An approach to the desulfurization of oligonucleotide phosphorothioates

Article abstract of DOI:10.1016/S0040-4039(03)00322-8

Protected oligonucleotide phosphorothioates are converted by a two-step procedure into oligonucleotides with standard phosphodiester internucleotide linkages. The remaining protecting groups are then removed by ammonolysis.

Full text of DOI:10.1016/S0040-4039(03)00322-8

TETRAHEDRON
LETTERS
Pergamon
Tetrahedron Letters 44 (2003) 2501–2504
An approach to the desulfurization of oligonucleotide
phosphorothioates
Colin B. Reese* and Hongbin Yan
Department of Chemistry, King’s College London, Strand, London WC2R 2LS, UK
Received 13 January 2003; accepted 31 January 2003
Abstract—Protected oligonucleotide phosphorothioates are converted by a two-step procedure into oligonucleotides with standard
phosphodiester internucleotide linkages. The remaining protecting groups are then removed by ammonolysis. © 2003 Elsevier
Science Ltd. All rights reserved.
The synthesis of phosphorothioate analogues of
oligonucleotides has, in recent years, become a matter
of great importance in the context of the antisense
approach1,2 to chemotherapy. Vitravene (ISIS 2922), a
21-mer oligodeoxyribonucleotide phosphorothioate, has
already been licensed3 by the US Food and Drug
Administration for the treatment of cytomegalovirus
retinitis in AIDS patients and advanced clinical trials
are being carried out on several other modified DNA
sequences of this type. As potential drugs, oligonucle-
otide phosphorothioates have the advantage that they
are not easily susceptible to digestion by phosphorolytic
enzymes. However, this resistance to enzymatic diges-
tion also has a disadvantage in that it prevents both the
characterization of these oligonucleotide analogues by
standard sequencing methods and the determination of
their nucleoside ratios by total enzymatic digestion.
With regard to both of these analytical procedures, it
would be advantageous if oligonucleotide phosphoro-
thioates could be readily and quantitatively desulfur-
ized to give the corresponding unmodified oligonu-
cleotides without any concomitant internucleotide
cleavage. Several oxidative procedures involving, for
example, iodine4 and potassium peroxymonosulfate
(oxone)5 have already been used to convert unprotected
oligonucleotide phosphorothioates into the correspond-
ing unmodified oligonucleotides. However, these desul-
furization procedures appear to result in some
accompanying internucleotide cleavage.
thioates. We now report that, following the unblocking
of the internucleotide linkages, it is possible to convert
the resulting partially-protected intermediates into
fully-unprotected unmodified oligonucleotides as well
as into oligonucleotide phosphorothioates. No detect-
able internucleotide cleavage occurs in the course of the
desulfurization process.
Our present approach8 to the synthesis of dinucleoside
phosphorothioates in solution is illustrated in Scheme
1a. A 5%-protected nucleoside 3%-H-phosphonate 1 is
coupled with a 3%-protected nucleoside derivative 2 in
the presence of diphenyl phosphorochloridate and N-
[(2-cyanoethyl)sulfanyl]succinimide 5 in pyridine solu-
tion. Adenine, cytosine, guanine and thymine residues
are protected as in 9, 10, 11 and 12, respectively. At the
beginning of the unblocking process, the 5%-O-DMTr
protecting group is removed from the product and the
released hydroxy function is acetylated (Scheme 1a,
steps ii and iii) to give the fully-protected dinucleoside
phosphorothioate 3. The S-(2-cyanoethyl) protecting
group is then removed by treatment with 1,8-diazabicy-
clo[5.4.0]undec-7-ene (DBU) in dichloromethane solu-
tion to give
a
partially-protected dinucleoside
phosphorothioate 4. Following the removal of the pro-
tecting groups from the base residues and the terminal
3%- and 5%-hydroxy functions in the usual way, the
fully-unblocked dinucleoside phosphorothioate is
obtained. We now report that, if the desulfurized di-
nucleoside phosphate 8 is required, the excess DBU
should first be neutralized with trifluoroacetic acid and
the phosphorothioate internucleotide linkage of the
intermediate 4 then alkylated with bromoacetonitrile in
the presence of N,N-dimethylaniline (Scheme 1b, step
v) to give the corresponding dinucleoside phosphoro-
We have recently introduced6–8 a method for the solu-
tion phase synthesis of oligonucleotide phosphoro-
* Corresponding author. Tel.: +44-20-7848-2260; fax: +44-20-7848-
1771; e-mail: colin.reese@kcl.ac.uk
0040-4039/03/$ - see front matter © 2003 Elsevier Science Ltd. All rights reserved.
doi:10.1016/S0040-4039(03)00322-8

2502
C. B. Reese, H. Yan / Tetrahedron Letters 44 (2003) 2501–2504
Scheme 1. Reagents and conditions: (i) (PhO)2POCl, 5, C5H5N, rt; (ii) Cl2CHCO2H, pyrrole, CH2Cl2, rt; (iii) Ac2O, C5H5N, rt; (iv)
DBU, CH2Cl2, rt, 30 min; (v) (a) CF3CO2H, CH2Cl2, rt, 5 min, (b) BrCH2CN, PhNMe2, CH2Cl2, rt, 15 h; (vi) 7, (Me2N)2CꢀNH
(TMG), MeCN, rt, 15 h; (vii) (a) conc. aq. NH3 (d 0.88), 55°C, 15 h, (b) Amberlite IR 120 (Na+) cation-exchange resin.
thioate 6 with an S-cyanomethyl-protected internu-
cleotide linkage. If the appropriate stoichiometry is
observed,9 quantitative and regiospecific S-alkylation of
the phosphorothioate diester function occurs and no
reaction takes place between bromoacetonitrile and any
of the base residues.10 Treatment of the fully-protected
intermediate 6 with E-2-nitrobenzaldoxime 7 and
N1,N1,N3,N3-tetramethylguanidine (TMG) in acetoni-
trile solution,12 followed by the ammonolytic removal of
the remaining protecting groups (steps vi and vii) leads
solely to the unprotected dinucleoside phosphate 8. It is
clear that oximate treatment of S-cyanomethyl phospho-
rothioate triesters does not lead to internucleotide cleav-
age as S-cyanomethyl phosphorothioate diester functions
13 (or the corresponding 5%-diesters) cannot be detected
in the 31P NMR spectra13 of the desulfurized products
obtained in this study. When an S-(2-cyanoethyl)-pro-
tected phosphorothioate (e.g. 3) is treated directly with
E-2-nitrobenzaldoxime 7 and TMG in acetonitrile solu-
tion, the corresponding phosphorothioate diester (e.g. 4)
is obtained as the only product.
A number of fully-protected dinucleoside phosphoro-
thioates, trinucleoside diphosphorothioates and oligo-
nucleotide phosphorothioates were unblocked (Table 1)
by this desulfurization procedure. These transforma-
tions were carried out on a relatively small (0.05–0.088
g) scale and the percentage yields of fully-unblocked
desulfurized products, which were isolated as their
sodium salts, were on the whole satisfactory. However,
none of these transformations has yet been optimized.
The resulting products were chromatographically
(HPLC) relatively homogeneous even though they were
not further purified after unblocking; when they were
digested14 first with Crotalus adamanteus snake venom

C. B. Reese, H. Yan / Tetrahedron Letters 44 (2003) 2501–2504
Table 1. Desulfurization of oligonucleotide phosphorothioates
2503
Substratea
Quantity desulfurized mg (mmol)
Yield (%)b
tR (min)
dA:dC:dG:T ratiosd
Calculated
c
Entry
Found
1
2
3
4
5
6
7
Ac-Cp(s)G-Lev
Ac-Gp(s)A-Lev
50 (46)
60 (49)
70 (49)
45 (33)
50 (16.3)
88 (15.2)
87 (8.4)
75
68
68
55
45
66
56
5.44 (A)
7.40 (A)
10.60 (A)
8.96 (A)
9.52 (A)
10.46 (A)
6.72 (B)
0:1.00:1.00:0
1.05:0:1.00:0
1.04:0:0:2.00
0:1.00:0:1.94
0:2.00:2.00:1.97
0:4.00:2.06:5.89
0:1.00:1.00:0
1.00:0:1.00:0
1.00:0:0:2.00
0:1.00:0:2.00
0:2.00:2.00:2.00
0:4.00:2.00:6.00
Ac-Ap(s)Tp(s)T-Lev
Ac-Cp(s)Tp(s)T-Lev
Ac-(6-mer)-Lev8
Ac-(12-mer)-Lev8
Ac-(21-mer)-Lev8
0:6.00:5.27:10.13 0:6.00:5.00:10.00
a The abbreviations for the substrates in entries 1–4 are explained below.11 Using the same abbreviations, the substrates in entries 5–7 are
Ac-Cp(s)Tp(s)Tp(s)Gp(s)Cp(s)G-Lev, Ac-[Cp(s)Tp(s)Tp(s)]3Gp(s)Cp(s)G-Lev and Ac-Gp(s)Cp(s)Gp(s)Tp(s)Tp(s)Tp(s)Gp(s)Cp(s)Tp(s)[Cp(s)Tp(s)-
Tp(s)]3Gp(s)Cp(s)G-Lev, respectively.
b The desulfurized oligonucleotides were isolated as their sodium salts.
c Reversed-phase HPLC was carried out on a 250×4.6 mm Hypersil ODS 5 m column. The column was eluted with 0.1 M triethylammonium
acetate buffer (pH 7.0)–acetonitrile mixtures. The HPLC programmes used are indicated in parentheses [(A): linear programme of buffer–aceto-
nitrile (95:5 v/v to 85:15 v/v) over 10 min and then isocratic elution; (B): linear programme of buffer–acetonitrile (95:5 v/v to 60:40 v/v) over
10 min and then isocratic elution].
d The nucleoside ratios were determined by reversed-phase HPLC [programme (A)c], following digestion of the desulfurized oligonucleotides
according to the procedure indicated below.14
phosphodiesterase and then with E. coli alkaline phos-
phatase, they underwent quantitative digestion and the
proportions of the constituent nucleosides obtained
were in close correspondence to the calculated propor-
tions (Table 1, final column; entries 1–7). Furthermore,
satisfactory 1H and 31P NMR spectra were obtained for
all of the products. It is particularly noteworthy that
signals in the region of 56 ppm, which may be assigned
to the resonances of phosphorothioate phosphorus
atoms, were either absent or very weak indeed in the
31P NMR spectra of all the products. The HPLC
profiles of the fully-unblocked hexamer [d(CTTGCG)]
and 21-mer [d(GCGTTTGCTCTTCTTCTTGCG)]
(Table 1, entries 5 and 7, respectively) and their diges-
tion products are illustrated in Figure 1; the 31P NMR
spectra of these two oligonucleotides are illustrated in
Figure 2. The detailed experimental procedure for the
unblocking and desulfurization of the 21-mer (entry 7)
is provided below.15
Figure 2. 31P NMR spectra (145.78 MHz, D2O) of (a)
d(CTTGCG) and (b) d(GCGTTTGCTCTTCTTCTTGCG).
References
1. Oligonucleotides. Antisense Inhibitors of Gene Expression;
Cohen, J. S., Ed.; Macmillan: Basingstoke, 1989.
2. Miller, P. S. In Bioorganic Chemistry: Nucleic Acids;
Hecht, S. M., Ed.; Oxford University Press: New York,
1996; pp. 347–374.
3. Sanghvi, Y. S. Org. Process Res. Dev. 2000, 4, 168–169.
4. Burgers, P. M. J.; Eckstein, F. Biochemistry 1979, 18,
450–454.
5. Wozniak, L. A.; Koziolkiewicz, M.; Kobylanska, A.;
Stec, W. J. Bioorg. Med. Chem. Lett. 1998, 8, 2641–2646.
6. Reese, C. B.; Song, Q. Bioorg. Med. Chem. Lett. 1997, 7,
2787–2792.
7. Reese, C. B.; Song, Q. J. Chem. Soc., Perkin Trans. 1
1999, 1477–1486.
8. Reese, C. B.; Yan, H. J. Chem. Soc., Perkin Trans. 1
2002, 2619–2633.
9. For each (2-cyanoethyl)-protected internucleotide link-
age, ca. 10 mol equiv. of DBU is used (e.g. 10 mol equiv.
for an S-(2-cyanoethyl) dinucleoside phosphorothioate
and 20 mol equiv. for a bis-(2-cyanoethyl) trinucleoside
diphosphorothioate). Neutralization is effected with ca. 9
mol equiv. of trifluoroacetic acid per internucleotide link-
age. Alkylation is effected with ca. 3 mol equiv. each of
bromoacetonitrile and N,N-dimethylaniline per internu-
Figure 1. Reversed-phase HPLC (see Table 1) profiles of (a)
d(CTTGCG), (b) d(GCGTTTGCTCTTCTTCTTGCG), (c)
enzymatic digest14 of d(CTTGCG) and (d) enzymatic digest14
of d(GCGTTTGCTCTTCTTCTTGCG). In (c) and (d), the
HPLC detector was set at 260 nm and the order of elution
was dC, dG, dT.

2504
C. B. Reese, H. Yan / Tetrahedron Letters 44 (2003) 2501–2504
cleotide linkage. Both the removal of S-(2-cyanoethyl)
and the resulting solution was incubated at 37°C for 20 h.
Alkaline phosphatase stock solution (15 ml) was then
added and incubation was continued for a further period
of 20 h. The digestion products were analyzed by HPLC
(see Table 1, footnoted).
and the introduction of S-cyanomethyl groups may be
monitored by NMR spectroscopy. The phosphorus
atoms in S-(2-cyanoethyl)-protected (e.g. 3), unprotected
(e.g. 4) and S-cyanomethyl-protected (e.g. 6) phospho-
rothioates resonate at ca. 28, 56 and 25 ppm, respectively.
15. DBU (0.25 ml, 1.67 mmol) was added to a stirred solu-
tion of Ac-Gp(s)Cp(s)Gp(s)Tp(s)Tp(s)Tp(s)Gp(s)Cp(s)-
Tp(s)[Cp(s)Tp(s)Tp(s)]3Gp(s)Cp(s)G-Lev (0.087 g, 8.4
mmol) in dichloromethane (1.5 ml) at rt. After 30 min, a
solution of trifluoroacetic acid (TFA) in dichloromethane
(10% w/v, 1.73 ml, 1.5 mmol of TFA) was added. After
5 min, diethyl ether (40 ml) was added and the resulting
precipitate was collected by centrifugation. This material
was reprecipitated by diethyl ether (30 ml) from its
dichloromethane (1.5 ml) solution two times, and was
finally dried in vacuo; it was then dissolved in
dichloromethane (1.5 ml), and N,N-dimethylaniline
(0.106 ml, 0.84 mmol) followed by bromoacetonitrile
(0.0585 ml, 0.84 mmol) were added to the stirred solution
at rt. After 15 h, diethyl ether (30 ml) was added. The
resulting precipitate was collected by centrifugation,
redissolved in dichloromethane (1.0 ml) and reprecipi-
tated with diethyl ether (30 ml). This material was then
fractionated by short column chromatography on silica
gel: the appropriate fractions, which were eluted with
dichloromethane–methanol (92:8 v/v), were combined
and evaporated under reduced pressure to give a colour-
less froth (0.063 g). E-2-Nitrobenzaldoxime 7 (0.164 g,
0.99 mmol) and TMG (0.11 ml, 0.88 mmol) were added
to a stirred solution of this material in acetonitrile (1.0
ml) and dichloromethane (1.0 ml) at rt. After 16 h, the
products were concentrated under reduced pressure and
the residue was heated with concentrated aq. NH3 (d
0.88, 1.5 ml) at 55°C for 15 h. The cooled products were
concentrated under reduced pressure and re-evaporated
with absolute ethanol (2×2 ml). Ethyl acetate (40 ml) was
added to a solution of the residue in methanol (3 ml). The
resulting precipitate was collected by centrifugation and
was reprecipitated from its methanol (3.0 ml) solution by
ethyl acetate (40 ml) two further times. A solution of the
resulting solid in water (4 ml) was applied to a column
(3×1.5 cm diameter) of Amberlite IR 120 (Na+ form)
cation-exchange resin. The column was eluted with water:
the appropriate fractions were combined and concen-
trated under reduced pressure to give the sodium salt of
d(GCGTTTGCTCTTCTTCTTGCG) (0.030 g, 56%) as a
colourless solid.
10. Following the treatment of Ac-Cp(s)G-Lev11 4; B=10,
B%=11 and Ac-Tp(s)A-Lev11 4; B=12, B%=9 with bro-
moacetonitrile and N,N-dimethylaniline, it was clear
from the 1H NMR spectra of the products that no
alkylation of the NH protons of the cytosine, guanine
and adenine residues had occurred. It was also clear from
the 31P NMR spectra of both products [Ac-Cp(s%)G-Lev11
6; B=10, B%=11 and Ac-Tp(s%)A-Lev11 6; B=12, B%=9]
that quantitative S-cyanomethylation of the phospho-
rothioate diester internucleotide linkages had occurred.
11. In a system of abbreviations for protected oligonucleotide
phosphorothioates that we have introduced,6,7 nucleoside
residues and internucleotide linkages are italicized if they
are protected in a defined way. In the present context, A,
C, G and T represent 2%-deoxyadenosine protected with a
benzoyl group on N-6 of its adenine residue (as in 9),
2%-deoxycytidine protected with a benzoyl group on N-4
of its cytosine residue (as in 10), 2%-deoxyguanosine pro-
tected with an isobutyryl group on N-2 and a 2,5-
dichlorophenyl group on O-6 of its guanine residue (as in
11) and thymidine protected with a phenyl group on O-4
of its thymine residue (as in 12), respectively; p(s), p(s)
and p(s%) represent an unprotected phosphorothioate
internucleotide linkage, an S-(2-cyanoethyl)- and an S-
cyanomethyl-protected phosphorothioate internucleotide
linkage, respectively.
12. For the unblocking of each S-cyanomethyl-protected
phosphorothioate internucleotide linkage and each gua-
nine and thymine base residue, ca. 4.5 mol equiv. of
E-2-nitrobenzaldoxime 7 and ca. 4 mol equiv. of TMG
were used.
13. 5%-O-DMTr-4-O-phenylthymidine
3%-(S-cyanomethyl)
R=DMTr, B=12 has
phosphorothioate
13;
lP[(CD3)2SO] 10.5. The only significant signals in the 31P
NMR spectra of the desulfurized products obtained in
this study are in the region of 0 ppm.
14. Stock enzyme solutions were prepared by dissolving Cro-
talus adamateus snake venom phosphorodiesterase (0.2–
0.4 unit) and E. coli alkaline phosphatase (ca. 1.0 unit)
separately in 0.1 M tris hydrochloride buffer (pH 8.3, 0.5
ml; 0.01 M with respect to magnesium chloride).
Phosphodiesterase stock solution (14 ml) was added to a
solution of substrate (ca. 1.0 A260 unit) in water (10 ml),