Potent antileukemic action of naphthoquinoidal compounds: Evidence for an intrinsic death mechanism based on oxidative stress and inhibition of DNA repair

Article abstract of DOI:10.1590/S0103-50532013000100019

The current study describes that nor-β-lapachone and its arylamino derivatives, iodinated and methylated naphthoquinones and nor-β-lapachone- based 1,2,3-triazoles exhibited pronounced cytotoxic effects against four human leukemia cell lines (HL-60, K562, Molt-4 and Jurkat). Nor-β-lapachones arylamino substituted with potent activity were identified, revealing themselves as potential prototypes against tumor cell lines. Moreover, cells treated with these compounds showed DNA damage according to the standard comet assay, a finding that was, at least in part, due to increased intracellular levels of ROS. HL-60 cells were chosen to study the underlying molecular mechanisms of cytotoxicity. Drug-induced apoptosis in HL-60 cells was observed by flow cytometry analyses. Strains of Saccharomyces cerevisiae were used for a preliminary investigation into the mechanism of drug action on DNA topoisomerases. These results suggested that the cytotoxicity of these compounds apparently does not involve topoisomerase inhibition, but that treatment impairs DNA repair activity, thus triggering cell death. Considering their pro-oxidant properties, we investigated the ability of these compounds to induce apoptosis and chromosomal aberrations as micronuclei in Chinese hamster lung fibroblasts (V79 cells). Morphological apoptotic nuclei and micronuclei induction following drug treatment were observed, suggesting a correlation between DNA damage and apoptosis.

Full text of DOI:10.1590/S0103-50532013000100019

J. Braz. Chem. Soc., Vol. 24, No. 1, 145-163, 2013.
Printed in Brazil - ©2013 Sociedade Brasileira de Química
0103 - 5053 $6.00+0.00
Article
A
Potent Antileukemic Action of Naphthoquinoidal Compounds: Evidence for an
Intrinsic Death Mechanism based on Oxidative Stress and Inhibition of DNA Repair
Bruno C. Cavalcanti,*,a Igor O. Cabral,a Felipe A. R. Rodrigues,a Francisco W. A. Barros,a
Danilo D. Rocha,a Hemerson I. F. Magalhães,a Dinara J. Moura,b Jenifer Saffi,b
João A. P. Henriques,b Tatiane S. C. Carvalho,c Manoel O. Moraes,a Cláudia Pessoa,a
Isadora M. M. de Melod and Eufrânio N. da Silva Júnior*,d
aNational Laboratory of Experimental Oncology, Department of Physiology and Pharmacology,
Federal University of Ceará, 60430-270 Fortaleza-CE, Brazil
bDepartment of Biophysics, Federal University of Rio Grande do Sul, 91501-970 Porto Alegre-RS, Brazil
cNatural Products Research Nucleus, Federal University of Rio de Janeiro, 21941-971 Rio de Janeiro-RJ, Brazil
dLaboratory of Synthetic and Heterocyclic Chemistry, Department of Chemistry, Institute of Exact
Sciences, Federal University of Minas Gerais, 31270-901 Belo Horizonte-MG, Brazil
O presente estudo descreve a acentuada atividade citotóxica da nor-β-lapachona, seus
derivados arilamino substituídos, naftoquinonas iodadas e metilada, além de nor-β-lapachonas
1,2,3-triazólicas, contra quatro linhagens de células de leucemia humana (HL-60, K562, Molt-4
e Jurkat). Nor-β-lapachonas arilamino substituídas foram identificadas com potente atividade,
revelando-se como potenciais protótipos contra as linhagens tumorais descritas. Estudos utilizando
o ensaio cometa evidenciaram danos ao ácido desoxirribonucleico (ADN) causado pelos derivados
arilamino substituídos devido o aumento dos níveis intracelulares de espécies reativas de oxigênio
(ERO’s). Células de HL-60 foram selecionadas para a continuidade dos estudos de mecanismos
moleculares subjacentes e apoptose induzida pelos derivados quinoidais foi observada por análise
de citometria de fluxo. Cepas de Saccharomyces cerevisiae foram utilizadas para uma investigação
preliminar sobre o mecanismo de ação em topoisomerases de ADN. Os estudos sugerem que,
aparentemente, a citotoxidade dos compostos não envolve a inibição de topoisomerases, mas
que o tratamento prejudica a atividade de reparação do ADN, provocando assim a morte celular.
A capacidade em induzir apoptose e aberrações cromossômicas em fibroblastos de pulmão de
hamster chinês (células V79) também foi investigada. Núcleos apoptóticos foram observados e
nossos estudos indicam uma correlação entre dano ao ADN e apoptose.
The current study describes that nor-β-lapachone and its arylamino derivatives, iodinated and
methylated naphthoquinones and nor-β-lapachone-based 1,2,3-triazoles exhibited pronounced
cytotoxic effects against four human leukemia cell lines (HL-60, K562, Molt-4 and Jurkat). Nor-β-
lapachones arylamino substituted with potent activity were identified, revealing themselves as potential
prototypes against tumor cell lines. Moreover, cells treated with these compounds showed DNA
damage according to the standard comet assay, a finding that was, at least in part, due to increased
intracellular levels of ROS. HL-60 cells were chosen to study the underlying molecular mechanisms
of cytotoxicity. Drug-induced apoptosis in HL-60 cells was observed by flow cytometry analyses.
Strains of Saccharomyces cerevisiae were used for a preliminary investigation into the mechanism of
drug action on DNA topoisomerases. These results suggested that the cytotoxicity of these compounds
apparently does not involve topoisomerase inhibition, but that treatment impairs DNA repair activity,
thus triggering cell death. Considering their pro-oxidant properties, we investigated the ability of these
compounds to induce apoptosis and chromosomal aberrations as micronuclei in Chinese hamster
lung fibroblasts (V79 cells). Morphological apoptotic nuclei and micronuclei induction following
drug treatment were observed, suggesting a correlation between DNA damage and apoptosis.
Keywords: naphthoquinone, nor-β-lapachone, antileukemic activity, reactive oxygen species,
genotoxicity, DNA repair
*e-mail: nunim_br@hotmail.com, eufranio@ufmg.br

146
Potent Antileukemic Action of Naphthoquinoidal Compounds
J. Braz. Chem. Soc.
Introduction
Experimental
Naphthoquinones are widely distributed in nature, and
many clinically important antitumor drugs containing
a quinone moiety (anthracyclines, mitomycin and
mitoxantrones) have demonstrated anticancer activity.1,2
Studies of the antitumor properties and mechanisms of
action of quinone derivatives have shown that they can act
as topoisomerase inhibitors via DNA intercalation, and
their toxicity can also be explained by oxidative stress
with reactive oxygen species (ROS) generation, which
are usually toxic to normal tissues, thus reducing the
therapeutic utility of quinones.3-5
Despite recent technological advances, cancer treatment
remains a challenge, and, in some circumstances, a complete
remission is difficult to achieve. Currently, the investigation
of natural products and chemical modifications to antitumor
substances are among the most important strategies used
in the search for new antineoplastic drugs.6 Among the
cytotoxic naphthoquinones, β-lapachone has been the
most extensively studied in recent years7 and is currently
under multiple phase II clinical trials.8 In addition, the
semisynthetic nor-β-lapachone and its derivatives have
been the subject of several cytotoxicity studies in various
human cancer cell lines.2 More recently, using molecular
hybridization,9 our group synthesized a set of 1,2,3-triazole,
3-arylamino and 3-alkoxy-nor-β-lapachone derivatives and
previously reported their elevated antiproliferative activity
against human cancer cell lines.10,11 The strategy employed
to synthesize the nor-β-lapachone derivatives was based
on a modification over the C-ring moiety of the prototype
β-lapachone. This approach has demonstrated the potential
of this substance and became the base for the synthesis of
new important antitumor compounds.
Continuing our program to develop naphthoquinones
with anticancer activity, it was investigated the
antileukemic activity of four 3-arylamino-nor-β-lapachone
derivatives 1-4 (Scheme 1), a methylated and iodinated
naphthoquinones 5-7 (Scheme 2) and nor-β-lapachone-
based 1,2,3-triazoles 8-10 (Scheme 3), which manifested
pronounced cytotoxicity against human cancer cells using
several different human leukemia cell lines (HL-60, K562,
Molt-4 and Jurkat).
Moreover, to further understand, the biological
mechanism of the cytotoxic effect of more potent
naphthoquinones, our group also investigated their effect on
Saccharomycescerevisiaestrainsdeficientintopoisomerases.
As naphthoquinones increase intracellular ROS production,
the in vitro genotoxic effects of the test compounds
in Chinese hamster lung fibroblasts (V79) cells were
determined using the cytokinesis-block micronucleus test.
Chemicals
Fetal bovine serum and Dulbecco’s modified eagle
medium (DMEM) were purchased from Cultilab
(Campinas-SP, Brazil). RPMI 1640 medium, trypsin-
EDTA, penicillin and streptomycin, low-melting point
agarose and agarose were purchased from GIBCO®
(Invitrogen, Carlsbad, CA, USA). Propidium iodide
(PI), acridine orange (AO), ethidium bromide (EB),
rhodamine 123 (Rho-123), cytochalasin-B (Cyt-B),
glutathione reduced ethyl ester (GSH-OEt) and MTT
(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide) were purchased from Sigma-Aldrich Co.
(St. Louis, MO, USA). Formamidopyrimidine DNA-
glycosylase (FPG) and endonuclease III (ENDOIII) were
obtained from New England BioLabs (USA). Doxorubicin
(Doxolem®) was purchased from Zodiac Produtos
Farmacêuticos S/A (Brazil). All other chemicals and
reagents used were of analytical grade.
The synthesis and isolation of arylamino-
nor-β-lapachone derivatives 1-4 and nor-β-lapachone-
based 1,2,3-triazoles 8-10 were previously described by our
research group and the same methods were used to prepare
the compounds herein used to perform the antitumoral
studies.11,14 Compounds 5-7 were prepared as described by
Pinto and co-workers.13 See Supplementary Information
section for the NMR spectra of the compounds.
Lapachol (2-hydroxy-3-(3´-methyl-2`-butenyl)-
1,4-naphthoquinone) was extracted from the heartwood
of Tabebuia sp. (Tecoma) and purified by a series of
recrystallizations in the appropriate solvent, generally
hexane.10,11 The next step consisted of obtaining
nor-lapachol from lapachol using Hooker’s oxidation
reaction.14 3-Bromo-nor-β-lapachone was prepared from
nor-lapachol by a reaction with bromine and was then
immediately reacted with the respective arylamine to
yield the substituted nor-β-lapachones 1-4 (Scheme 1) in
moderate to high yields as recently described by us.11
The methylated and iodinated compounds were obtained
by methodology described by Pinto and co-workers13
from C-allyl lawsone. Initially, compounds 5 and 6 were
synthesized from C-allyl lawsone by simple reaction with
metallic iodine in dichloromethane. The substances 5 and 6
were obtained as crystalline solids (red and yellow crystals)
after purification by column chromatography. Finally, the
substance 7 was prepared by acid cyclization using sulfuric
acid.13
The last class of evaluated compounds was prepared
by methodology described by our research group.8

Vol. 24, No. 1, 2013
Cavalcanti et al.
147
Scheme 1. Synthetic route for preparation of β-lapachone, nor-β-lapachone and 3-arylamino-nor-β-lapachone derivatives 1-4.
Scheme 2. Synthetic route for obtainment of methylated and iodinated naphthoquinones 5-7.
Scheme 3. Synthetic route for preparation of nor-β-lapachone-based 1,2,3-triazoles 8-10.

148
Potent Antileukemic Action of Naphthoquinoidal Compounds
J. Braz. Chem. Soc.
Nor-β-lapachone-based 1,2,3-triazoles 8-10 were
synthesized, asveryrecentlydescribedbyus,12 ingoodyields,
from 3-azido nor-β-lapachone by click chemistry reaction,
methodology published by Sharpless and co-workers15 as
shown in the Scheme 3.
the absorbance was measured using a multiplate reader
(Spectra Count, Packard, Ontario, Canada). The drug effect
was quantified as the percentage of control absorbance of
the reduced dye at 595 nm.
Measurement of intracellular reactive oxygen species (ROS)
Cell lines and cell cultures
Levels of intracellular ROS were estimated
following treatment with the various compounds using
2’,7’-dichlorofluorescein diacetate (H2DCFDA) as a
fluorescent probe. H2DCFDA readily diffuses through
the cell membrane and is hydrolyzed by intracellular
esterases to non-fluorescent dichlorofluorescein (DCFH),
which is then rapidly oxidized to highly fluorescent
2’,7’-dichlorofluorescein (DCF) by a broad range of
intracellular oxidative stresses in addition to H2O2.17,18
Therefore, the increased mean fluorescence intensity
of DCF can be used as a probe for a broad range of
oxidative events not limited to H2O2. Briefly, leukemia
cell lines were exposed to the test compounds (0.25, 0.5,
1 and 2 µmol mL-1) for 4 h, and the culture medium was
then replaced by fresh serum-free medium containing
20 µmol mL-1 H2DCFDA. In another experimental set,
HL-60 cells were pre-exposed to GSH-OEt (15 mmol L-1)
for 2 h before treatment with some compounds (1-3). DCF
fluorescence intensity was detected by flow cytometry
using a Guava EasyCyteTM Mini (Guava Technologies, Inc.,
Hayward, CA, USA) and Guava Express Plus software. In
general, the DCF fluorescence intensity is proportional to
the amount of intracellular ROS.19
The human myeloid leukemia cancer cell lines used
in this report included the HL-60 (promyelogenous
leukemia), K562 (chronic myelogenous leukemia),
MOLT-4 (acute lymphoblastic leukemia) and Jurkat
(T-cell lymphoblast leukemia) lines, which were obtained
from the National Cancer Institute (Bethesda, MD, USA).
Chinese hamster lung fibroblasts (V79 cells) were kindly
provided by Dr. J. A. P. Henriques (Federal University of
Rio Grande do Sul, Porto Alegre, Brazil).
Leukemia cells were maintained in RPMI 1640
medium, and V79 cells were cultivated under standard
conditions in MEM with Earle’s salts. All culture media
were supplemented with 10% fetal bovine serum, 2 mmol L-1
glutamine, 100 µg mL-1 penicillin and 100 µg mL-1
streptomycin, and cultures were performed at 37 °C with 5%
CO2. To evaluate the cytotoxic and genotoxic activities of
the tested compounds usingV79 cells as a model, cells were
grown for 2 days prior to treatment with the test substances,
at which point, the medium was replaced with fresh medium
containing the test substance or DMSO solution as a control.
The final concentration of DMSO in the culture medium was
kept constant, under 0.1% (v/v). All cell treatments were
performed in triplicate and repeated at least 3 times.
DNA strand breaks
Inhibition of tumor cell proliferation
The comet assay, which is used to detect DNA strand
breaks, was conducted under alkaline conditions as
described by Singh et al.20 with minor modifications21 and
following the recommendations of the International
Workshop on GenotoxicityTest Procedures.22 Leukemia cell
lines were exposed to the test compounds (0.25, 0.5, 1 and
2 µmol L-1) for 4 h. Following exposure, slides containing
treated cells for the comet assay were placed in the chilled
lysis solution containing 2.5 mol L-1 NaCl, 100 mmol L-1
EDTA, 100 mmol L-1 Tris-HCl, 1% Trisma base, 1%
Triton X-100 and 10% DMSO for 16 h at 4 °C. The slides
were then removed from the lysing solution and placed
on a horizontal electrophoresis tank filled with freshly
prepared alkaline buffer (300 mmol L-1 NaOH, 1 mmol L-1
EDTA, pH > 13.00). The slides were equilibrated in the
same buffer for 20 min, and electrophoresis was performed
at 25 V, 300 mA for 20 min. After electrophoresis, the
slides were washed gently with 2 mol L-1 Tris-HCl buffer,
The growth of the leukemia and V79 cell lines was
quantified by the ability of living cells to reduce the
yellow dye 3-(4,5-dimethyl-2-thiozolyl)-2,5-diphenyl-
2H-tetrazolium bromide (MTT) to a purple formazan
product.16 For these experiments, myeloid leukemia and
V79 cells were plated in 96 well plates (0.3 × 106 cells
per well), and nor-β-lapachone and its derivatives 1-4
(0.02 to 13.07 µmol L-1), dissolved in DMSO (0.1%), were
then added to each well and incubated for 72 h. In some
experiments, the contribution of ROS to the cytotoxicity of
some tested compounds (1-3) was measured by HL-60 cells
pre-treated with a non-toxic concentration of GSH-OEt
(15 mmol L-1) for 2 h. DMSO (0.1%) was used as a negative
control. Subsequently, the plates were centrifuged, and
the medium was replaced by fresh medium (150 µL)
containing 0.5 mg mL-1 MTT. Three hours later, the MTT
formazan product was dissolved in 150 µL DMSO, and

Vol. 24, No. 1, 2013
Cavalcanti et al.
149
pH 7.4, to remove the alkali. Each slide was stained with
50 µL ethidium bromide (20 µg mL-1), and a cover slip was
placed on the slide. The analysis of the cells (100 cells from
each of the three replicate slides) was performed using a
visual scoring system23 that categorized tail length into
five classes. The damage index, which is considered to be
a sensitive DNA measure, was based on migration length
as well as the amount of DNA in the tail. Therefore, a
damage index value was assigned to each comet according
to its class, and the values ranged from 0 (completely
undamaged) to 400 (maximum damage).24 Doxorubicin
(0.6 µmol L-1) was used as the positive control.25
transformed using the lithium acetate method26 with the
linear disruption cassette gpx3::URA3, which generated the
double mutant top1Dtop3D. Transformants were selected by
growth on SynCo-Ura media, and disruption of the TOP3
gene was verified by genomic PCR.
Table 1. Saccharomyces cerevisiae strains used in this study
Strain
Relevant genotype
Source
BY4741
top1D
MATa his3D1; leu2D0; met15D0; ura3D0 Euroscarf
like BY4741, except yap1::kanMX4
like BY4741, except gpx3::kanMX4
like top1D, except yap1::URA3
Euroscarf
Euroscarf
this study
top3D
top1Dtop3D
Measurement of oxidized purines and pyrimidines
Media and growth inhibition assay
The alkaline comet assay was performed as described
above in the HL-60 and K562 cell lines. At the end of the
treatment (2 µmol L-1 for 4 h), the slides were removed
from the lysing solution, washed 3 times in enzyme buffer
(40 mmol L-1 HEPES, 100 mmol L-1 KCl, 0.5 mmol L-1
Na2EDTA, 0.2 mg mL-1 BSA, pH 8.0), and then drained and
incubated with 70 µL FPG (30 min at 37 °C) or ENDOIII
(45 min at 37 °C) diluted 1:103 in enzyme buffer according
to manufacturer. In some experiments, the relevance of
ROS on oxidative DNA damage (only oxidized purine
bases by FPG-modified comet assay) of some tested
compounds (1-3) was assessed by HL-60 cells pre-treated
with GSH-OEt (15 mmol L-1) for 2 h. Images of 100
randomly selected cells (50 cells from each of two replicate
slides) per group were visually analyzed. The amount of
oxidized purines (FPG-sensitive sites) and pyrimidines
(ENDOIII-sensitive sites) was then determined by
subtracting the amount of strand breaks (samples incubated
with buffer alone) from the total amount of breaks obtained
after incubation with FPG and ENDOIII.
Exponential phase cultures of S. cerevisiae strains
were diluted in PBS (phosphate buffered saline; Na2HPO4,
KH2PO4 and KCl; 20 mmol L-1; pH 7.4) to a density of
1 × 107 cells mL-1 for the growth inhibition assay. An
inoculation loop of cells from a cell suspension was
streaked from the center to the edge of a Petri dish in
one continuous streak; test compounds at increasing
concentrations (10, 20, 40 and 80 µg mL-1) were placed on
a filter-paper disk in the center of the plate and incubated
for 48 h at 30 °C. Impaired growth was measured as mm
of growth inhibition from the edge of the filter-paper disk
to the beginning of cell growth. Values ranged from 0
(complete growth to the filter-disk) to 30 mm (absence of
growth to the rim of the Petri dish). All tests were repeated
at least three times for each treatment.
Analysis of mechanisms involved in cytotoxicity
The following experiments were performed to elucidate
the mechanisms involved in the cytotoxic action of the
active compounds in HL-60 cells, a well-established cell
line suitable for examining the effects of test drugs on cell
proliferation, cell cycle progression, cell differentiation, and
apoptotic events.27,28 For the lipid peroxidation, nitrite/nitrate
measurements and flow cytometric experiments described
below, cells were exposed to increasing concentrations
(0.25, 0.5, 1 and 2 µmol L-1) of test compounds for 4 h, and
the cells were then reincubated for 20 h in the absence of
the test substances.
Saccharomyces cerevisiae strains and constructs
BY4741 haploid S. cerevisiae cells and two
topoisomerase mutant isogenic strains (Table 1)
were purchased from EUROSCARF (Institute of
Microbiology, Johann Wolfgang Goethe University
Frankfurt, Germany). The double mutant was constructed
using a gpx3::URA3 disruption cassette that was amplified
from YCPLac33 by PCR using specific primers [foward
(5’ATGAAAGTGCTATGTGTCGCAGAGAAAAATT
CTATAGCGAAATTAAATTGAAGCTCTAAT3’) and
reverse (5’TTACATGGATGCCTTGACACGGTCA
TAAACTTGCAAGAGACATACTCTTCCTTTTT
CAAT3’)]and a high-fidelity thermostable DNA polymerase
(Platinum® Taq, Invitrogen). The simple mutant top1D was
Determination of lipid peroxidation (TBARS assay) and
nitrite/nitrate production
Lipid peroxidation and the production of nitrite/nitrate
as a result of nitric oxide (NO) release were measured

150
Potent Antileukemic Action of Naphthoquinoidal Compounds
J. Braz. Chem. Soc.
in cell cultures using the standard methods described by
Draper and Hadely29 and Green et al.30 All experiments were
performed in triplicate in three independent experiments.
assessedaccordingtotheincorporationofbromodeoxyuridine
(BrdU) in the presence of hydroxyurea, a DNA synthesis
inhibitor that does not inhibit repair mechanisms.35 In brief,
HL-60 cells were treated for 24 h with the test compounds
(5 µmol L-1) and were then washed twice with ice-cold PBS
to remove the compounds. Then, the cells were immediately
incubated for an additional 30 min with medium containing
3 mmol L-1 hydroxyurea, at which point, the culture medium
was supplemented with BrdU (10 mmol L-1). After 2 h
incubation, the cells were washed (PBS), harvested and
transferred to cytospin slides, which were allowed to dry for
2 h at room temperature. Cells that had incorporated BrdU
were labeled by direct peroxidase immunocytochemistry
utilizing the chromogen diaminobenzidine. Slides were
counterstained with hematoxylin, mounted, and covered with
a cover slip. Evaluation of BrdU positivity was performed
using light microscopy (Olympus, Tokyo, Japan). Two
hundred cells were counted per sample to determine the
percentage of positive cells (UDS detection). MMS (8 × 10-5
mol L-1; 1 h) was used as a positive control.
Determination of cell membrane integrity, internucleosomal
DNA fragmentation, mitochondrial transmembrane potential
(DYm) and cell surface phosphatidylserine (PS)
Cell membrane integrity was evaluated by the
exclusion of propidium iodide (PI) at 50 µg mL-1. To
assay internucleosomal DNA fragmentation, the cells
were incubated at 37 °C for 30 min in the dark in a lysis
solution containing 0.1% citrate, 0.1% Triton X-100 and
50 µg mL-1 PI, and the percentage of degraded DNA was
determined according to the number of cells displaying
subdiploid (sub-Go/G1) DNA in relation to the total number
of cells examined.31
Transmembrane mitochondrial potential (DYm) was
evaluated using Rho-123 incorporation according to the
method described by Marinho-Filho et al.32 Rho-123 is
a cell-permeable, cationic, fluorescent dye that is readily
sequestered by active mitochondria without inducing
cytotoxic effects. Fluorescence was measured, and the
percentage of mitochondrial depolarization was determined.
The annexinV flow cytometry assay was used to detect
cell populations in apoptosis or necrosis, according to
the method described Cavalcanti et al.33 The cells were
stained with FITC-conjugated annexin V (Guava Nexin
kit, Guava Technologies, Inc., Hayward, CA, USA) and
PI (necrotic cell indicator), and they were then subjected
to flow cytometric analysis.
Cytokinesis-block micronucleus assay in V79 cells
The micronucleus assay was performed using the
standard Cyt-B technique described by Matsuoka et al.36
with modifications.37 V79 cells were incubated for 4 h with
various concentrations (1, 5 and 10 µmol L-1) of the test
compounds. After treatment, Cyt-B was added at a final
concentration of 3 µg mL-1, and the cells were harvested 21 h
after Cyt-B addition. The cells were dislodged, resuspended
(0.075 mol L-1 KCl at 4 °C), and fixed with methanol/acetic
acid (3:1) solution.After the slides were prepared, they were
stained with Giemsa (pH 6.8). Doxorubicin (0.6 µmol L-1)
was used as the positive control, and the vehicle (DMSO)
was used as the negative control. Micronuclei were counted
in 2,000 binucleated cells with well-preserved cytoplasm.
The identification of micronuclei was performed according
to the method described by Fenech.38,39
For all cytometric experiments, cell fluorescence was
determined by flow cytometry using a Guava EasyCyteTM
Mini (Guava Technologies, Inc., Hayward, CA, USA) with
Guava Express Plus software. 5,000 events were evaluated
per experiment.
Kinetics of DNA repair and unscheduled DNA synthesis
To study DNA repair kinetics, HL-60 cells were treated
with 8 × 10-5 mol L-1 methyl methanesulfonate (MMS) for
1 h and post-incubated in RPMI 1640 or post-treated in
RPMI 1640 with 0.25 µmol L-1 of the naphthoquinones to
be tested for 24 h. Cells not treated with MMS were also
incubated in RPMI 1640 as a control. To measure DNA
repair activity, the alkaline version of the comet assay was
performed as described above.
Determination of unscheduled DNA synthesis (UDS),
which principally measures global genome nucleotide
excision repair (NER) activity, was performed as described
by Bootsma et al.34 with minor modifications.31 UDS was
Determination of the proportion of apoptotic and necrotic
cells
To observe the cell death pattern induced by the test
compounds after 24 h of incubation, acridine orange/
ethidium bromide (AO/EB) staining of V79 cells
(3 × 105 cells mL-1) was performed according to the
method described by McGahon et al.40 At least 300 cells
were examined under a fluorescence microscope, and
the percentages of apoptotic and necrotic cells were then
calculated. Experiments were performed in triplicate in
three independent experiments.

Vol. 24, No. 1, 2013
Cavalcanti et al.
151
Table 2. Cytotoxicity of nor-β-lapachone and its semisynthetic derivatives
(1-10) in human leukemia cell lines after 72 h exposure
Statistical analysis
Data are presented as the mean values SEM (standard
error of the mean). For the MTT assay, the IC50 values
were obtained by nonlinear regression using the GraphPad
program (Intuitive Software for Science, San Diego, CA).
For other assays, data were analyzed by one-way analysis
of variance (ANOVA) followed by the Newman-Keuls test.
IC50 SEMa / (µmol L-1)
Compound
HL-60
K562
Molt-4
Jurkat
Nor-β-lapachone 1.86 0.11 1.62 0.25 0.92 0.10 1.34 0.18
1
2
3
4
5
6
7
8
9
10
0.69 0.15b 2.22 0.11 1.27 0.22 1.13 0.11
0.61 0.27b 1.85 0.22 0.77 0.11 1.10 0.21
1.30 0.25 2.30 0.27 1.26 0.22 2.05 0.56
0.33 0.01b 1.46 0.25 0.78 0.11 0.80 0.15b
3.44 0.33 3.11 0.11 1.73 0.15 1.38 0.22
4.05 1.10 3.55 0.50 3.05 0.55 2.73 0.11
1.11 0.11b 3.44 0.33 1.82 0.33 2.76 0.17
1.43 0.01b 1.92 0.21 1.79 0.01 1.33 0.55
2.21 0.55 2.74 0.10 0.94 0.10 2.14 0.15
0.74 0.01b 1.99 0.22 0.76 0.10 0.98 0.21b
Results and Discussion
An important strategy to obtain novel compounds with
potent antitumor activities is based on the modification of
β-lapachone structure.11 Among several strategies described
by us, the C-ring modification (Figure 1) has been used
with great success in the last years towards the synthesis
of antitumor arylamino compounds applied against some
cancer cell lines.11
aObtained by nonlinear regression from three independent experiments in
triplicate; bp < 0.001 compared to nor-β-lapachone by ANOVA followed
by Newman-Keuls test.
The insertion of arylamino ring intensifies the
activity with more efficiency than the insertion of
1,2,3-triazole ring. As observed in Table 2, the most active
naphthoquinones were 1-4 with IC50 values in the range
of 0.33 to 2.30 µmol L-1. The iodinated and methylated
compounds 5-7 were considered less active against the
evaluated cancer cell lines with IC50 values in the range of
4.05 to 3.44 µmol L-1 with some exceptions: compound 7
for HL-60 (IC50 = 1.11 µmol L-1) and compound 5 for Jurkat
(IC50 = 1.38 µmol L-1).
In comparison with nor-β-lapachone, our group
was delighted to see that compounds 2, 3 and 4 (for
HL-60), 4 (for K562), 3 and 4 (for Molt-4) and 2, 3 and
4 (for Jurkat) were more active than nor-β-lapachone, the
naphthoquinoidal precursor.
In previous studies, our research group described
β-lapachone-based 1,2,3-triazoles with activity against
tumor cell lines,10 and the mechanism of action is related
to inducing apoptotic cell death mediated by ROS
generation. In another recently study,6 our group showed
a 3’-nitro-3-phenylamino nor-β-lapachone derivative
with cytotoxicity based on apoptosis, which is partially
caused by ROS release. In the light of previous results, the
importance to verify the mechanism of action of different
nor-β-lapachone arylamino substituted is relevant. Due to
the potent activity observed for the compounds 1-4, these
substances were selected to further studies envisaging
the intrinsic mechanism of action related with the
antileukemic activity observed as will be discussed in
the next topics.
Figure 1. β-lapachone and nor-β-lapachone arylamino substituted with
potent antitumor activity.
In our preliminary studies, it was identified that some
nor-β-lapachone arylamino substituted had considerably
activity against HL-60 cancer cell lines. These results
prompted us to evaluate the most potent compounds against
one large panel of leukemia cell lines, i.e., HL-60, K562,
Molt-4 and Jurkat cells. To improve our knowledge about
this class of compounds, lapachones C-ring iodinated and
substituted by a heterocyclic ring, 1,2,3-triazole were
prepared. This pattern of substitution is based on a previous
work which shows that the insertion of both 1,2,3-triazole
ring and halogens in the nor-β-lapachone intensifies the
desired antitumor activity.11
Table2showsthecytotoxiceffectsofnor-β-lapachoneand
its arylamino derivatives (1-4), methylated and iodinated
naphthoquinones (5-7) and nor-β-lapachone-based
1,2,3-triazoles (8-10) on leukemia cell lines.All compounds
elicited significant antiproliferative effects in all myeloid
human leukemia cells examined after 72 h of exposure.
Among the four leukemia cell lines evaluated, the chronic
myelogenous leukemia cells (K562) were slightly less
sensitive (slightly greater IC50 values in relation to the other
cell lines) to treatment with the tested compounds.
In general terms, when compared to 1-4, only compound
10 presented similar activities against the four cancer cell
lines evaluated. This substance will be subject for further
mechanism studies.

152
Potent Antileukemic Action of Naphthoquinoidal Compounds
J. Braz. Chem. Soc.
ROS are continually generated and eliminated in
HL-60, MOLT-4 and Jurkat cell lines. Interestingly, the
amount of ROS generated in K562 cells was lower when
compared to that observed in the other three leukemia cell
lines, which may be the result of high levels of GSH,49
which can confer resistance to oxidative stress.
biological systems, playing important roles in a variety
of normal biochemical functions as well as abnormal
pathological processes. Excessive ROS production in the
cell is known to induce apoptosis,41,42 and consequently, the
ability of ROS to inflict severe cellular damage and cause
cell death has been exploited as an approach to kill cancer
cells. The generation of ROS associated with mitochondrial
disruption, resulting in oxidative stress, has been suggested
as a component of a common final pathway in the execution
of the apoptotic program.43,44
The oxidative stress associated with autooxidation of
a semiquinone free radical, which produces a superoxide
anion, hydrogen peroxide, and other active oxygen species,
has been related to naphthoquinone cytotoxicity.45,46
Moreover, ROS have been demonstrated to be highly
reactive species that cause DNA damage.47,48 In our
evaluation, short exposure (4 h) to nor-β-lapachone and
its derivatives (1-4) led to the generation of intracellular
ROS (Table 3).
Following short exposure (4 h) to the tested compounds,
slight increases in the DNA damage index were observed
for the HL-60, MOLT-4 and Jurkat cells, but not for K562
cells, as compared to doxorubicin-treated cells (Table 4).
However, there was no clear linear correlation between
ROS production and the induction of DNA strand breaks
after a short exposure time evaluated by standard comet
assay procedure. One of the limitations of the standard
comet assay, when not assaying with specific enzymes to
detect oxidative damage (i.e., FPG and ENDO III), is the
difficulty associated with detecting very low levels of DNA
damage. At such low levels of damage, the fragments and
breaks would be of such a size that migration in an agarose
gel becomes difficult to visualize.50 Therefore, it was
performed the modified comet assay in the presence of
the endonucleases FPG and ENDOIII, which specifically
recognize oxidized purine and pyrimidine bases in DNA,
However, the levels of ROS induced after treatment
were similar among all the compounds evaluated in the
Table 3. Effect of nor-β-lapachone (nor-β-lap) and related compounds (1-4) on intracellular reactive oxygen species (ROS) generation determined by
cytometric flow analysis
Cell line
Compound
Treatment / (µmol L-1)
HL-60
K562
MOLT-4
ROS SEM / %
5.18 0.23
Jurkat
ROS SEM / %
ROS SEM / %
ROS SEM / %
DMSOa
β-Lapb
Nor-β-Lap
-
2
2.85 0.22
1.62 0.12
9.28 0.32
80.00 2.39c
11.17 1.05d
27.82 1.41c
42.10 2.09c
70.63 2.41c
11.32 1.10c
32.19 0.94c
69.87 1.74c
81.24 2.06c
10.41 1.26c
26.33 0.84c
61.44 0.86c
83.31 2.20c
7.07 0.66
30.04 1.87c
45.07 1.43c
68.48 2.51c,e
14.53 0.57c
29.74 1.77c
67.43 0.75c
86.69 1.23c
51.17 3.15c
7.15 1.22c
76.28 1.06c
10.18 0.27d
23.75 0.96c
44.23 2.17c
61.11 0.25c,e
17.72 1.18c
31.98 1.38c
45.28 1.95c
65.24 2.19c,e
20.61 2.14c
22.31 1.36c
35.68 1.40c
73.42 1.25c
22.04 2.10c
32.35 1.07c
42.33 1.22c
74.81 3.42c
33.84 1.06c
32.51 2.17c
51.15 1.62c
71.23 1.56c
68.46 1.10c
21.06 1.88c
27.27 2.30c
39.87 0.97c
65.24 2.19c
28.88 1.39c
35.31 1.36c
51.92 0.79c
76.99 1.46c
18.71 3.04c
32.35 1.07c
50.68 2.18c
74.83 2.23c
25.79 2.06c
48.70 3.91c
65.08 0.31c
79.50 2.66c
23.59 0.96c
39.86 3.15c
59.71 1.81c
84.64 1.67c
0.25
0.5
1
15.39 0.24c
17.25 1.15c
44.84 1.17c
14.04 0.84c
18.25 0.94c
20.37 1.64c
38.23 0.75c,e
14.16 1.16c
18.00 2.31c
21.04 1.18c
39.87 0.97c,e
14.06 0.70c
19.23 1.62c
27.88 1.93c
51.48 2.00c
15.07 0.69c
18.66 1.73c
24.71 1.38c
38.28 2.81c,e
2
1
2
3
4
0.25
0.5
1
2
0.25
0.5
1
2
0.25
0.5
1
2
0.25
0.5
1
2
aNegative control was treated with the vehicle (DMSO, 0.1%) used for diluting the test substances; bpositive control; cp < 0.001; dp < 0.01 compared to
control (DMSO); ep < 0.001 compared to positive control byANOVA followed by Newman-Keuls test. Data are presented as mean values SEM (standard
error of the mean) for three independent experiments in triplicate.

Vol. 24, No. 1, 2013
Cavalcanti et al.
153
respectively. In our experiments, cultures treated with
DMSO (0.1%) or buffer solution does not increase the DNA
migration pattern in modified comet assay, in agreement
with our previously publication.51 Figure 2 shows the
mean DNA damage caused by the tested compounds
in the leukemia HL-60 and K562 cell lines, and these
values are expressed as the DNA damage index after
treatment with DNA repair endonucleases. Furthermore,
the post-incubation results after enzyme treatment clearly
showed increased DNA migration for the treated human
leukemia cell cultures. The percentages of ROS generation
(Table 3) in HL-60 and K562 cultures after treatments
with tested compounds (2 µmol L-1) were compared with
the amounts of oxidized nucleotide bases (Figure 2). In
both cultures, ROS correlated with DNA damage after
treatment with DNA repair enzymes (FPG and ENDOIII).
Interestingly, as measured by MTT assay (Figure 3a),
HL-60 cultures pre-treated with GSH-OEt showed an
increased viability (close to vehicle group), which may
indicate a neutralization of ROS produced by quinonoid
exposure (Figure 3b), and consequently a reduction on the
levels of oxidized nucleotide bases (Figure 3c), suggesting
that ROS have an important role in the cytotoxic effects of
tested compounds.
Some naphthoquinones have exhibited topoisomerase
inhibition effects.52-54 Among these naphthoquinones,
β-lapachone was first reported as a topoisomerase I catalytic
inhibitor,55 and subsequently, Frydman et al.52 reported
β-lapachone to be a weak topoisomerase II poison that,
unlike prototypical poisons, also inactivates the enzyme
upon drug/enzyme pre-incubation. However, the effects of
β-lapachone on topoisomerases remain controversial, as this
naphthoquinone has been shown to be both a topoisomerase I
inhibitor55 and activator56 as well as a topoisomerase II
inhibitor in in vitro systems.52,57 Furthermore, this agent has
alsobeenshowntofailtoinhibittopoisomeraseII55,56 ininvitro
conditions, although this finding remains controversial.
To investigate the action of nor-β-lapachone and
its derivatives 1-4 on topoisomerases, it was used the
budding yeast S. cerevisiae, which is commonly used to
investigate the cytotoxic mechanisms of drugs that target
DNA topoisomerases.58,59 Contrary to what was expected,
Figure 4 demonstrates that cultures of S. cerevisiae
strains with defective expression of DNA topoisomerases
Table 4. Effects of compounds on DNA damage index (DI) for 4 h using alkaline version of comet assay
Cell line
Compound
Treatment / (µmol L-1)
HL-60
K562
MOLT-4
DI SEM
Jurkat
DI SEM
DI SEM
DI SEM
DMSOa
Doxorubicinb
-
0.6
2
5.33 0.71
9.66 1.1
6.16 1.13
118.83 3.73c
23.19 0.15c
5.83 1.16
9.50 0.42
12.16 1.13c
20.50 1.11c
9.50 1.60
12.50 0.95c
18.33 1.30c
29.72 1.18e
7.50 1.74
7.00 1.78
13.00 1.41c
27.60 0.42e
10.66 2.26
10.16 1.10
9.16 1.32
19.66 1.25e
7.33 1.45
7.00 0.93
9.16 2.04
5.20 1.02
138.00 8.03c
15.27 0.42c
6.40 1.50
6.40 1.47
11.40 2.13c
21.00 1.14d
4.20 1.02
7.60 1.43
14.40 2.06c
21.00 1.30d
5.60 0.60
11.20 0.80c
13.00 1.18c
26.37 2.15d,f
3.80 1.02
8.00 1.22
9.60 0.51
19.80 1.85d
7.40 1.28
6.00 0.83
10.40 1.40c
23.80 1.39d
150.16 5.17c
17.25 0.56c
6.77 0.96
127.33 5.13c
8.46 0.17
7.00 1.12
10.00 1.59
6.50 1.58
12.16 0.98
7.33 0.88
8.66 0.91
9.16 0.70
9.83 1.32
4.66 0.42
7.00 0.57
10.00 1.57
10.83 0.87
7.66 0.95
8.50 1.20
9.33 1.76
14.50 1.40
8.16 0.94
6.33 1.30
9.16 1.04
13.50 1.23
β-Lap
Nor-β-Lap
0.25
0.5
1
9.42 0.75
12.22 1.28c
20.11 0.97c
6.55 1.16
14.37 1.56d
30.71 1.80c,f
42.62 2.57c,f
5.66 1.20
11.33 1.06c
31.33 2.69c,f
41.55 3.51c,f
4.77 1.23
11.33 0.97c
18.88 1.80c
22.77 1.35c
5.44 1.02
2
1
2
3
4
0.25
0.5
1
2
0.25
0.5
1
2
0.25
0.5
1
2
0.25
0.5
1
8.42 0.99
27.18 0.56c,f
38.21 1.45c,f
2
21.33 1.96d
b
c
d
e
aNegative control was treated with the vehicle (DMSO, 0.1%) used for diluting the test substances; positive controls; p < 0.001; p < 0.05; p < 0.01
compared to control (DMSO); fp < 0.001 compared to positive control byANOVA followed by Newman-Keuls test. Data are presented as mean values SEM
(standard error of the mean) for three independent experiments in triplicate.

154
Potent Antileukemic Action of Naphthoquinoidal Compounds
J. Braz. Chem. Soc.
Figure 2. Effects of FPG and ENDOIII on oxidative DNA strand breaks after 4 h of exposure to 2 µmol L-1 of the tested compounds, according to the
alkaline version of the comet assay, in the HL-60 (a) and K562 (b) cell lines. Bars represent the mean SEM of three independent experiments in triplicate.
*p < 0.05 vs. DMSO (0.1%) by ANOVA followed by the Newman-Keuls test.
Figure 3. Evaluation of HL-60 cells viability (a) by MTT assay (optical density at 595 nm), ROS formation (b): (I) DMSO (0.1%); (II) tested compound;
(III) tested compound plus GSH-OEt; and oxidative DNA damage (c) after compounds (1-3) exposure (2 µmol L-1) for 4 h in the presence or absence of
GSH-OEt at 15 mmol L-1. Bars or histograms represent the mean SEM of three independent experiments in triplicate. *p < 0.05 vs. DMSO (0.1%) by
ANOVA followed by the Newman-Keuls test.

Vol. 24, No. 1, 2013
Cavalcanti et al.
155
Figure 4. Effects of nor-β-lapachone (a), its semisynthetic derivatives 1 (b), 2 (c), 3 (d), 4 (e) and β-lapachone (f) on the growth of budding S. cerevisiae
yeast, including single (top1D and top3D), and double (top1Dtop3D)-gene deletion strains, after 48 h of exposure. The negative control was treated with
the vehicle (0.1% DMSO) used to dilute the test substance. *p < 0.001, as compared to the control, by ANOVA followed by the Newman-Keuls test. Data
are presented as the mean values SEM from three independent experiments in triplicate.
(top1D, top3D and top1Dtop3D) were more sensitive to
nor-β-lapachone and its derivatives (1-4) than the wild-type
strain (BY4741). This result suggests that the mechanism
of cytotoxicity of the naphthoquinones is, apparently, not
likely to involve the inhibition of topoisomerases. The fact
that the observed decrease in survival was not specific to
the lack of a single type of topoisomerase can be explained
by the fact that topoisomerase complexes at a DNA lesion
may alter the repair efficiency and initiate alternative and
more efficient processing of damage repair.60,61 Moreover,
the deletion of TOP1 has no effect on yeast survival,62
furthermore, it is possible to conclude that the toxic
mechanism of nor-β-lapachone and its derivatives does
not include topoisomerase I poisoning. Also, our results
indicate that topoisomerases served as important survival
factors following DNA damage induced by the tested
compounds.
It has been demonstrated that the deletion of TOP3
increased yeast sensitivity to ultraviolet light (UV)-induced
DNA adducts and alkylation damage by MMS,62,63 whereas
the deletion of TOP1 had no effect on yeast survival after
exposure.62 This finding suggests that TOP3 may facilitate

156
Potent Antileukemic Action of Naphthoquinoidal Compounds
J. Braz. Chem. Soc.
DNA damage repair, while TOP1 may hinder damage
recognition.60 In addition, unlike mammalian cells, which
require both type I and II topoisomerases, only the deletion
of TOP2 is lethal in yeast.64 Therefore, to evaluate the
action of the tested compounds on topoisomerase II, a
double mutant with a deletion of TOP1 (top1D) and TOP3
(top3D) was used. The sensitivity increase of double
mutant top1Dtop3D can be suggested as a possible role of
nor-β-lapachone and their derivatives on topoisomerase II,
however more studies are necessary to confirm this
mechanism of action. In this sense, Krishnan and Bastow57
showed that β-lapachone was an irreversible inhibitor of
topoisomerase II by induced religation and dissociation of
the enzyme from DNA in the presence ofATP. Interestingly,
Cline and Hanawalt60 previously showed that, similar
to TOP1, TOP2 may obscure DNA lesions induced by
UV damage, leading to their processing by other repair
mechanisms or to the initiation of cell death if damage
levels exceed the repair capabilities.
However, the growth of yeast lacking topoisomerase I
expression is suppressed by β-lapachone, which raises
doubts about its mechanism of action and suggests that
this compound has critical intracellular targets other than
topoisomerase I.57 These observations are in agreement
with our data (Figure 4f) and also indicate that targets other
than topoisomerase II may be associated with the cytotoxic
mechanisms of β-lapachone, nor-β-lapachone and its
derivatives 1-4.
Oliveira-Brett et al.71 reported that the cytotoxic actions of
β-lapachone and related naphthoquinones derive, in part,
from the alkylation of exposed thiol or cysteine residues
on topoisomerase II. Ortho-quinones such as β-lapachone
have better redox cycling ability than para-quinones
such as α-lapachone. Therefore, it was suggested that
the cytotoxic actions of naphthoquinones derive, at least
in part, from the alkylation of exposed thiol residues on
topoisomerase II-DNA complexes.70
Because β-lapachone was found to inactivate DNA
repair56,65,69 and because the chemical structures of the
tested compounds and β-lapachone are very similar, the
potential influence of the studied naphthoquinones on the
functionality of DNA repair mechanisms in HL-60 cells
was tested by introducing MMS-induced DNA lesions
prior to exposure to the tested compounds. MMS is an
alkylating agent that directly alkylates the nitrogen of DNA
bases. The repair of N-methylated base adducts in living
cells occurs mainly via base excision repair, homologous
recombination, and to a lesser extent, via NER.72-74
In our study, 0.25 µmol L-1 naphthoquinone did
not significantly increase the DNA migration in the
alkaline comet assay (Figure 5a), although it was
capable of inhibiting the repair of MMS-induced DNA
damage, as evidenced by the low levels of DNA repair
activity observed in MMS-treated cells after post-
treatment with the evaluated molecules in comparison to
MMS-treated and post-incubated cells (Figure 5b).
Additionally, as shown in Figure 5c, HL-60 cells treated
with the tested naphthoquinones showed significantly less
BrdU incorporation as compared to cells treated with MMS.
These data indicated that interference with mechanisms of
DNA repair (i.e., NER) might be involved in the mechanism
of cytotoxic activity of these molecules.
Subsequent studies described β-lapachone as a DNA
repair inhibitor56,65 capable of sensitizing tumor cells
to DNA damaging agents.66,67 β-lapachone was shown
to indirectly inhibit DNA repair enzymes through the
modification of the redox homeostasis of the intracellular
environment, causing oxidative damage to the cysteine
residues of the enzymes and subsequently impairing their
structure and function to render them incapable of mediating
DNA damage repair.68,69 Additionally, Neder et al.70 and
Induction of apoptosis by naphthoquinones has been
previously reported.50,75,76 Because many chemotherapeutic
drugs have been shown to induce apoptosis in malignant
Figure 5. Effect of the compounds (0.25 µmol L-1) on the DNA damage index in HL-60 cells as assessed by the alkaline version of the comet assay after
24 h of exposure (a) and on the kinetics of DNA repair of MMS-induced DNA damage as assessed by the alkaline comet assay (b), and UDS detection after
24 h of exposure to 5 µmol L-1 of each compound as assessed by the BrdU incorporation assay (c). Bars represent the mean SEM of three independent
experiments in triplicate. *p < 0.05 vs. MMS (80 µmol L-1) by ANOVA followed by the Newman-Keuls test.

Vol. 24, No. 1, 2013
Cavalcanti et al.
157
cells, the induction of apoptosis is a target for the
development of antitumor drugs.77,78 As none of the tested
compounds caused nonselective growth inhibition in the
leukemia cell lines evaluated, the underlying molecular
mechanisms of the compound antiproliferative activity
were evaluated using human promyelocytic leukemia
HL-60 cells.
20 h reincubation period without the drug) of 0.5 µmol L-1
for all compounds evaluated, apoptotic events such as
the alteration of cell membrane integrity (instability),
mitochondrial depolarization, internucleosomal DNA
fragmentation (Figure 6) and PS cell membrane localization
(Figure 7) were observed (p < 0.001).
Following drug exposure, all evaluated compounds
were found to slightly reduce cell membrane integrity.
In addition, at least 15.54 1.82% (nor-β-lapachone),
Our flow cytometry results with HL-60 cells showed
that after pulse treatment (4 h of exposure followed by a
Figure 6. Effects of nor-β-lapachone (a) and its semisynthetic derivatives 1 (b), 2 (c), 3 (d), 4 (e) and β-lapachone (f) on HL-60 cell viability, mitochondrial
transmembrane potential (DYm) and internucleosomal DNA fragmentation. The negative control was treated with the vehicle (0.1% DMSO) used to dilute
the test substance. 5,000 events were analyzed in each experiment. *p < 0.001, as compared to the control, by ANOVA followed by the Newman-Keuls
test. Data are presented as the mean values SEM from three independent experiments performed in triplicate.

158
Potent Antileukemic Action of Naphthoquinoidal Compounds
J. Braz. Chem. Soc.
14.51 0.52% (1), 15.44 0.96% (2), 15.18 0.44% (3),
14.75 0.43% (4) and 21.18 0.75% (β-lapachone) of
the HL-60 cells displayed subdiploid sized DNA (sub-Go/
G1), representing apoptotic cells with a fractional DNA
content. The percentages of HL-60 cells showing low DYm
were 12.75 1.12% (nor-β-lapachone), 10.84 1.03%
(1), 25.35 1.95% (2), 12.26 1.10% (3), 13.58 0.76%
(4), and 16.82 0.81% (β-lapachone). In addition,
6.62 1.19% (nor-β-lapachone), 5.79 0.62% (1),
5.70 0.13% (2), 2.87 0.28% (3), 5.68 0.64%
(4) and 5.57 0.37 % (β-lapachone) of the HL-60 cells
demonstrated annexin V-conjugated PS in cultures treated
with the lowest concentration of the test compounds. In
cultures exposed to the highest concentration (2 µmol L-1)
of the test substances, the percentages of HL-60 cells with
degraded DNA, altered DYm, and externalized PS were
greater than 33, 29 and 9%, respectively, for all compounds
evaluated (p < 0.001). Moreover, our data showed that
after pulse treatment, lipid peroxidation (Figure 8) and
Figure 7. Phosphatidylserine (PS) externalization in HL-60 cells treated
with the test compounds (0.25, 0.5, 1 and 2 µmol L-1) after pulse treatment
(4 h exposure followed by 20 h reincubation without the drug). The
negative control was treated with the vehicle (0.1% DMSO) used to
dilute the test substance. Five thousand events were analyzed in each
experiment. *p < 0.001, as compared to the control, byANOVA followed
by the Newman-Keuls test. Data are presented as the mean values SEM
from three independent experiments performed in triplicate.
Figure 8. TBARS formation after pulse treatment (4 h exposure followed by 20 h reincubation without the drug) of HL-60 cells with the test compounds
(0.25, 0.5, 1 and 2 µmol L-1). The negative control was treated with the vehicle (DMSO, 0.1%) used to dilute the test substances. *p < 0.001, as compared
to the control, byANOVA followed by the Newman-Keuls test. Data are presented as the mean values SEM for three independent experiments performed
in triplicate.

Vol. 24, No. 1, 2013
Cavalcanti et al.
159
nitrite/nitrate production (Figure 9) as a result of nitric
oxide release were observed in treated HL-60 cells, which
is in agreement with the finding that nor-β-lapachone and
its arylamino derivatives (1-4) induced oxidative stress,
as assessed by the determination of intracellular ROS
generation detected by the H2DCFDA probe.
In situ generated ROS can open permeability transition
pores with subsequent DYm loss and can cause cellular
damage through apoptosis, enzyme inactivation and
cytochrome c release into the cytosol.79,80 In the present
study, it was demonstrated that nor-β-lapachone and
its arylamino derivatives (1-4) induced alterations in
mitochondrial redox functions that are critical to initiating
ROS-mediated cell death, in general agreement with the
previously reported antiproliferative properties of other
naphthoquinones.81,82 The decrease in DYm induced by
the test compounds indicated ROS-mediated mitochondrial
dysfunction in the promyelocytic leukemia cells. Thus, the
alterations in mitochondrial function caused by exposure
to these naphthoquinones may be a major cause of
apoptosis and cell death.
Overall, the in vivo use of quinones presents a major
challenge because of their toxicity.5,83 With regard to the
side effects of chemotherapy, it is essential to know whether
a compound exerts a harmful effect on normal dividing
cells. In this context, with the exception of nor-β-lapachone
(IC50 for V79 cells was greater than 21.9 µmol L-1), all
nor-β-lapachone derivatives tested exerted a cytotoxic
effect againstV79 cells, with the antiproliferative potential
ranging from moderate (2 and 3) to high (1 and 4) (Table 5).
Additionally, unlike nor-β-lapachone, a previous study
determined that all four 3-arylamino-nor-β-lapachone
derivatives studied here were not selective for tumor cells,
as a toxic effect against proliferating human lymphocytes
was observed at similar concentrations, with IC50 values
after 72 h exposure equal to 2.45 0.10 µmol L-1 (1),
2.49 0.23 µmol L-1 (2), 3.06 0.56 µmol L-1 (3) and
2.11 0.21 µmol L-1 (4).
Figure 9. Nitrite/nitrate formation in HL-60 treated with the test compounds (0.25, 0.5, 1 and 2 µmol L-1) after pulse treatment (4 h exposure followed
by 20 h reincubation without the drug). The negative control was treated with the vehicle (DMSO, 0.1%) used to dilute the test substances. *p < 0.05, as
compared to the control, byANOVA followed by the Newman-Keuls test. Data are presented as the mean values SEM from three independent experiments
performed in triplicate.

160
Potent Antileukemic Action of Naphthoquinoidal Compounds
J. Braz. Chem. Soc.
Table 5. Cytotoxic activity of nor-β-lapachone (nor-β-lap) and related
compounds (1-4) on V79 cell line
the lowest concentration tested (p < 0.001), and the effects
of compounds 2 and 3 were observed at a concentration
as low as 5 µmol L-1 (p < 0.001; p < 0.01, respectively),
as detected by an increase in micronuclei. However, for
nor-β-lapachone, increases in micronuclei were only
observed at the highest concentration evaluated (p < 0.001).
The reduced cytokinesis-block proliferation index (Table
6) and the presence of morphologically apoptotic nuclei in
V79 cells (Figure 10) suggest that DNA damage induced
by nor-β-lapachone and its arylamino derivatives (1-4)
may be important features of their cytotoxic mechanisms.
V79 cell
Compound
IC50 SEMa / (µmol L-1)
Nor-β-lap
> 21.9
1
2
3
4
1.32 0.11
6.33 0.56
5.80 0.33
1.91 0.20
aData are presented as IC50 values SEM (standard error of the mean)
from three independent experiments performed in triplicate.
Conclusion
Finally, to obtain a complete evaluation of the toxic
effects of these compounds in mammalian cells (V79 line),
DNA damage induced by nor-β-lapachone and its arylamino
derivatives (1-4) was estimated using the cytokinesis-block
micronucleus test. This assay is a non-specific genotoxicity
test that detects fixed mutations and permanent DNA
damage. This test detects chromosomal aberrations as
micronuclei in dividing versus non-dividing cells,37 which
serve as a good biomarker of exposure to genotoxins.
The presence of a micronucleus represents the disruption
of small amounts of non-condensed chromatin, and
their increased frequency is evidence of prior structural
chromosome damage or changes in chromosome
number.38,48 The data presented in Table 6 show that the
mutagenic effects of compounds 1 and 4 occurred at even
In conclusion, the 3-arylamino-nor-β-lapachone
derivatives (1-4) elicited a significant antiproliferative
effect in all human myeloid leukemia cell lines examined,
which is similar to the effect observed with the precursor
molecule (nor-β-lapachone). Compounds 5-7 and
nor-β-lapachone-based 1,2,3-triazoles 8-10 presented
activity against the cancer cell lines assayed but with less
activity than β-lapachone and substances 1-4. Furthermore,
compounds 1-4 induce oxidative DNA damage by ROS
generation, and somehow, treatments impair DNA repair
activity triggering apoptosis. We hypothesized that DNA
damage caused by redox cycling as a result of treatment
with the tested naphthoquinones would be an important
initiating signal for cell death. However, because of the
lack of selectivity between cancer and non-cancer cells, the
Table 6. Effect of nor-β-lapachone (nor-β-lap) and related compounds (1-4) on V79 micronucleated cell frequency in the micronucleus (MN) test after
3 h pulse treatment
Compound
Ca
Db
Treatment / (µmol L-1)
MN per 2,000 BNCc
4.33 0.88
BNC / %
-
0.6
1
91.27 2.56
68.13 0.90a
93.45 3.41
90.74 4.26
86.21 2.18a
89.40 0.50
83.35 0.18a
70.02 2.50a
91.12 1.30
86.31 2.10a
81.55 0.50a
93.00 2.10
86.44 3.56a
78.12 0.66a
91.17 1.56
83.16 0.75a
61.50 3.54a
Nor-β-lap
4.33 0.71
5
4.83 0.30
10
1
19.33 2.53a
10.83 0.94a
22.83 3.20a
49.16 3.91a
2.83 0.91
11.83 1.30b
24.16 2.27a
5.50 0.56
19.66 1.78a
27.66 2.56a
11.00 1.29b
26.00 1.36a
1
2
3
4
5
10
1
5
10
1
5
10
1
5
10
48.66 2.15a
72.41 1.12a
b
c
aNegative control was treated with the vehicle (DMSO, 0.1%) used for diluting the test substances; doxorubicin (positive control); MN frequency is
expressed per 2000 binucleated cells (BNC); cp < 0.001; bp < 0.01 compared to control by ANOVA followed by Newman-Keuls test. Data are presented
as mean values SEM (standard error of the mean) for three independent experiments in triplicate.

Vol. 24, No. 1, 2013
Cavalcanti et al.
161
Figure 10. Effect of the test compounds on the HL-60 cell death pattern following acridine orange and ethidium bromide double staining and evaluation
by fluorescence microscopy after 24 h of exposure. The negative control (DMSO) was treated with the vehicle (0.1 % DMSO) used to dilute the test
substance. *p < 0.001, as compared to the control, by ANOVA followed by the Newman-Keuls test. Data are presented as the mean values SEM from
three independent experiments performed in triplicate.
3-arylamino-nor-β-lapachone derivatives (1-4) evaluated
may have limited therapeutic potential as anticancer
agents if administered as single drug but may be useful
in combination with other antitumor agents. One strategy
for overcoming the intrinsic toxicity of quinones may be
to use derivatives that are more stable in their reduced
state and thereby less likely to initiate the formation of
radicals and damage cells indiscriminately. Therefore,
these mechanism insights also reinforce the need for
further studies with other nor-β-lapachone derivatives to
determine the structure-activity relationship between both
therapeutic and toxicological activities. In general terms,
this work is an important contribution for developing novel
antitumor drugs from lapachone group, substance currently
in multiple phase II clinical trials as monotherapy and in
combination with other cytotoxic drugs.84
Aperfeiçoamento de Pessoal de Nível Superior (CAPES) and
Instituto Claude Bernard for financial support in the form
of grants and fellowship awards. We are also grateful to
the National Cancer Institute (Bethesda, MD, USA) for
the donation of the leukemia cell lines used in this study.
Dr. E. N. da Silva Júnior thanks the Programa Institucional
deAuxílio à Pesquisa de Doutores Recém-Contratados and
Universidade Federal de Minas Gerais (edital 12/2011),
FAPEMIG (APQ-04166-10) and CNPq (Universal Project,
MCTI/CNPq No. 14/2012). We also thank Silvana F.
dos Santos for technical assistance and Dr. A. Leyva for
English editing of the manuscript. This study is dedicated
to ProfessorAntônioV. Pinto (in memoriam) and Maria do
Carmo F. R. Pinto due to excellent advices, samples and
spectra of compounds 5, 6 and 7.
Supplementary Information
Acknowledgments
Supplementary information (1H and 13C NMR spectra
for all compounds) is available free of charge at http://jbcs.
sbq.org.br as PDF file.
WewishtothankConselhoNacionaldeDesenvolvimento
Científico e Tecnológico (CNPq), Coordenação de

162
Potent Antileukemic Action of Naphthoquinoidal Compounds
J. Braz. Chem. Soc.
References
17. Crow, J. P.; Nitric Oxide 1997, 1, 145.
18. Hempel, S. L.; Buettner, G. R.; O’Malley,Y. Q.; Wessels, D.A.;
Flaherty, D. M.; Free Radical Biol. Med. 1999, 27, 146.
19. LeBel, C. P.; Ischiopoulos, H.; Bondy, S. C.; Chem. Res. Toxicol.
1992, 5, 227.
1. Zhang, G.; Fang, L.; Zhu, L.; Zhong, Y.; Wang, P. G.; Sun, D.;
J. Med. Chem. 2006, 9, 1792.
2. da Silva Júnior, E. N.; de Souza, M. C. B. V.; Pinto, A. V.;
Pinto, M. C. F. R.; Goulart, M. O. F.; Barros, F. W.; Pessoa, C.;
Costa-Lotufo, L. V.; Montenegro, R. C.; de Moraes, M. O.;
Ferreira V. F.; Bioorg. Med. Chem. 2007, 15, 7035.
3. Joseph, P.; Long II, D. J.; Klein-Szanto, A. J. P.; Jaiswal, A. K.;
Biochem. Pharmacol. 2000, 60, 207.
20. Singh, N. P.; McCoy, M. T.; Tice, R. R.; Schneider, E. L.; Exp.
Cell Res. 1988, 175, 184.
21. Klaude, M.; Eriksson, S.; Nygren, J.;Ahnström, G.; Mutat. Res.
1996, 363, 89.
22. Tice, R. R., Agurell, E.; Anderson, D.; Burlinson, B.;
Hartmann, A.; Kobayashi, H.; Miyamae, Y.; Rojas, E.; Ryu,
J. C.; Sasaki, Y. F.; Environ. Mol. Mutagen. 2000, 35, 206.
23. Miyamae, Y.; Yamamoto, M.; Sasaki, Y. F.; Kobayashi, H.;
Igarashi-Soga, M.; Shimoi, K.; Hayashi, M.; Mutat. Res. 1998,
418, 131.
4. Wardman, P.; Curr. Med. Chem. 2001, 8, 739.
5. Verma, R. P.; Anticancer Agents Med. Chem. 2006, 6, 489.
6. Araújo, A. J.; de Souza, A. A.; da Silva Júnior, E. N.;
Marinho-Filho, J. D. B.; de Moura, M. A. B. F.; Rocha, D. D.;
Vasconcellos, M. C.; Costa, C. O.; Pessoa, C.; de Moraes, M. O.;
Ferreira, V. F.; deAbreu, F. C.; Pinto, A. V.; Montenegro, R. C.;
Costa-Lotufo, L. V.; Goulart, M. O. F.; Toxicol. in Vitro 2012,
26, 585.
24. Hartmann, A.; Agurell, E.; Beevers, C.; Brendler-Schwaab, S.;
Burlinson, B.; Clay, P.; Collins, A.; Smith, A.; Speit, G.;
Thybaud, V.; Tice, R. R.; Mutagenesis 2003, 18, 45.
25. Cavalcanti, B. C.; Bezerra, D. P.; Magalhães, H. I. F.; de Moraes,
M. O.; Lima, M. A.; Silveira, E. R.; Câmara, C. A.; Rao, V. S.;
Pessoa, C.; Costa-Lotufo, L.V.; J. Appl. Toxicol. 2009, 29, 560.
26. Gietz, R. D.; Woods, R. A.; Methods Enzymol. 2002, 350, 87.
27. Collins, S. J.; Blood 1987, 70, 1233.
7. Ferreira, D. C. M.; Goulart, M. O. F.; Moreira, M. S. A.;
Tapsoba, I.; Arbault, S.; Bouret, Y.; Pinto, A. V.; Amatore, C.;
ChemBioChem. 2009, 10, 528.
8. da Silva Júnior, E. N.; de Moura, M.A. B. F.; Pinto,A.V.; Pinto,
M. C. F. R.; de Souza, M. C. B. V.; Araújo, A. J.; Pessoa, C.;
Costa-Lotufo, L. V.; Montenegro, R. C.; de Moraes, M. O.;
Ferreira, V. F.; Goulart, M. O. F.; J. Braz. Chem. Soc. 2009, 20,
635.
28. Militão, G. C. G.; Dantas, I. N. F.; Pessoa, C.; Falcão, M. J.;
Silveira, E. R.; Lima, M.A.; Curi, R.; Lima, T.; de Moraes, M. O.;
Costa-Lotufo, L. V.; Life Sci. 2006, 78, 2409.
9. Viegas-Jr., C.; Danuello,A.; Bolzani,V. S.; Barreto, E. J.; Fraga,
C. A.; Curr. Med. Chem. 2007, 14, 1829.
29. Draper, H. H.; Hadely, M.; Methods Enzymol. 1990, 186, 421.
30. Green, L. C.; Tannenbaum, S. R.; Goldman, P.; Science 1981,
212, 56.
10. da Silva Júnior, E. N.; Cavalcanti, B. C.; Guimarães, T. T.;
Pinto, M. C. F. R.; Cabral, I. O.; Pessoa, C.; Costa-Lotufo,
L.V.; de Moraes, M. O.; deAndrade, C. K. Z.; dos Santos, M. R.;
de Simone, C. A.; Goulart, M. O. F.; Pinto, A. V.; Eur. J. Med.
Chem. 2011, 46, 399.
31. Logrado, L. P.; Santos, C. O.; Romeiro, L. A.; Costa, A. M.;
Ferreira J. R.; Cavalcanti, B. C.; de Moraes, O. M.; Costa-Lotufo,
L. V.; Pessoa, C.; dos Santos, M. L.; Eur. J. Med. Chem. 2010,
45, 3480.
11. daSilvaJúnior, E. N.;deDeus, C. F.;Cavalcanti, B. C.;Pessoa, C.;
Costa-Lotufo, L. V.; Montenegro, R. C.; de Moraes, M. O.;
Pinto, M. C. F. R.; de Simone, C. A.; Ferreira, V. F.; Goulart,
M. O. F.; Andrade, C. K. Z.; Pinto, A. V.; J. Med. Chem. 2010,
53, 504.
32. Marinho-Filho, J. D.; Bezerra, D. P.;Araújo,A. J.; Montenegro,
R. C.; Pessoa, C.; Diniz, J. C.; Viana, F. A.; Pessoa, O. D.;
Silveira, E. R.; de Moraes, M. O.; Costa-Lotufo, L. V.; Chem.
Biol. Interact. 2010, 183, 369.
33. Cavalcanti, B. C.; da Costa, P. M.; Carvalho, A. A.; Rodrigues,
F. A.; Amorim, R. C.; Silva, E. C.; Pohlit, A. M.; Costa-Lotufo,
L. V.; de Moraes, M. O.; Pessoa, C.; Pharm. Biol. 2012, 50,
980.
12. da Silva Júnior, E. N.; de Melo, I. M. M.; Diogo, E. B. T.; Costa,
V. A.; de Souza Filho, J. D.; Valença, W. O.; Camara, C. A.; de
Oliveira, R. N.; deAraújo,A. S.; Emery, F. S.; dos Santos, M. R.;
de Simone, C. A.; Menna-Barreto, R. F. S.; de Castro, S. L.;
Eur. J. Med. Chem. 2012, 52, 304.
34. Bootsma, D.; Mudle, M. P.; Cohen, J. A.; Pot F.; Mutat. Res.
1970, 9, 507.
13. Silva, R. S. F.; Costa, E. M.; Trindade, U. L. T.; Teixeira, D. V.;
Pinto, M. C. F. R.; Santos, G. L.; Malta, V. R. S.; de Simone,
C. A.; Pinto, A. V.; Castro, S. L.; Eur. J. Med. Chem. 2006, 41,
526.
35. Snyder, R. D.; Mutat. Res. 1984, 131, 163.
36. Matsuoka,A.;Yamazaki, N.; Suzuki, T.; Hayashi, M.; Sofuni, T.;
Mutat. Res. 1992, 272, 223.
37. Bonacker, D.; Stoiber, T., Wang, M.; Böhm, K. J.; Prots, I.;
Unger, E.; Their, R.; Bolt, H. M.; Degen, G. H.; Arch. Toxicol.
2004, 78, 575.
14. Fieser, L. F.; Fieser, M.; J. Am. Chem. Soc. 1948, 70, 3215.
15. Rostovtsev, V. V.; Green, G. L.; Fokin, V. V.; Sharpless, K. B.;
Angew. Chem., Int. Ed. 2002, 41, 2596.
38. Fenech, M.; Mutat. Res. 2000, 455, 81.
16. Mosmann, T.; J. Immunol. Methods 1983, 16, 55.
39. Fenech, M.; Mutat. Res. 2006, 600, 58.

Vol. 24, No. 1, 2013
Cavalcanti et al.
163
40. McGahon,A. J.; Martin, S. M.; Bissonnette, R. P.; Mahboubi,A.;
Shi, Y.; Mogil, R. J.; Nishioka, W. K.; Green, D. R.; Methods
Cell Biol. 1995, 46, 153.
65. Boothman, D.A.; Schlegel, R.; Pardee,A. B.; Mutat. Res. 1988,
202, 393.
66. Boothman, D. A.; Greer, S.; Pardee, A. B.; Cancer Res. 1987,
47, 5361.
41. Sastre, J.; Pallardó, F. V.; Viña, J.; IUBMB Life 2000, 49, 427.
42. Martindale, J. L.; Holbrook, N. J.; J. Cell Physiol. 2002, 192, 1.
43. Buttke, T. M.; Sandstrom, P. A.; Immunol. Today 1994, 15, 7.
44. Slater, A. F.; Stefan, C.; Nobel, I.; Van den Dobbelsteen, D. J.;
Orrenius, S.; Toxicol. Lett. 1995, 82-83, 149.
67. Li, C. J.; Wang, C.; Pardee, A. B.; Cancer Res. 1995, 55,
3712.
68. Boorstein R. J.; Pardee,A. B.; Biochem. Biophys. Res. Commun.
1984, 118, 828.
45. Cadenas, E.; Biochem. Pharmacol. 1995, 49, 127.
46. Fourie, J.; Oleschuk, C. J.; Guziec, F.; Guziec, L.; Derek, J.;
Fiterman, D. J.; Monterrosa, C.; Begleiter, A.; Cancer
Chemother. Pharmacol. 2002, 49, 101.
69. Bentle, M. S.; Reinicke, K. E.; Bey, E. A.; Spitz, D. R.;
Boothman, D. A.; J. Biol. Chem. 2006, 281, 33684.
70. Neder, K.; Marton, L. J.; Liu, L. F.; Frydman, B.; Cell Mol.
Biol. 1998, 44, 465.
47. Devasagayam, T. P. A.; Steenken, S.; Obendorf, M. S. W.;
Schulz, W. A.; Sies, H.; Biochemistry 1991, 30, 6283.
48. Cavalcanti, B. C.; Nobre Jr., H.V.; Seleghim, M. H. R.; Berlinck,
R. G.; Cunha, G. M.; de Moraes, M. O.; Pessoa, C.; Chem.-Biol.
Interact. 2008, 174, 155.
71. Oliveira-Brett, A. M.; Goulart, M. O. F.; Abreu, F. C.;
Bioelectrochemistry 2002, 56, 53.
72. Sancar, A.; Lindsey-Boltz, L. A.; Unsal-Kacmaz, K.; Linn, S.;
Annu. Rev. Biochem. 2004, 73, 39.
73. Meira, L. B.; Burgis, N. E.; Samson, L. D.; Adv. Exp. Med. Biol.
2005, 570, 125.
49. Chau,Y. P.; Shiah, S. G.; Don, M. J.; Kuo, M. L.; Free Radical
Biol. Med. 1998, 24, 660.
74. Schwartz, T. R.; Kmiec, E. B.; Gene Ther. Mol. Biol. 2005, 9,
193.
50. Olive, P. L.; Durand, R. E.; Cytometry A 2005, 66, 1.
51. Cavalcanti, B. C.; Barros, F.W.A.; Cabral, I. O.; Ferreira, J. R. O.;
Magalhães, H. I. F.; Nobre Júnior, H.V. N.; da Silva Júnior, E. N.;
deAbreu, F. C.; Costa, C. O.; Goulart, M. O. F.; Moares, M. O.;
Pessoa, C.; Chem. Res. Toxicol. 2011, 24, 1560.
52. Frydman, B.; Marton, L. J.; Sun, J. S.; Neder, K.; Witiak, D. T.;
Liu,A.A.;Wang, H.; Mao,Y.;Wu, H.; Sanders, M. M.; Liu, L. F.;
Cancer Res. 1997, 57, 620.
75. Kumar, M. R. S.;Aithal, K.; Rao, B. N.; Udupa, N.; Rao, B. S.;
Toxicol. In Vitro 2009, 23, 242.
76. D’anneo, A.; Augello, G.; Santulli, A.; Giuliano, M.; Di Fiore,
R.; Messina, C.; Tesoriere, G.;Vento, R.; J. Cell Physiol. 2010,
222, 433.
77. Bamford, M.; Walkinshaw, G.; Brown, R.; Exp. Cell Res. 2000,
256, 1.
53. Krishnan, P.; Bastow, K. F.; Cancer Chemother. Pharmacol.
2001, 47, 187.
78. Fernandez-Luna, J. L.; Clin. Transl. Oncol. 2007, 9, 555.
79. Li, P.; Nijhawan, D.; Budihardjo, I.; Srinivasula, S. M.;
Ahmad, M.; Alnemri, E. S.; Wang, X.; Cell 1997, 91, 479.
80. Pisani, D. E.; Elliot, A. J.; Hinman, D. R.; Aaronson, L. M.;
Pardini, R. S.; Biochem. Pharmacol. 1986, 35, 3791.
81. Yu-Bin, J.; Zhong-Yuan, Q.; Xiang, Z.; Exp. Toxicol. Pathol.
2011, 63, 69.
54. Sperry, J.; Lorenzo-Castrillejo, I.; Brimble, M. A.; Machín, F.;
Bioorg. Med. Chem. 2009, 17, 7131.
55. Li, C. J.; Averboukh, L.; Pardee, A. B.; J. Biol. Chem. 1993,
268, 22463.
56. Boothman, D. A.; Trask, D. K.; Pardee, A. B.; Cancer Res.
1989, 49, 605.
82. Bolton, J. L.; Trush, M.A.; Penning, T. M.; Dryhurst, G.; Monks,
T. J.; Chem. Res. Toxicol. 2000, 13, 135.
57. Krishnan, P.; Bastow, K. F.; Biochem. Pharmacol. 2000, 60,
1367.
83. Miao, X. S.; Zhong, C.; Wang, Y.; Savage, R. E.; Yang, R. Y.;
Kizer, D.; Volckova, E.; Ashwell, M. A.; Chan, T. C.; Rapid
Commun. Mass Spectrom. 2009, 23, 12.
58. Reid, R. J. D.; Benedetti, P.; Bjornsti, M.A.; Biochim. Biophys.
Acta 1998, 1400, 289.
59. Rogojina, A. T.; Nitiss, J. L.; J. Biol. Chem. 2008, 283, 29239.
60. Cline, S. D.; Hanawalt, P. C.; DNA Repair 2006, 5, 611.
61. Wagner, M.; Price, G.; Rothstein, R.; Genetics 2006, 174, 555.
62. Nitiss, J. L.; Nitiss, K. C.; Rose, A.; Waltman, J. L.; J. Biol.
Chem. 2001, 276, 26708.
84. Zakharova, O. D.; Ovchinnikova, L. P.; Goryunov, L. I.;
Troshkova, N. M.; Shteingarts, V. D.; Nevinsky, G. A.; Eur. J.
Med. Chem. 2010, 45, 2321.
Submitted: November 5, 2012
63. Oakley, T. J.; Hickson, I. D.; DNA Repair 2002, 1, 175.
64. Nitiss, J. L.; Biochim. Biophys. Acta 1998, 1400, 63.
Published online: February 19, 2013