Tetrahydroindolocarbazoles (THICZs) as new class of urokinase (uPA) inhibitors: Synthesis, anticancer evaluation, DNA-damage determination, and molecular modelling study

Article abstract of DOI:10.1016/j.bioorg.2018.06.033

Tetrahydroindolocarbazoles (THICZs) with versatile substituents, have been designed, synthesized, structure characterized, then investigated for their in-vitro anticancer screening, urokinase inhibition (uPA) evaluated, DNA-damage determination was further explored. Compounds 5, 8, 10 and 17 displayed the most promising antitumor activities against the breast cancer cell line as compared to the standard drug, doxorubicin with IC₅₀ = 5.24 ± 0.37, 4.00 ± 0.52, 7.20 ± 0.90 and 9.60 ± 1.10 μg/ml (versus 3.30 ± 0.48 μg/ml for doxorubicin). Compounds 5, 8, 10 and 17 represents the most significant uPA inhibitors of our study with IC₅₀ of 3.80, 2.70. 4.75, 10.80 (ng/ml) respectively. The expression levels of CDKN2A gene were decreased in 8, 10 and 17 cell lines as compared to those in positive control samples. Cell lines treated with 5, 8, 10 and 17 clearly observed a high score of damaged DNA cells. A deeper examination revealed that our hetroaromatics showed an extensive hydrogen bonding interactions that is required in the S pocket which is important for activity Arg 217, Gly 219, Gly 216, Lys 143 and Ser 190. So we present THICZs as promising uPA inhibitors expected as significant promise for further development as anti-invasiveness drugs.

Full text of DOI:10.1016/j.bioorg.2018.06.033

Accepted Manuscript
Tetrahydroindolocarbazoles (THICZs) as New Class of Urokinase (uPA) In-
hibitors: Synthesis, Anticancer Evaluation, DNA-Damage Determination, and
Molecular Modelling Study
Marwa A.M.Sh. El-Sharief, Mohamed H. El-Naggar, Entesar M. Ahmed,
Shahenda M. El-Messery, Abeer E. Mahmoud, Mamdouh M. Ali, Lamiaa M.
Salem, Karima F. Mahrous, Mardia T. El Sayed
PII:
S0045-2068(18)30443-7
DOI:
https://doi.org/10.1016/j.bioorg.2018.06.033
YBIOO 2413
Reference:
Bioorganic Chemistry
To appear in:
Received Date:
Revised Date:
Accepted Date:
3 May 2018
5 June 2018
29 June 2018
Please cite this article as: M.A.M. El-Sharief, M.H. El-Naggar, E.M. Ahmed, S.M. El-Messery, A.E. Mahmoud,
M.M. Ali, L.M. Salem, K.F. Mahrous, M.T. El Sayed, Tetrahydroindolocarbazoles (THICZs) as New Class of
Urokinase (uPA) Inhibitors: Synthesis, Anticancer Evaluation, DNA-Damage Determination, and Molecular
Modelling Study, Bioorganic Chemistry (2018), doi: https://doi.org/10.1016/j.bioorg.2018.06.033
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Tetrahydroindolocarbazoles (THICZs) as New Class of Urokinase (uPA) Inhibitors: Synthesis,
Anticancer Evaluation, DNA-Damage Determination, and Molecular Modelling Study
Marwa A.M.Sh. El-Sharief1,2, Mohamed H. El-Naggar3, Entesar M. Ahmed4, Shahenda M. El-
Messery5,*, Abeer E. Mahmoud6, Mamdouh M. Ali6, Lamiaa M. Salem7, Karima F. Mahrous7,
Mardia T. El Sayed1*.
1Department of Applied Organic Chemistry, National Research Centre, 12622 Dokki, Giza, Egypt.
2Chemistry Department, Faculty of Sciences, King Khaled University, Saudi Arabia.
3Chemistry Department, Faculty of Sciences, University of Sharjah, Sharjah, UAE, 27272
4Chemistry department, Faculty of Science, Al Azhar University, Cairo, Egypt.
5Department of Pharmaceutical Organic Chemistry, Faculty of Pharmacy, Mansoura University,35516,
Mansoura, Egypt.
6Biochemistry Department, Division of Genetic Engineering and Biotechnology, National Research Centre,
Dokki 12622, Giza, Egypt. 7Cell Biology Department, National Research Centre, 12622-Dokki, Egypt.
Corresponding authors:
Dr. Shahenda El-Messery, selmessery@gmail.com
Dr. Mardia El Sayed, mardia.elsayed2016@gmail.com
Abstract
Tetrahydroindolocarbazoles (THICZs) with versatile substituents, have been designed,
synthesized, structure characterized, then investigated for their in-vitro anticancer screening,
urokinase inhibition (uPA) evaluated, DNA-damage determination was further explored.
Compounds 5, 8, 10 and 17 displayed the most promising antitumor activities against the
breast cancer cell line as compared to the standard drug, doxorubicin with IC50 = 5.24±0.37,
4.00±0.52, 7.20±0.90 and 9.60±1.10 µg/ml (versus 3.30±0.48 µg/ml for doxorubicin).
Compounds 5, 8, 10 and 17 represents the most significant uPA inhibitors of our study with
IC50 of 3.80, 2.70. 4.75, 10.80 (ng/ml) respectively. The expression levels of CDKN2A
gene were decreased in 8, 10 and 17 cell lines as compared to those in positive control
samples. Cell lines treated with 5, 8, 10 and 17 clearly observed a high score of damaged
DNA cells. A deeper examination revealed that our hetroaromatics showed an extensive
hydrogen bonding interactions that is required in the S pocket which is important for activity
Arg 217, Gly 219, Gly 216 , Lys 143 and Ser 190. So we present THICZs as promising uPA
inhibitors expected as significant promise for further development as anti-invasiveness drugs.
Key Words: Tetrahydroindolocarbazoles, breast cancer, urokinase inhibition, DNA damage and
molecular modelling .
1

1. Introduction
Different sorts of cancer therapeutics have been designed aiming to target cancer. [1-3].
Several mechanisms of anticancer activity have been postulated, but none seems universal for
all cancers Human cancers compelling proteolytic enzymes to invade cells and custom
metastases, one of these enzymes is urokinase (uPA). A feature of a number of malignancies
including lung, prostate, breast, and stomach cancers is the over-expression of the
plasminogen activator urokinase [4]. The function of this plasminogen activator in tumor cell
biology has yet to be clearly defined. [5]. Inhibition of uPA can decline tumour size or even
produce comprehensive reduction of cancers in mice [6,]. The identified uPA inhibitors are
improbable to be consumed in anticancer rehabilitation because of their feeble inhibitory
action or extraordinary toxicity. Urokinase-type plasminogen activator (uPA) is an important
mediator of cellular invasiveness. Specifically, cell surface receptor-bound uPA activates
plasminoceli to the forceful overall protease plasmin, which then diminishes extracellular
matrix or basement membrane either straight or via proteolytic motivation of latent
collagenases. Consequently, cell external uPA starts an extracellular proteolytic cascade with
which invasive cells dismiss hindrances to movement.[7,8].
Subsequently cellular
invasiveness acting important roles in numerous disease shapes, plus cancer metastasis and
invasion, arthritis and inflammation, and diabetic retinal neovascularization, the development
of synthetic uPA inhibitors is an attractive therapeutic goal [9]. So the involvement of the
uPAS in cancer progression identifies its components as suitable targets for anti-cancer
therapy [10].
These inhibitors can generally be classified into two main types: aromatic amidines and
derivatives of guanidines [11]. Aromatic amidine–derived uPA inhibitors include
benzimidazole and indole derivatives [12] (A, B-chart, 1), benzothiophene amidines [13],
quinoline amidines [14], isocoumarin amidines [15], and naphthamidines Guanidine-based
inhibitors of uPA include amiloride pyridinylguanidines [16,17], Many of them have been
evaluated to be very promising anticancer candidates.
On the other side, Indoles, are collective components of drugs and are commonly found to be
of pharmaceutical curiosity in a diversity of therapeutic zones. A recent review and articles
for indoles as anticancer agents has been published by us [18,19]. Indole derivatives also used
DNA-based electrochemical biosensors proved that it can considerably reduce the growth of
2

cancer cell lines such as HOP-92 (lung), A498 (renal) and MDAMB-231/1TCC (breast)
[20,21]. Indolocarbazoles are associated with anticancer, antimicrobial, and antifungal
activities. The biological action depends on the communication prospective with DNA [22].
Additionally, many investigational studies have indicated that the size, shape and planarity of
this structure are significant principles in such DNA interaction [23].
Taking all together, our research group reported herein, the synthesis of
tetrahydroindolocarbazoles (THICZs) with broad numbers of substituents, (Chart 1) . They
have been investigated for their in-vitro anticancer screening against breast cancer
specifically supported by
advanced urokinase inhibition, DNA-damage determination
further exploration. Molecular modelling was performed using the active site of uPA to
study the binding mode and interpretate the activity pattern of our active uPA inhibitors
active candidates.
2. Result and discussion
2.1.Chemistry:
THICZs (1-17) were synthesized by two different reported synthetic approaches. It has been
reported by Mardia El Sayed [2,3] that reaction can be done either by using prepared bis-
indolylmethane (BIMs) with aldehydes or direct treatment of indole with aromatic aldehydes
affording the corresponding THICZs, (Scheme 1). In the current research, BIMs were
prepared from condensation of indole and indole-3-carboxyaldehyde with formalin solution
37% or p-methoxy-m-benzyloxybenzaldehyde in molar ratios (1:1) for the preparation of the
mixed THICZs 9 and 10 respectively. Both have been synthesized according to our reported
approach to identify the mixed THICZs [2,3]. The mixed THICZs were synthesized in a
totally low yield 36 to 45 % respectively. Whereas the other THICZs (1-8) were prepared by
the direct approach of utilizing indole itself or its derivatives with the appropriate aromatic
aldehyde. Mixture of both indole and aldehyde in 1:1 molar ratio dissolved in methanol with
few drops of conc. sulphuric acid was refluxed for one hour to give the THICZs (1-8). All
THICZs derived from aldehydes (1-10) were confirmed by means of analytical and spectral
data. The THICZs (1, 3 and 8-10) are known have previously reported by our group and
their identities are equivalent [2,3]. Whereas the other THICZs are novel derivatives were
13
synthesized and confirmed by the means of 1H- and C-NMR, ESI-MS and IR spectra (see
supporting information), for example, the appearance of the aliphatic protons of C11H23 in
compound 2 ranging from 1.02-1.72 and the appearance of 4 methoxy groups of compound
7 at 3.61 at the 3.71 ppm. The other group of THICZs (11-17) (Scheme 1) derived from
3

condensation reaction of indole with ketones such as indole-3-acetyl, pyridine-3-acetyl, 2-
chloroacetyl chloride, acetophenone, p-methylacetophenone, p-methoxyacetophenone, p-
aminoacetophenone. The reaction takes place smoothly by the same method of using
methanol catalyzed with few drops of conc. H2SO4 afforded the group of THICZs (11-17)
respectively. All THICZs (11-17) were confirmed by means of analytical and spectral data.
The THICZs (11 and 12) are known have previously reported in our published article [2,3].
Whereas the other THICZs are novel derivatives were synthesized and confirmed by the
means of 1H- and 13C-NMR, ESI-MS and IR spectra (see experimental section). Appearance
of aromatic protons and methyl protons peaks of compound 14 indicates the structure of the
proposed compound.
2.2.Anticancer evaluation screening in NRC, Egypt
The in vitro antitumor activities of the synthesized compounds against five cancer cell lines,
including lung cancer cells (A594), colon carcinoma cells (HCT116), breast cancer cells
(MCF-7), liver cancer cells (HepG2) and prostate cancer cells (PC3) as well as human normal
melanocyte (HFB4), were assayed [25] and the results expressed as IC50 are summarized in
Table 1. The anticancer activity of the established compounds was calculated in vitro via
MTT assay [26,27]. Doxorubicin was used as control. The results revealed that the tested
compounds had no anticancer activity against lung, colon, liver, and prostate cancer cells. On
the other hand, within the series of the synthesized compounds, we found that compounds 5,
8, 10 and 17 displayed the most promising antitumor activities against the breast cancer cell
line as compared to the standard drug, doxorubicin with IC50 = 5.24±0.37, 4.00±0.52,
7.20±0.90 and 9.60±1.10 µg/ml (versus 3.30±0.48 µg/ml for doxorubicin). Otherwise, the
results revealed that nearly all these (5, 8, 10 and 17) compounds had no toxic effect against
the normal HFB4 cells.
2.3.Urokinase (uPA) concentration assay
The levels of uPA protein expressed in cell extracts of MCF7 cell line were represented in
Table 2. The data revealed that, the concentrations of uPA protein were reduced when the
cells treated with compounds 5, 8, 10 and 17 as compared with the cancer cells. While the
level of uPA of untreated cancer cells (control) was 22.00±3.70 ng/ml, the levels of uPA
protein in compounds 5, 8, 10 and 17 were decreased by 84%, 50%, 83%, 88%, 78% and
51% respectively when compared with control cancer cells. Thus the decrement in the level
4

of uPA protein expression are consistent with the cytotoxicity results indicating that the
anticancer effect of tested compounds may exert its anticancer activity by inhibiting uPA [28]
and possess significant anticancer activity comparable to the activity of the commonly used
anticancer drug, doxorubicin.
2.4. Molecular genetics Study
2.4.1 Reverse Transcription (RT) Reaction
Complete Poly(A)+ RNA isolated from tumor cell lines was reverse transcribed into cDNA in
a total volume of 20 µl using RevertAidTM First Strand cDNA Synthesis Kit. Step One™
Real-Time PCR System from Applied Biosystems (Thermo Fisher Scientific, Waltham, MA
USA) was used to determine the tumor cell lines cDNA copy number. Each experiment
included a distilled water control. According to de Oliveira [29] the sequences of the genes
are listed in Table 3. The relative quantification of the target to the reference was determined
by using the 2−ΔΔCT method as follows:
ΔCT(test) = CT(target, test) − CT(reference, test)
ΔCT(calibrator) = CT(target, calibrator) − CT(reference, calibrator)
ΔΔCT = ΔCT(Test) − ΔCT(calibrator)
,
,
.
2.4.2 Gene expression analysis by Quantitative Real Time PCR
This study was conducted to investigate the effect compounds on the expression patterns of
MTAP and CDKN2A genes against tumor cell lines. The results revealed that the expression
levels MTAP-mRNA in 5 cell line were significantly (P 0.005) lower than those in positive
control group and all these (5, 8, 10 and 17) compounds.[29] However the expression levels
of CDKN2A – mRNA in 5 cell line were significantly (P 0.005) lower than those in negative
and positive control groups, but were not significantly different as compared with 8, 10 and
17 (Figure 1). Moreover, the expression levels of MTAP and CDKN2A genes in 8, 10 and 17
cell lines were significantly higher (P 0.01) than those in negative contrary, the expression
level of MTAP gene in 8, 10 and 17 cell lines were relatively similar to those in positive
control. Farthermore, the expression levels of CDKN2A gene were decreased in 8, 10 and 17
cell lines as compared to those in positive control samples but without any significant
differences (P 0.05) (Figure 2).
5

2.5 DNA damage assessed by comet assay
The treatments on breast tumor cell line cultures and the comet values that based on DNA
damage in 400 analyzed cell types were summarized in table 4 and figure 3. For samples cell
lines treated with 5, 8, 10 and 17 clearly observed a high score of damaged DNA cells as
compared to the negative control group, this damage was non-significant for sample 5 and
significant for the other three treated with cell lines that displayed a little differences among
them, in which sample 10 represented the highest score followed by sample 17 then sample 8.
In contrast, as compared the former treatment cell lines with the positive control group, a
significant decrease in the damage cells was detected. [30, 31]
2.6 Molecular modeling study
For further understanding of the higher activity of the synthesized compounds 5, 8, 10, and
17 against uPA and then be able to derive and design new uPA inhibitors with even improved
potency and selectivity, we did molecular modeling and docking studies on the
aforementioned confirmed active candidates. Firstly lowest energy conformers of selected
references Aniloride and UK 122 (Fig 4) and our compounds of interest were characterized
(Fig 5). The compounds were first docked into the active site of the uPA enzyme using the
MOE docking program. The published X-ray co-crystal structure with amiloride inhibitor
was used as a reference for our calculations.[32] Amiloride was chosen as it was an orally
administered potassium-sparing diuretic that has been used clinically for several decades but
recently it was discovered that amiloride bound to uPA and was used as a template for
designing new uPA inhibitors. [33]
Amiloride was docked as a reference , it was showed that it occupies the S1 and S1 sites of
uPA through formation of a hydrogen bonds network in addition to van der Waals contacts
and salt-bridge interaction with Asp189 (Figure 6 a,b). The Ser190 hydroxyl group forms a
hydrogen bond to a terminal nitrogen atom of the acylguanidine, which in turn forms a
hydrogen bond with a water molecule bound deep within the S1 pocket. Hydroxyl group of
Ser190 forms another hydrogen bond to water molecule. A weak hydrogen bond (O---N) is
formed via the Gly219 carbonyl oxygen to the acylguanidine amide NH. There were also
additional hydrogen bonds with Val 227 , Arg 217, and Lys 224, Ser 214 and Tryp 215
which seem important in binding site (binding energy -13.09456 Kcal/mol) .
6

For further validation of our docking results, we additionally get use of the identification of
new uPA inhibitor UK122, which act as a new anticancer agent that prevents the invasion
and metastasis of pancreatic cancer [34]. The 2D binding model of compound UK 122 into
uPA enzyme was depicted in Fig. 7a. where hydrogen bonding network was formed and
mediated via water and sulfate bridge with Ser 195 , Val 227 and Tryp 215 Ser 214 in
addition to arene cationic bonding between Arg 217 and phenyl group . Interstingly our
synthezied compounds have shown the same pattern of binding as the selected most powerful
uPA inhibitors , where compound 5 Fig. 7b 2D binding profiles produced a similar arene-
cation interaction between Arg 217 and furan ring as a an aromatic counterpart (binding
energy -11.01931 Kcal/mol). Compound 8 gives a higher binding similarity pattern to
reference uPA inhibitors by both an arene-cation interaction
Kcal/mol) (Fig 8a).
Compound 10 binds with the active site by arene-cation interaction between both indole
bicyclic ring system and Arg 217 , a hydrogen bonding interaction between NH atom of
pyrrole ring with Ser 146, In addition to water molecule hydrogen bond with Gly 219 and
Gly 216 ,binding energy -12.11844 (Fig 8b). Compound 17 showed an arene-cation
interaction by both rings of indole with Lys 143 , a hydrogen bonding with Ser 190 by 97 % (
via NH group with a binding energy of -10.95941 Kcal/mol (Fig. 8c). All the binding profiles
was shown in 2D form for simplicity due to the interference of a higher number of
aminoacids in binding process. From these finding we can explain the activity of our
compounds and conclude that the heteroaromatic parts of our compounds illustraten in furan,
pyridine and indole represent a structural fragment that is critical for binding to the uPA
active site. A deeper examination revealed that these hetroaromatics compensated the
extensive hydrogen bonding interactions that is required in the S pocket which is important
for activity, confirming the UK 122 model for selective uPa inhibitors. [35]
Hydrophobic surface mapping study was additionally performed.for further investigation
behind activity of our compounds, firstly the surface mapping of reference compounds were
created (Fig 9 a,b) . Then Compounds of interest, 5, 8, 10 and 17 clearly showed a preference
for more hydrophobic regions (more greener areas on the map, Figure 10( a,b,c,d) that could
be attributed to the presence of higher aromatic ares in addition of two methoxy moieties on
phenyl part in compounds 10 and 17 causing higher lipophilic character of the whole
molecule. Comparing the two figures 9 and 10 oviosly assures the similarity pattern between
7

the compounds of interst against the most widely known uPA inhibitors amiloride and
UK122.
3. Structure activity correlation
Concerning the first group of compounds, the presence of hetrocyclic structure favors the
activity as in case of furfuryl derivative in compound 5 and pyridyl derivative in compound 8.
The introduction of these 2 rings produces the most active compounds among the synthesized
ones. Furthermore, the introduction of dimethoxy phenyl group in compound 10 produce
active compound while the absence of such group decreases the activity dramatically as in
case of compound 9 by 10 folds. Finally, in the series of compounds 11-17 it was noticed that
the introduction of amino group at the para position of the phenyl ring favors the activity over
the electron withdrawing group as nitro and chloride even over the other electron donating
ones such as methyl group.
4. Conclusion
The present research introduces some THICZs (5, 8, 10 and 17) as potent synthetic uPA
inhibitors expected as significant promise for further development as anti-invasiveness drugs.
Compounds 5, 8, 10 and 17 displayed the most promising antitumor activities against the
breast cancer cell line as compared to the standard drug, Cell lines treated with 5, 8, 10 and
17 clearly observed a high score of damaged DNA cells as compared to the negative control
group, this damage was non-significant for sample 5 and significant for the other three treated
with cell lines that displayed a little differences among them, in which sample 10 represented
the highest score followed by sample 17 then sample 8. Molecular modeling study have
showed deeper insught into the binding mode of our acrive canduidates showing an
extensive hydrogen bonding interactions that is required in the S pocket which is important
for activity Arg 217, Gly 219, Gly 216 , Lys 143 and Ser 190. Hence, our THICZs could
represent an emerging class of antibreast cancer via uPA inhibition mechanism.
5. Experimental
5.1 Chemistry
The melting points were measured on a Boetius-Mikroheiztisch the company “VEB
weighing, Rapido Radebeul/VEB NAGEMA” measured and are uncorrected. The carbon,
hydrogen and nitrogen content of the substances was performed on a “CHNS-932” automatic
analyzer of the company “LECO Corporation” in the automatic Micro chemical determined.
8

The halogen content was determined by titration in semi micro method determined. For the
analyses TLC were with aluminium foil fluorescent indicator from Merck KGaA (silica gel
60 F254, layer thickness 0.2 mm) used. Rf -values (run level relative to the solvent front),
The separations were with column chromatography at atmospheric pressure on silica gel 60
(Grain size from 0.063 to 0.200 mm) from Merck KGaA. The NMR spectra were recorded on
a “Gemini 2000” (400/ 100 MHz). The ATR spectra were recorded on an FT-IR spectrometer
“IFS 28” by “Bruker”, the KBr spectra on an FT-IR Spectrometer “Spectrum BX” the
Company “PerkineElmer” measured. The ESI mass spectra were recorded on a “Finnigan
LCQ Classic” by “thermal Electron measured” the sample was injected directly. The
antitumor screening was performed in NCR, Cairo, Egypt against five cell lines named lung
cancer cells (A594), colon carcinoma cells (HCT116), breast cancer cells (MCF-7), liver
cancer cells (HepG2) and prostate cancer cells (PC3) as well as human normal melanocyte
(HFB4).
General procedure for the preparation of THICZs (1 – 17):
In a round bottom flask containing 2 mmol of indole or its derivatives was stirred with 50 ml
MeOH under heating until it completely dissolved. The aromatic or heterocyclic aldehyde or
ketones in 2 mmol was then added and the reaction mixture was stirred under heating until
the reaction solution became clear. Then a few drops of conc. H2SO4 were added. The
reaction solution became pink turned to dark red by refluxing for about 1 h. Upon the
reaction completion as monitored by TLC (100 % CH2Cl2) the reaction was worked up by
adding 50 ml water, which was neutralized by NH4OH addition, extracted with ethylacetate
100 ml for two times, washed with water and then brine, dried over anhydrous Na2SO4,
filtered and concentrated in vacuum. The crude reaction mixture was purified via column
chromatography on silica gel using (30% EtAc/hexane) as a solvent to afford the alternative
THICZs derivatives 1-17. THICZs 1, 3 and 8-12 their identities were found to be identical as
the reported [4,5]. Whereas 2, 4-7, 13-17 are novel derivatives couldn’t found in the literature
and their structures have been identified as follow:
6,12-didodecyl-5,6,11,12-tetrahydroindolo[3,2-b]carbazole (2): White powder, mp. 165-
167 oC, yield 73 %, 594.96 g/mol, C42H62N2, ESI-MS: 595.25 [M+H+], IR (ATR,cm-1): 3848
(NH), 2992, 2998 (CH), 1H-NMR (400 MHz, DMSO-d6): δ (ppm): 1.02-1.12(m, 6H, 2CH3),
1.32-1.34 (m, 12H, 6CH2), 1.37-1.39 (m, 12H, 6CH2), 1.41-1.43 (m, 8H, 4CH2), 1.51-1.53
(m, 8H, 4CH2), 1.71-1.72 (m, 4H, 2CH2), 4.45 (s, 2H, 2CH), 6.43 - 6.46 (m, 2H, ArH), 7.01
(t, 2H, J =7Hz, ArH), 7.40(d, 2H, J =7.4 Hz, ArH), 7.48 (d, 2H, J = 9 Hz, ArH), 10.31 (s, 2H,
9

2NH), 13C-NMR: (100 MHz, DMSO-d6)δ (ppm) = 16.23 (2CH3), 17.20, 18.31, 20.61, 25.00,
27.17, 28.04, 45.00 (CH),112.02, 117.65, 118.17, 120.78, 121.78, 123.65, 125.49, 127.45,
128.99, 138.19, EA calcd. : C, 84.79, H, 10.50, N, 4.71, found C, 84.80, H, 10.50, N, 4.72, Rf
0.70 (CH2Cl2).
6,12-bis(5-methylfuran-2-yl)-5,6,11,12-tetrahydroindolo[3,2-b]carbazole (4): Light brawn
o
powder, mp. 126-127 C, yield 64 %, 418.49, g/mol, C28H22N2O2, ESI-MS: 419.20 [M+H+],
1
IR (ATR,cm-1): 3921 (NH), 2983, 2987 (CH), H-NMR (400 MHz, DMSO-d6): δ (ppm):
2.05 (s, 3H, CH3), 2.11 (s, 3H, CH3), 5.53 (s, 2H, 2CH), 6.57 - 6.64 (m, 2H, ArH), 7.14 (t,
2H, J = 7.5Hz, ArH), 7.40 (d, 2H, J = 8 Hz, ArH), 7.56 (d, 2H, J = 8.4 Hz, ArH), 7.90 (t, 2H,
13
J = 7.6 Hz, ArH), 8.06 (m, 2H, ArH), 10.13 (s, 2H, 2NH), C-NMR: (100 MHz, DMSO-d6)δ
(ppm) = 45.80 (2CH), 100.11, 112.00, 117.55, 118.18, 120.08, 121.90, 123.45, 125.69,
127.85, 128.39, 135.14, 138.89, EA calcd.: C, 80.36, H, 5.30, N, 6.69, found C, 80.37, H,
5.31, N, 6.68, Rf 0.37 (CH2Cl2).
6,12-bis(4-nitrofuran-2-yl)-5,6,11,12-tetrahydroindolo[3,2-b]carbazole (5): Dark brawn
o
powder, mp. 116-118 C, yield 55 %, 480.43 g/mol, C26H16N4O6, ESI-MS: 481.11 [M+H+],
1
IR (ATR,cm-1): 3921 (NH), 2998, 2989 (CH), H-NMR (400 MHz, DMSO-d6): δ (ppm):
5.36 (s, 2H, 2CH), 6.57 - 6.64 (m, 2H, ArH), 7.14 (t, 2H, J 7.5Hz, ArH), 7.40 (d, 2H, J=8 Hz,
ArH), 7.56 (d, 2H, J=8.4 Hz, ArH), 7.90 (d, 2H, J 7.6Hz, ArH), 8.06 (m, 2H, ArH), 10.13 (s,
2H, 2NH), 13C-NMR: (100 MHz, DMSO-d6)δ (ppm) = 45.80 (2CH), 100.11, 112.00, 117.55,
118.18, 120.08, 121.90, 123.45, 125.69, 127.85, 128.39, 135.14, 138.89, EA calcd. : C,
65.00, H, 3.36, N, 11.66, found C, 65.02, H, 3.38, N, 11.65, Rf 0.59 (CH2Cl2).
6,12-di(benzo[d][1,3]dioxol-5-yl)-5,6,11,12-tetrahydroindolo[3,2-b]carbazole (6): Yellow
o
orange powder, mp. 156-157 C, yield 85 %, 498.53 g/mol, C32H22N2O4, ESI-MS: 499.23
1
[M+H+], IR (ATR,cm-1): 3822 (NH), 2988, 2994 (CH), H-NMR (400 MHz, DMSO-d6): δ
(ppm): 3.52 (s, 4H, 2OCH2O), 5.35 (s, 2H, 2CH), 6.23 - 6.24 (m, 4H, ArH), 7.44 (t, 4H, J 7.0
Hz, ArH), 7.53 (d, 2H, J = 7.0 Hz, ArH), 7.56 (d, 2H, J = 8.5 Hz, ArH), 7.58-7.59 (m, 2H,
13
ArH), 10.41 (s, 2H, 2NH), C-NMR: (100 MHz, DMSO-d6) δ (ppm) = 45.00 (CH), 58.06
(OCH2O), 111.02, 116.65, 119.13, 121.75, 122.09, 123.05, 125.22, 126.43, 129.90, 138.39,
EA calcd. : C, 77.10, H, 4.45, N, 5.62, found C, 77.11, H, 4.43, N, 5.60, Rf 0.37 (100%
CH2Cl2).
10

6,12-bis(3,4-dimethoxyphenyl)-5,6,11,12-tetrahydroindolo[3,2-b]carbazole (7): Yellow
o
powder, Mp 188-189 C, yield 89 %, C34H30N2O4, 530.61 g/ mol, ESI-MS: 531.22 [M+H+],
IR (ATR,cm-1) 3430 (NH), 1H-NMR (400 MHz, DMSO-d6): δ (ppm): 3.61 (s, 6H, 2OCH3),
3.71 (s, 6H, 2OCH3), 5.60 (s, 2H, 2CH-Ph), 6.71 (t, 4H, J = 7.4 Hz, ArH), 6.79 (d, 4H, J 7.3
Hz, ArH), 7.20 – 7.25 (m, 2H, ArH), 7.54-7.59 (m, 4H, ArH), 10.59 (s, 2H, 2NH), 13C-NMR
(100 MHz, DMSO-d6): δ (ppm): 45.77, 70.33, 111.42, 111.53, 114.44, 118.77, 119.34,
120.52, 126.32, 128.62, 128.99, 129.40, 129.77, 130.99, 136.90, 137.86, 137.25, 137.55,
157.60, EA: calcd. C, 76.96, H, 5.70, N, 5.28, found C, 76.94, H, 5.71, N, 5.29, Rf 0.35
(CH2Cl2).
6,12-dichloro-6,12-bis(chloromethyl)-5,6,11,12-tetrahydroindolo[3,2-b]carbazole (13):
o
Yellow orange powder, mp. 146-148 C, yield 95 %, 424.15 g/mol, C20H14Cl4N2, ESI-MS:
1
471.15 [M+H+], IR (ATR,cm-1): 3822 (NH), 2988, 2994 (CH), H-NMR (400 MHz, DMSO-
d6): δ (ppm): 5.46 (s, 4H, 2CH), 7.34 (t, 4H, J = 7.8Hz, ArH), 7.42 (d, 2H, J = 8.0 Hz, ArH),
13
7.46 (d, 2H, J = 8.0 Hz, ArH), 10.33 (s, 2H, 2NH), C-NMR: (100 MHz, DMSO-d6)δ
(ppm) = 53.11 (CH2Cl), 65.00 (C-Cl), 112.02, 117.65, 120.78, 123.65, 125.49, 127.45,
128.99, 138.19, EA calcd. : C, 56.63, H, 3.33, N, 6.60, found C, 56.63, H, 3.33, N, 6.60, Rf
0.45 (CH2Cl2).
6,12-dimethyl-6,12-diphenyl-5,6,11,12-tetrahydroindolo[3,2-b]carbazole (14): Yellow
o
orange powder, mp. 155-157 C, yield 85 %, 438.57 g/mol, C32H26N2, ESI-MS: 439.15
1
[M+H+], IR (ATR,cm-1): 3872 (NH), 2988, 2994 (CH), H-NMR (400 MHz, DMSO-d6): δ
(ppm): 2.41 (s, 6H, 2CH3), 6.65 - 6.63 (m, 2H, ArH), 7.25 (t, 2H, J = 7.5Hz, ArH), 7.48 (d,
2H, J = 8 Hz, ArH), 7.58- 7.61 (m, 5H, Ar-H), 7.66 (d, 2H, J = 8.5 Hz, ArH), 8.22- 8.25 (m,
13
5H, Ar-H), 10.42 (s, 2H, 2NH), C-NMR: (100 MHz, DMSO-d6) δ (ppm) = 35.14 (CH3),
110.12, 112.02, 116.64, 119.18, 121.58, 122.58, 124.95, 125.29, 128.40, 129.90, 138.49, EA
calcd. : C, 87.64, H, 5.98, N, 6.39, found: C, 87.65, H, 5. 99, N, 6.39, Rf 0.35 (CH2Cl2).
6,12-dimethyl-6,12-dip-tolyl-5,6,11,12-tetrahydroindolo[3,2-b]carbazole (15): Yellow
o
orange powder, mp. 144-146 C, yield 75 %, 466.63 g/mol, C34H30N2, ESI-MS: 471.15
1
[M+H+], IR (ATR,cm-1): 3822 (NH), 2988, 2994 (CH), H-NMR (400 MHz, DMSO-d6): δ
(ppm): 2.36 (s, 6H, 2CH3), 3.01(s, 6H, CH3) 6.58 - 6.06 (m, 2H, ArH), 7.45 (t, 2H, J 8Hz,
ArH), 7.50 (d, 2H, J = 9 Hz, ArH), 7.56 (d, 2H, J=8Hz, ArH), 7.63 (d, 4H, J = 8.5 Hz, ArH),
13
7.90 (d, 4H, J = 8.0 Hz, ArH), 10.63 (s, 2H, 2NH), C-NMR: (100 MHz, DMSO-d6) δ
(ppm) = 35.14 (CH3), 41.11(CH3), 109.10, 111.22, 114.04, 118.28, 122.88, 125.59, 126.90,
11

128.00, 128.89, 130.62, 137.41,, EA calcd. : C, 87.52; H, 6.48; N, 6.00 found C, 87.50, H,
6.49, N, 6.00, Rf 0.21 (CH2Cl2).
6,12-bis(4-methoxyphenyl)-6,12-dimethyl-5,6,11,12-tetrahydroindolo[3,2-b]carbazole
o
(16): Yellow orange powder, mp. 136-138 C, yield 83 %, 498.61 g/mol, C34H30N2O2, ESI-
1
MS: 471.15 [M+H+], IR (ATR,cm-1): 3822 (NH), 2988, 2994 (CH), H-NMR (400 MHz,
DMSO-d6): δ (ppm): 2.36 (s, 6H, 2CH3), 3.71 (s, 3H, OCH3), 3.79 (s, 3H, OCH3), 6.58 -
6.06 (m, 2H, ArH), 7.45 (t, 2H, J = 8.0 Hz, ArH), 7.50 (d, 2H, J = 9 Hz, ArH), 7.56 (d, 2H, J
= 8.0 Hz, ArH), 7.70 (d, 4H, J = 8.0 Hz, ArH), 7.99 (d, 4H, J = 8.5 Hz, ArH), 10.63 (s, 2H,
2NH), 13C-NMR: (100 MHz, DMSO-d6) δ (ppm) = 35.14 (CH3), 41.11(CH3), 109.10,
13
110.22, 112.04, 116.28, 124.88, 127.59, 128.90, 129.00, 130.89, 134.62, 137.41,, C-NMR:
(100 MHz, DMSO-d6)δ (ppm) = 35.55 (CH3), 55.01 (MeO), 112.02, 117.65, 118.17, 120.78,
121.78, 123.65, 125.49, 127.45, 128.99, 138.19, EA calcd.: C, 81.90, H, 6.06, N, 5.62, found
C, 81. 91, H, 6.06, N, 5.62, Rf 0.18 (CH2Cl2).
4,4'-(6,12-dimethyl-5,6,11,12-tetrahydroindolo[3,2-b]carbazole-6,12-diyl)dianiline (17):
o
Yellow orange powder, mp. 134-135 C, yield 85 %, 468.59 g/mol, C32H28N4, ESI-MS:
1
467.15 [M-H+], IR (ATR,cm-1): 3838 (NH), 2989, 2999 (CH), H-NMR (400 MHz, DMSO-
d6): δ (ppm): 2.43 (s, 6H, 2CH3) 5.26 (s, 4H, 2NH2), 6.52 - 6.54 (m, 2H, ArH), 7.04 (t, 4H, J
8Hz, ArH), 7.44 (d, 2H, J=7 Hz, ArH), 7.54 (d, 2H, J=7.5 Hz, ArH), 7.57-7.59 (m, 2H,
13
ArH), 7.87 (d, 2H, J 7Hz, ArH), 8.32-8.34 (m, 2H, ArH), 10.21 (s, 2H, 2NH), C-NMR:
(100 MHz, DMSO-d6)δ (ppm) = 34.00 (CH3), 112.02, 117.65, 118.17, 120.78, 121.78,
123.65, 125.49, 127.45, 128.99, 138.19, 145.31, EA calcd. : C, 82.02; H, 6.02; N, 11.96,
found C, 82.02, H, 6.02, N, 11.95, Rf 0.45 (CH2Cl2).
5.2. In vitro anticancer screening
5.2.1 Materials
Fetal bovine serum (FBS) and L-glutamine, were obtained from Gibco Invitrogen Company
(Scotland, UK). Dulbecco's modified Eagle's (DMEM) medium was provided from Cambrex
(New Jersey, USA). Dimethyl sulfoxide (DMSO), doxorubicin, penicillin, streptomycin and
(3-(4, 5-dimethylthiazol-2-yl)-2, 5- diphenyl tetrazolium bromide) (MTT) (3-(4,5-
dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were obtained from Sigma Chemical
Company (St. Louis, MO, USA). Human urokinase (uPA) ELISA kit was purchase from
Assaypro, USA. All other chemicals and reagents used in this study were of analytical grade
and purchased from Sigma-Aldrich chemical Co. (St. Louis, MO, USA). For anticancer
activity screening of the tested compounds, lung A549, colon HCT116, breast MCF-7,
12

prostate PC3 and liver HepG2 cancer cell lines as well as the normal cell line (human normal
melanocyte, HFB4) were obtained from the American Type Culture Collection (Rockville,
MD, USA). The cells were maintained in Dulbecco's modified Eagle's medium (DMEM)
supplemented with 10% heat inactivated fetal calf serum (GIBCO), penicillin (100 U/ml) and
streptomycin (100 µg/ml) at 37oC in humidified atmosphere containing 5% CO2. Cells at a
concentration of 0.50 x 106 were grown in a 25 cm2 flask in 5 ml of culture medium [25].
5.2.2 In Vitro anti-cancer activity assay
The anticancer activity of the established compounds was calculated in vitro via MTT assay
[26, 27]. Concisely, Cells were immunized in 96-well micro titer plate (104 cells/ well) for 24
h earlier behavior with the tested compounds to allow attachment of cell to the wall of the
plate. Test compounds were dissolved in DMSO at 1 mg/ml. Diverse dilution of verified
compounds and doxorubicin were added to the cells. Monolayer cells were incubated with the
compounds for 24 h. at 37°C and in atmosphere of 5% CO2. The outcomes were associated to
the effect of the reference drug, doxorubicin.
5.3. Urokinase (uPA) concentration assay :
Compounds (5, 8, 10 and 17) which gave the best anti proliferative results were further used
to guesstimate their effects on the expression of uPA protein height in the cell extracts. All
the compounds as well as standard were incubated for 24 h with MCF7 cells at concentration
of their IC50 values of each compound which shown in Table 3. The color will change from
blue to yellow. Read the absorbance on a micro plate reader at a wavelength of 450 nm
immediately. The concentrations of uPA in the samples were determined based on the uPA
standard curve.
5.4. Molecular genetics
Gene expression analysis & Quantitative Real Time PCR method
5.4.1 RNA isolation
Total RNA was isolated from tumor cell lines using the RNeasy Mini Kit (Qiagen, Hilden,
Germany) supplemented with DNaseI (Qiagen) digestion step, according to the
manufacturer’s protocol.[29]
13

5.4.2 Reverse Transcription (RT) Reaction
Complete Poly(A)+ RNA isolated from tumor cell lines was reverse transcribed into cDNA in
a total volume of 20 µl using RevertAidTM First Strand cDNA Synthesis Kit. [29]
5.5. DNA Damage using comet assay
The neutral comet assay for tumor cell lines was used as described according to Olive et al.
[30]. For each sample about 100 cells were examined to determine the percentage of cells
with DNA damage that appear like comets. The no overlapping cells were randomly selected
and were visually assigned a score on an arbitrary scale of 0–3 (i.e., class 0 = no detectable
DNA damage and no tail; class 1 = tail with a length less than the diameter of the nucleus;
class 2 = tail with length between 1× and 2× the nuclear diameter; and class 3 = tail longer
than 2× the diameter of the nucleus) based on perceived comet tail length migration and
relative proportion of DNA in the nucleus [31].
5.6 Molecular modelling methodology
The three-dimensional structures of synthesized compounds with best biological profile 5, 8,
10, and 17, in their neutral forms were sketched using the MOE of Chemical Computing
Group Inc software. Then lowest energy conformers for each derivative ‘global-minima’ was
identified using Conformational search. They were then prepared for docking into the
urokinase-type plasminogen activator (uPA) enzyme-binding domain. A crystal structure of
uPA bound with an inhibitor (benzothiophene2-carboxamide) was obtained from the Protein
Data Bank (PDB ID: 1f51) for docking calculations. [32] The protein structure was first
separated from the inhibitor molecule and refined using molecular minimization with added
hydrogens. The molecular mechanics forcefield was used for all molecular minimizations.
This refined protein structure was used in the subsequent docking studies. Hydrogen atoms
were added at their standard geometry, the partial charges were computed then energy
optimization was conducted. Triangle matcher as placement method and affinity dG as a
scoring function was used for docking .30 conformers of the ligand were retained with the
highest and best score. Amiloride and UK122 was docked into the active site, to validate the
docking procedure and results, ligand receptor interaction via docking was demonstrated by
2D and 3D ligand views. The active site has been defined as the collection of residues wit of
the bound inhibitor and comprised the union of all ligands of the ensemble. All atoms located
14

less than 10.0 A° from any ligand atom were considered. The compounds of interest has
been sunjected to surface mapping against the selected standards using ‘Molecular Operating
Environment’ software (MOE of Chemical Computing Group Inc., on a Core i7 2.3 GHz
workstation). Lowest energy aligned conformation(s) were identified [36-40].
Conflict of interest
The Author(s) declare(s) that they have no conflicts of interest to disclose.
6. References
[1] A.M.Mahmoud,, A. Abdel-Halim, A. Fyiad, Anti-cancer effect of some prepared sulfated
oligosaccharides on three different human cancer cell lines. Asian Journal of
Pharmaceutical and Clinical Research. 7 (2014) 168-176.
[2] M. El Sayed, K. Ahmed, K. Mahmoud, A. Hilgeroth, Synthesis, cytostatic evaluation and
structure activity relationships of novel bis-indolylmethanes and their corresponding
tetrahydroindolocarbazoles, European Journal of Medicinal Chemistry, 90 (2015) 845-
859.
[3] M. El Sayed, A. Voronkov, I. Ogungbe, S. El-Hallouty, K. Ahmed, B. Vladimir, K.
Balakin, Anti-cancer, Molecular docking and structure activity relationship studies of
some Novel Synthetic spiroindolo[3,2-b]carbazoles as predicted HER2 and BrK Kinase
Inhibitors, 2017. DOI: 10.2174/1573407213666170213154357
[4] G. Markus, S. Camiolo, S. Kohga, J. Madeja, and A. Mittleman, Plasminogen activator
secretion of human tumors in short-term organ culture, including a comparison of
primary and metastatic colon tumors. Cancer Res., 43: 5517-5525, 1983.
[5] S. Siicela., and J. Barrett, In vitro degradation of radiolabelled, intact basement membrane
mediated by cellular plasminogen activator. Carcinogenesis (Lond.), 3: 363-369, 1982.
[6] Jankun, J., Keck, R. W., Skrzypczak-Jankun, E. & Swiercz, R. Cancer Res. 57, 559–563
(1997).
[7] J.Unkeless, K. Dang, G. Kellerman, and E. Reich Fibrinolysis associated with oncogenic
transformation. J. Biol. Chem., 249 (1974) 4295-4305,.
[8] S. Ulisse E. Baldini, S. Sorrenti, M, Armiento. The Urokinase Plasminogen Activator
System: A Target for Anti-Cancer Therapy. Current Cancer Drug Targets, 9, (2009) 32-
71
[9] J.Murray, A. L. Towle, C. Emmanuel, C. Maduakor, E. Schwartz, ,J. A. Bridges, and B.
A. Littlefield, Inhibition of Urokinase by 4-substituted Benzo[f]thiophene-2-
carboxamidines: An Important New Class of Selective Synthetic Urokinase Inhibitor I
Cancer Research, 53, 1993, 2551-2559.
15

[10] L. S. Gutierrez, A. Schulman, T. Brito-Robinson, F. Noria, V. A Ploplis. F. J.
Castellino, Tumor Development is Retarted in Mice Lacking the Gene for Urokinase-
Type Plasminogen Activator or its Inhibitor, Plasminogen Activator Inhibitor-1. Cancer
Res. 60, 2000, 5839-5847.
[11] TW. Rockway, VL Giranda. Inhibitors of the proteolytic activity of urokinase type
plasminogen activator. Curr Pharm Des 9 (2003) 1483–98.
[12]. RL Mackman, HC Hui, JG Breitenbucher, et al. 2-(2-Hydroxy-3alkoxyphenyl)-1H-
benzimidazole-5-carboxamidine derivatives as potent and selective urokinase-type
plasminogen activator inhibitors. Bioorg Med Chem Lett 12 (2002) 2019–22.
[13] A.J. Bridges, A. Lee, C.E. Schwartz, M.J. Towle, B.A. Littlefield. The synthesis
of three 4-substituted benzo[b]thiophene-2-carboxamidines as potent and selective
inhibitors of urokinase. Bioorg Med Chem 1 (1993) 403–10.
[14] C.G. Barber, R.P. Dickinson, P.V. Fish Selective urokinase-type plasminogen
activator (uPA) inhibitors. Part 3: 1-isoquinolinylguanidines. Bioorg Med Chem Lett.
2004;14:3227–30.
[15] JJ Heynekamp, LA Hunsaker, TA Vander Jagt, LM Deck, DL Vander Jagt
.
Uncharged isocoumarin-based inhibitors of urokinase-type plasminogen activator.
BMC Chem Biol;6: (2006) 1.
[16] CG Barber, RP Dickinson. Selective urokinase-type plasminogen activator (uPA)
inhibitors. Part 2: (3-substituted-5-halo-2-pyridinyl)guanidines. Bioorg Med Chem Lett
2002;12:185 –7.
[17] CG Barber, RP Dickinson, VA Horne. Selective urokinase-type plasminogen
activator (uPA) inhibitors. Part 1: 2-pyridinylguanidines.Bioorg Med Chem Lett 12
(2002) 181 –4.
[18] M.T. El Sayed, N.A. Hamdy, D.A. Osman et al. Indoles as anti-cancer agents. Adv Mod
Oncol Res 1(1) (2015) 20–35
[19] MT, El Sayed, HAR, Hussein, KM, Ahmed et al. Synthesis and antiproliferative activity
of some novel indole Mannich bases. Adv Mod Oncol Res 1(2) (2015) 104–111;
http://dx.doi.org/10.18282/amor.v1.i2.4.
[20] D. Maciejewska, M. Niemyjska, I. Wolska, M. Waostowski, M. Rasztawicka,
Z. Naturforsch . 1,2-Deoxygenation of vic-Dihydroxyindenoimidazoles: Optimization
of a Novel Deoxygenation Reagent B Chem. Sci. 59 (2004) 1137.
[21] D. Maciejewska, I. Wolska, M. Niemyjska, P. Zero, Glacial acetic acid as an efficient
catalyst for simple synthesis of dindolylmethanes . J. Mol. Struct. 753 (2005) 53.
[22] D. Pelaprat, R. Oberlin, I. Le Guen, B.P. Roques, J.B. LePecq, J. Med. Chem. 23
(1980) 1330.
[23] (a) G. Martin, C. Cocca, E. Rivera, G. Cricco, R. Caro, A. Segall, H. Pappa,
R. Casaubon, M.T. Pizzorno, R.M. Bergoc, J. Exp. Ther. Oncol. 2 (2002) 77e84;
16

[24] M.M. Ali, A.E. Mahmoud, A.E Rashad Inhibition of human MCF-7 breast cancer
growth by free radicals enhancement of polycondensed thienopyrimidine derivatives.
Asian Journal of Pharmaceutical and Clinical Research 4 (2011) 118-122.
[25] T. El Malah, H.F. Nour, A. A. Nayl, R. A. Elkhashab, F.M.E. Abdel-Megeid, M.M. Ali,
Anticancer evaluation of tris(triazolyl)triazine derivatives generated via click chemistry.
Austr. J. Chem. 69(8) (2016) 905-910
[26]T. Mosmann Rapid colorimetric assay for cellular growth and survival: application to
proliferation and cytotoxicity assays. J immunol meth,. 65(1) 1983 55-63.
[27] A. E. Rashad, A. E. Mahmoud, M. M. Ali..Synthesis and anticancer effects of some
novel pyrazolo[3,4-d]pyrimidine derivatives by generating reactive oxygen species in
human breast adenocarcinoma cells. European Journal of Medicinal Chemistry, 46
(2011) 1019-1026.
[28] M. A. Omar, Y. M. Shaker, S. A. Galal, M. M. Ali, S. M. Kerwin, J. Li, H.Tokuda, R. A.
Ramadan, H. I. El Diwani Synthesis and docking studies of novel antitumor
benzimidazoles, Bioorganic and Medicinal Chemistry, 20(24) (2012) 6989-7001
[29] SF. de Oliveira, M. Ganzinelli, R. Chilà, L. Serino, ME. Maciel, C. A. de Urban ,
RS. de Lima, I .J. Cavalli, Generali D, Broggini M, Damia G, Ribeiro EM.
Characterization of MTAP Gene Expression in Breast Cancer Patients and Cell Lines.
PLoS One. Jan 11;11(1) (2016) 0145647
[30] C. A, Dusinska M, Franklin M, Somorovska M, Petrovska H, Duthie S, Fillion L,
Panayiotidis M, Raslova K. Vaughan N. Comet assay in human biomonitoring studies:
Reliability, validation, and applications. Environ. Mol. Mutagen. 30 (1997) 139-146.
[31] Olive, JP. Banáth, RE . Durand. Heterogeneity in radiation-induced DNA damage and
repair in tumor and normal cells measured using the "comet" assay. Radiat Res. Aug;
178(2): (2012) AV35-42.
[32] E. Zeslawska,, A. Schweinitz,. A. Karcher, P. Sondermann,, S. Sperl, J. Stürzebecher,
U. Jacob. A transient interaction between two phosphorelay proteins trapped in a crystal
lattice reveals the mechanism of molecular recognition and phosphotransfer in signal
transduction. J. Mol. Biol. 301 (2000) 465.
[33] H. Matthews, M. Ranson, M. J. Kelso. Anti-tumour/metastasis effects of the potassium-
sparing diuretic amiloride: An orally active anti-cancer drug waiting for its call-of-duty?
Int. J. Cancer 129 (2011) 2051.
[34] Z. Ming, M. Vijay, M. Gokhale, M. Ruben, B. Sridevi, Daniel D., L.V. Hoff ,H. Baek,
L. H. Hurley,and H. Han Identification of a novel inhibitor of urokinase-type
plasminogen activator Mol Cancer Ther; 6(4): 2007 1348–56.
17

[35] BA Katz, C. Luong C, Ho JD, et al. Dissecting and designing inhibitor selectivity
determinants at the S1 site using an artificial Ala190 protease (Ala190 uPA). J Mol Biol
2004;344:527–47.
[36] M. Feher , E. Sourial , J. M. Schmidt P. Labute et al., "Flexible alignment of small
molecules"J. Med. Chem., , 44 ,10 (2001) pp 1483–1490
[37] V. Cody, C. H. Schwalbe. Structural characteristics of antifolate dihydrofolate reductase
enzyme interactions Crystallography Reviews, 12 (2006), 301–333.
[38] J. P.Volpato, B. J. Yachnin, J. Blanchet, V. Guerrero, L. Poulin,, E. A. Fossati,.
M. Berghuis, J. N. Pelletier, Multiple conformers in active site of human dihydrofolate
reductase F31R/Q35E double mutant suggest structural basis for methotrexate
resistance. J.Biol.Chem. 284: (2009) 20079-20089
[39] N. L. Allinger. Conformational analysis. 130. MM2. A hydrocarbon force field utilizing
V1 and V2 torsional terms J. Am. Chem. Soc. 99 (1977) 8127-8134.
[40] P. Labute, C. Williams, M. Feher, E. Sourial, J.M. Schmidt, Flexible alignment of small
molecules. J. Med. Chem. 44 (2001) 1483–1490.
Captions
Chart 1. Structures of some literature uPA inhibitors, A,B and the synthesized compounds 1
17
Scheme 1. Synthesis of THICZs derived from aldehydes (1-10) and ketones (11-17).
Table 1: Antitumor activity of the synthesized target compounds 1-17
Table 2: The level of uPA protein in the MCF7 cells exposed to 1/10 of IC50 of tested
compounds.
Table 3: Primers sequence used for RT-qPCR
Table 4: Visual score of DNA damage in tumor cell lines treated with samples 5, 8, 10 and
17.
Fig 1: The alterations of MTAP gene in tumor cell lines treated with samples 5, 8, 10 and 17.
Data are presented as mean ± SEM. a,b,cMean values within tissue with unlike
superscript letters were significantly different (a: P<0.01, b, c P<0.05).
Fig 2: The alterations of CDKN2A gene in tumor cell lines treated 5, 8, 10 and 17.
Data are presented as mean ± SEM. a,b,cMean values within tissue with unlike
superscript
letters were significantly different (a: P<0.01, b, c P<0.05).
18

Fig 3: Visual score of normal DNA (class 0) using comet assay in tumor cell lines Visual score
of DNA damag (class 1, 2 and 3) using comet assay in tumor cell lines exposed to
compounds
Fig 4: Lowest energy conformers of most active compounds (a) Amiloride (b) UK 122 with
balls and cylinders rendering.
Fig 5: Lowest energy conformers of most active compounds (a) 5 (b) 8 (c) 10 and (d) 17 ,
with balls and cylinders rendering
Fig 6: (a) The 2D binding mode and residues involved in the recognition for Amiloride, (b)
The 3D binding mode and residues involved in the recognition for Amiloride The
essential amino acid residues at the binding site are tagged in circles.
Class 1
Fig 7: (a) The 2D binding mode and residues involved in the recognition for UK 122, (b) The
2D binding mode and residues involved in the recognition for compound 5. The
essential amino acid residues at the binding site are tagged in circles.
Fig 8: (a) The 2D binding mode and residues involved in the recognition for compound 8,
(b) compound 10, (c) compound 17. The essential amino acid residues at the binding
site are tagged in circles.
Fig. 9 Surface map for (a) Amiloride ; (b)UK 122, Pink: hydrogen bond, blue: mild polar,
green: hydrophobic region.
Fig 10 Surface map for (a) the most active compound 5; (b) Compound 8, (c) compound 10,
and Compound 17 Pink: hydrogen bond, blue: mild polar, green: hydrophobic region
19

Chart 1: Structures of some literature uPA inhibitors, A,B and the synthesized
compounds 1-17

Figure 1: The alterations of MTAP gene in tumor cell lines treated with samples 5, 8, 10 and 17. Data are presented
as mean ± SEM. a,b,cMean values within tissue with unlike superscript letters were significantly different (a: P<0.01,
b, c P<0.05).
Figure 2: The alterations of CDKN2A gene in tumor cell lines treated 5, 8, 10 and 17.
Data are presented as mean ± SEM. a,b,cMean values within tissue with unlike superscript
letters were significantly different (a: P<0.01, b, c P<0.05).

Class1
Class
0
Class3
Class2
Class 1
Figure 3: Visual score of normal DNA (class 0) using comet assay in tumor cell lines Visual score of DNA damage
(class 1, 2 and 3) using comet assay in tumor cell lines exposed to compounds
(a)
(b)
Figure 4: Lowest energy conformers of most active compounds (a) Amiloride (b) UK 122 with balls
and cylinders rendering.

(b)
(a)
(d)
(c)
Figure 5: Lowest energy conformers of most active compounds (a) 5 (b) 8 (c) 10 and (d) 17 , with
balls and cylinders rendering

(a)
Figure 6: (a) The 2D binding mode and residues involved in the recognition for Amiloride, (b) The 3D
binding mode and residues involved in the recognition for Amiloride The essential amino acid
residues at the binding site are tagged in circles.
(b)
(a)
Figure 7: (a) The 2D binding mode and residues involved in the recognition for UK 122, (b) The 2D
binding mode and residues involved in the recognition for compound 5. The essential amino
acid residues at the binding site are tagged in circles.

.
(b)
(a)
(c)
Figure 8: (a) The 2D binding mode and residues involved in the recognition for compound 8, (b)
compound 10, (c) compound 17. The essential amino acid residues at the binding site are tagged in
circles.
(b)
(a)
Figure 9: Surface map for (a) Amiloride ; (b)UK 122, Pink: hydrogen bond, blue: mild polar, green:
hydrophobic region.

(a)
(b)
(d)
(c)
Figure 10: Surface map for (a) the most active compound 5; (b) Compound 8, (c) compound 10, and
Compound 17 Pink: hydrogen bond, blue: mild polar, green: hydrophobic region.

Table 1: Antitumor activity of the synthesized target compounds 1-17
Comp. NO.
R
R1
R2
R3
MCF-7
HFB4
-
-
-
-
-
-
-
-
-
62.00±5.80
75.80±8.20
43.66±5.72
62.90±7.00
5.24±0.37
43.80±5.11
37.90±4.50
4.00±0.52
61.71±7.16
7.20±0.90
43.80±5.40
39.80±4.75
14.22±3.20
16.65±2.81
12.77±2.65
18.00±1.60
75.20±8.65
12.70±1.85
19.06±3.10
80.00±7.37
14.22±3.28
17.34±2.63
21.16±3.90
24.35±4.21
3-OH-Ph
C11H23
3-indolyl
1
2
3
4
5
6
7
8
9
5-CH3-furfural
4-NO2-furfural
pipronal
3,4-(CH3O)2-Ph
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
H
3-pridyl
-
-
-
-
4- CH3O-3-OCH2Ph
10
11
12
3-indolyl
3-pridyl
CH3
CH3
-
-
-
-
-
-
-
Cl
Ph
CH2Cl
CH3
CH3
CH3
CH3
-
-
-
-
-
70.05±8.13
66.90±7.80
56.25±8.81
48.23±5.34
9.60±1.10
3.30±0.48
11.15±1.44
13.32±1.20
17.29±1.90
20.11±3.63
65.14±7.86
88.75±9.20
13
14
15
16
17
4- CH3-Ph
4- CH3O-Ph
4-NH2-Ph
Doxorubicin
28

Table 2. The level of uPA protein in the MCF7 cells exposed to 1/10 of IC50 of tested compounds.
Compound
uPA level
(ng/ml)
3.80±0.45a
2.70±0.40a
4.75±0.25a
10.80±1.05a
22.00±3.70
2.30±0.37a
5
8
10
17
DMSO
Dox
Table 3: Primers sequence used for RT-qPCR
Gene
Forward
Reverse
(β)-actin
GATGCAGAAGGAGATCACTGC
CCACCGCCGTGAAGATTGGAA
AGTACTTGCGCTCAGGAGGA
CCACCGCCGTGAAGATTGGAA
AAGTTTCCCGAGGTTTCTCA
MTAP
CDKN2A CCACCGCCGTGAAGATTGGAA
MTAP: Methylthioadenosine Phosphorylase;CDKN2A:Cyclin Dependent Kinase Inhibitor 2A
Table 4: Visual score of DNA damage in tumor cell lines treated with samples 5, 8, 10 and 17.
Treatment
No. of cells
Class**
DNA damaged cells %
(Mean±SEM)
Analyzed* Comets
0
1
2
3
0
Control (-ve)
Control (+ve)
Sample 5
400
400
400
400
400
400
42
86
59
62
66
65
358
314
341
338
334
335
37
42
35
40
38
34
5
10.50±0.65c
21.50±0.87a
14.80±0.47bc
15.50±0.64b
16.50±0.65b
16.30±0.62b
29
18
15
17
22
15
6
Sample 8
7
Sample10
11
9
Sample 17
*: Number of cells examined per a group, **: Class 0= no tail; 1= tail length < diameter of nucleus; 2= tail length
between 1X and 2X the diameter of nucleus; and 3= tail length > 2X the diameter of nucleus.
29