Design, Synthesis, and Structure–Activity Relationship Analysis of Thiazolo[3,2-a]pyrimidine Derivatives with Anti-inflammatory Activity in Acute Lung Injury

Article abstract of DOI:10.1002/cmdc.201700175

Acute lung injury (ALI) has a high lethality rate, and interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) contribute most to tissue deterioration in cases of ALI. In this study, we designed and synthesized a new series of thiazolo[3,2-a]pyrimidine derivatives based on a previously identified lead compound, and we evaluated their anti-inflammatory activities. Structure–activity relationship studies led to the discovery of two highly potent inhibitors. The two promising compounds were found to inhibit lipopolysaccharide (LPS)-induced IL-6 and TNF-α release in a dose-dependent manner in mouse primary peritoneal macrophages (MPMs). Furthermore, administration of these compounds resulted in lung histopathological improvements and attenuated LPS-induced ALI in vivo. Taken together, these data indicate that these novel thiazolo[3,2-a]pyrimidine derivatives could be developed as candidate drugs for the treatment of ALI.

Full text of DOI:10.1002/cmdc.201700175

Accepted Article
Title: Design, synthesis and structure-activity relationship analysis of
novel thiazolo[3,2-a]pyrimidin derivatives with anti-inflammatory
activity in acute lung injury
Authors: Guang Liang, Lingfeng Chen, Yiyi Jin, Weitao Fu, Siyang
Xiao, Chen Feng, Bo Fang, Yugui Gu, Chenglong Li, Yunjie
Zhao, and Zhiguo Liu
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: ChemMedChem 10.1002/cmdc.201700175
Link to VoR: http://dx.doi.org/10.1002/cmdc.201700175
A Journal of
www.chemmedchem.org

10.1002/cmdc.201700175
ChemMedChem
Design, synthesis and structure-activity relationship analysis of novel
thiazolo[3,2-a]pyrimidin derivatives with anti-inflammatory activity
in acute lung injury
Lingfeng Chenab1, Yiyi Jina1, Weitao Fua, Siyang Xiaoa, Chen Fenga, Bo Fanga,
Yugui Guc, Chenglong Lia,, Yunjie Zhaoa*, Zhiguo Liua*, Guang Liangab*
1 These authors contributed equally to this work.
[a] Dr. L. Chen, Y. Jin, Dr. W. Fu, S. Xiao, C. Feng, B. Fang, Prof. C. Li, Prof.
Y. Zhao, Prof. Z. Liu, Prof. G. Liang.
Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou
Medical University, Wenzhou, Zhejiang 325035, China
[b] Dr. L. Chen, Prof. G. Liang.
School of Chemical Engineering, Nanjing University of Science and
Technology, Nanjing, Jiangsu, 210094, China
[c] Prof. Y. Gu
School of Chemical Engineering and Materials, Wenzhou University, Wenzhou,
Zhejiang 325035, China
* Corresponding author:
Guang Liang, Ph.D, Professor
Chemical Biology Research Center at School of Pharmaceutical Sciences, Wenzhou
Medical University. 1210 University Town, Wenzhou, Zhejiang 325035, China
Tel: (+86)-577-86699396; Fax: (+86)-577-86699396.
E-mail: wzmcliangguang@163.com
and
Zhiguo Liu, Ph.D, Associate Professor, E-mail: lzgcnu@163.com
Yunjie Zhao, Ph.D, Associate Professor, E-mail: aabye1100@yahoo.com.cn
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
Abstract
Acute lung injury (ALI) results in high lethality rate, and interleukin-6 (IL-6) and
tumor necrosis factor-α (TNF-α) contribute most to tissue deterioration in ALI. In this
study, we designed and synthesized a new series of thiazolo[3,2-a]pyrimidine
derivatives based on lead compound found previously, and evaluated their
anti-inflammatory activities. The structure-activity relationship studies led to the
discovery of two highly potent inhibitors. Two promising compounds inhibited
lipopolysaccharide (LPS)-induced IL-6 and TNF-α release in a dose-dependent
manner in mouse primary peritoneal macrophages (MPMs). Furthermore,
administration of them resulted in lung histopathological improvements and
attenuated LPS-caused ALI in vivo. Taken together, these data indicate that the novel
thiazolo[3, 2-a]pyrimidine derivatives could be developed as candidates for the
treatment of ALI.
Keywords: Thiazolo[3,2-a]pyrimidines; Acute lung injury; Anti-inflammatory;
Cytokines; interleukins;
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
1. Introduction
Acute lung injury (ALI) is characterized by non-cardiogenic pulmonary edema,
and results in several disorders including pneumonia, aspiration syndromes, sepsis,
and major trauma and shock.[1] Despite advancing knowledge, lethality from ALI
remains high (30-40%), which is comparable to that of breast cancer.[1c, 2] Although
several pharmacologic treatments have been developed, such as protease inhibitors,
glucocorticoids, antioxidants, surfactants and anti-thrombotic treatments, none has
proven to be effective.[3] Hence, the development of alternative strategies against ALI
is highly desirable.
Several clinical studies have demonstrated that inflammatory cytokines play a
crucial role in mediating the initiation and amplification of ALI. Two key cytokines,
interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) contribute most to the
deterioration seen in ALI.[4] Elevated levels of IL-6 and TNF-α have been found in
bronchoalveolar lavage fluid (BALF) from human or experimental ALI.[1c, 5] These
observations suggest that attenuating excessive production of pro-inflammatory
cytokines, including IL-6 and TNF-α, may be promising approach for ALI therapy.
Inhibitors against the cytokine storm are emerging, and a few are effective in clinical
applications.[6]
Please insert Figure 1 here
Thiazolo- and pyrimidine-fused heterocyclic ring-systems were commonly found
in novel therapeutics,[7] including antimicrobial (1, Figure 1),[8] antiviral (2),
anticancer (3, 4)[9], anti-Parkinson’s (5),[10] and anti-inflammatory agents[11]. In the
past, our research group has designed, synthesized and evaluated a number of
compounds targeting pro-inflammatory cytokines for the treatment of sepsis and
ALI.[12]
Amongst
these
compounds,
ethyl
(Z)-7-methyl-2-(4-morpholinobenzylidene)-3-oxo-5-phenyl-2,
3-dihydro-5H-thiazolo[3,2-a]pyrimidine-6-carboxylate (6)[13] with a thiazolo- and
pyrimidine-fused heterocyclic ring showed high inhibitory rate on the release of
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
cytokines such as IL-6 and TNF-α in a dose-dependent manner and exhibited a
beneficial protection effects against liposaccharide (LPS)-induced septic death in a
mouse model. Yet, the relationship between anti-inflammatory activity and
thiazolo[3,2-a]pyrimidine derivatives remains unclear. Thus, we herein evaluated the
anti-inflammatory properties of thiazolo[3,2-a]pyrimidine derivatives, their inhibitory
effect against LPS-induced expression of IL-6 and TNF-α, as well as the
structure−activity relationships.
2. Results and discussion
2.1 Chemistry
The synthesis route of thiazolo[3,2-a]pyrimidine derivatives is shown in Scheme
1 (11a-o) and Scheme 2 (12a-i). The dihydropyrimidine derivatives 8a-o were
prepared using the classic one pot Biginelli reaction[14] of commercially available
ethyl 3-oxobutanoate, thiourea, and the corresponding aldehydes (7a-o), catalyzed by
sulfamic acid. Subsequently, Biginelli product (8a-o) was refluxed with ethyl
2-chloroacetate in the presence of pyridine to afford the cyclization product 9a-o. The
nitrogen containing aldehydes 10a-f and 13a were obtained by nucleophilic
displacement of the 4-fluorobenzaldehyde with the corresponding amines (Supporting
Information Scheme S1).[15] 10g-i were commercially available. Finally, cyclization
products 9a-o were allowed to undergo a Knoevenagel condensation with
4-morpholinobenzaldehyde (13a) to yield compounds 11a-o. Similarly, reaction of
ethyl
7-methyl-3-oxo-5-(thiophen-2-yl)-2,3-dihydro-5H-thiazolo[3,2-a]pyrimidine-6-carbo
xylate (9l) with corresponding aldehydes 10a-i provided compounds 12a-i. The
resulting residues were purified by silica chromatography and elution with 30%
EtOAc in petroleum ether. Compounds were then recrystallized in EtOH and DCM
solution (2:1) to yield target compounds at 35-85% (11a-o, 12a-i). Analytical and
spectral data of all synthesized compounds are in full agreement with the proposed
structures.
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
Please insert Scheme 1 and Scheme 2 here
2.2 Screening for inhibitory effect against LPS-induced IL-6 and TNF-α release
LPS is one of the most potent innate immune-activating stimuli found in the
outer membrane of Gram-negative bacteria. LPS induces the activation of monocytes
and macrophages, resulting in the production of pro-inflammatory cytokines including
TNF-α, IL-6, and IL-12.[16] Experimental and clinical evidence shows that
pro-inflammatory cytokines play a significant role in the pathogenesis of
inflammation-induced ALI. We utilized an enzyme-linked immunosorbent assay
(ELISA) to screen for the inhibition of LPS-induced IL-6 and TNF-α release by the
synthesized compounds (11a-o, 12a-i) in mouse primary peritoneal macrophages
(MPMs). Macrophages were pre-incubated with the compounds at 10 μM
concentration for 30 min. Compound 6 was used as a positive control, and DMSO
was the vehicle control. Following pretreatment, MPMs were challenged with LPS
(0.5 μg/mL) for 24 h at 37 °C. The ability (% inhibition) of the detected compounds to
reduce pro-inflammatory cytokines IL-6 and TNF-α is summarized in Table 1 and
Table 2.
Please insert Table 1 and Table 2 here
Among these compounds, 11a, 11b, 11e, 11i and 11l exhibited strong inhibition
on IL-6 expression (inhibitory rates > 75%), whereas 11e, 11f, 11i, 11n and 12d
showed high inhibitory effect on TNF-α expression (inhibitory rates > 60%). Notably,
11e and 11l, with an 4-allyloxy phenyl and thiophen group at R1 respectively, showed
the strongest inhibitory effect on LPS-induced cytokine expression. For 11e and 11l,
inhibitory rates reached 92.82% and 94.75% for IL-6, and 65.96% and 65.67% for
TNF-α, respectively, compared to the LPS control.
2.3 Structure–activity relationship analysis of thiazolo[3,2-a]pyrimidin derivatives
To our knowledge, there are several studies showing thiazolo[4,5-d]pyrimidines
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
scaffold as anti-inflammatory agents, but few have reported on the cytokine-inhibitory
effects of thiazolo[3,2-a]pyrimidine derivatives and their structure−activity
relationship (SAR).[7] As shown in Table 1, compounds with halogen substitution on
the phenyl moiety at the R1-position such as 4-bromo (11a) or 4-fluoro (11b) group,
showed similar potency to the lead compound 6 (phenyl). An improved activity was
observed when the allyloxy group was introduced at the para-position of phenyl (11e,
with 92.8 % and 65.96 % inhibitory rates for IL-6 and TNF-α, respectively). On the
other hand, replacement of the phenyl group with 3,4-dimethoxyphenyl (11c) or
4-ethoxyphenyl (11d), slightly decreased the activity against IL-6. Incorporation of
hydroxyl group at the meta- or para- position (11f and 11g) led to significant
reduction in the inhibition rates of IL-6 (67.9 % and 45.9 %, respectively), whereas
TNF-α inhibitory activity remained comparable to 6. Surprisingly, the introduction of
3,4-dihydroxyphenyl (11i) dramatically enhanced the activities against TNF-α
(71.4 % inhibitory rates). But conversion of one hydroxy group of 11i to a methoxy
group at the para-position (11h) resulted in dramatic loss of IL-6 and TNF-α
inhibitory activities. Furthermore, when a heterocyclic substitution was introduced at
R1-position, IL-6 inhibition displayed the following order: thiophen (11l, 94.7%) >
4-methylthiazol (11j, 37.2%) > 5-methylfuran (11k, 36.8%), and the activities of 11j
and 11k against TNF-α decreased approximately 3-fold relative to 11l. Compounds
with nonaromatic substitution, such as compound 11m (cyclopropyl), 11n (propyl)
and 11o (cyclohexyl), showed significant loss of activities.
Compound 11l exhibited a good overall profile and was selected to further
optimize the R2-position (Table 2). The introduction of 4-methylpiperazine and other
nitrogen-containing substituents at the para-position of the phenyl ring led to
compounds 12a-e. We observed that 12a-d lost the ability to inhibit IL-6 release. But
12d, with a diethylamino group, showed the highest inhibitory activity against TNF-α
(76.3% inhibitory rates). However, the removal of morpholinyl group (12i) resulted in
total loss of ability against IL-6 and TNF-α, suggesting that the potency for
suppressing IL-6 or TNF-α expression is directly related to the substituent at the
para-position of phenyl and that the oxygen atom of morpholinyl group is
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
indispensable. Interestingly, the introduction of (dimethylamino)propoxy (12h) group
caused a high level of toxicity in human normal hepatic cell line (HL-7702) at a
concentration of 10 μM (30% relative survival). While other active compounds
showed no significant toxicity in HL-7702 and MPMs after 24 h treatment
(Supporting Information Figure. S1AB). Compounds with heterocyclic substitution at
R2-position (12f and 12g), exhibited weak anti-inflammatory activity. To demonstrate
the SAR of thiazolo[3,2-a]pyrimidin derivatives in the inhibition of IL-6 and TNF-α
expression, quantitative SAR (QSAR) was constructed. The results of predicted
versus experimental values are shown in Figure 2. The QSAR results indicate that the
atomic mass may play an important role in the anti-IL-6 activity, while atomic charge
and electro-negativity may influence the anti-TNF-α inhibitory activity. Taken
together, the SAR and QSAR results on the IL-6 and TNF-α inhibitory activities of
the thiazolo[3,2-a]pyrimidin derivatives may provide valuable information for further
development of novel anti-inflammatory compounds.
Please insert Figure 2 here
2.4 Active compounds inhibit TNF-a and IL-6 release in a dose-dependent manner
Based on significant inhibitory activities and lower cytotoxicity against HL-7702
cells than lead compound 6, 11e, 11f, 11i and 11l were selected for further evaluation
of dose-dependent inhibitory effects against LPS-induced IL-6 and TNF-α release. As
shown in Figure 3A-B, all active compounds exhibited a dose-dependent inhibition of
IL-6 and TNF-α induced by LPS. Most of the compounds potently suppressed the
cytokines with IC50 values in the low micromolar range. Interestingly, 11e and 11l
showed IC50 values in the nanomolar range. Their potency against TNF-α release
were increased by 3-5x fold compared to compound 6. These results suggest that 11e
and 11l are promising anti-inflammatory candidates for the treatment of acute
inflammatory diseases such as ALI and sepsis.
Please insert Figure 3 here
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
2.5 Effect of 11e and 11l pretreatment on survival rate in mice after LPS
administration
Sepsis is a systemic inflammatory response to infections and is often fatal.[17]
LPS from Gram-negative bacteria has been implicated as a major cause of sepsis. To
determine whether active compounds are able to attenuate the development of
inflammatory shock in vivo, LPS was intraperitoneally (i.p.) injected into mice at 20
mg/kg with or without 11e and 11l pretreatment. Survival rate of mice was then
monitored for 7 days. As shown in Figure 4, all mice in the LPS control group died
within 36 h as a result of sepsis. By contrast, 40% and 30% of the animals that
received 11e and 11l respectively, at 20 mg/kg prior to LPS injection survived. The
overall difference in survival rate between 11e and 11l treated group and control
group was significant (p < 0.01). Thus, both of the compounds showed excellent
anti-inflammatory activity in vivo.
Please insert Figure 4 here
2.6 Compounds 11e and 11l ameliorated histopathological changes in lung tissues
following LPS challenge
Thiazolo[3,2-a]pyrimidin derivatives 11e and 11l were also evaluated in mice
with ALI induced by intratracheal instillation of LPS. As shown in Figure 5A, the
lung wet/dry weight ratio, an index of lung edema,[18] was significantly suppressed in
LPS + 11e or 11l group when compared to the LPS alone group. Figure 5B also
shows that LPS challenge remarkably increased the total number of cells in mice
bronchial alveolar lavage fluid (BALF), whereas treatment with 11e and 11l at 10 and
20 mg/kg significantly decreased the numbers. In addition, recruitment of neutrophils
into the lung tissue is an important factor in causing tissue damage in ALI.[19] As
shown in Figure S2, LPS challenge substantially increased the number of neutrophils,
whereas treatment with 11e and 11l resulted in significantly lower number of
neutrophils in BALF.
To verify the inhibitory effect of 11e and 11l against macrophage infiltration into
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
the lung tissue, we performed immunofluorescence detection for CD68. CD68 is a
glycoprotein which binds to low density lipoprotein and is highly expressed on
monocytes/macrophages.[20] As shown in Figure 5D, LPS induced a significant
accumulation of CD68-positive cells in the lung sections (red fluorescence). On the
other hand, with 11e and 11l pretreatment, no notable change in CD68-positive
macrophages were observed when compared to the control group. The quantification
of CD68 staining fluorescence is shown in Figure 5C. We then evaluated the
histological changes after 11e and 11l treatment in LPS-challenged mice by
hematoxylin and eosin (H&E) staining. Lung tissues from the control group mice
showed a normal structure, while LPS instillation resulted in significant alterations
characterized by interstitial edema, pulmonary congestion, infiltration of
inflammatory cells and thickening of the alveolar wall. However, these pathological
changes induced by LPS were remarkably ameliorated by 20 mg/kg of 11e and 11l
treatment (Figure 5E). These studies show that 11e and 11l had a remarkable
protective effect on LPS-induced histopathological changes in a rat model of ALI.
Please insert Figure 5 here
2.7 Attenuation of acute LPS-induced pulmonary inflammation by 11e and 11l
Pro-inflammatory cytokines, including IL-6 and TNF-α, are known to play a
critical role in the early phase of ALI. Thus, the levels of pro-inflammatory cytokines
were measured in BALF and serum to confirm the inhibitory effect of 11e and 11l in
vivo. As shown in Figure 6, cytokine levels were significantly elevated after LPS
challenge compared to control mice. Administration of 11e and 11l at a dose of 20
mg/kg significantly reduced the levels of IL-6 and TNF-α in BALF as well as in
serum samples. These results indicated that 11e and 11l had a protective effect on
LPS-induced pulmonary inflammation of ALI.
Please insert Figure 6 here
2.8 Compounds 11e and 11l suppressed LPS-induced mRNA expression in Mice
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
LPS exposure also increased the mRNA levels of inflammatory cytokines in
mouse lung tissues.[21] Therefore, we next investigated the inhibitory effect of
compounds 11e and 11l on mRNA abundance of important pro-inflammatory factors,
including IL-1β, IL-6, TNF-α, vascular cell adhesion molecule 1 (VCAM-1) and
intercellular adhesion molecule-1 (ICAM-1) in the mouse model of ALI. As shown in
Figure 7, 11e and 11l at 10 mg/kg and 20 mg/kg effectively suppressed LPS-induced
upregulation of mRNA of various cytokines in a dose-dependent manner. These data
showed that anti-inflammatory compounds 11e and 11l partly affect the cytokine
profile at the mRNA level.
Please insert Figure 7 here
3. Conclusion
ALI is a major cause of acute respiratory failure in patients with no effective
treatment.[22] Hence, there is a pressing need to identify an effective strategy to
prevent or mitigate ALI. Thiazolo and pyrimidine fused heterocyclic rings are viable
templates for the development of anti-inflammatory molecules.[7] In this study, we
designed and synthesized a novel series of thiazolo[3,2-a]pyrimidine analogues and
evaluated their anti-inflammatory activity relative to the lead compound 6. The
majority of the synthetic analogues exhibited significant inhibitory activities against
LPS-induced TNF-α and IL-6 expression in MPMs. The preliminary
structure−activity relationship (SAR) studies indicated that an electron donating group
such as allyloxy at the para-position of the phenyl group or heterocycles such as
thiophen at R1 enhances anti-inflammatory activity. Further optimization of R2
position indicates that oxygen atom of morpholinyl group is crucial to maintain the
activity. Following initial screening for anti-inflammatory activity, 11e and 11l were
identified as the most promising compounds. Pretreatment with 11e and 11l decreased
the W/D ratio and the cytokines levels in BALF and serum of animals challenged with
LPS. More importantly, 11e and 11l ameliorated the histopathological changes of
lung and suppressed the mRNA levels of multiple inflammatory factors in LPS
stimulated ALI mice. Taken together, 11e and 11l are promising potential
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
anti-inflammatory candidates for the treatment of ALI.
4. Experimental section
4.1. Chemistry
In general, commercial chemicals or solvents were reagent grade and were used
without further purification. All reagents for synthesis were obtained from Sigma
Aldrich and Energy-Chemical. All reactions were monitored by thin-layer
chromatography (250 silica gel 60 F254 glass plates). Melting points were determined
1
13
on a Fisher-Johns melting apparatus and were uncorrected. H NMR and C NMR
spectra were recorded on a Bruker 600 MHz instruments, and the chemical shifts were
presented in terms of parts per million with TMS as the internal reference. J values
are given in hertz. The spectra data of the target compounds were shown in
Supporting Information. Electronspray ionization mass spectra in positive mode
(ESI-MS) data were obtained with a Bruker Esquire 3000t spectrometer.
Chromatographic purification was carried out on Silica Gel 60 (E.Merck, 70-230
mesh). Analytical HPLC analyses were performed on Agilent 1260 liquid
chromatograph fitted with a Inertex C18 column (4.6 mm×150 mm, 5 μm particle
size) with CH3CN−H2O (A) and 0.1% TFA in CH3CN−H2O (B) solvent mixtures and
equipped with a G1314AVWD detector. The purity of all synthetic compounds was
determined by HPLC analysis and was greater than 95%.
4.1.1. General procedure for the preparation of the intermediates 8a-o
Sulfamic acid (3 mmol) was added to a solution of benzaldehydes 7a-o (2
mmol), ethyl acetylacetate (2.5 mmol), and thiourea (3 mmol) in ethanol (30 mL) and
refluxed for 4 h. The mixture was cooled to room temperature and poured to water.
The residue was filtered and washed with 10% MeOH in water to give crude products
(8a-o) in 52.0-93.4 % yield.
4.1.2. General procedure for the preparation of the intermediates 9a-o
Crude product (8a-o, 2 mmol) was refluxed with ethyl 2-chloroacetate (2.5 mmol)
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
in the presence of pyridine (1 mmol) in ethanol (20 mL) for 3 hours to afford the
cyclization crude solution of 9a-o.
4.1.3. General procedure for the preparation of the aminobenzaldehydes
intermediates 10a-f, 13a
Example: 4-((2-(dimethylamino)ethyl)(methyl)amino)benzaldehyde (10e). A
mixture of 4-Fluorobenzaldehyde (620.5 mg,
5
mmol), N1, N1,
N2-trimethylethane-1,2-diamine (766.3 mg, 7.50 mmol) and K2CO3(1.38 g, 10 mmol)
was stirred in dry DMF at 100°C under nitrogen atmosphere overnight. Then the
reaction was quenched by addition of water. The resulting mixture was extracted with
EtOAc (3 × 25 mL), washed with brine, dried over anhydrous Na2SO4 and
concentrated. The resulting residue was purified by flash chromatography (Yield
45.8 %). 1H NMR (600 MHz, DMSO-d6) δ (ppm): 9.649 (s, 1H, -CHO), 7.668 (d, J =
9.0 Hz, 2H, Ar-H), 6.778 (d, J = 9.0 Hz, 2H, Ar-H), 3.528 (t, J = 7.2 Hz, 2H,
N-CH2-CH2-), 3.021 (s, 3H, CH3-N-CH2-CH2-), 2.399 (t, J = 7.2 Hz, 2H,
13
N-CH2-CH2-), 2.184 (s, 6H, N-CH2-CH2-N(CH3)2). C NMR (150 MHz, DMSO-d6)
δ (ppm): 189.70, 153.27, 131.70×2, 124.43, 110.90×2, 55.67, 49.54, 45.52×2, 38.39.
ESI-MS m/z: 207.3 (M + H)+, calcd for C12H18N2O: 206.14. The characterization of
other aldehydes were reported in the Supporting Information file.
4.1.4.1. General Procedure for the Preparation of the Thiazolo[3, 2-a]pyrimidines
11a-o,
ethyl(Z)-5-(4-bromophenyl)-7-methyl-2-(4-morpholinobenzylidene)-3-oxo-2,3-dihydr
o-5H-thiazolo[3,2-a]pyrimidine-6-carboxylate (11a):
12a-i
Example:
4-(4-methylpiperazin-1-yl)benzaldehyde (2 mmol) was added to a solution of crude
9a described above in the presence of morpholine (1 mmol) to undergo a
Knoevenagel condensation in EtOH, and the mixture was stirred at 78 °C for 6 h.
Then the mixture was diluted with EtOAc (50 mL) and washed with water (2 × 50
mL) and saturated brine (50 mL). The solution was dried (MgSO4) and concentrated
in vacuo. The crude product was purified by silica chromatography eluting with 30 %
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
EtOAc in petroleum ether and recrystallized to afford 11a as red powder (56.5%
o
1
yield). m.p: 162.5-163.9 C, 98% purity. H NMR (600 MHz, DMSO-d6) δ (ppm):
7.676 (s, 1H, C=CH-Ph), 7.547 (d, J = 8.4 Hz, 2H, Ar-H), 7.464 (d, J =9.0 Hz, 2H,
Ar-H), 7.256 (d, J = 8.4 Hz, 2H, Ar-H), 7.058 (d, J = 9.0 Hz, 2H, Ar-H), 6.008 (s, 1H,
pyrimidine-H), 4.026-4.047 (m, 2H, CH3CH2O-), 3.721 (t, J = 4.8 Hz, 4H,
morpholine), 3.295 (t, J = 4.8 Hz, 4H, morpholine), 2.384 (s, 3H, pyrimidine-CH3),
1.124 (t, J = 7.2 Hz, 3H, CH3CH2O-). 13C NMR (150 MHz, DMSO-d6) δ (ppm):
164.77, 164.47, 156.16, 152.24, 152.02, 139.89, 133.82, 132.084×2, 131.58×2,
129.69 ×2, 122.04, 121.68, 114.12×2, 113.41, 107.59, 65.78×2, 60.15, 54.28,
46.64×2, 22.53, 13.87. ESI-MS m/z: 569.2 (M + H)+, calcd for C27H26BrN3O4S:
567.08. Other target compounds 11b-11o, 12a-12i can be found in the Supporting
Information.
4.2 Animals
Male C57BL/6 mice and Institute of Cancer Research (ICR) mice weighing 18 to
22 g were obtained from the Animal Center of Wenzhou Medical University
(Wenzhou, China). The animals were acclimatized in an air-conditioned room and
maintained in a 12:12-h light/dark cycle and fed with standard food and water.
Animals involved in this experiment were treated in accordance with the Guide for
Care and Use of Laboratory Animals of National Institutes of Health. The present
study was approved by Wenzhou Medical College Animal Policy and Welfare
Committee (approval documents: 2013/APWC/0361).
4.3 Cells and reagents
Lipopolysaccharide (LPS) was purchased from Sigma-Aldrich (St Louis, MO,
USA). The mouse IL-6 and TNF-α enzyme-linked immunosorbent assay (ELISA) kits
were obtained from eBioscience, Inc. (San Diego, CA, USA). For peritoneal
macrophage preparation, ICR mice were stimulated by intraperitoneal (i.p.) injection
of 3 mL thioglycollate solution (Beef extract (0.3 g), tryptone (1 g), sodium chloride
(0.5 g) and soluble starch (6 g) which were dissolved and boiled in 100 mL water. The
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
solution was filtrated with 0.22 mm filter per mouse and kept in pathogen-free
conditions for 3 days before peritoneal macrophage isolation. Total peritoneal
macrophages were harvested by washing the peritoneal cavity with PBS containing 30
mM of EDTA (8 mL per mouse) and centrifuged. The pellet was resuspended in
RPMI-1640 medium (Gibco/BRL life Technologies, Eggenstein, Germany) with 10%
FBS (Hyclone, Logan, UT), 100 U/mL penicillin and 100 mg/mL streptomycin.
Peritoneal macrophages were cultured on 60 mm plates (1.2*106 cells in 3 mL media
o
per plate) and maintained at 37 C in a 5% CO2-humidified air. Nonadherent cells
were removed by washing with medium for 3 h after seeding. Experiments were
undertaken after the cells adhered firmly to the culture plates.
4.4 Determination of IL-6 and TNF-α
The inhibition effects of IL-6 and TNF-α release of novel
thiazolo[3,2-a]pyrimidin derivatives were evaluated in LPS stimulated MPMs. After
treatment of cells with indicated compounds and LPS, the cytokines levels in medium
were determined by an ELISA kit (eBioScience, San Diego, CA) according to the
manufacturer’s instructions. Briefly, MPMs were seeded into 96-well plates at a
density of 400000 cells per well in DMEM medium and incubated at 37 °C in 5%
CO2 for 24 h. Cells were pretreated with compounds for 30 min, and then LPS was
added (0.5 μg/mL). After 24 h, the culture media and cells were collected separately.
The total protein in cultural plates was collected and the concentrations were
determined by using Bio-Rad protein assay. The total amount of the inflammatory
factor in the media was normalized to the total protein quantity of the viable cell
pellets.
4.5 Real-Time quantitative PCR
Cells were homogenized in TRIZOL kit (Invitrogen, Carlsbad, CA) for
extraction of RNA according to each manufacturer’s protocol. Both reverse
transcription and quantitative PCR were carried out using a two-step
M-MLVPlatinum SYBR Green qPCR SuperMix-UDG kit (Invitrogen, Carlsbad, CA).
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
Eppendorf Mastercycler ep realplex detection system (Eppendorf, Hamburg,
Germany) was used for q-PCR analysis. The primers of genes including IL-1β, IL-6,
TNF-α, VCAM-1, ICAM-1 and β-actin were synthesized by Invitrogen. The primer
sequences of mouse genes used are shown as follows:
Mouse β-actin sense primer, CCGTGAAAAGATGACCCAGA;
Mouse β-actin antisense primer, TACGACCAGAGGCATACAG.
Mouse TNF-α sense primer, TGATCCGCGACGTGGAA;
Mouse TNF-α antisense primer, ACCGCCTGGAGTTCTGGAA.
Mouse IL-6 sense primer, GAGGATACCACTCCCAACAGACC;
Mouse IL-6 antisense primer, AAGTGCATCATCGTTGTTCATACA.
Mouse IL-1β sense primer, ACTCCTTAGTCCTCGGCCA;
Mouse IL-1β antisense primer, CCATCAGAGGCAAGGAGGAA.
Mouse VCAM-1 sense primer, TGCCGAGCTAAATTACACATTG;
Mouse VCAM-1 antisense primer, CCTTGTGGAGGGATGTACAGA.
Mouse ICAM-1 sense primer, GCCTTGGTAGAGGTGACTGAG;
Mouse ICAM-1 antisense primer, GACCGGAGCTGAAAAGTTGTA.
The amount of each gene was determined and normalized by the amount of
β-actin.
4.6 Assessment of cytotoxicity of active compounds
To assess the safety of the thiazolo[3, 2-a]pyrimidine derivatives. Compounds
were tested for their totoxicity in the human normal hepatic cell line (HL-7702) or
MPMs by MTT at a concentration of 10 μM. The survival rates of the cells with the
administrated compounds at 24 h were determined.
4.7 Quantitative structure-activity relationships analysis
4.7.1 Quantitative SAR (QSAR) model
These thiazolo[3, 2-a]pyrimidine derivatives were calculated with the ChemoPy
descriptor calculation program [40]. In this program, about 1000 molecular
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
descriptors based on molecular structure were obtained. After calculation, those
molecular descriptors that stayed constant for all molecules were eliminated and pairs
of variables with a correlation coefficient greater than 0.75 were classified as
inter-correlated and one in each correlated pair was deleted.
4.7.2 Multiple linear regression (MLR) analysis
MLR analysis is a statistical method that uses several explanatory variables to
predict the outcome of a response variable. The goal of multiple linear regression
(MLR) is to model the relationship between the explanatory and response variables.
In present study, MLR was performed using R program, a widely used tool for
statistical computing and graphics, to derive QSAR models. The biological data used
in this study were the IL-6 or TNF-α inhibitory rates in comparison to LPS alone
group. The inhibition rates against IL-6 and TNF-α release were used as dependent
variables in the linearization procedure. Subsequently, Stepwise Multiple Linear
Regression (Stepwise-MLR) was applied to select the significant descriptors. The
most relevant descriptors were used as independent variables.
4.7.3 Validation of the models
Validation of the lineal models are required for testing the predictive ability and
generalizing the methods by cross-validation. The leave-one-out (LOO) procedure
was employed. When a data point was removed from the analyzed set, the regression
was recalculated, and then the predicted value for that point was compared to its
actual value. This process was repeated until each datum had been omitted once and
then the sum of squares of these deletion residuals could be used to calculate q2, an
equivalent statistic to R2.
4.8. Lipopolysaccharide-induced sepsis in Mice
Compounds 11e and 11l were dissolved in 0.1% sodium carboxyl methyl
cellulose (CMC-Na). Male ICR mice were pretreated with 11e, 11l or vehicle for
seven days by intragastric administration (20 mg/kg/day), followed by the injection of
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
LPS (i.v., 20 mg/kg). Control animals received same volume (200 μL) of vehicle.
Mortality were recorded for 7 days at an interval of 12 h after the LPS injection.
4.9. LPS-induced ALI
Male B6 mice were randomly divided into six groups, designated control (n = 6),
LPS (n = 6), and 11e (10 mg/kg and 20 mg/kg) + LPS (n = 6) and 11l (10 mg/kg and
20 mg/kg) + LPS (n = 6). Prior to intratracheal injection of LPS (5 mg/kg), the mice
were treated orally with 11e and 11l at a dose of 10 mg/kg or 20 mg/kg for 1 week.
After 6 h of LPS induction, mice were then euthanized with ketamine. The chest
cavity of each animal was carefully opened, and the collection of BALF was
performed.
4.10. Wet-to-dry weight ratio
The lung wet/dry weight ratio was calculated to observe the pulmonary edema.
Mice were sacrificed at 6 h after LPS challenge. After the middle lobe of right lung
was collected, the wet weight was recorded. Then lung was heated in a thermostatic
oven at 65 °C for 48 h and weighed to determine the baseline lung dry mass levels.
4.11. Protein concentration in bronchoalveolar lavage fluid (BALF)
Collected BALF was centrifuged at 1000 rpm for 10 min at 4 °C, and the
supernatant was used for protein concentration and cytokine determinations. The
precipitation was resuspended in 50 μL physiological saline. The total number of cells
on BALF was detected by cell counting instrument. The protein concentration in the
supernatant was determined by using a BCA protein assay (Pierce, Rockford, IL,
USA).
4.12. Histopathologic examination of lung
The superior lobe of right lung was collected and fixed in 4% formalin solution,
and then embedded in paraffin and cut into 5 μm sections. After dehydration, the
sections were stained with hematoxylin and eosin (H&E) using standard protocol and
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
observed with a Nikon Eclipse E800 microscope (400× amplification; Nikon, Tokyo,
Japan).
4.13. Immunofluorescence for CD68 detection
After deparaffinization and rehydration, 5 μm lung sections were treated with 3%
H2O2 for 20 min and with 1% BSA in PBS for 30 min. Slides were incubated
overnight at 4 °C with anti-CD68 antibody (Santa Cruz; 1:100), and then incubated
with PE-labeled secondary antibody (Santa Cruz;1:200) for 1 h at room temperature.
Following staining the nucleus with DAPI for 5 min, the images were viewed under
confocal microscope (400×, amplification; Nikon A1, Japan).
4.14. Statistical analysis
Results are presented as the mean ± standard error of the mean (SEM). Student's
t test or ANOVA multiple comparisons were employed to analyze the statistical
significance of differences between sets of data. Statistics was performed using
GraphPad Pro (GraphPad, San Diego, CA). P values less than 0.05 were considered
significant. All experiments were repeated at least three times.
Conflict of interest
The authors have declared no conflict of interest.
Acknowledgment
Financial support was provided by the National Natural Science Foundation of
China (21572167, 21572166, and 81622043), Natural Science Foundation of Zhejiang
Province (LR16H310001 and LY17B020008), and Xinmiao Talent Program of
Zhejiang Province (2015R413081 and 2016R413063).
References
[1]
a) O. Brattstrom, F. Granath, P. Rossi, A. Oldner, Acta Anaesthesiol Scand
2010, 54, 1007-1017; b) C. Brun-Buisson, C. Minelli, G. Bertolini, L. Brazzi, J.
Pimentel, K. Lewandowski, J. Bion, J. A. Romand, J. Villar, A. Thorsteinsson,
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
P. Damas, A. Armaganidis, F. Lemaire, A. S. Group, Intensive Care Med 2004,
30, 51-61; c) G. D. Rubenfeld, E. Caldwell, E. Peabody, J. Weaver, D. P.
Martin, M. Neff, E. J. Stern, L. D. Hudson, N Engl J Med 2005, 353,
1685-1693.
[2]
a) M. Zambon, J. L. Vincent, Chest 2008, 133, 1120-1127; b) K. J. Bosma, R.
Taneja, J. F. Lewis, Drugs 2010, 70, 1255-1282; c) A. J. Frank, B. T.
Thompson, Curr Opin Crit Care 2010, 16, 62-68; d) P. A. Efron, A. Martins, D.
Minnich, K. Tinsley, R. Ungaro, F. R. Bahjat, R. Hotchkiss, M. Clare-Salzler,
L. L. Moldawer, J Immunol 2004, 173, 3035-3043.
[3]
[4]
a) M. A. Matthay, R. L. Zemans, Annu Rev Pathol 2011, 6, 147-163; b) S.
Toussaint, H. Gerlach, N Engl J Med 2009, 361, 2646-2652.
a) T. R. Martin, J Clin Invest 2002, 110, 1603-1605; b) B. V. Patel, M. R.
Wilson, K. P. O'Dea, M. Takata, J Immunol 2013, 190, 4274-4282; c) R.
Bhargava, W. Janssen, C. Altmann, A. Andres-Hernando, K. Okamura, R. W.
Vandivier, N. Ahuja, S. Faubel, PloS one 2013, 8, e61405.
[5]
[6]
S. Mukhopadhyay, J. R. Hoidal, T. K. Mukherjee, Respir Res 2006, 7, 125.
a) L. Nespoli, G. Lo Bianco, F. Uggeri, F. Romano, A. Nespoli, D. P.
Bernasconi, L. Gianotti, World J Gastroenterol 2015, 21, 8366-8372; b) B.
Rabinow, J. Werling, A. Bendele, J. Gass, R. Bogseth, K. Balla, P. Valaitis, A.
Hutchcraft, S. Graham, Inflammation 2015, 38, 40-60.
[7]
[8]
B. Kuppast, H. Fahmy, Eur J Med Chem 2016, 113, 198-213.
A. A. Bekhit, H. T. Fahmy, S. A. Rostom, A. M. Baraka, Eur J Med Chem
2003, 38, 27-36.
[9]
B. Zhou, X. Li, Y. Li, Y. Xu, Z. Zhang, M. Zhou, X. Zhang, Z. Liu, J. Zhou, C.
Cao, B. Yu, R. Wang, ChemMedChem 2011, 6, 904-921.
[10] P. M. Luthra, C. B. Mishra, P. K. Jha, S. K. Barodia, Bioorg Med Chem Lett
2010, 20, 1214-1218.
[11] M. S. Mohamed, R. Kamel, S. S. Fatahala, Eur J Med Chem 2010, 45,
2994-3004.
[12] a) Z. Liu, L. Tang, H. Zhu, T. Xu, C. Qiu, S. Zheng, Y. Gu, J. Feng, Y. Zhang,
G. Liang, J Med Chem 2016, 59, 4637-4650; b) G. Chen, Y. Zhang, X. Liu, Q.
Fang, Z. Wang, L. Fu, Z. Liu, Y. Wang, Y. Zhao, X. Li, G. Liang, J Med Chem
2016, 59, 2436-2451; c) Y. Wang, X. Shan, G. Chen, L. Jiang, Z. Wang, Q.
Fang, X. Liu, J. Wang, Y. Zhang, W. Wu, G. Liang, Br J Pharmacol 2015, 172,
4391-4405; d) P. Yu, L. Dong, Y. Zhang, W. Chen, S. Xu, Z. Wang, X. Shan, J.
Zhou, Z. Liu, G. Liang, Eur J Med Chem 2015, 94, 436-446.
[13] J. Hu, Y. Wang, X. Wei, X. Wu, G. Chen, G. Cao, X. Shen, X. Zhang, Q. Tang,
G. Liang, X. Li, Eur J Med Chem 2013, 64, 292-301.
[14] a) Y. Shi, J. Zhang, N. Grazier, P. D. Stein, K. S. Atwal, S. C. Traeger, S. P.
Callahan, M. F. Malley, M. A. Galella, J. Z. Gougoutas, J Org Chem 2004, 69,
188-191; b) S. Kolb, O. Mondesert, M. L. Goddard, D. Jullien, B. O.
Villoutreix, B. Ducommun, C. Garbay, E. Braud, ChemMedChem 2009, 4,
633-648.
[15] M. M. Abdel-Atty, N. A. Farag, S. E. Kassab, R. A. Serya, K. A. Abouzid,
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
Bioorg Chem 2014, 57, 65-82.
[16] a) M. Rossol, H. Heine, U. Meusch, D. Quandt, C. Klein, M. J. Sweet, S.
Hauschildt, Crit Rev Immunol 2011, 31, 379-446; b) C. Alexander, E. T.
Rietschel, J Endotoxin Res 2001, 7, 167-202.
[17] a) K. N. Iskander, M. F. Osuchowski, D. J. Stearns-Kurosawa, S. Kurosawa, D.
Stepien, C. Valentine, D. G. Remick, Physiol Rev 2013, 93, 1247-1288; b) P.
Shukla, G. M. Rao, G. Pandey, S. Sharma, N. Mittapelly, R. Shegokar, P. R.
Mishra, Br J Pharmacol 2014, 171, 5011-5031.
[18] R. R. Bell, V. K. Nonavinakere, M. R. Soliman, Toxicol Lett 2000, 114,
101-109.
[19] J. Grommes, O. Soehnlein, Mol Med 2011, 17, 293-307.
[20] N. Bagul, S. Roy, A. Ganjre, R. Kathariya, A. Meher, P. Singh, J Clin Diagn
Res 2016, 10, ZC81-84.
[21] a) W. J. Zhang, B. Frei, Mediators Inflamm 2015, 2015, 274314; b) C. A.
Martin, M. E. Dorf, Cell Immunol 1991, 135, 245-258.
[22] S. G. Royce, Y. Moodley, C. S. Samuel, Pharmacol Ther 2014, 141, 250-260.
Abbreviations
LPS, Lipopolysaccharides; ALI, Acute lung injury; ELISA, Enzyme linked
immunosorbent assay; MPMs, Mouse primary peritoneal macrophages; BALF,
Bronchoalveolar lavage fluid; CD68, Cluster of Differentiation 68; VCAM-1,
Vascular cell adhesion molecule 1; ICAM-1, Intercellular Adhesion Molecule 1.
Figure Legends
Table 1. Anti-inflammatory screening of compounds 11a-o.
Table 2. Anti-inflammatory screening of compounds 12a-i.
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
Figure 1. Structures of 1−6 with thiazolo and pyrimidine fused heterocyclic
ring-systems.
Figure 2. Plots of predicted activity against the corresponding experimental activity
on IL-6 inhibition. N, the number of compounds taken into account in the regression;
R2, the multiple correlation coefficient; Radj2, adjusted multiple correlation coefficient;
s, residual standard error; and the F value is related to the F-statistic analysis (Fischer
test). The numbers in parentheses mean the standard deviation of the coefficients. (A)
IRIL-6= 103.0571 (±24.4099) + 21.9904 (±5.7686) MoRSEE10 + 5.9199 (±0.9759)
RDFM12 - 6.7264 (±1.4819) RDFM8, N=24, R2=0.7643, Radj2=0.7289, s=14.96, F3,
20=21.62, p=1.737-6; (B) IRTNF-α
=
-144.107 (±30.726)-115.138 (±19.247)
MoRSEC1+40.129 (±7.044) MoRSEE10 + 31.139 (±6.869) MoRSEE7, N=24,
R2=0.7634, Radj2=0.7279, s=11.45, F3, 20=21.51, p=1.804-6.
Figure 3. Active compounds inhibited LPS-induced inflammatory cytokines in a
dose-dependent manner. Mouse primary peritoneal macrophages (MPMs) were
pretreated with vehicle or compounds at indicated concentrations (1, 2.5, 5 and 10
μM) for 30 min. Then, cells were incubated with LPS (0.5 μg/mL) for 24 h. IL-6 and
TNF-α levels in the culture medium were measured by ELISA and were normalized to
the total protein amount. (A) IL-6 levels measured by ELISA. (B) TNF-α levels
measured by ELISA. Each bar represents mean ± SEM of 3 independent. Statistical
significance relative to the LPS group was indicated, *p < 0.05, **p < 0.01, ***p <
0.001 vs LPS vehicle.
Figure 4. Effect of 11e and 11l pretreatment on survival rate in mice after LPS
administration. Compounds were dissolved with 0.1% sodium carboxyl methyl
cellulose (CMC-Na). Male ICR mice were pretreated with 11e, 11l or vehicle for
seven days by intragastric administration (20 mg/kg/day), followed by the injection of
LPS (i.v., 20 mg/kg). The survival rate was recorded for 7 days at an interval of 12 h
after the LPS injection; n = 10 animals in each group, *p < 0.05, **p < 0.01vs LPS
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
vehicle.
Figure 5. 11e and 11l ameliorated histopathological changes of lung in LPS stimulated
ALI mice. Male B6 mices were given an intragastric administration of compounds (10
or 20 mg/kg/day) or 1% CMC-Na 7 days prior to an intratracheal administration of
LPS (5 mg/kg), then mice were anaesthetized and killed at 6 h after LPS challenged.
Bronchoalveolar lavage fluid and lung tissues were collected for further tests. (A) The
lung W/D ratio. (B) The total number of cells in BALF. (C) Quantification of CD68
staining. (D) CD68-immunostained macrophage in the lung sections (red, ×400). (E)
H&E staining (×400). *p < 0.05, **p < 0.01 , ***p < 0.001 vs LPS vehicle.
Figure 6. Attenuation of acute LPS-induced pulmonary inflammation by 11e and 11l.
(A) The relative amount of IL-6 in BALF. (B) The relative amount of TNF-α in
BALF. (C) The relative amount of IL-6 in serum. (D) The relative amount of TNF-α
in serum. Statistical significance relative to the LPS group was indicated, ns: no
significance, *p < 0.05, **p < 0.01, ***p < 0.001 vs LPS vehicle.
Figure 7. 11e and 11l inhibited the inflammatory genes expression induced by LPS in
mouse lung tissue. (A) ) IL-1β, (B) IL-6, (C) TNF-α, (D) VCAM-1, (E) ICAM-1. ns:
no significance, *p < 0.05, **p < 0.01, ***p < 0.001 vs LPS vehicle.
Scheme 1. General synthetic route of thiazolo [3, 2-a] pyrimidine derivatives 11a-o.
o
aReagents and conditions: (a) sulfamic acid, EtOH, 78 C, 4 h, 90−95%; (b) ethyl
2-chloroacetate, pyridine, EtOH, 78 oC, 3 h; (c) 4-morpholinobenzaldehyde,
morpholine, EtOH, 78 oC, 6 h, 35−60%.
Scheme 2. General synthetic route of thiazolo [3, 2-a] pyrimidine derivatives 12a-i.
o
bReagents and conditions: (a) sulfamic acid, EtOH, 78 C, 4 h, 90−95%; (b) ethyl
o
2-chloroacetate, pyridine, EtOH, 78 C, 3 h; (c) aldehydes 10a-10i, morpholine,
EtOH, 78 oC, 6 h, 35−60%.
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
Table 1.
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
Table 2.
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
Figure 1.
Figure 2.
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
Figure 3.
Figure 4.
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
Figure 5.
Figure 6.
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
Figure 7.
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201700175
ChemMedChem
Scheme 1.
Scheme 2.
This article is protected by copyright. All rights reserved.