siRNAs with Thio-2ꢁ-O-methyluridine Modification
RNA Expression Analysis
909
Total RNA was harvested after 16 hours using the RNeasy pro-
cess from Qiagen according to the manufacturer’s protocol. Gene ex-
pression was determined via real time quantitative RT-PCR on the
ABI Prism 7900 system (Applied Biosystems, Foster City, CA, USA)
as described in the literature.[17–18] The following primer probe
set (Qiagen) was used: hu PTEN (Accession No. U92436.1), for-
ward primer 5ꢁ-AATGGCTAAGTGAAGATGACAATCAT, reverse primer
5ꢁ- TGCACATATCATTACACCAGTTCGT and FAM/TAMRA probe 5ꢁ-
TTGCAGCAATTCACTGTAAAGCTGGAAAGG. Total RNA for each well was
measured using RiboGreen (Molecular Probes), and these values were used
for sample-to-sample normalization.[19] IC50 values were calculated from the
linear regression analysis from the plot of the logarithmic value of siRNA
concentration versus percentage of untreated control.
REFERENCES
1. Fire, A.; Xu, S.; Montgomery, M.K.; Kostas, S.A.; Driver, S.E.; Mello, C.C. Potent and specific
interference by double-stranded RNA in Caenorhabditis elegans. Nature, 1998, 391, 806–811.
2. a) Elbashir, S.M.; Harborth, J.; Lendeckel, W.; Yalcin, A.; Weber, K.; Tuschl, T. Duplexes of 21-
nucleotide RNAs mediated RNA interference in cultured mammalian cells. Nature, 2001, 411,
494–498. b) Elbashir, S.M.; Lendeckel, W.; Tuschl, T. RNA interference is mediated by 21 and 22
nt RNAs. Genes Dev., 2001, 15, 188–200. c) Caplen, N.J.; Parrish, S.; Imani, F.; Fire, A.; Morgan, R.A.
Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate
systems. Proc. Natl. Acad. Sci. USA, 2001, 98, 9742–9747.
3. a) Corey, D.R. RNA learns from antisense. Nature Chem. Biol. 2007, 3, 8–11. b) Bumcrot, D.;
Manoharan, M.; Koteliansky, V.; Sah, D.W.Y. RNAi therapeutics: a potential class of pharmaceutical
drugs. Nature Chem. Biol. 2006, 2, 711–719.
4. a) Soutschek, J., Akinc, A., Bramlage, B., Charisse, K., Constien, R., Donoghue, M., Elbashir,
S., Geick, A., et al. Therapeutic silencing of an endogenous gene by systemic administration of
modified siRNAs. Nature 2004, 432, 173–178. b) Sorensen, D.R.; Leirdal, M.; Sioud, M. Gene
silencing by systemic delivery of synthetic siRNAs in adult mice. J. Mol. Biol. 2003, 327, 761–766.
c) Lee, N.S.; Dohjima, T.; Bauer, G.; Li, H.; Li, M.J.; Ehsani, A.; Salvaterra, P.; Rossi, J. Expression
of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nat. Biotechnol.
2002, 19, 500–505. d) Jacque, J.M.; Triques, K.; Stevenson, M. Modulation of HIV-1 replication
by RNA interference. Nature 2002, 418, 435–438. e) Novinc, C.D.; Murrray, M.F.; Dykxhoorn,
D.M.; Beresford, P.J.; Riess, J.; Lee, S.K.; Collman, R.G.; Lieberman, J.; Shankar, P.; Sharp, P. A.
siRNA-directed inhibition of HIV-1 infection. Nat. Med. 2002, 8, 681–686.
5. a) Manoharan, M. RNA interference and chemically modified small interfering RNAs. Curr. Opin.
Chem. Biol. 2004, 8, 570–579. b) Chiu, Y.L.; Rana, T.M. siRNA function in RNAi: A chemical
modification analysis. In RNA, 2003; 9, 1034–1048.
6. a) Allerson, C.R.; Sioufi, N., Jarres, R.; Prakash, T.P.; Naik, N.; Berdeja, A.; Wanders, L.; Griffey,
R.H.; et al. Fully 2ꢁ-modified oligonucleotide duplexes with improved in vitro potency and stability
compared to unmodified siRNA. J. Med. Chem. 2005, 48, 901–904. b) Prakash, T.P.; Allerson, C.R.;
Dande, P.; Vickers, T.A.; Sioufi, N.; Jarres, R.; Baker, B.F.; Swayze, E.E.; et al. Positional effect of
chemical modifications on siRNA activity in mammalian cells. Journal of Medicinal Chemistry 2005, 48,
4247–4253.
7. a) Testa, S.M.; Disney, M.D.; Turner, D.H.; Kierzek, R. Thermodynamics of RNA−RNA duplexes with
2- or 4-thiouridines: implications for antisense design and targeting a group I intron. Biochemistry
1999, 38, 16655–16662. b) Sierzputowska-Gracz, H.; Sochacka, E.; Malkiewicz, A.; Kuo, K.; Gehrke,
C.W.; Agris, P.F. Chemistry and structure of modified uridines in the anticodon, wobble position of