Synthesis and biological evaluation of 9Z-retinoic acid analogs having 2-substituted benzo[b]furan

Article abstract of DOI:10.1248/cpb.58.418

Palladium-catalyzed cross-coupling reactions of a 2-substituted 3-iodobenzo[b]furans and stannanyl ester afforded the stereoselective production of 9Z-retinoic acid ester analogs in good yields. These esters were then converted to the corresponding acids

Full text of DOI:10.1248/cpb.58.418

418
Notes
Chem. Pharm. Bull. 58(3) 418—422 (2010)
Vol. 58, No. 3
Synthesis and Biological Evaluation of 9Z-Retinoic Acid Analogs Having
2-Substituted Benzo[b]furan1)
a
a
b
b
,a
*
Takashi OKITSU, Daisuke NAKAZAWA, Kimie NAKAGAWA, Toshio OKANO, and Akimori WADA
a Department of Organic Chemistry for Life Science, Kobe Pharmaceutical University; and b Department of Hygienic
Sciences, Kobe Pharmaceutical University; 4–19–1 Motoyamakita-machi, Higashinada, Kobe 658–8558, Japan.
Received October 29, 2009; accepted December 21, 2009; published online December 25, 2009
Palladium-catalyzed cross-coupling reactions of a 2-substituted 3-iodobenzo[b]furans and stannanyl ester
afforded the stereoselective production of 9Z-retinoic acid ester analogs in good yields. These esters were then
converted to the corresponding acids via basic hydrolysis in excellent yields, and their biological activities were
evaluated. The analog changed the connected position of polyene side chain from 2-position to 3-position of
benzo[b]furan decreased the biological activities dramatically, and the introduction of various substituents at 2-
position afforded almost no effect on the activities.
Key words retinoid X receptor; 9Z-retinoic acid analog; transcriptional assay; coupling reaction; 2-substituted 3-iodobenzo-
furan
All-E-retinoic acid (ATRA: all-trans-retinoic acid) 1 and ene side chain but also by introduction of substituent, which
9Z-retinoic acid (9CRA: 9-cis-retinoic acid) 2 (Chart 1) are might cause the interaction with ligand-binding domain of
metabolites of vitamin A and these compounds are the well nuclear receptor, on the benzo[b]furan ring. Here we wish to
known ligand molecules of the retinoic acid receptors describe 9CRA analogs having the 2-substituted benzo[b]-
(RARa, b, g) and retinoid X receptors (RXRa, b, g), respec- furan 4 which were synthesized using a palladium-catalyzed
tively.2) These receptors are members of the nuclear receptor cross-coupling reaction. We also evaluated the biological ac-
superfamily and exhibit significant biological functions in- tivities of the new compounds.
cluding cell differentiation, cell proliferation, embryonic de-
Chemistry Very recently, we have reported the efficient
velopment etc. through gene transcription.3,4) Much effort has synthesis of 3-iodobenzo[b]furans by iodocyclization of 2-
been directed toward for the preparation of receptor-selective alkynyl-1-(1-ethoxyethoxy)benzenes.20) In addition, we have
retinoids in order not only to define the functions of each re- developed the cesium fluoride-promoted Stille coupling reac-
ceptor but also to develop therapeutic agents.5—12) We have tion of vinyl triflates with alkenylstannane having an electron
also studied the stereoselective synthesis13—16) and struc- withdrawing group.21) We adopted these methodologies for
ture–activity relationship of retinoid analogs.1,17—19) Recently, the preparation of the 9CRA analogs having a 2-substituted
we showed that the 9Z-retinoic acid analog 3, in which the benzo[b]furan 4. Treatment of 2-substituted 3-iodobenzofu-
cyclohexene ring and adjacent double bond in retinoic acid rans 6, derived from 2-alkynyl-1-(1-ethoxyethoxy)benzenes
(2) were replaced by 2-benzo[b]furan, had no biological ef- 5, with alkenylstannane 7 in the presence of cesium fluoride,
fects such as antiproliferative, differentiation-inducing, and copper iodide, and with tetrakis(triphenylphosphine)palla-
apoptosis-inducing activities in HL-60 cells. Rather, com- dium(0) (Pd(PPh3)4) as the catalyst in N,N-dimethylform-
pound 3 exhibited stronger transcriptional activity towards amide (DMF) afforded the coupled products 8 in good yield
RXR as compared to native 9CRA.18) It was speculated that without an isomerization of double bonds.21,22) The structure
the low biological activities of 3 were attributed to no inter- of 8 was confirmed on the basis of its spectral data.
action between the amino acid residues of RAR and the
For the preparation of ester 8a, without a substituent at the
lipophilic part (benzo[b]furan ring) of ligand molecule 3. We 2-position of benzo[b]furan, we pursued another pathway be-
are very interested in an influence towards the biological ac- cause no 3-iodobenzofuran 6a was obtained by iodocycliza-
tivities not only by changing the connected position of poly- tion of 5a. Thus, commercially available benzofuran-3(2H)-
one 9 was transformed into the enol triflate 1023) and was
used for the coupling reaction. The coupling reaction of 10
with the stannanyl ester 7 proceeded smoothly under the
above conditions to give the ester 8a in 56% yield. Basic hy-
drolysis of the esters 8 was achieved using potassium hy-
droxide (10%) to afford the corresponding acids 4 in good to
excellent yields (Chart 2). In both the coupling reaction and
basic hydrolysis, an isomerization of double bonds was not
observed at all and the structure of each compound was con-
firmed by its spectral data. The results of the coupling reac-
tions and basic hydrolysis are listed in Table 1.
Biological Activity Ligand molecules of the nuclear re-
ceptors act as transcriptional factors that bind to the corre-
sponding responsive elements in the promotion regions of
target genes. ATRA is the endogeneous low molecular
Chart 1. Structures of Retinoic Acids and Analogs
weight ligand that modulates the transcriptional activity by
© 2010 Pharmaceutical Society of Japan
∗ To whom correspondence should be addressed. e-mail: a-wada@kobepharma-u.ac.jp

March 2010
419
the RARs.24—26) On the contrary, 9CRA, the natural ligand of ited a comparable or even higher RARb/RARE mediated
RXRs, exhibits almost the same binding affinity to both gene expression than did ATRA, the natural ligand of RAR
RARs and RXRs and controls their transcriptional activi- (Fig. 1).
ties.27—29) Therefore, the analogs prepared here (having 9Z-
In the transcriptional activities of analogs toward a rat cel-
stererochemistry) were tested for potency of transcriptional lular retinoic acid-binding protein II (CRABPII) gene includ-
assays of both RAR and RXR. ing RXREs in transfected MG-63 cells, none of the analogs
It is well documented that the RARb subtype is essential exhibited higher transcriptional activity than 9CRA, the natu-
for the anti-proliferative effect exerted by retinoid, the levels ral ligand of RXR (Fig. 2). It is noteworthy that 4a, which
of RARb increased in tumors, and epigenetic silence of the differs from 3 in the position of attachment of the polyene
RARb gene has been demonstrated in breast cancer.30,31) side chain, was markedly less active compared to 3. In addi-
Thus, initially we assessed the transcriptional activity to- tion, introduction of a substituent at the 2-position of the
wards a human RARb gene promoter with three copies of benzo[b]furan ring decreased the transcriptional activity, and
retinoic acid responsive elements (RAREs) in transfected this remarkable effect was retained despite differences in the
MG-63 cells. None of the 9Z-analogs 4a—f at 10ꢀ6 M exhib- nature of the substituent (compounds 4b—f).
Similarly, all the new analogs showed low transcriptional
activity for human RXRa-GAL4 expressed in transfected
MG-63 cells (Fig. 3). Thus, all the 9Z-analogs 4a—f showed
weak activity to RXRa as compared to the native ligand
(9CRA), and among the analogs, non-substituted benzo[b]-
furan analog 4a exhibited the highest activity. This fact
strongly corroborated the result obtained in the transcrip-
tional assay of RXRE.
In summary, we have developed a novel method for the
Chart 2. Synthetic Route for Retinoic Acid Analogs Having a 2-Substi-
tuted Benzo[b]furan
Table 1. Yields of Reactions for the Synthesis of Retinoic Acid Analogs
Yield
(%)
Yield
(%)
Run
Substituent R
Product
Product
Fig. 1. Transcriptional Activity of ATRA, 9CRA, and Their Analogs to-
ward a Human RARa-RARE Expression Gene in Transfected MG-63 Cells
1
2
3
4
5
6
H
n-Pr
1-Cyclohexenyl
Ph
2-Thienyl
3-Thienyl
8a
8b
8c
8d
8e
8f
56
72
60
80
63
72
4a
4b
4c
4d
4e
4f
93
85
89
92
92
75
The cells were cotransfected with a luciferase reporter plasmid (pGVB2 vector) con-
taining a human RARa gene promoter including a RARE and a pRL-CMV vector as
an internal control. Luciferase activities induced by ATRA, 9CRA and the analogs in
MG-63 cells were quantified and are presented as fold increase in induction as com-
pared to the luciferase activity observed in the ethanol treated control cells, which is de-
fined as 1.0. Each result represents the mean of three experiments (values in column) at
10ꢀ6 M, and the vertical bars indicate the standard error of the mean, ∗∗∗ pꢁ0.001.
Fig. 2. Transcriptional Activity of ATRA, 9CRA, and Their Analogs toward a Rat CRBPII-RXRE Expression Gene in Transfected MG-63 Cells
The cells were cotransfected with a luciferase reporter plasmid (pGVB2 vector) containing a rat CRABPII gene promoter including a RXRE and a pRL-CMV vector as an inter-
nal control. Luciferase activities induced by ATRA, 9CRA and the analogs in MG-63 cells were quantified and are shown as the fold increase in induction as compared with lu-
ciferase activity observed in the ethanol treated control cells (defined as 1.0). Results represent the mean of three experiments (values in column) at 10ꢀ6 M, and the vertical bars in-
dicate the standard error of the mean, ∗∗ pꢁ0.01; ∗∗∗ pꢁ0.001.

420
Vol. 58, No. 3
mmol) and CsF (304 mg, 2.00 mmol) in 72% yield (244 mg) as pale yellow
oil. Eluent: hexane/AcOEtꢂ40/1.
1
IR nmax cmꢀ1: 3022, 2966, 2934, 2875, 1699, 1604; H-NMR (300 MHz)
d: 7.46—7.43 (1H, m), 7.39—7.36 (1H, m), 7.28—7.17 (2H, m), 6.49 (1H,
dd, Jꢂ15.0, 10.5 Hz), 6.39 (1H, dq, Jꢂ10.5, 1.2 Hz), 6.27 (1H, d,
Jꢂ15.0 Hz), 5.75 (1H, s), 4.15 (2H, q, Jꢂ7.2 Hz), 2.62 (2H, td, Jꢂ7.5,
3.3 Hz), 2.20 (3H, s), 2.09 (3H, d, Jꢂ0.9 Hz), 1.75 (2H, sext, Jꢂ7.5 Hz),
1.27 (3H, t, Jꢂ6.9 Hz), 0.93 (3H, t, Jꢂ7.5 Hz); 13C-NMR (75 MHz) d:
167.1, 154.9, 154.2, 152.6, 134.5, 134.1, 132.3, 129.6, 128.7, 123.5, 122.4,
119.8, 118.8, 115.7, 110.9, 59.6, 29.1, 24.8, 21.2, 14.3, 13.8, 13.7; HR-EI-
MS Calcd for C22H26O3 (Mꢃ); 338.1882. Found 338.1898.
Ethyl (2E,4E,6Z)-3-Methyl-7-(2-(cyclohexen-1-yl)benzo[b]furan-3-yl)-
2,4,6-octatrienoate (8c) This was prepared from 6c (210 mg, 0.649
mmol), 7 (396 mg, 0.844 mmol), Pd(PPh3)4 (75.1 mg, 64.9 mmol), CuI (24.8
mg, 130 mmol) and CsF (197 mg, 1.30 mmol) in 60% yield (145 mg) as a
pale yellow oil. Eluent: hexane/AcOEtꢂ40/1.
Fig. 3. Transcriptional Potency of ATRA, 9CRA, and Their Analogs in a
Human RXRa-GAL4 Expression Gene in Transfected MG-63 Cells
1
IR nmax cmꢀ1: 3026, 2984, 2939, 2861, 1701, 1604; H-NMR (300 MHz)
The cells were cotransfected with an expression plasmid (pM vector) inserted with a
human RXRa cDNA connected with GAL4-DNA binding domain, a luciferase re-
porter plasmid (pGVP2 vector) containing the GAL4-binding site, and a pRL-CMV
vector as an internal control. Results represent the mean of three experiments (values in
column) at 10ꢀ6 M and the vertical bars show the standard error of mean. The data are
expressed as fold increase in induction, and are expressed relative to the ethanol-treated
control, which is defined as 1.0. ∗∗∗ pꢁ0.001.
d: 7.44 (1H, d, Jꢂ7.8 Hz), 7.32 (1H, d, Jꢂ7.8 Hz), 7.25 (1H, td, Jꢂ7.8,
1.2 Hz), 7.18 (1H, dd, Jꢂ7.8, 1.2 Hz), 6.53—6.35 (3H, m), 6.37 (1H, d,
Jꢂ15.0 Hz), 5.73 (1H, s), 4.14 (2H, q, Jꢂ7.2 Hz), 2.39 (2H, br s), 2.22 (2H,
br s), 2.18 (3H, s), 2.05 (3H, d, Jꢂ1.2 Hz), 1.78—1.60 (4H, m), 1.26 (3H, t,
Jꢂ7.2 Hz); 13C-NMR (75 MHz) d: 167.1, 153.4, 152.8, 134.8, 134.5, 132.4,
130.2, 129.7, 129.5, 128.5, 124.1, 122.5, 119.8, 118.7, 114.3, 110.8, 77.2,
59.6, 25.8, 25.5, 24.4, 22.5, 21.9, 14.3, 13.7; HR-EI-MS Calcd for C25H28O3
(Mꢃ); 376.2038. Found 376.2055.
stereoselective synthesis of 9Z-retinoic acid analogs 4a—f
having 2-subustituted benzo[b]furan moieties, and found that
changing the site of the connecting position of the side chain
Ethyl (2E,4E,6Z)-3-Methyl-7-(2-phenylbenzo[b]furan-3-yl)-2,4,6-octa-
trienoate (8d) This was prepared from 6d (326 mg, 1.02 mmol), 7 (622
mg, 1.33 mmol), Pd(PPh3)4 (116 mg, 102 mmol), CuI (38.1 mg, 204 mmol)
decreased the transcriptional activity toward RXR. Further- and CsF (310 mg, 2.04 mmol) in 80% yield (301 mg) as a pale yellow oil.
Eluent: hexane/AcOEtꢂ40/1.
more, differences in the substituent at the 2-position of
benzo[b]furan had little effect on the biological activities.
IR nmax cmꢀ1: 3027, 2930, 2855, 1701, 1605; 1H-NMR (500 MHz) d:
7.83 (2H, d, Jꢂ8.0 Hz), 7.54 (1H, d, Jꢂ8.0 Hz), 7.42—7.38 (3H, m), 7.34—
Experimental
7.30 (2H, m), 7.24—7.21 (1H, m), 6.50—6.44 (2H, m), 6.26—6.22 (1H, m),
Melting points were determined on a Yanagimoto micro melting point ap- 5.70 (1H, s), 4.12 (2H, q, Jꢂ7.5 Hz), 2.19 (3H, s), 1.92 (3H, d, Jꢂ1.0 Hz),
paratus and are uncorrected. UV spectra were recorded on a JASCO Ubest- 1.25 (3H, t, Jꢂ7.5 Hz); 13C-NMR (125 MHz) d: 167.0, 154.0, 152.6, 150.4,
55 instrument in EtOH. IR spectra were recorded on a Perkin-Elmer FT-IR 135.1, 134.0, 132.1, 130.7, 130.6, 129.6, 128.7, 128.5, 126.5, 124.7, 122.9,
1
Paragon 1000 spectrometer in CHCl3. H-NMR spectra were obtained on a 120.2, 119.0, 116.1, 111.2, 59.6, 24.0, 14.3, 13.6; HR-EI-MS Calcd for
Varian Gemini-300 or a Varian VXR-500 superconducting FT-NMR spec- C25H24O3 (Mꢃ); 372.1725. Found 372.1721.
trometer with tetramethylsilane as an internal standard in CDCl3. 13C-NMR
Ethyl (2E,4E,6Z)-3-Methyl-7-(2-(2-thienyl)benzo[b]furan-3-yl)-2,4,6-
spectra were obtained on a Varian Gemini-300 (75 MHz) or a Varian VXR- octatrienoate (8e) This was prepared from 6e (303 mg, 0.930 mmol), 7
500 (125 MHz) superconducting FT-NMR spectrometer in CDCl3. Mass (567 mg, 1.21 mmol), Pd(PPh3)4 (108 mg, 93.0 mmol), CuI (35.4 mg,
spectra were determined on a Hitachi M-4100 instrument. Column chro-
matography was performed using Kanto Silica Gel 60 N (spherical, neutral). yellow oil. Eluent: hexane/AcOEtꢂ40/1.
All reactions were carried out under an argon atmosphere. Materials ob-
186 mmol) and CsF (283 mg, 1.86 mmol) in 63% yield (222 mg) as a pale
IR nmax cmꢀ1: 3026, 2938, 1700, 1605; 1H-NMR (300 MHz) d: 7.52 (1H,
tained from commercial suppliers were used without further purification. d, Jꢂ7.5 Hz), 7.45 (1H, dd, Jꢂ6.9, 1.2 Hz), 7.40—7.29 (3H, m), 7.24 (1H,
Standard workup means that the organic layers were finally washed with dd, Jꢂ7.5, 1.5 Hz), 7.07 (1H, dd, Jꢂ6.9, 5.1 Hz), 6.54—6.40 (2H, m), 6.28
brine, dried over anhydrous sodium sulfate (Na2SO4), filtered, and concen- (1H, d, Jꢂ14.1 Hz), 5.72 (1H, s), 4.12 (2H, q, Jꢂ6.9 Hz), 2.23 (3H, s), 1.95
trated in vacuo below 30 °C using a rotary evaporator.
(3H, s), 1.25 (3H, t, Jꢂ6.9 Hz); 13C-NMR (75 MHz) d: 167.0, 153.8, 152.5,
General Procedure for the Stille Coupling (8a—f) A mixture of the
135.5, 133.2, 131.9, 131.5, 129.4, 127.6, 126.6, 125.8, 124.8, 123.1, 120.0,
iodide (1.0 eq) 6 or triflate 1022) and the stannanyl ester 7 (1.3 eq) was dis- 119.1, 115.0, 111.1, 77.3, 59.6, 23.7, 14.3, 13.6; HR-EI-MS Calcd for
solved in dry DMF (0.1 M), then CsF (2.0 eq), Pd(PPh3)4 (10 mol%), and CuI
(20 mol%) was added. The flask was evacuated and refilled with argon five
times. The mixture was stirred at 40—45 °C for 12—15 h, cooled to room
C23H22O3S (Mꢃ); 378.1290. Found 378.1316.
Ethyl (2E,4E,6Z)-3-Methyl-7-(2-(3-thienyl)benzo[b]furan-3-yl)-2,4,6-
octatrienoate (8f) This was prepared from 6f (391 mg, 1.20 mmol), 7
temperature, and diluted with CH2Cl2 and water. After vigorous stirring, the (732 mg, 1.56 mmol), Pd(PPh3)4 (139 mg, 0.120 mmol), CuI (45.7 mg,
mixture was filtered through Celite with CH2Cl2/AcOEt (1 : 1). The organic 0.240 mmol) and CsF (365 mg, 2.40 mmol) in 72% yield (327 mg) as a pale
layer was separated, followed by standard workup. The residue was purified yellow oil. Eluent: hexane/AcOEtꢂ40/1.
by column chromatography using neutralized SiO2/powdered KF (9 : 1) to
1
IR nmax cmꢀ1: 3117, 3026, 2984, 2939, 1701, 1605; H-NMR (300 MHz)
give coupling product 8.
d: 7.71 (1H, dd, Jꢂ4.2, 1.2 Hz), 7.53—7.48 (2H, m), 7.39—7.29 (3H, m),
Ethyl (2E,4E,6Z)-3-Methyl-7-(benzo[b]furan-3-yl)-2,4,6-octatrienoate 7.25—7.20 (1H, m), 6.52—6.40 (2H, m), 6.25 (1H, d, Jꢂ14.1 Hz), 5.71
(8a) This was prepared from 10 (108 mg, 0.407 mmol), 7 (248 mg,
0.529 mmol), Pd(PPh3)4 (47.0 mg, 40.7 mmol), CuI (15.6 mg, 82.1 mmol) and
CsF (124 mg, 0.821 mmol) in 56% yield (67.5 mg) as a pale red oil. Eluent:
hexane/AcOEtꢂ30/1.
(1H, s), 4.12 (2H, q, Jꢂ7.2 Hz), 2.22 (3H, s), 1.92 (3H, d, Jꢂ0.9 Hz), 1.25
(3H, t, Jꢂ7.2 Hz); 13C-NMR (75 MHz) d: 167.0, 153.8, 152.5, 147.4, 135.2,
133.8, 132.0, 131.6, 130.8, 129.4, 126.1, 125.8, 124.6, 122.9, 120.0, 119.0,
114.9, 111.1, 77.3, 59.6, 24.1, 14.3, 13.6; HR-EI-MS Calcd for C23H22O3S
IR nmax cmꢀ1: 3684, 3619, 3487, 3019, 2980, 1698, 1601; 1H-NMR (Mꢃ); 378.1290. Found 378.1306.
(300 MHz) d: 7.54—7.51 (2H, m), 7.36—7.31 (1H, m), 7.31—7.23 (2H,
m), 6.80 (1H, dd, Jꢂ15.0, 10.8 Hz), 6.37 (1H, d, Jꢂ10.8 Hz), 6.28 (1H, d, (4a—f) A mixture of the ester (8, 1.0 eq) and 10% KOH (0.133 M) in
General Procedure for the Preparation of 9Z-Retinoic Acid Analogs
Jꢂ15.0 Hz), 5.76 (1H, s), 4.15 (2H, q, Jꢂ7.2 Hz), 2.26 (3H, s), 2.11 (3H, d,
ethanol (0.08 M) was heated at 50 °C for 2—3 h. After cooling, the reaction
Jꢂ1.2 Hz), 1.27 (3H, t, Jꢂ7.2 Hz); 13C-NMR (75 MHz) d: 167.1, 155.3, mixture was made acidic with 5% HCl, and the organic compounds were ex-
152.6, 142.7, 134.7, 132.5, 132.2, 128.9, 126.9, 124.6, 122.8, 121.1, 118.8, tracted with ethyl acetate followed by standard workup. The residue was pu-
111.7, 77.2, 59.7, 25.3, 14.3, 13.7; HR-EI-MS Calcd for C19H20O3 (Mꢃ); rified by flash column chromatography on silica gel to give the acid (4).
296.1412. Found 296.1408.
(2E,4E,6Z)-3-Methyl-7-(benzo[b]furan-3-yl)-2,4,6-octatrienoic Acid
Ethyl (2E,4E,6Z)-3-Methyl-7-(2-propylbenzo[b]furan-3-yl)-2,4,6-octa- (4a) This was prepared from 8a (63.0 mg, 0.213 mmol) in 93% yield
trienoate (8b) This was prepared from 6b (286 mg, 1.00 mmol), 7 (610 (53.2 mg) as yellow crystals. Eluent: hexane/AcOEtꢂ4/1.
mg, 1.30 mmol), Pd(PPh3)4 (116 mg, 0.100 mmol), CuI (38.1 mg, 0.200
mp 170—171 °C (hexane/AcOEt), IR nmax cmꢀ1: 3690, 2939, 1678, 1586,

March 2010
421
UV–vis lmax 308 (e 31200) nm; 1H-NMR (300 MHz) d: 7.61 (1H, s),
7.55—7.51 (2H, m), 7.34 (1H, ddd, Jꢂ7.8, 7.5, 1.8 Hz), 7.26 (1H, td, Jꢂ7.5,
1.2 Hz), 6.85 (1H, dd, Jꢂ15.3, 11.1 Hz), 6.39 (1H, d, Jꢂ11.1 Hz), 6.31 (1H,
d, Jꢂ15.3 Hz), 5.79 (1H, s), 2.27 (3H, s), 2.12 (3H, d, Jꢂ1.2 Hz); 13C-NMR
(75 MHz) d: 172.1, 155.2 (2C), 142.7, 134.5, 133.3, 133.1, 128.8, 126.8,
124.7, 122.8, 121.1, 121.0, 118.0, 111.7, 25.3, 13.9; HR-EI-MS Calcd for
C17H16O3 (Mꢃ); 268.1099. Found 268.1104.
GGGTAAAGTTCACCGAAAGTTCACTCG) or the RXRE from the rat
CRBPII promoter (639/605: GCTGTCACAGGTCACAGGTCACAGGT-
CACAGTTCA) in the pGL3 vector.8,9) The pRL-CMV vector was an inter-
nal control using the Tfx-50 reagent. After transfection, the cells were incu-
bated with retinoids (10ꢀ6 M) for 2 d. Luciferase activity of the cell lysates
was measured with a luciferase assay system (Toyo Ink Co., Ltd.), according
to the manufacturer’s instructions. Transactivation determined from the lu-
ciferase activity was standardized with respect to the luciferase activity of
the same cells measured with the Sea Pansy luciferase assay system as a
control (Toyo Ink Co., Ltd.). Each set of experiments was repeated at least
three times, and the results (meansꢅS.E.M.) are presented in terms of folds
in increase induction compared to the vehicle (ethanol)-treated control,
which is expressed as 1.0.
Transcriptonal Activity Assay of RXRa-GAL4 Human osteosarcoma
MG-63 cells, which are positive for RXR gene expression, were maintained
in Dulbecco’s modified Eagle medium (Gibco BRL) supplemented with 1%
penicillin, 1% streptomycin, and 10% dextran-coated charcoal-treated FCS
(Gibco BRL). The day before transfection, cells were seeded on six-well cul-
ture plates at a density of 2ꢄ105 cells per well so that they were confluent on
day of transfection. The cells were cotransfected with 1.0 mg of a one-hybrid
plasmid (pM vector) containing a human RXR cDNA connected with a
yeast GAL4-DNA binding domain cDNA, 0.5 mg of luciferase reporter plas-
mid (pGVP2 vector) containing GAL4-binding site and a pRL-CMV vector
as an internal control. Each set of experiments was repeated at least three
times using 10ꢀ6 M of the retinoid compound, and the results presented as
meansꢅS.E.M., represented the fold increase in induction.
(2E,4E,6Z)-3-Methyl-7-(2-propylbenzo[b]furan-3-yl)-2,4,6-octa-
trienoic Acid (4b) This was prepared from 8b (244 mg, 0.721 mmol) in
95% yield (213 mg) as yellow crystals. Eluent: hexane/AcOEtꢂ7/3.
mp 129—131 °C (hexane/AcOEt), IR nmax cmꢀ1: 3674, 3523, 3022, 2967,
1
2876, 1679, 1598, UV–vis lmax 299 (e 60900) nm; H-NMR (300 MHz) d:
7.46—7.43 (1H, m), 7.38—7.36 (1H, m), 7.28—7.17 (3H, m), 6.53 (1H, dd,
Jꢂ15.0, 10.8 Hz), 6.40 (1H, dd, Jꢂ10.8, 1.5 Hz), 6.29 (1H, d, Jꢂ15.0 Hz),
5.77 (1H, s), 2.61 (1H, t, Jꢂ7.5 Hz), 2.60 (1H, t, Jꢂ7.5 Hz), 2.20 (3H, s),
2.09 (3H, d, Jꢂ1.5 Hz), 1.75 (2H, sext, Jꢂ7.5 Hz), 0.93 (3H, t, Jꢂ7.5 Hz);
13C-NMR (75 MHz) d: 172.6, 155.2, 154.9, 154.2, 134.9, 134.3, 133.2,
129.5, 128.6, 123.6, 122.5, 119.8, 118.0, 115.6, 110.9, 29.1, 24.8, 21.2,
13.9, 13.8; HR-EI-MS Calcd for C20H22O3 (Mꢃ); 310.1569. Found
310.1568.
(2E,4E,6Z)-3-Methyl-7-(2-(cyclohexen-1-yl)benzo[b]furan-3-yl)-2,4,6-
octatrienoic Acid (4c) This was prepared from 8c (144 mg, 0.382 mmol)
in 89% yield (110 mg) as yellow crystals. Eluent: hexane/AcOEtꢂ7/3.
mp 161—163 °C (hexane/AcOEt), IR nmax cmꢀ1: 3677, 3523, 3022, 2967,
1
2876, 1679, 1598, UV–vis lmax 294 (e 55200) nm; H-NMR (300 MHz) d:
7.44 (1H, d, Jꢂ7.2 Hz), 7.33—7.18 (3H, m), 6.58—6.37 (3H, m), 6.27 (1H,
d, Jꢂ7.2 Hz), 5.75 (1H, s), 2.44—2.34 (2H, m), 2.28—2.21 (2H, m), 2.20
(3H, s), 2.06 (3H, s), 1.76—1.60 (4H, m); 13C-NMR (75 MHz) d: 172.1,
155.4, 153.4, 152.8, 135.7, 134.3, 133.3, 130.1, 129.8, 129.5, 128.5, 124.1,
122.5, 119.7, 117.8, 114.2, 110.8, 25.8, 25.5, 24.5, 22.5, 21.9, 13.9; HR-EI-
MS Calcd for C23H24O3 (Mꢃ); 348.1725. Found 348.1734.
Statistical Analysis Statistical significances were determined using
Dunnett’s test and are expressed as meansꢅS.E.M. The data were compared
to EtOH-treated control cells, and levels of significance were determined as
∗∗∗ pꢁ0.001 or ∗∗ pꢁ0.01.
Acknowledgment This work was supported in part by Grant-in-Aid for
Scientific Research (C) (A.W.) and for Young Scientist (B) (T.O.) from the
Ministry of Education, Culture, Sports, Science and Technology of Japan.
We thank the Science Research Promotion Fund of the Japan Private School
Promotion Foundation for research grants.
(2E,4E,6Z)-3-Methyl-7-(2-phenylbenzo[b]furan-3-yl)-2,4,6-octa-
trienoic Acid (4d) This was prepared from 8d (298 mg, 0.800 mmol) in
92% yield (253 mg) as yellow crystals. Eluent: hexane/AcOEtꢂ7/3.
mp 190—191 °C (hexane/AcOEt), IR nmax cmꢀ1: 3692, 3524, 3028, 1678,
1
1601, UV–vis lmax 301 (e 60100) nm; H-NMR (300 MHz) d: 7.84—7.81
(2H, m), 7.54 (1H, d, Jꢂ7.8 Hz), 7.44—7.30 (6H, m), 6.52—6.49 (2H, m),
6.31—6.24 (1H, m), 5.72 (1H, s), 2.20 (3H, s), 1.91 (3H, s); 13C-NMR
(75 MHz) d: 172.2, 155.1, 154.0, 150.4, 134.9, 134.8, 132.9, 130.6, 130.5,
129.5, 128.7, 128.5, 126.4, 124.8, 122.9, 120.2, 118.2, 116.0, 111.2, 24.1,
13.7; HR-EI-MS Calcd for C23H20O3 (Mꢃ); 344.1412. Found 344.1426.
(2E,4E,6Z)-3-Methyl-7-(2-(2-thienyl)benzo[b]furan-3-yl)-2,4,6-octa-
trienoic Acid (4e) This was prepared from 8e (212 mg, 0.561 mmol) in
92% yield (181 mg) as yellow crystals. Eluent: hexane/AcOEtꢂ7/3.
References
1) Wada A., Matsuura N., Mizuguchi Y., Nakagawa K., Ito M., Okano T.,
Bioorg. Med. Chem., 16, 8471—8481 (2008).
2) Mangelsdorf D. J., Umesono K., Evans R. M., “The Retinoids,” 2nd
ed., ed. by Sporn M. B., Roberts A. B., Goodman D. S., Raven Press,
New York, 1994, pp. 319—350.
3) Germain P., Chambon P., Eichele G., Evans R. M., Lazar M. A., Leid
M., de Lera Á. R., Lotan R., Mangelsdorf D. J., Gronemeyer H., Phar-
macol. Rev., 58, 712—725 (2006).
mp 189—190 °C (hexane/AcOEt), IR nmax cmꢀ1: 3692, 3527, 3024, 1679,
1
1602, UV–vis lmax 306 (e 49800) nm; H-NMR (300 MHz) d: 7.52 (1H, d,
4) Germain P., Chambon P., Eichele G., Evans R. M., Lazar M. A., Leid
M., de Lera Á. R., Lotan R., Mangelsdorf D. J., Gronemeyer H., Phar-
macol. Rev., 58, 760—772 (2006).
Jꢂ8.1 Hz), 7.44 (1H, dd, Jꢂ4.2, 1.2 Hz), 7.39—7.34 (2H, m), 7.31 (1H, dd,
Jꢂ8.1, 1.2 Hz), 7.21 (1H, d, Jꢂ8.1 Hz), 7.07 (1H, dd, Jꢂ5.1, 4.2 Hz),
6.54—6.44 (2H, m), 6.30 (1H, d, Jꢂ14.4 Hz), 5.73 (1H, s), 2.23 (3H, s),
1.95 (3H, s); 13C-NMR (75 MHz) d: 172.2, 155.2, 153.8, 146.3, 135.2,
134.0, 132.8, 132.1, 131.4, 129.3, 127.6, 126.6, 125.9, 124.8, 123.1, 120.0,
118.2, 114.9, 111.1, 23.7, 13.8; HR-EI-MS Calcd for C21H18O3S (Mꢃ);
350.0977. Found 350.0990.
(2E,4E,6Z)-3-Methyl-7-(2-(3-thienyl)benzo[b]furan-3-yl)-2,4,6-octa-
trienoic Acid (4f) This was prepared from 8f (303 mg, 0.800 mmol) in
75% yield (210 mg) as yellow crystals. Eluent: hexane/AcOEtꢂ7/3.
mp 190—192 °C (hexane/AcOEt), IR nmax cmꢀ1: 3692, 3524, 3026, 1678,
1600, UV–vis lmax 299 (e 45000) nm; 1H-NMR (300 MHz) d: 7.71 (1H, dd,
Jꢂ3.0, 1.2 Hz), 7.52 (1H, d, Jꢂ8.1 Hz), 7.48 (1H, dd, Jꢂ8.1, 1.2 Hz),
7.40—7.20 (4H, m), 6.51—6.44 (2H, m), 6.32—6.25 (1H, m), 5.73 (1H, s),
2.23 (3H, s), 1.92 (3H, s); 13C-NMR (75 MHz) d: 171.8, 155.2, 153.8,
147.5, 135.0, 134.7, 132.9, 131.6, 130.7, 129.3, 126.1, 125.8, 124.6, 123.0,
120.0, 118.1, 114.9, 111.1, 24.1, 13.8; HR-EI-MS Calcd for C21H18O3S
(Mꢃ); 350.0977. Found 350.1000.
Transcriptional Activity Assay of RARE and RXRE Human os-
teosarcoma MG-63 cells, which are positive for RXR gene expression, were
maintained in Dulbecco’s modified Eagle medium (Gibco BRL) supple-
mented with 1% penicillin, 1% streptomycin, and 10% dextran-coated char-
coal-treated FCS (Gibco BRL). The day before transfection, cells were
seeded on six-well culture plates at a density of 2ꢄ105 cells per well so
that they were confluent on day of transfection. The retinoid-responsive
luciferase reporter constructs human RARb-RARE3-SV40-Luc and rat
CRBPII-RXRE-SV40-Luc were generated by cloning three copies of the
retinoic acid response element (RARE) from the RARb promoter (59/33:
5) Morishita K., Yakushiji N., Ohsawa F., Takamatsu K., Matsuura N.,
Makishima M., Kawahata M., Yamaguchi K., Tai A., Sasaki K.,
Kakuta H., Bioorg. Med. Chem. Lett., 19, 1001—1003 (2009).
6) Charton J., Deprez-Poulain R., Hennuyer N., Tailleux A., Staels B.,
Deprez B., Bioorg. Med. Chem. Lett., 19, 489—492 (2009).
7) García J., Khanwalkar H., Pereira R., Erb C., Voegel J. J., Collete P.,
Mauvais P., Bourguet W., Gronemeyer H., de Lera Á. R., Chem-
BioChem, 10, 1252—1259 (2009).
8) Álvarez S., Pazos-Randulfe Y., Khanwalkar H., Germain P., Álvarez
R., Gronemeyer H., de Lera Á. R., Bioorg. Med. Chem., 16, 9719—
9728 (2008).
9) Sakaki J., Konishi K., Kishida M., Gunji H., Kanazawa T., Uchiyama
H., Fukaya H., Mitani H., Kimura M., Bioorg. Med. Chem. Lett., 17,
4808—4811 (2007).
10) Sun W., Desai S., Piao H., Carroll P., Canney D. J., Heterocycles, 71,
557—567 (2007).
11) Walker J. R., Alshafie G., Nieves N., Ahrens J., Clagett-Dame M.,
Abou-Issa H., Curley R. W. Jr., Bioorg. Med. Chem., 14, 3038—3048
(2006).
12) Ikegami S., Iimori T., Sudo M., Kitsukawa M., Foroumadi A., Yone-
mura T., Takahashi H., Kizaki K., Ishii H., Bioorg. Med. Chem., 14,
5099—5109 (2006).
13) Wada A., Wang F., Ito M., Chem. Pharm. Bull., 56, 112—114 (2007).
14) Wada A., Ieki Y., Nakamura S., Ito M., Synthesis, 2005, 1581—1588
(2005).

422
Vol. 58, No. 3
15) Wada A., Babu G., Shimomoto S., Ito M., Synlett, 2001, 1759—1762
24) Petkiovich M., Brand N. J., Krust A., Chambon P., Nature (London),
330, 444—450 (1987).
(2001).
16) Wada A., Fujioka N., Tanaka Y., Ito M., J. Org. Chem., 65, 2438—
25) Giguere V., Ong E. S., Segui P., Evans R. M., Nature (London), 330,
624—629 (1987).
2443 (2000).
17) Wada A., Mizuguchi Y., Miyake H., Niihara M., Ito M., Nakagawa K., 26) Krust A., Kastner P., Petkiovich M., Zelent A., Chambon P., Proc.
Okano T., Lett. Drug Des. Discov., 4, 442—445 (2007). Natl. Acad. Sci. U.S.A., 86, 5310—5314 (1989).
18) Wada A., Mizuguchi Y., Shinmen M., Ito M., Nakagawa K., Okano T., 27) Heyman R. A., Mangelsdorf D. J., Dyck J. A., Stein R. B., Eichele G.,
Lett. Drug Des. Discov., 3, 118—122 (2006). Evans R. M., Thaller C., Cell, 68, 397—406 (1992).
19) Wada A., Fukunaga K., Ito M., Mizuguchi Y., Nakagawa K., Okano T., 28) Levin A. A., Sturzenbecker L. J., Kazmer S., Bosakowski T., Huselton
Bioorg. Med. Chem., 12, 3931—3942 (2004).
20) Okitsu T., Nakazawa D., Taniguchi R., Wada A., Org. Lett., 10,
4967—4970 (2008).
21) Okitsu T., Iwatsuka K., Wada A., Chem. Commun., 2008, 6330—6332
(2008).
C., Allenby G., Speck J., Kratzeisen C., Rosenberger M., Lovey A.,
Grippo J. F., Nature (London), 355, 359—361 (1992).
29) Allenby G., Bocquel M. T., Sanders M., Kazmer S., Speck J., Rosen-
berger M., Lovey A., Kastner P., Grippo J. F., Chambon P., Levin A.
A., Proc. Natl. Acad. Sci. U.S.A., 90, 30—34 (1993).
22) Mee S. P. H., Lee V., Baldwin J. E., Chem. Eur. J., 11, 3294—3308 30) Alvarez S., Germain P., Alvarez R., Rodríguez-Barrios F., Gronemeyer
(2005). H., de Lera A. R. Int. J. Biochem. Cell Biol., 39, 1406—1415 (2007).
23) Morice C., Garrido F., Mann A., Suffert J., Synlett, 2002, 501—503 31) Sirchia S. M., Ren M., Pili R., Sironi E., Somenzi G., Ghidoni R.,
(2002). Toma S., Nicolò G., Sacchi N., Cancer Res., 62, 2455—2461 (2002).