 20
minutes at 37◦C. After incubation, the reaction mixture was irradiated
by UVA on a transilluminator (FTI-LW, 365 nm, 1.4 mW/cm2, Funakoshi
Co., Ltd., Tokyo, Japan), and then analyzed by denatured PAGE (18%
polyacrylamide, 7M urea/TBE, 300 V, 2 h). The bands in the denatured
PAGE were visualized by UV shadowing procedure. The photo-cross-linking
yields were evaluated from the amount of the intact ORN by reverse-phase
HPLC.

2 ꢁ-O-Psoralen-Conjugated Oligonucleotide
283
RESULTS AND DISCUSSION
Design of Photo-Cross-Linking Antisense Oligonucleotide
The fidelity of sequence recognition of target mRNAs by ODN is a
crucial issue of the antisense strategy. Other than ODN with phosphodiester
linkages, various types of antisense DNAs such as PNA,[29] morpholino
oligonucleotide,[30] and BNA (or LNA)[31,32] have been designed to in-
crease the fidelity. The fidelity was usually evaluated by a comparison of
UV-melting temperatures of fully matched hybrids with those of mismatched
hybrids. Significant difference in melting temperature (Tm) suggests that
those antisense DNAs possess enough potential to discriminate mismatched
sequences from fully matched ones. However, it is unclear whether those
DNAs can discriminate single mismatched sequences in cellular systems. It
is necessary to design an antisense DNA that strictly inactivates designated
mRNAs with high sequence fidelity.
We developed an antisense molecule so as to cross-link to the pyrimidine
base at the site of the point mutation in the target RNA, but not to randomly
cross-link to off-target pyrimidine bases. For this purpose, we designed an
adenosine derivative anchoring a psoralen derivative at the 2 ꢁ-position of
D-ribose via a methylene linker (Aps) as shown in Figure 1a, and Aps was in-
troduced into ODNs by a phosphoramidite protocol giving a photo-reactive
antisense ODN (2 ꢁ-Ps-oligo). The conformational calculation of the hybrid
of 2 ꢁ-Ps-oligo with its complementary ORN (cORN1), whose sequence was
originated from c-K-ras-mRNA, was carried out by Macro Model (ver.5.5;
CA, USA) using the Amber∗ algorithm.[33,34] The psoralen moiety of the
single-stranded 2 ꢁ-Ps-oligo was localized between adjacent bases as shown in
Figure 1b. When 2 ꢁ-Ps-oligo formed a hybrid with the cORN1, the psoralen
was localized between the designated base pairs as shown in Figure 1c,
site a. The distance between tꢁhe double bond of the pyrimidine base, 5–6,
ꢁ
˚
and that of the psoralen, 4 -3 , was calculated to be 5.6 A. The distance is
close enough for two moieties to interact with each other in the ground
state and to react to form a cyclobutane adduct upon UVA irradiation.
Other several semi-stable structures also were postulated by the calculation,
and they were substantially similar to the model shown in Figure 1c. As
a comparison, a similar calculation was carried out for the 5ꢁ-O-psoralen-
conjugated oligonucleotide (5ꢁ-Ps-oligo). Figures 1d and 1e suggest that the
psoralen of 5ꢁ-Ps-oligo could intercalate in two ways (site b and site c). That
is, the sequence selective inactivation of mRNAs having a point mutation by
5ꢁ-Ps-oligo is not realistic, and 2 ꢁ-Ps-oligo could be suitable for the purpose.
Synthesis of 2 ꢁ-O-Psoralen-Conjugated Oligonucleotide
2 ꢁ-O-[(4,5ꢁ,8-trimethyl)psoralen-4ꢁ-ylmethyl]adenosine (II) was synthe-
sized from unprotected adenosine and 4ꢁ-chloromethyl-4,5ꢁ,8-trimethylp-

284
M. Higuchi et al.
FIGURE 1 Structure of psoralen-conjugated oligonucleotide. The arrows indicated trimethylpsoralen.
(a) 2 ꢁ-O-psoralen-conjugated adenosine (Aps), (b) single strand of 2 ꢁ-Ps-oligo, (c) duplex of 2 ꢁ-Ps-oligo
and cORN1, (d), (e) two intercalation patterns in the duplex of 5ꢁ-Ps-oligo and cORN2. a,b,c: psoralen
intercalation sites.
soralen (I) in the presence of NaH. I was introduced to either the 2 ꢁ-O- or 3ꢁ-
O-position. The ratio of II to 3ꢁ-O-modified adenosine was ca.17:1 estimated
1
by H-NMR. II was then separated from 3ꢁ-O-conjugated adduct by silica
gel chromatography, and was used for consecutive reactions to obtain VI
(Scheme 1). The overall yield of VI from I was 12%. Aps was phosphytilated
at 3ꢁ-OH to form VII and it was introduced to the designated position of an
ODN by a syringe protocol followed by an elongation protocol using a DNA
synthesizer. The sequences of 2 ꢁ-Ps-oligo and related oligonucleotides are
shown in Table 1.

2 ꢁ-O-Psoralen-Conjugated Oligonucleotide
285
SCHEME 1 Synthesis of 2 ꢁ-O-psoralen-conjugated adenosine derivative.
Interaction between 2 ꢁ-Ps-Oligo and Its Complementary RNA
In order to evaluate the effect of the introduced psoralen moiety on
the stability of the hybrid with ORN, the UV-thermal stability was examined
(Table 2). The Tm of the hybrid of 2 ꢁ-Ps-oligo with the complementary
ORN (cORN1) was lower than that of the hybrid of ODN1 with cORN1.
In the case that the mismatched base pair located in the close vicinity of
the psoralen, Tm of the hybrid of 2 ꢁ-Ps-oligo with mismatch-ORN1 also was
decreased. These results suggest that the modification of a psoralen to the
2 ꢁ-O-position of oligonucleotide destabilized the hybrid to some extent.
The location of the psoralen in the hybrid was examined by electronic
spectroscopy. The UV spectra of the hybrid did not show any appreciable
spectrum change, which might due to the broad absorption band attributed
to psoralen around 300–360 nm.
The CD spectrum of the hybrid of 2 ꢁ-Ps-oligo and cORN1 clearly showed
a similar spectrum of the hybrid of ODN1 and cORN1, suggesting that the
hybrid was A-form-like (Figure 2). The induced circular dichroism (ICD)
around 300–350 nm due to the psoralen of 2 ꢁ-Ps-oligo was not observed.
TABLE 2 The melting temperatures of the hybrid of
2 ꢁ-Ps-oligo with ORNs
Tm (◦C)
cORN1
Mismatch-ORN1
2 ꢁ-Ps-olig
ODN1
61.6
64.6
59.0
60.0
Measurements were carried out at 260 nm for the
equimolar mixture of 2 ꢁ-Ps-oligo (ODN1) and ORN in
0.1 M phosphate buffer (pH 7.0) with 0.1 M NaCl.

286
M. Higuchi et al.
FIGURE 2 CD spectra of the duplexes of psoralen-conjugated oligonucleotide with its complementary
oligoribonucleotide.—: 2 ꢁ-Ps-oligo and cORN1, ----: ODN1 and cORN1. [2 ꢁ-Ps-oligo] = [ODN1] =
[cORN1] = 5 µM in 0.1M phosphate buffer/0.1 M NaCl (pH 7.0). Measurements were carried out
at 37◦C.
ICD often is used to identify the locations of intercalators. In this case, ICD
might be too weak and broad to be observed. Therefore, CD was not suitable
to specify the location of the psoralen in the hybrid.
In contrast, the fluorescence spectra showed a drastic change in fluo-
rescence due to the psoralen. The fluorescence of 2 ꢁ-Ps-oligo alone showed
diminished fluorescence around 450 nm with slight shifts compared with 4ꢁ-
hydroxymethyl-4,5ꢁ,8-trimethylpsoralen. This phenomenon might be due to
the interaction of the psoralen with adjacent bases (Figure 3). When 2 ꢁ-Ps-
oligo formed a hybrid with cORN1, the fluorescence was further quenched
to about 30% with a slight blue shift, suggesting that the psoralen relocated
so as to alter its location to a stable one. In general, when psoralen was
intercalated between base pairs, the fluorescence was appreciably quenched
with a slight shift.[35] These characteristic changes of the fluorescence
suggest that the psoralen moiety intercalates between base pairs and that
the location allowed the psoralen to photo-cross-link to the adjacent pyrim-
idine base. These spectroscopic characteristics showed good accordance
with the results from the calculation by the Amber∗ algorithm as shown
in Figures 1b and 1 c. In addition, when 2 ꢁ-Ps-oligo formed a hybrid with
mismatch-ORN1, the fluorescence was further quenched to about 55% with
a slight blue shift. The greater decrease observed in the mismatch hybrid
than the full match hybrid suggests that the intercalation of psoralen in
the mismatch region was more favored. We think that psoralen in the mis-
match hybrid located in the certain pocket produced by mismatch hybrid
formation. The decrease in Tm in the mismatch hybrid can be explained

2 ꢁ-O-Psoralen-Conjugated Oligonucleotide
287
FIGURE 3 Fluorescence spectra of the duplexes of psoralen-conjugated oligonucleotide with its
complementary oligoribonucleotide.—: the single-strand 2 ꢁ-Ps-oligo, — : 2 ꢁ-Ps-oligo and cORN1, ----:
2 ꢁ-Ps-oligo and mismatch-ORN1, – ·· – : 4ꢁ-Hydroxymethyl-4,5ꢁ,8-trimethyl-psoralen monomer (HMT)
[2 ꢁ-Ps-oligo] = [ORN (cORN1 or mismatch-ORN1)] = [HMT] = 2 µM in 0.1 M phosphate buffer/0.1
M NaCl (pH 7.0). Measurements were carried out at 11◦C. (λex = 330 nm).
that the stabilization due to the intercalation could not compensate the
destabilization due to the mismatch hybridization.
Comparison of the Cross-Linking Efficacy between 5ꢁ-Ps-Oligo
and 2 ꢁ-Ps-Oligo
When 2 ꢁ-Ps-oligo alone was irradiated by UVA (365 nm) in the physio-
logical media, a fast-moving band appeared along with the parent band in
PAGE. The intensity of the fast-moving band increased as the irradiation
time increased. As 2 ꢁ-Ps-oligo had a cytidine adjacent to the psoralen of
2 ꢁ-Ps-oligo, the newly appeared band presumably corresponded to a self-
cross-linked adduct.
When a hybrid of 2 ꢁ-Ps-oligo (or 5ꢁ-Ps-oligo) with cORN1 (or cORN2)
was irradiated by UVA (365 nm), the psoralen cross-linked to the adjacent
pyrimidine, giving photo-adducts as shown in Figures 4a and 4b. In the
case of 5ꢁ-Ps-oligo, two main photo-adducts were observed. The slow-moving
band, indicated by an arrow, was isolated and the extracted compound was
irradiated by UVB (254 nm). Two main bands were observed in PAGE, both
of which corresponded to the starting materials. This result suggests that
the slow-moving band was the photo-cross-linked adduct between 5ꢁ-Ps-oligo
and cORN2. The fast-moving materials were probably the self-cross-linked

288
M. Higuchi et al.
FIGURE 4 Time course of photo-cross-linking reactions of psoralen-conjugated oligonucleotide with
the target oligoribonucleotide. (a) 5ꢁ-Ps-oligo and ORN (cORN2 or mismatch-ORN2), and (b) 2 ꢁ-Ps-
oligo and ORN (cORN1 or mismatch-ORN1). 18% denatured polyacrylamide gel. [2 ꢁ-Ps-oligo or 5ꢁ-Ps-
oligo] = [ORN] = 5 µM in 0.1M phosphate buffer/0.1 M NaCl (pH 7.0).
photo-adduct. When mismatch-ORN2, which contained a mismatched base
around the region of the 5ꢁ-end of 5ꢁ-Ps-oligo, was used as the target RNA,
the photo-cross-linked hybrid also was observed. The photo-cross-linking
yield of the hybrid of 5ꢁ-Ps-oligo and cORN2 was ca.70% upon UVA-
irradiation for 60 minutes. The result suggests that 5ꢁ-Ps-oligo cross-linked to
an undesignated base to some extent. This was expected from the calculated
structure shown in Figures 1d and 1e. The tether was long enough to alter
the location of the psoralen of 5ꢁ-Ps-oligo. The change of the tether could
increase the fidelity of photo-cross-linking. That is, in conclusion, 5ꢁ-Ps-oligo
might not be suitable for the selective inhibition of mRNAs with point
mutation sites as it is. When 2 ꢁ-Ps-oligo was used, it also formed a stable
hybrid with both the cORN1 and mismatch-ORN1. However, after UVA
irradiation, 2 ꢁ-Ps-oligo photo-cross-linked predominantly to the cORN1
and scarcely photo-cross-linked to mismatch-ORN1. The photo-cross-linking
yield of the hybrid of 2 ꢁ-Ps-oligo and cORN1 was ca. 25% and that of the
hybrid of 2 ꢁ-Ps-oligo and mismatch-ORN1 was not more than 3% upon
UVA-irradiation for 60 minutes. These results suggest that 2 ꢁ-Ps-oligo fairly
discriminated the sites of single point mutation. Namely, the introduction
of a psoralen at the 2 ꢁ-O-position of a nucleoside enhanced the selectivity of
the photo-cross-linking.
This kind of functionalized antisense oligonucleotide will be needed
to regulate and consequently to clarify the functions of genes with point

2 ꢁ-O-Psoralen-Conjugated Oligonucleotide
289
mutations. Recently, RNA-interference has attracted the enthusiastic inter-
est of researchers in molecular biology and medicinal science. The concept
might dominate the scientific field of gene silencing in the near future.
Despite the widespread use of RNAi to “knock down” gene functions, the
RNAi pathway itself remains poorly understood. Also, short-interference
RNA (siRNA), is not always applicable to all purposes. Many reports suggest
that the off-target gene regulation by siRNA could be serious issues.[36–38]
The ability to discriminate single-base difference in RNAs could be an-
other high hurdle for the siRNA strategy. Although this weak points for
sequence specific inhibition are shared by the antisense strategy, our 2 ꢁ-
psoralen-conjugated antisense oligonucleotide could overcome the weak
point.
So far, the selectivity in cross-linking has drastically increased; however,
the efficiency in cross-linking has not been sufficient for extensive uses. By
designing the tether between a ribose and a psoralen, and by choosing the
structure of the tether, a more effective photo-cross-linkable antisense DNA
could be designed.
REFERENCES
1. International Human Genome Sequencing Consortium. Finishing the euchromatic sequence of the
human genome. Nature 2004, 431, 931–945.
2. The FANTOM Consortium, RIKEN Genome Exploration Research Group and Genome Science
Group. The transcriptional landscape of the mammalian genome. Science 2005, 309, 1559–1563.
3. RIKEN Genome Exploration Research Group, Genome Science Group and the FANTOM Consor-
tium. Antisense transcription in the mammalian transcriptome. Science 2005, 309, 1564–1566.
4. Kurreck, J. Antisense technologies. Eur. J. Biochem. 2003, 207, 1628–1644.
5. Hutvagner, G.; Simard, M.J.; Mello, C.C.; Zamore, P.D. Sequence-specific inhibition of small RNA
function. PLoS Biol. 2004, 2, 465–475.
6. Meister, G.; Landthaler, M.; Dorsett, Y.; Tuschl, T. Sequence-specific inhibition of microRNA- and
siRNA-induced RNA silencing. RNA 2006, 10, 544–550.
7. Zhao, Y.; Samal, E.; Srivastava, D. Serum response factor regulates a muscle-specific microRNA that
targets Hand2 during cardiogenesis. Nature 2005, 436, 214–220.
8. Krutzfelds, J.; Rajewsky, N.; Braich, R.; Rajeev, K.G.; Tuschl, T.; Manoharan, M.; Stoffel, M. Silencing
of microRNAs in vivo with ‘antagomirsꢁ. Nature 2005, 438, 685–689.
9. Weiler, J.; Hunziker, J.; Hall, J. Anti-miRNA oligonucleotides(AMOs) : Ammunition to target miRNAs
implicated in human disease? Gene Therapy 2006, 13, 496–502.
10. Patil, S.D.; Rhodes, D.G.; Burgess, D.J. DNA-based therapeutics and DNA delivery systems: A
comprehensive review. AAPS J . 2005, 7, E61–E77.
11. Crooke, S.T. Vitravene—another piece in the mosaic. Antisense Nucleic Acid Drug Dev. 8, 1998, vii–viii.
12. Iwase, R.; Yamayoshi, A.; Nishida, J.; Yamaoka, T.; Wake, N.; Murakami, A. Photodynamic antisense
regulation using psoralen-conjugated oligo(nucleoside phosphorothioate)s (I). Growth regulation
of cervical carcinoma cells. Nucleic Acids Symposium Series 1999, 42, 223–224.
13. Cimino, G.D.; Gamper, H.B.; Isaacs, S.; Hearst, J. Psoralen as photoactive probes of nucleic acid
structure and function: Organic chemistry, photochemistry, and biochemistry. Ann. Rev. Biochem.
1985, 54, 1151–1193.
14. Gleave,M.E.; Monia, B.P. Antisense therapy for cancer. Nat. Rev. Canc. 2005, 5, 468–479.
15. Kurreck, J. Antisense technologies. Eur. J. Biochem. 2003, 270, 1628–1644.
16. Shaw, J.P.; Kent, K.; Bird, J.; Fishback, J.; Froehler, B. Modified deoxyoligonucleotides stable to
exonuclease degradation in serum. Nucleic Acids Res. 1991, 19, 747–750.

290
M. Higuchi et al.
17. Murakami, A.; Yamayoshi, A.; Iwase, R.; Nishida, J.; Yamaoka, T.; Wake, N. Photodynamic antisense
regulation of human cervical carcinoma cell growth using psoralen-conjugated oligo(nucleoside
phosphorothioate). Eur. J. Pharma. Sci. 2001, 13, 25–34.
18. Barbacid, M. ras genes. Ann. Rev. Biochem. 1987, 56, 779–827.
19. Bos, J.L.; Fearon, E.R.; Hamilton, S.R. Prevalence of ras gene mutations in human colorectal cancers.
Nature 1987, 327, 293–297.
20. Kahn, S.; Yamamoto, F.; Almoguera, C.; Winter, E.; Forrester, K.; Jordano, J. Perucho, M. The c-K-ras
gene and human cancer (Review). Anticancer Res. 1987, 7, 639–652.
21. Mukhopadhyay, T.; Tainsky, M.; Cavender, A.C.; Roth, J.A. Specific inhibition of K-ras expression and
tumorigenicity of lung cancer cells by antisense RNA. Cancer Res. 1991, 51, 1744–1748.
22. Georges, R.N.; Mukhopadhyay, T.; Zhang, Y.; Yen, N.; Roth, J.A. Prevention of orthotopic human
lung cancer growth by intratracheal instillation of a retroviral antisense K-ras construct. Cancer Res.
1993, 53, 1743–1746.
23. Zhang, Y.; Mukhopadhyay, T.; Donehower, L.A.; George, R.N.; Roth, J.A. Retroviral vector-mediated
transduction of K-ras antisense RNA into human lung cancer cells inhibits expression of the
malignant phenotype. Human Gene Therapy 1993, 4, 451–460.
24. Aoki, K.; Yoshida, T.; Sugimura, T.; Terada, M. Liposome-mediated in vivo gene transfer of antisense
K-ras construct inhibits pancreatic tumor dissemination in the murine peritoneal cavity. Cancer Res.
1995. 55, 3810–3816.
25. Cowsert, L.M. In vitro and in vivo activity of antisense inhibitors of ras: Potential for clinical
development. Anti-Cancer Drug Dev. 1997, 12, 359–371.
26. Lee, B.L.; Murakami, A.; Blake, K.R.; Lin, S.; Miller, P.S. Interaction of psoralen-derivatized
oligodeoxyribonucleoside methylphosphonates with single-stranded DNA. Biochemistry 1988, 27,
3197–3203.
27. Isaacs, S.T.; Shen, C.J.; Hearst, J.E.; Rapoport, H. Synthesis and characterization of new psoralen
derivatives with superior photoreactivity with DNA and RNA. Biochemistry 1977, 16, 1058–1064.
28. Ti, G.S.; Gaffney, B.L.; Jones, R.A. Transient protection: Efficient one-flask syntheses of protected
deoxynucleosides. J. Am. Chem. Soc. 1982, 104, 1316–1319.
29. Nielsen, P.E.; Egholm, M.; Berg, R.H.; Buchardt, O. Sequence-selective recognition of DNA by strand
displacement with a thymine-substituted polyamide. Science 1991, 254, 1497–1500.
30. Summerton, J. Morpholino antisense oligomers: The case for an RNase H-independent structural
type. Biochim. Biophys. Acta. 1999, 1489, 141–158.
31. Obika, S.; Nanbu, D.; Hari, Y.; Andoh, J.; Morio, K.; Doi, T.; Imanishi, T. Stability and structural
features of the duplexes containing nucleoside analogues with a fixed N-type conformation, 2 ꢁ-O,4ꢁ-
C-methyleneribonucleosides. Tetrahedron Lett. 1998, 39, 5401–5404.
32. Koshkin, A.A.; Singh, S.K.; Nielsen, P.; Rajwanishi, V.K.; Kumar, R.; Meldgaard, M.; Olsen, C.E.;
Wengel, J. Novel convenient syntheses of LNA [2.2.1]bicyclo nucleosides. Tetrahedron 1998, 54,
3607–3630.
33. Mohamadi, F.; Richard, N.G.J.; Guida, W.C.; Liskamp, R.; Lipton, M.; Caulfield, C.; Chang, G.;
Hendrickson, T.; Still, W.C. MacroModel—An integrated software system for modeling organic and
bioorganic molecules using molecular mechanics. J. Comput. Chem. 1990, 11, 440–467.
34. McDonald, D.Q.; Still, W.C. AMBER∗ torsional parameters for the peptide backbone. Tetrahedron
Lett. 1992, 33, 7743–7746.
35. Salet, C.; DeSa E Melo TM, Bensasson, R.; Land, E. J. Photophysical properties of aminoethylpso-
ralen in presence and absence of DNA. Biochem. Biophys. Act. 1980, 607, 379–383.
36. Jackson, A.L.; Bartz, S.R.; Schelter, J.; Kobayashi, S.V.; Burchard, J.; Mao, M.; Li, B.; Cavet, G.; Linsley,
P.S. Expression profiling reveals off target gene regulation by RNAi. Nat. Biol. 2003, 21, 635–637.
37. Saxene, S.; Jonsson, Z.O.; Dutta, A. Small RNAs with imperfect match to endogenous mRNA repress
translation. J. Biol. Chem. 2003, 278, 44312–44319.
38. Scacheri, P.C.; Rozenblatt-Rosen, O.; Caplen, N.J.; Wolfsberg, T.G.; Umayam, L.; Lee, J.C.; Hughes,
C.M.; Shanmugam, K.S.; Bhattacharjee, A.; Meyerson, M.; Collins, F.S. Short interfering RNAs can
induce unexpected and divergent changes in the levels of untargeted proteins in mammalian cells.
Proc. Natl. Acad. Sci. USA 2004, 101, 1892–1897.