β-D-Galactosidase from Paenibacillus thiaminolyticus catalyzing transfucosylation reactions

Article abstract of DOI:10.1093/glycob/cwp196

A genomic library of bacterial strain Paenibacillus thiaminolyticus was constructed and the plasmid DNA of the clone, containing the gene encoding β-D-galactosidase with β-D-fucosidase activity, detected by 5-bromo-4-chloro-3-indoxyl β-D-galactopyranoside, was sequenced. Cells of Escherichia coli BL21 (DE3) were used for production of the enzyme in the form of a histidine-tagged protein. This recombinant fusion protein was purified using Ni-NTA agarose affinity chromatography and characterized by using p-nitrophenyl β-D-fucopyranoside (K_m value of 1.18 ± 0.06 mmol/L), p-nitrophenyl β-D-galactopyranoside (K_m value of 250 ± 40 mmol/L), p-nitrophenyl β-D-glucopyranoside (K_m value of 77 ± 6 mmol/L), and lactose (K_m value of 206 ± 5 mmol/L) as substrates. Optimal pH and temperature were estimated as 5.5 and 65°C, respectively. According to the amino acid sequence, the molecular weight of the fusion protein was calculated to be 68.6 kDa and gel filtration chromatography confirmed the presence of the enzyme in a monomeric form. In the following step, its ability to catalyze transfucosylation reactions was tested. The enzyme was able to catalyze the transfer of fucosyl moiety to different p-nitrophenyl glycopyranosides (producing p-nitrophenyl β-D-fucopyranosyl-(1,3)-β-D-fucopyranoside, p-nitrophenyl β-D-fucopyranosyl-(1,3)-α-D-glucopyranoside, p-nitrophenyl β-D-fucopyranosyl-(1,3)-α-D-mannopyranoside, and p-nitrophenyl β-D-fucopyranosyl-(1,6)-α-D-galactopyranoside) and alcohols (producing methyl β-D-fucopyranoside, ethyl β-D-fucopyranoside, 1-propyl β-D-fucopyranoside, 2-propyl β-D-fucopyranoside, 1-octyl β-D-fucopyranoside, and 2-octyl β-D-fucopyranoside). These results indicate the possibility of utilizing this enzyme as a promising tool for enzymatic synthesis of β-D-fucosylated molecules. The Author 2009. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org.

Full text of DOI:10.1093/glycob/cwp196

Glycobiology, vol. 20 no. 4 pp. 442–451, 2010
doi:10.1093/glycob/cwp196
Advance Access publication on December 14, 2009
β-D-Galactosidase from Paenibacillus thiaminolyticus catalyzing transfucosylation
reactions
Eva Benesˇova´1,2, Petra Lipovova´2, Hana Dvorˇa´kova´3, and
Blanka Kra´lova´2
2Department of Biochemistry and Microbiology; and 3Laboratory of NMR
spectroscopy, ICT Prague, Prague, 166 28, Czech Republic
they act as specific recognition markers or protein function mod-
ulators. The attachment of an oligosaccharidic chain may also
affect the stability, solubility, conformation states, or protease
resistance of biologically active molecules. Abnormal types of
glycosylations were observed during different pathological pro-
cesses, cancer being one of the most serious ones (Varki 1993;
Dwek 1996). The diversity of the oligosaccharides functions and
also different types of glycoconjugates is a challenge to modern
biochemistry in an attempt to find new ways of synthesizing a
broad spectrum of new glycosides and to test their biological
activities as well as their pharmaceutical or biotechnological
potential.
The approach of using enzymatic synthesis of oligosaccha-
rides and glycoconjugates is, at present, often preferred to the
time-consuming and complicated multistep chemical synthesis.
Two types of enzymes are usually used for the catalysis of gly-
cosidic linkage formation in oligosaccharidic chains of glyco-
sylated molecules—glycosyltransferases and glycosidases. Al-
though in the case of the former group of enzymes the transfer
of the glycosyl moiety is a result of their natural function, very
often glycosidases, which under normal conditions catalyze the
hydrolysis of the glycosidic bond, are preferred. The advantage
of glycosidases application issues from the good availability of
these enzymes, their stereospecificity and ability to glycosy-
late a wide variety of a hydroxyl group containing molecules
and the usage of relatively simple and cheap donor molecules
(Crout and Vic 1998; Kˇren and Thiem 1997; Watt et al. 1997).
In some cases lower yields and regioselectivity may compli-
cate the work; however, these problems may be overcome by
a careful choice of used glycosidase and reaction conditions
(concentration of reactants, use of organic solvents, etc.) or by
genetic manipulation enabling the production of glycosynthases
from corresponding glycosidases (Kˇren and Thiem 1997; Palcic
1999).
β-D-Galactosidases (β-D-galactoside galactohydrolases, EC
3.2.1.23) are enzymes which have been for many years ap-
plied in biotechnological processes for different purposes. Their
hydrolytic activity is useful in the processing of different lac-
tose containing products of food industry, e.g. in the produc-
tion of lactose-free milk for people suffering from lactose
intolerance. Their ability to catalyze transgalactosylation reac-
tions enables the production of galactooligosaccharides, benefi-
cially affecting intestinal microflora or galactosylated molecules
with the potential for pharmaceutical industry. Some of these
widespread enzymes, present in animals, plants, and a wide
variety of microorganisms (Panesar et al. 2006), are known
to often display not only β-D-galactosidase activity, but also
the β-D-fucosidase, β-D-glucosidase, or α-L-arabinosidase ac-
tivity (Chang et al. 2009). This broad substrate specificity of
some β-D-galactosidases together with the ability to transfer
diverse monosaccharidic residues to different saccharidic or
Received on July 29, 2009; revised on November 17, 2009; accepted on
December 9, 2009
A genomic library of bacterial strain Paenibacillus thi-
aminolyticus was constructed and the plasmid DNA of the
clone, containing the gene encoding β-D-galactosidase with
β-D-fucosidase activity, detected by 5-bromo-4-chloro-3-
indoxyl β-D-galactopyranoside, was sequenced. Cells of
Escherichia coli BL21 (DE3) were used for production of
the enzyme in the form of a histidine-tagged protein. This
recombinant fusion protein was purified using Ni-NTA
agarose affinity chromatography and characterized by us-
ing p-nitrophenyl β-D-fucopyranoside (Km value of 1.18
0.06 mmol/L),
(Km value of 250
p-nitrophenyl β-D-galactopyranoside
40 mmol/L), p-nitrophenyl β-D-
glucopyranoside (Km value of 77 6 mmol/L), and lactose
(Km value of 206 5 mmol/L) as substrates. Optimal pH
and temperature were estimated as 5.5 and 65◦C, respec-
tively. According to the amino acid sequence, the molecular
weight of the fusion protein was calculated to be 68.6 kDa
and gel filtration chromatography confirmed the presence
of the enzyme in a monomeric form. In the following
step, its ability to catalyze transfucosylation reactions was
tested. The enzyme was able to catalyze the transfer of
fucosyl moiety to different p-nitrophenyl glycopyranosides
(producing p-nitrophenyl β-D-fucopyranosyl-(1,3)-β-D-
fucopyranoside, p-nitrophenyl β-D-fucopyranosyl-(1,3)-
α-D-glucopyranoside, p-nitrophenyl β-D-fucopyranosyl-
(1,3)-α-D-mannopyranoside, and p-nitrophenyl β-D-
fucopyranosyl-(1,6)-α-D-galactopyranoside) and alcohols
(producing methyl β-D-fucopyranoside, ethyl β-D-
fucopyranoside, 1-propyl β-D-fucopyranoside, 2-propyl
β-D-fucopyranoside, 1-octyl β-D-fucopyranoside, and 2-octyl
β-D-fucopyranoside). These results indicate the possibility
of utilizing this enzyme as a promising tool for enzymatic
synthesis of β-D-fucosylated molecules.
Keywords: β-D-fucosidase/β-D-galactosidase/Paenibacillus
thiaminolyticus/transglycosylation
Introduction
In living organisms oligosaccharidic structures are involved in
many biologically important processes in which, among others,
1To whom correspondence should be addressed: Tel: +420-220-443-028; Fax:
+420-220-445-167; e-mail: Eva.Benesova@vscht.cz
ꢀc
442
The Author 2009. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

Transfucosylation activity of Paenibacillus thiaminolyticus
Table I. β-D-Galactosidases exhibiting more than 50% identity with the amino
acid sequence of β-D-galactosidase from P. thiaminolyticus
nonsaccharidic acceptors enables these enzymes to become
promising synthetic tools. The possibility of using recom-
binant β-D-galactosidase from bacterial strain Paenibacillus
thiaminolyticus (P. thiaminolyticus) for the synthesis of β-D-
fucosylated molecules is reported in this paper. In previous pub-
lications, these compounds have been reported to display differ-
ent biotechnologically interesting features. Alkyl fucosides were
confirmed to be surface-active molecules and thus applicable as
non-ionic surfactants (Kobayashi et al. 1999), some β-D-fucosyl
group containing disaccharides (fucosylglucose and fucosylxy-
lose) were reported as possible Bifidus factors (Sakai et al. 1989;
Nunoura et al. 1996). Another field of investigation of β-D-
fucosylated compounds is the synthesis of molecules with a
reputed pharmacological potential, such as asterosaponins with
antitumor and antiviral activities (Li et al. 1998).
Identity (%) with
Source of β-D-galactosidase
β-D-galactosidase
(EMBL Database accesion number)
from P. thiaminolyticus
Paenibacillus sp. JDR-2 (EDS51475)
Geobacillus sp. Y412MC10 (EDV73651)
Geobacillus sp. Y412MC10 (EDV79034)
Paenibacillus sp. JDR-2 (EDS54839)
Bacillus circulans (BAA21669)
60
59
58
57
53
52
Catenulispora acidiphila DSM 44928 (EEN34964)
The results were obtained using program WU-BLAST2.
Plasmid Midiprep kit and used as a template for sequencing
carried out by the Geneart company, Germany. After the com-
parison of the determined sequence with NCBI database us-
ing program WU-BLAST2, an open reading frame was found
with a 60% identity with the gene of β-D-galactosidase from
Paenibacillus JDR-2. The summary of β-D-galactosidases ex-
hibiting more than 50% identity with the amino acid sequence
of β-D-galactosidase from P. thiaminolyticus is presented in Ta-
ble I. The complete nucleotide sequence of the gene encoding
β-D-galactosidase from P. thiaminolyticus is available in EMBL
Nucleotide Sequence Database with accession no. FN397629.
For production of the recombinant protein, plasmid pET16b
enabling the production of histidine-tagged recombinant pro-
teins was chosen. The vector was ligated to the polymerase
chain reaction (PCR) product containing β-D-galactosidase en-
coding sequence and the correctness of the prepared construct
(named pET16b-βgal-2M) was confirmed by sequencing.
An expression and purification of a recombinant β-D-
galactosidase originating from P. thiaminolyticus and the char-
acterization of its β-D-fucosidase, β-D-galactosidase, and β-D-
glucosidase activity is described in this paper. Moreover, its
ability to catalyze the transfucosylation reaction using differ-
ent p-nitrophenyl glycopyranosides and alcohols as acceptors
is reported. According to the obtained results β-D-galactosidase
with β-D-fucosidase activity from P. thiaminolyticus seems to
be a promising tool for the synthesis of different types of β-D-
fucosylated molecules with a potential importance in biotech-
nology and pharmaceutical industry.
Results
Hypothesis of β-D-fucosidase activity of the β-D-galactosidase
from P. thiaminolyticus confirmation
β-D-Fucosidase activity of the whole cells of P. thiaminolyti-
cus was tested using the chromogenic substrate p-nitrophenyl
β-D-fucopyranoside (pNPβ-D-Fuc). It was supposed to be pos-
sibly the second activity of enzyme β-D-galactosidase. This
theory was supported by the results obtained from the na-
tive polyacrylamide gel electrophoresis (PAGE) of the cell
lysate stained simultaneouslywith pNPβ-D-Fuc or o-nitrophenyl
β-D-galactopyranoside (oNPβ-D-Gal) or 5-bromo-4-chloro-3-
indolyl β-D-galactopyranoside (X-gal). The colored (yellow or
blue) bands, indicating the position of the enzyme with the abil-
ity to cleave the appropriate chromogenic substrate, appeared in
the same positions in the individual lines (data not shown). On
the basis of these results, the use of X-gal for screening of ge-
nomic library of P. thiaminolyticus and thus for the detection of
the positive colony, containing plasmid deoxyribonucleic acid
(DNA) with the gene of an enzyme possessing β-D-fucosidase
activity, was possible.
Expression and purification of recombinant β-D-galactosidase
The recombinant enzyme was expressed in cells E. coli BL21
(DE3) and purified after the disintegration process using affinity
chromatography on the Ni-NTA agarose column. The processes
of expression, disintegration, and purification were analyzed
by sodium dodecyl sulfate (SDS)–PAGE electrophoresis un-
der denaturating conditions (Figure 1). Only one single band
was observed after the purification process (using Coomassie
Brilliant Blue for visualization), corresponding to the calculated
molecular mass of 68.6 kDa. The supposed molecular weight
was calculated from the amino acid sequence of the histidine-
tagged fusion protein using a program ProtParam tool on the
ExPASy Proteomics server. (Gel filtration chromatography was
used to determine the native form of the enzyme and the results
indicated the presence of the enzyme only in the monomeric
form (data not shown).)
After purification the enzyme preparates were used for bio-
chemical characterization of the recombinant β-D-galactosidase
and subsequently for transfucosylation reactions.
Detection, sequencing, and homology determination of the
gene encoding β-D-galactosidase from P. thiaminolyticus
The genomic library of P. thiaminolyticus was constructed
in cells Escherichia coli (E. coli) DH5α using plasmid
pUC19ꢀlacZ. The advantage of detection of positive colonies
with β-D-galactosidase activity directly on ampicillin contain-
ing Luria–Bertani medium (LBA) plates with X-gal was taken,
because the absence of lacZ does not allow the expression of
active β-D-galactosidase of E. coli. Plasmid DNA from the pos-
itive colony containing active β-D-galactosidase (indicated by
the blue color of the colony) was isolated by Gen EluteTM HP
Characterization of β-D-fucosidase, β-D-galactosidase, and
β-D-glucosidase activity of recombinant β-D-galactosidase
As mentioned above, β-D-galactosidase from P. thiaminolyticus
was supposed to possess not only the β-D-galactosidase but
also β-D-fucosidase activity, which was, alongside the possible
ability to catalyze transfucosylation reactions, the central point
of this study. In addition to these two activities the ability of
443

E Benesˇova´ et al.
was stored at – 20◦C and its activity did not decrease below 90%
of its original activity.
Transfucosylation reactions using p-nitrophenyl
glycopyranosides and alcohols as acceptors
The ability of recombinant β-D-galactosidase to catalyze trans-
fucosylation reactions was tested for two different types of ac-
ceptor molecules, p-nitrophenyl glycopyranosides and alcohols.
The possibility of transferring the fucosyl moiety from pNPβ-D-
Fuc to different saccharidic molecule parts and hydroxyl groups
of alcohols, the regiospecificity of the enzyme and influence
of length of alcohol alkyl chains as well as hydroxyl groups
positions were monitored.
For experiments with p-nitrophenyl glycopyranosides, serv-
ing as acceptors, three molecules that the enzyme was not able
to cleave were chosen: p-nitrophenyl α-D-galactopyranoside
(pNPα-D-Gal), p-nitrophenyl α-D-glucopyranoside (pNPα-D-
Glc), and p-nitrophenyl α-D-mannopyranoside (pNPα-D-Man).
In addition to these molecules also the possibility of transfer-
ring fucosyl moiety to pNPβ-D-Fuc was determined. During
transglycosylation experiments, p-nitrophenyl β-D-glucuronide
(pNPα-D-GlcA) was also tested as a potential acceptor molecule,
but in the presence of this substrate in the reaction mixture, the
β-D-fucosidase activity of the enzyme was completely inhibited.
Other tested molecules (pNPβ-D-Gal, oNPβ-D-Gal, and pNPβ-
D-Glc) were cleaved by the enzyme and thus are unsuitable for
intended purposes.
In transglycosylation reactions containing alcohols as accep-
tors, methanol and ethanol were chosen as the simplest alcohol
molecules, 1-propanol and 2-propanol as an example of the
shortest alcohols differing in the position of the hydroxyl group,
and 1- and 2-octanol represented alcohols with a longer alkyl
chain.
Fig. 1. SDS–PAGE analysis of the expression and purification of the
recombinant β-D-galactosidase from P. thiaminolyticus produced in E. coli
BL21 (DE3). Electrophoresis was carried out in 10% polyacrylamide gel and
proteins were visualized with Coomassie Brilliant Blue R-250. Lines 1 and
11 – SDS–PAGE Molecular Weight Standards, Broad Range, line 2 – cells
E. coli BL21 (DE3) before induction of expression, line 3 – cells E. coli BL21
(DE3) 4 h after induction of expression by IPTG, line 4 – supernatant after
disintegration of cells after expression, line 5 – fraction of supernatant
proteins, which did not bind to the Ni-NTA agarose column after the
application of the supernatant sample, line 6 – Ni-NTA agarose after
application of the supernatant sample, line 7 – fraction after wash of the
Ni-NTA agarose column with the 50 mM phosphate buffer (pH 7.5) with
150 mM KCl containing 10 mM imidazole, line 8 – fraction after wash of the
Ni-NTA agarose column with the 50 mM phosphate buffer (pH 7.5) with
150 mM KCl containing 40 mM imidazole, line 9 – Ni-NTA agarose after
wash with the 50 mM phosphate buffer (pH 7.5) with 150 mM KCl containing
40 mM imidazole, line 10 – recombinant β-D-galactosidase from
P. thiaminolyticus eluted by the 50 mM phosphate buffer (pH 7.5) with
150 mM KCl containing 250 mM imidazole.
the enzyme to cleave the chromogenic substrate, containing the
β-D-glucopyranoside moiety, was also tested.
Four different substrates (pNPβ-D-Fuc, p-nitrophenyl
β-D-galactopyranoside (pNPβ-D-Gal), p-nitrophenyl β-D-
glucopyranoside (pNPβ-D-Glc), and lactose) were used for the
basic characterization. The Km values and average specific ac-
tivities of the purified samples were measured as (1.18 0.06)
All transglycosylation reactions were carried out at 50◦C.
This temperature was chosen as a compromise between the
high activity and good stability of the enzyme (activity of the
enzyme did not decrease below 70% of the original activity
after 4 h incubation at 50◦C) and relatively good solubility of
chromogenic substrates in a 50 mM phosphate buffer (pH 6).
Thin-layer chromatography (TLC) in the mobile phase ethy-
lacetate:acetic acid:water (7:2:2, v/v/v) was used for the first
determination of transglycosylation products. The results for p-
nitrophenyl glycopyranosides used as acceptors are presented in
Figure 2, and for alcohols in Figure 3. These results confirmed
the ability of the enzyme to transfer the fucosyl residue to all
chosen acceptor molecules.
The main transglycosylation products of reactions with
pNPα-D-Gal, pNPα-D-Glc, pNPα-D-Man, and pNPβ-D-Fuc
were isolated by extraction from the TLC plates to methanol
and prepared for mass spectrometry and nuclear magnetic res-
onance (NMR) analysis, so as to solve the question of the re-
giospecificity of the enzyme. Both methods confirmed the pres-
ence of the supposed transglycosylation products. The standard
NMR experiments (1H, 13C, COSY, HMQC, HMBC, NOE,
and TOCSY) enabled the assignment of all proton and carbon
resonances. The type of glycosidic linkage was based on the
1H-13C HMBC experiment, possessing two and three bond 1H-
13C correlations. Thus, the key HMBC contacts establishing the
(1ꢁ→ 3) glycosidic linkage for products obtained by fucosyla-
tion of pNPβ-D-Fuc, pNPα-D-Glc, and pNPα-D-Man are cross
mmol/L and 1.7 μmol/min/mg for pNPβ-D-Fuc, (250
mmol/L and 270 μmol/min/mg for pNPβ-D-Gal, (77
40)
6)
mmol/L and 0.1 μmol/min/mg for pNPβ-D-Glc, and (206
5) mmol/L and 0.9 μmol/min/mg for the lactose (37◦C, 50 mM
phosphate buffer (pH 6)).
At this stage it is necessary to point out complications aris-
ing when using in experiments the pNPβ-D-Gal as a substrate.
Considering the high Km value and relatively low solubility of
pNPβ-D-Gal in the buffer system, it was not possible to mea-
sure the whole scale of substrate concentrations necessary to
approach the maximal reaction rate; therefore, the accuracy of
the result decreased. Because of a strong influence of the sol-
vents on the enzyme activity, it was not possible to measure the
dependence of the enzyme activity on the pNPβ-D-Gal concen-
tration in organic solvents (e.g. dimethylformamide (DMF)),
which would increase the solubility of the substrate.
The temperature profile exhibited its optimum at 65◦C and the
pH of 5.5 was determined as optimal for the enzyme. However
also in the pH range of 5–7, the enzyme possessed more than
90% of maximal activity. During the entire research, the enzyme
444

Transfucosylation activity of Paenibacillus thiaminolyticus
Fig. 2. The results of the transfucosylation reactions catalyzed by recombinant
β-D-galactosidase from P. thiaminolyticus using 50 mM (or 80 mM as indicated
below) pNPβ-D-Fuc as a donor and different p-nitrophenyl glycopyranosides
as acceptors of fucosyl residue. All reactions were performed at 50◦C for a
period necessary for the maximal production of the desired transfucosylation
product. Standard molecules (lines 1–6) and reaction mixtures (lines 7–10)
were spotted on the Silica gel TLC plate. The separation was carried out in the
mobile phase ethylacetate:acetic acid:water (7:2:2, v/v/v) and the compounds
containing saccharidic moiety were visualized by 2-methylresorcinol. Line 1 –
p-nitrophenol, line 2 – D-fucose, line 3 – pNPβ-D-Fuc, line 4 – pNPα-D-Gal,
line 5 – pNPα-D-Man, line 6 – pNPα-D-Glc, line 7 – reaction mixture
containing 80 mM pNPβ-D-Fuc serving as a donor as well as an acceptor, line
8 – reaction mixture containing 33 mM pNPα-D-Gal as an acceptor, line 9 –
reaction mixture containing 33 mM pNPα-D-Man as an acceptor and line 10 –
reaction mixture containing 33 mM pNPα-D-Glc as an acceptor. Desired
transglycosylation products isolated for NMR analysis are indicated by arrows.
Fig. 3. The results of the transfucosylation reactions catalyzed by recombinant
β-D-galactosidase from P. thiaminolyticus using 60 mM pNPβ-D-Fuc as a
donor and alcohols as acceptors of the fucosyl residue. All reactions were
performed at 50◦C for a period necessary for the maximal production of the
desired transfucosylation product. Standard molecules (lines 1–3) and reaction
mixtures (lines 4–9) were spotted on the Silica gel TLC plate. Separation was
carried out in the mobile phase ethylacetate:acetic acid:water (7:2:2, v/v/v) and
the compounds containing saccharidic moiety were visualized by
2-methylresorcinol. Line 1 – p-nitrophenol, line 2 – D-fucose, line 3 –
pNPβ-D-Fuc, line 4 – reaction mixture containing 20% methanol as an
acceptor, line 5 – reaction mixture containing 20% ethanol as an acceptor, line
6 – reaction mixture containing 10% 1-propanol as an acceptor, line 7 –
reaction mixture containing 10% 2-propanol as an acceptor, line 8 – reaction
mixture containing 10% 1-octanol as an acceptor and line 9 – reaction mixture
containing 10% 2-octanol as an acceptor. Desired transglycosylation products
are indicated by arrows.
Table II. Results of transfucosylation reactions catalyzed by recombinant
β-D-galactosidase from P. thiaminolyticus using p-nitrophenyl
glycopyranosides as acceptors
Table III. Results of transfucosylation reactions catalyzed by recombinant
β-D-galactosidase from P. thiaminolyticus using alcohols as acceptors
Donor
Acceptor
Product linkage
Yield (%)
Donor
Acceptor
Yield (%)
pNPβ-D-Fuc
pNPβ-D-Fuc
pNPα-D-Gal
pNPα-D-Glc
pNPα-D-Man
(1→3)
(1→6)
(1→3)
(1→3)
16
42
13
69
pNPβ-D-Fuc
Methanol
Ethanol
1-propanol
2-propanol
1-octanol
2-octanol
94
72
56
24
15
5
Yields are calculated according to the amount of added acceptor.
Yields are calculated according to the amount of added donor.
peaks between H-1ꢁ–C-3 and H-3–C-1ꢁ. On the other hand, cross
peaks between H-1ꢁ–C-6 and H-6–C-1ꢁ characterized the (1ꢁ→
6) glycosidic bond for the compound formed by fucosylation
of pNPα-D-Gal. The results of the NMR analysis are summa-
rized in Table II. Presented yields are calculated according to
the amount of acceptor molecule added to reaction mixture and
the amount of transfucosylation products isolated by the extrac-
tion to methanol during the preparation of samples for NMR
analysis. It is necessary to emphasize that the yield of the trans-
glycosylation reaction using pNPβ-D-Fuc as a donor as well
as an acceptor is not easily comparable with yields from other
transglycosylations, for the final yield is relative to the entire
amount of pNPβ-D-Fuc added to the reaction mixture.
transfer to galactose. The bonds involving the hydroxyl groups
at C2 and C4 were not detected.
For the transglycosylation products of reactions containing
alcohol molecules as acceptors, only mass spectrometry anal-
ysis was carried out, for only one possible bond between the
alcohol and fucosyl residue exists, the glycosidic bond between
the C1 of the fucosyl moiety and hydroxyl group of the alco-
hol, resulting from the reaction mechanism. The transfucosy-
lation products were not isolated from the reaction mixtures in
these experiments; only the enzyme was removed before analy-
sis from the mixture by filtration on Cellulose Triacetate filters
Vecta Spin Micro. Mass spectrometry confirmed the presence
of all supposed glycosylated alcohols. The results of transgly-
cosylation reactions are summarized in Table III. The yields
The results indicate the ability of the enzyme to create differ-
ent glycosidic bonds, depending on the type of used saccharidic
acceptor. The hydroxyl group at C3 of the fucose, mannose,
and glucose is preferred while the C6 position is used for the
445

E Benesˇova´ et al.
Transfucosylation activity of Paenibacillus thiaminolyticus
of transfucosylation reactions were, in these cases, calculated
using the data of the TLC spot densities (obtained by using
program TotalLab) of substrates and hydrolysis and transfuco-
sylation products. Presented yields were calculated according to
the amount of the pNPβ-D-Fuc used as the donor in the reaction
mixture. The results indicate that the amount of transglycosy-
lation products decreases with the length of the alkyl chain and
that the primary hydroxyl group is more easily accessible for
the enzyme than the secondary group of acceptor alcohols.
The yields of transglycosylation reactions using p-
nitrophenyl glycopyranosides as acceptors, presented in Ta-
ble II, are (in comparison with the results of reactions with
alcohols, analyzed by program TotalLab) decreased by the ex-
traction process. Program TotalLab was not correctly applicable
in the case of p-nitrophenyl glycopyranosidic acceptors owing
to the presence of different types and combinations of monosac-
charidic moieties that may influence the results of staining by
2-methylresorcinol (Bru¨ckner 1955). (This problem did not ap-
pear during the analysis of TLC results of transglycosylation
reactions when using alcohols as acceptors, where only one
type of saccharidic moiety was present.) This is the reason why
the yields were calculated for samples obtained by extraction
during the process of sample preparation for the NMR anal-
ysis. Not identical contaminant compounds of the molecular
weights of 304 Da (measured in the positive mode) and 894
Da (measured in the negative mode) were detected by mass
spectrometry analysis in the samples of p-nitrophenyl β-D-
fucopyranosyl-(1,6)-α-D-galactopyranoside and p-nitrophenyl
β-D-fucopyranosyl-(1,3)-α-D-glucopyranoside after the extrac-
tion, respectively. Their presence was considered in the final
yield calculation.
and 145 kDa) (data published in The Comprehensive Enzyme
Information System BRENDA (Chang et al. 2009)). As an ex-
ample, the data published by Fujimoto and co-workers can be
mentioned as being in good agreement with our results. They de-
scribed the β1–3 linkage specific β-galactosidase from Bacillus
circulans, occurring in the monomeric form with the deducted
molecular weight of 66.9 kDa (Fujimoto et al. 1998).
As presumed in the very beginning of this work, the enzyme
from P. thiaminolyticus exhibited two different activities, β-
D-fucosidase and β-D-galactosidase. In addition to these two
activities an ability to cleave β-D-glucosides was also observed.
The ability to cleave the chromogenic substrate pNPβ-D-Fuc
or o-nitrophenyl β-D-fucopyranoside was observed by many
different β-D-galactosidases (Chang et al. 2009). They in-
cluded salt-tolerant β-galactosidase from psychrophilic Antarc-
tic Planococcus isolate (Sheridan and Brenchley 2000) or
thermostable β-galactosidases from Thermotoga maritima (Li,
Zhang, et al. 2009) and Sterigmatomyces elviae CBS8119
(Onishi and Tanaka 1995). Even two successful strategies for
enhancing the β-fucosidase activity of β-galactosidase from E.
coli were described in works of Zhang et al. and Parikh and
Matsumura. In the first mentioned paper, the authors used the
method of DNA shuffling (Zhang et al. 1997), while the second
work applied the strategy of site-saturation mutagenesis (Parikh
and Matsumura 2005).
Regarding the interest of finding new synthetic tools for
the synthesis of β-D-fucosylated compounds, two types of
molecules (p-nitrophenyl glycopyranosides and alcohols) were
tested for the possibility of serving as acceptors in transglycosy-
lation reactions catalyzed by the recombinant β-D-galactosidase
from P. thiaminolyticus. As mentioned earlier, all transgly-
cosylation reactions were followed by TLC analysis and the
products containing saccharidic moieties were visualized by
2-methylresorcinol. In the case of p-nitrophenyl glycopyra-
nosidic acceptors, ultraviolet light (UV) detection, visualizing
donor, acceptor, and transglycosylation products containing the
p-nitrophenyl part, was also useful.
According to TLC results it was possible to predict the gly-
cosylation of all chosen acceptors, for not only the spots cor-
responding to substrates of the reactions (donor and acceptor
molecules) or to hydrolysis products, but also one or more ad-
ditional spots were observed, representing the transglycosyla-
tion products. The presence of all expected transglycosylation
products was confirmed by mass spectrometry analysis. In the
case of p-nitrophenyl glycopyranosidic acceptor molecules, a
further structural analysis, enabling the identification of glyco-
sylated hydroxyl groups positions, was necessary. NMR spec-
troscopy was used for these purposes and the main transfucosy-
lation products were isolated by extraction to methanol. Other
molecules, present in small amounts and detectable by UV, are
assumed to be the products of transfucosylation of the donor
molecule (in all cases the pNPβ-D-Fuc may serve as a donor as
well as an acceptor) or products containing more than one at-
tached fucosyl residue. Other minor products, visible only after
staining by 2-methylresorcinol, are supposed to be the products
of transglycosylation reactions using D-fucose, liberated during
hydrolysis, as an acceptor.
Discussion
The gene of β-D-galactosidase from P. thiaminolyticus was
found and sequenced. According to the glycosyl hydrolases clas-
sification introduced by Henrissat (1991), based on the primary
sequences similarities, β-D-galactosidases generally belong to
the glycoside hydrolase families 1, 2, 35, and 42, all of which
are ordered to the clan GH-A (Henrissat and Davies 1997).
According to the amino acid sequence it was determined that β-
D-galactosidase from the P. thiaminolyticus exhibits the highest
similarity to the enzymes from the glycoside hydrolase family
35. This family encloses the enzymes with β-D-galactosidase
(EC 3.2.1.23) or exo-β-glucosaminidase (EC 3.2.1.165) activity
from all three domains, i.e., Archaea, Bacteria, and Eukaryota.
β-D-Galactosidases from Bacillus circulans ATCC 31382, Ara-
bidopsis thaliana, or human β-D-galactosidase could be men-
tioned as examples of the most interesting members of the gly-
coside hydrolase family 35 (Cantarel et al. 2009).
According to our results β-D-galactosidase from P. thi-
aminolyticus is a monomeric enzyme with the molecular weight
of 66.0 kDa (68.6 kDa in the form of a histidine-tagged fusion
protein). As noted earlier, β-D-galactosidases are enzymes oc-
curring in microorganisms as well as in plants and animals
(Panesar et al. 2006). Their molecular weight ranges from
19 kDa to 750 kDa and both monomeric and multimeric proteins
are known. The presence of β-D-galactosidase in the monomeric
form was referred to in different organisms including bacteria,
fungi, plants, and mammals (molecular weights between 41 kDa
Transglycosylation activities of many β-D-galactosidases
originating from numerous sources have been investigated
in the past few years. Enzymes with the ability to catalyze
the formation of different glycosidic bonds were found and
446

Transfucosylation activity of Paenibacillus thiaminolyticus
characterized. Thus, the ability to transfer the galactosyl residue
to a number of different acceptors was described. Although the
β-D-fucosidase activity of some β-D-galactosidases has been
known for a long time, the possibility of utilizing these en-
zymes for the synthesis of β-D-fucosylated molecules has not
been so far sufficiently described.
The recombinant β-D-galactosidase from P. thiaminolyticus
seems to be an enzyme preferring the formation of β(1→6)
and β(1→3) glycosidic bonds, depending on the glycosylated
molecule. The β(1→6) glycosidic linkage was found in the main
product in the transfucosylation reaction, using pNPα-D-Gal as
an acceptor. In all other analyzed products the fucosyl moiety
was attached to the acceptor by the β(1→3) linkage.
for the production of β-D-fucopyranosyl-β-D-xylopyranosides
containing (1→2) and (1→3) glycosidic bonds. According to
the used xylopyranoside derivative (an acceptor), the final yield
could reach 88%. The ratio of arising products, containing the
(1→2) or (1→3) glycosidic linkage, could be influenced by the
character of the aglyconic part of the xylopyranoside derivative
(Li et al. 1998).
Growing interest in possible applications of alkylglycosides
in different biotechnological areas was the reason for testing
the ability of the recombinant β-D-galactosidase from P. thi-
aminolyticus to utilize also primary or secondary alcohols of a
different alkyl chain length as acceptors in transfucosylation re-
actions. A significant influence of both mentioned features was
observed. The enzyme was able to use all of the tested alcohols
(methanol, ethanol, 1- and 2-propanol, and 1- and 2-octanol) as
acceptors (products confirmed in the reaction mixtures by mass
spectrometry analysis); however, primary hydroxyl groups were
preferred to secondary ones and the transglycosylation yields
decreased markedly from methanol to alcohols with a longer
alkyl chain.
Similar trends were obtained using the lipid-coated β-D-
galactosidase from E. coli and Aspergillus orzyae in the
two-phase aqueous-organic system. Okahata and Mori (1998)
reported the ability of both enzymes to catalyze transgalacto-
sylation reactions (lactose used as a galactosyl donor) and the
decrease in the reaction yield from the primary to secondary
hydroxyl group of 1-butanol and 2-butanol used as acceptors.
Only β-D-galactosidase from E. coli was able to galactosylate the
tertiary hydroxyl group of tert-butanol, the yield being approxi-
mately one half as much as for 2-butanol. Different results were
observed for the lipid-coated β-D-galactosidase from Bacillus
circulans, where the secondary hydroxyl group was preferred
to the primary one, but where the tertiary hydroxyl group was
not glycosylated at all. In the same work the influence of the
alkyl chain length over the transgalactosylation activity of lipid-
coated β-D-galactosidase from E. coli was also tested. High
yields were obtained for 1-butanol or 1-octanol used as accep-
tors (67% and 82% of conversion, respectively), but a rapid
decrease was observed when using 1-decanol or 1-dodecanol
(Okahata and Mori 1998). Similar results were obtained dur-
ing the study of galactosylation of 1-butanol, 1-hexanol, and
1-octanol using β-D-galactosidase from Bacillus megaterium 2-
37-4-1 for all three acceptors, yields ranging from 15–20% (Li,
Wang, et al. 2009).
The formation preference of the (1→6) glycosidic link-
age during the transglycosylation reaction catalyzed by β-D-
galactosidase from porcine liver, using pNPα-D-Gal and pNPβ-
D-Gal as acceptors and oNPβ-D-Gal as a donor, was published
by Zeng and co-workers. They also reported a significant influ-
ence of acceptor p-nitrophenyl group orientation, because yields
obtained by using the α-glycosidic acceptors were higher than
for the β-linkage containing derivatives. In the same work, the
formation of (1→3) and (1→6) glycosidic bonds was reported
to be catalyzed by the β-D-galactosidase from Bacillus circu-
lans ATCC 31382 in the reaction with pNPα-D-Gal, serving as
an acceptor, but only linkage (1→6) was formed when using
pNPβ-D-Gal (Zeng et al. 2000).
The regioselectivity toward D-mannose used as an acceptor
was tested for a series of β-D-galactosidases of different ori-
gins. Only β-1,3-galactosidase from Bacillus circulans ATCC
31382 was able to catalyze the formation of products contain-
ing (1→3) and (1→6) glycosidic bonds, in the ratio favor-
able for the (1→3) linkage-containing product (final ratio 2:1).
β-Galactosidases from E. coli, Aspergillus oryzae, and Penicil-
lium multicolor preferred the formation of the (1→6) glyco-
sidic bond, and in the case of β-1,4-galactosidase from Bacil-
lus circulans dominated the formation of the (1→4) linkage
(62%), while the yields of (1→6) and (1→3) linkage-containing
products were almost similar (18% and 20%, respectively). β-
Galactosidase from Bifidobacterium bifidum catalyzed the for-
mation of (1→3), (1→4), and (1→6) linkage-containing prod-
ucts, approximately in the ratio of 1:2:2. The enzyme from
Streptococcus 6646K catalyzed exclusively the formation of the
(1→4) glycosidic linkage (Miyasato and Ajisaka 2004).
Recombinant β-glycosidase from Thermus thermophilus, fa-
voring the formation of the (1→3) glycosidic linkage during
transglycosylation reactions, was used in the work of Fourage
and Colas for the transfucosylation reaction using pNPβ-D-Fuc
as a donor and glucose as an acceptor. During the research the
preparative synthesis of forming disaccharide was tested. The
final yield (expressed as a percentage of initial concentration in
pNPβ-D-Fuc) after purification of the product was 25% (Fourage
and Colas 2001).
High transfucosylation activity was confirmed for β-
glucosidase from Thai rosewood and for almond β-glucosidase
in reactions containing methanol, ethanol, 1-propanol, and 2-
propanol as acceptors and pNPβ-D-Fuc as a donor molecule
(Lirdprapamongkol and Svasti 2000). Almond β-glucosidase
was also confirmed to be able to catalyze the condensation
reactions producing alkyl fucosides. The trend of decreasing
conversion was observed from 1-hexanol to 1-octanol used as
acceptors (Kobayashi et al. 1999).
In conclusion, during research the gene of β-D-galactosidase
with β-D-fucosidase activity from P. thiaminolyticus was found
and sequenced and the enzyme was expressed in the form of
the recombinant histidine-tagged fusion protein. The ability of
the enzyme to catalyze the transfucosylation reactions was con-
firmed and, regarding broad acceptor specificity and in some
cases relatively high yields of transglycosylation reactions, the
enzyme seems to be a promising biocatalyst for synthesis of
The ability to catalyze the transfucosylation reaction, using
pNPβ-D-Fuc as a donor and glucose as an acceptor molecule,
was also confirmed for the β-D-glucosidase I from Bifidobac-
terium breve clb. A mixture of transfucosylation products, con-
taining (1→2), (1→3), (1→4), and (1→6) glycosidic linkages
was obtained and its successful assimilation by bifidobacteria
was determined (Sakai et al. 1989).
Glycosidase Gly-001-09 from CLONEZYMETM ther-
mophilic glycosidase library was chosen by Li and co-workers
447

E Benesˇova´ et al.
β-D-fucosylated molecules. Based on these results, the study
deepening the knowledge on the possibility of using this en-
zyme in transglycosylation reactions will continue. The main
emphasis will be directed at testing the enzyme’s ability to use
further acceptor types in transfucosylation reactions.
Sequence analysis and expression plasmid construction
The inserted part of isolated plasmid DNA from the pos-
itive colony was sequenced (Geneart, Germany) using the
method of primer walking; thus, the sequence of both
strands was determined. The obtained sequence was com-
pared to the NCBI database using program WU-BLAST2,
and the open reading frame of the gene encoding β-D-
galactosidase was determined. According to the obtained re-
sults, two primers were designed for PCR producing DNA
fragment for insertion into the expression vector. The re-
striction site for endonuclease NdeI (emphasized by under-
lining) was inserted into primer designed for the 5ꢁ-terminal
part (ATCGGCGAAGGAGAGAAGCATATGACAACG) and
the restriction site for BamHI was contained in the primer for the
3ꢁ-terminal part (CACAGCGCTGGGGATCCGAACTAAAG)
of the amplified sequence. Genomic DNA of P. thiaminolyti-
cus was used as a template in the PCR reaction catalyzed by
Kod Hot Start DNA polymerase (Novagen, USA). Reaction
conditions were adjusted according to the instructions of the
manufacturer. The PCR product was specifically cleaved by re-
striction endonucleases NdeI and BamHI to be applicable for
ligation into the expression plasmid pET16b (Novagen, USA)
digested with the same enzymes and dephosphorylated by CIAP.
The competent cells of E. coli BL21 Gold (DE3) (Stratagene,
USA) were transformed by the ligation mixture and cultivated
on LBA plates with X-gal and IPTG, as described previously.
The plasmid DNA of colonies producing active β-D-
galactosidase (indicated by the blue color of colony) was
isolated by alkaline lysis. The accuracy of the construct was con-
firmed by sequencing and the construct (named pET16b-βgal-
2M) was used for the expression of the histidine-tagged protein.
Material and methods
Cultivation of P. thiaminolyticus
Bacterial strain P. thiaminolyticus was cultivated in the liquid
Luria–Bertani medium (LB) for 16 h at 30◦C in a platform
shaker at 250 RPM or on LB plates under same temperature
conditions. After cultivation, cells were harvested by centrifu-
gation (4000 g, 20 min, 4◦C).
Disintegration of cells of P. thiaminolyticus
After cultivation the harvested cells were resuspended in the
25 mM EPPS buffer (pH 8) (Sigma-Aldrich, USA) and dis-
rupted using lysozyme (final concentration of 5 mg/mL) (Fluka,
USA), natrium deoxycholate (final concentration 0.1%) (Sigma-
Aldrich), DNase (30 U to 1 mL) (Sigma-Aldrich) and sonication
R
(20 W, 6 × 30 s) at Sonicatorꢀ 3000 ultrasonic liquid processor
(Misonix Inc., USA). Cell debris was discarded by centrifuga-
tion (20,000 g, 20 min, 4◦C).
Native electrophoresis in polyacrylamide gel
Native electrophoresis in polyacrylamide gel (Laemli 1971) was
performed in 6.8% running gel under a constant voltage of
100 V at 4◦C. After separation the gels were incubated in the
(a) 6.6 mM pNPβ-D-Fuc (MP Biomedicals Inc., France) in 0.2 M
HEPES buffer (pH 8) (Sigma-Aldrich) or (b) 6.6 mM oNPβ-D-
Gal (Sigma-Aldrich) in 0.2 M HEPES buffer (pH 8) or (c)
2.2 mM X-gal (purchased from Duchefa Biochemie, Nether-
lands) dissolved in a 2% solution of DMF (Sigma-Aldrich) in
25 mM EPPS buffer (pH 8) to visualize the proteins with β-D-
fucosidase and β-D-galactosidase activity.
Expression, disintegration, and purification of recombinant
β-D-galactosidase
The competent cells of E. coli BL21 (DE3) (Novagen, USA)
were transformed with plasmid pET16b-βgal-2M and grown
on LBA plates. One colony was used for the preparation of
overnight inoculum (10 mL of LBA, 37◦C, 250 RPM), subse-
quently used the following day for 1% inoculation. After inocu-
lation the cells were grown in a shaking incubator (LBA, 37◦C,
250 RPM) and the increase of optical density (OD) at 600 nm
was followed. At an OD of 0.5 IPTG was added to the final con-
centration of 0.3 mmol/L to induce expression. Four hours after
induction of expression, the cells were harvested by centrifuga-
tion (4000 × g, 20 min, 4◦C), suspended in the 25 mM EPPS
buffer (pH 8), and disrupted, as described previously, for disinte-
gration of cells of P. thiaminolyticus. The supernatant, obtained
by centrifugation (20,000 × g, 20 min, 4◦C) after disintegra-
tion, was applied on the Ni-NTA agarose affinity chromatog-
raphy column (Qiagen GmbH, Germany) equilibrated with the
50 mM phosphate buffer (pH 7.5) with 150 mM KCl (Lach-
Ner, s.r.o, CZ) and 10 mM imidazole (Sigma-Aldrich, USA).
The contaminants were washed out of the column by the same
buffer with 40 mM imidazole. The recombinant histidine-tagged
β-D-galactosidase was eluted with the 50 mM phosphate buffer
(pH 7.5) with 150 mM KCl and 250 mM imidazole. Fractions
containing the recombinant protein (determined by the activ-
ity assay) were put together and desalted by gel chromatog-
raphy using column PD10 (GE Healthcare, UK). Processes of
expression, disintegration, and purification were followed by
Preparation of genomic library
Genomic DNA of P. thiaminolyticus was isolated from the
overnight culture with a Genomic tip 500/G kit (Qiagen, USA)
and partially digested by the restriction enzyme Sau3AI. Re-
sulting fragments were ligated into BamHI linearized and Calf
Intestinal Alkaline Phosphatase (CIAP) dephosphorylated vec-
tor pUC19ꢀlacZ (derived from commercial pUC19 (Gibco-
BRL, USA) by Karasova´-Lipovova´ et al. (2003)) using T4 DNA
ligase (CIAP was purchased from Invitrogen (USA); all other
enzymes were purchased from New England Biolabs (USA)).
Competent cells of E. coli DH5α (GibcoBRL, USA) were trans-
formed with the ligation reaction mixture and spread on LBA
plates (final concentration of ampicillin was 0.1 mg/mL) (Ap-
pliChem GmbH, Germany), X-gal (40 μg/mL), and isopropyl
β-D-thiogalactopyranoside (IPTG, 40 μg/mL) (purchased from
Duchefa biochemie, Netherlands). Plasmid DNA was isolated
by alkaline lysis from positive colonies (production of β-D-
galactosidase indicated by the blue color). The procedures of
ligation, transformation, and alkaline lysis were performed ac-
cording to standard protocols (Sambrook and Russel 2001).
448

Transfucosylation activity of Paenibacillus thiaminolyticus
SDS–PAGE electrophoresis (Laemli 1971) in 10% running gel
under reduction conditions of dithiotreitol (Amresco, USA).
Separated proteins were visualized by Coomassie Brilliant Blue
R-250 (Amresco).
viously) were purchased from Sigma-Aldrich. In the second case
alcohols containing the primary or secondary hydroxyl group
(methanol, ethanol, and 1-propanol, (Penta, CZ), 2-propanol
(Lach-Ner, s.r.o, CZ), 1-octanol (Fluka, USA), and 2-octanol
(Sigma-Aldrich)) were used.
The reaction mixture with p-nitrophenyl glycopyranosides
as acceptor molecules consisted of the 50 mM phosphate buffer
(pH 6), 50 mM pNPβ-D-Fuc (as the donor molecule), and 33 mM
acceptor (all acceptor molecules are listed previously). The only
exception was the reaction mixture with pNPβ-D-Fuc serving as
a donor as well as an acceptor molecule, where the concentra-
tion was 80 mmol/L. The reaction was initiated by the addition
of 0.53 U of the purified β-D-galactosidase to 1050 μL of the re-
action mixture containing pNPα-D-Glc or pNPα-D-Man, 0.26 U
to the reaction mixture of the final volume 875 μL containing
pNPβ-D-Fuc, and 0.12 U to 700 μL of the reaction mixture
with pNPα-D-Gal. (Different amounts of the added enzyme re-
sult from different isolations used in particular experiments.)
The basic effort was to use the highest possible amount of
the enzyme and to retain the concentrations of acceptor and
donor molecules. The volumes of the reaction mixtures were
designed according to expected yields, so that the initial amount
of pNPβ-D-Fuc was 10 mg (pNPα-D-Gal used as an accep-
tor), 15 mg (pNPα-D-Glc or pNPα-D-Man used as acceptors),
or 20 mg (pNPβ-D-Fuc used as an acceptor). All the reactions
were carried out at 50◦C.
The reaction times (50 min for pNPα-D-Gal as an acceptor,
5 h for pNPα-D-Man, 4 h for pNPβ-D-Fuc and 3 h for pNPα-D-
Glc) were determined as times of maximal production of trans-
glycosylation products. The reactions were not terminated but
immediately applied on TLC plates and separation was carried
out. Desired transglycosylation products were then isolated and
prepared for mass spectrometry and NMR spectroscopy anal-
ysis. The final yields of particular transglycosylation products
were calculated from amounts of acceptor added to the reaction
mixture and obtained compound after the isolation procedure.
Reaction mixtures containing alcohols as acceptor molecules
differed in the amount of alcohol content (20% v/v of methanol
and ethanol and 10% of 1-propanol, 2-propanol, 1-octanol, and
2-octanol). The content of alcohol resulted from screening ex-
periments, where different amounts of alcohols (ranging from
10% to 30%) were used. Reaction mixtures with highest yields
were used for further investigation. All reactions were per-
formed at 50◦C in the 50 mM phosphate buffer (pH 6) containing
60 mM pNPβ-D-Fuc. Reactions were started by the addition of
0.02 U of the purified β-D-galactosidase to 150 μL of the reac-
tion mixtures containing methanol, ethanol, and 2-propanol and
0.05 U to the reaction mixtures with 1-propanol, 1-octanol, and
2-octanol. Different amounts of added β-D-galactosidase again
resulted from different enzyme isolates used in particular exper-
iments and from the effort to use the highest possible amount
of the enzyme and to retain the concentrations of acceptor and
donor molecules. After the reaction (2.5 h were determined
as times of maximal production of transglycosylation products
for methanol and ethanol, 4 h for 1-propanol and 2-propanol
and 2 h for 1-octanol and 2-octanol), the enzyme was removed
from the reaction mixture by filtration on Cellulose Triacetate
filters Vecta Spin Micro (Whatmann, UK) with cut-off of 12
kDa. Prepared samples were analyzed by TLC and character-
ized by mass spectrometry. (Particular transglycosylation prod-
ucts were not isolated from reaction mixtures.) Yields of formed
Protein concentration estimation
Protein concentration was estimated parallelly by measuring the
absorbance at 280 nm and by Bradford protein assay (Bradford
reagent was purchasedfromAmresco, USA) usingbovineserum
albumin (SERVA Electrophoresis GmbH, Germany) as standard
(Bradford 1976).
Enzyme assay
β-D-Fucosidase activity was measured in the 50 mM phosphate
buffer (pH 6) at 37◦C for 10 min using as a substrate 15 mM
pNPβ-D-Fuc in the reaction mixture. The reaction was termi-
nated by the addition of an equal volume of 10% Na2CO3.
The absorbance of the reaction mixture was detected at 405 nm
and the amount of released p-nitrophenol was calculated using
the calibration curve carried out under same conditions. The
amount of the enzyme, able to release 1 μmol of p-nitrophenol
per minute at 37◦C, was defined as one unit.
The pH dependence of the enzyme activity was determined in
a set of Britton–Robinson buffers of different pH covering the
range from 2 to 10. The influence of the temperature on activity
was tested for temperatures ranging from 10◦C to 85◦C. Kinetic
parameters were calculated by the nonlinear regression method.
The dependence of the enzyme activity on the substrate con-
centration was also measured for substrates pNPβ-D-Gal, pNPβ-
D-Glu, and lactose (37◦C, 50 mM phosphate buffer (pH 6)).
The experimental procedure for chromogenic substrates dif-
fered from the measurement with pNPβ-D-Fuc only in the re-
action time (1 h) in the experiment using pNPβ-D-Glu as a
substrate. In the case of lactose used as a natural substrate of
β-D-galactosidases, the reaction was terminated after 15 min by
5 min incubation at 90◦C. The concentration of released glucose
was determined using Glu God BIO-LA-TEST (Pliva-Lachema
Diagnostika s.r.o., CZ). Kinetic parameters were again calcu-
lated using the method of nonlinear regression.
Gel filtration chromatography
The molecular weight of the produced recombinant protein
was determined by gel filtration chromatography using column
Sephacryl S-300 HR 16/60 (AP Biotech, UK). Separation was
carried out in the 0.1 M phosphate buffer (pH 6) with the flow
rate of 0.5 mL/min on the BioLogic Duo-Flow System (Bio-
Rad, USA). Molecular weight was calculated from the calibra-
tion curve. Blue dextran 2000 (2000 kDa), ferritin (440 kDa),
catalase (232 kDa), aldolase (158 kDa) (all purchased from AP
Biotech, UK), bovine serum albumin (67 kDa) (SERVA Elec-
trophoresis GmbH, Germany), and lysozyme (14.5 kDa) (Fluka,
USA) were used as standard proteins.
Transglycosylation reactions
For transglycosylation reactions two different types of acceptor
molecules were used: p-nitrophenyl glycopyranosides and al-
cohols. In the first case chromogenic substrates, not cleavable
by the enzyme (with the exception of pNPβ-D-Fuc), as pNPβ-
D-Fuc, pNPα-D-Gal, pNPα-D-Glc, pNPα-D-GlcA, and pNPα-D-
Man, were used. All of them (besides pNPβ-D-Fuc as listed pre-
449

E Benesˇova´ et al.
transglycosylation products were calculated according to TLC
spot densities determined by program TotalLab (Nonlinear Dy-
namics, UK) using the data for the added donor molecule, ob-
tained transglycosylation products, and fucose released during
the reaction. The sum of all these data represents 100% of fu-
cosyl moieties in reaction mixtures.
p-Nitrophenyl β-D-fucopyranosyl-(1,3)-α-D-mannopyrano-
side: 1H NMR: δ 8.21 (d, 2H, J = 9.2 Hz, p-NO2Ph), δ 7.25 (d,
2H, J = 9.2 Hz, p-NO2Ph), δ 5.76 (d, 1H, J = 1.5 Hz, H-1),
δ 4.52 (d, 1H, J = 7.8 Hz, H-1ꢁ), δ 4.33 (dd, 1H, J = 3.2 Hz,
H-2), δ 4.15 (dd, 1H, J = 3.2 Hz, 9.6 Hz, H-3), δ 3.82 (dd, 1H,
J = 9.7 Hz, H-4), δ 3.79 (m, 1H, H-5ꢁ), δ 3.75–3.66 (m, 3H, H-4ꢁ,
H-6, overlapped), δ 3.65 (dd, 1H, J = 3.6 Hz, 9.9 Hz, H-3ꢁ), δ
3.63 (m, 1H, H-5), δ 3.53 (dd, 1H, J = 7.9 Hz, 9.8 Hz, H-2ꢁ), δ
1.23 (d, 3H, J = 6.6 Hz, 6ꢁ-CH3).
Thin-layer chromatography
The samples of the reaction mixtures were spotted on the Silica
gel TLC plate (Fluka, USA) and developed by a solvent sys-
tem ethylacetate:acetic acid:water (7:2:2, v/v/v) (ethylacetate
purchased from Lach-Ner, s.r.o, CZ and acetic acid from Penta,
CZ). The spots of reaction products after separation were visual-
ized by UV detection (in the case of molecules containing the p-
nitrophenyl group) and by 0.1 M 2-methylresorcinol (Alfa Aesar
GmbH & Co. KG, Germany) dissolved in the 5% (v/v) solution
of sulfuric acid (Lach-Ner, s.r.o, CZ) in ethanol, detecting the
saccharidic parts of molecules (after heating of the TLC plate).
13C NMR: δ 160.8 (p-NO2Ph-1ꢁꢁ), 142.3 (p-NO2Ph-4ꢁꢁ),
126.1 (p-NO2Ph-3ꢁꢁ), 116.7 (p-NO2Ph-2ꢁꢁ), 101.2 (C-1ꢁ), 97.5
(C-1), 78.4 (C-3), 73.5 (C-5), 72.8 (C-3ꢁ), 71.3 (C-4ꢁ), 71.1
(C-5ꢁ), 70.6 (C-2ꢁ), 67.5 (C-2), 65.0 (C-4), 60.6 (6-CH2), 15.4
(6ꢁ-CH3).
p-Nitrophenyl β-D-fucopyranosyl-(1,3)-β-D-fucopyranoside:
1H NMR: δ 8.21 (d, 2H, J = 9.3 Hz, p-NO2Ph), δ 7.25 (d,
2H, J = 9.3 Hz, p-NO2Ph), δ 5.19 (d, 1H, J = 7.7 Hz, H-1), δ
4.58 (d, 1H, J = 7.8 Hz, H-1ꢁ), δ 4.04 (d, 1H, J = 3.1 Hz, H-4),
δ 4.00 (q, 1H, J = 6.6 Hz, H-5), δ 3.92 (dd, 1H, J = 7.7 Hz,
9.8 Hz, H-2), δ 3.87 (dd, 1H, J = 3.2 Hz, 9.8 Hz, H-3), δ 3.73
(q, 1H, J = 6.5, H-5ꢁ), δ 3.69 (d, 1H, J = 3.4 Hz, H-4ꢁ), δ 3.61
(dd, 1H, J = 3.4 Hz, 9.8 Hz, H-3ꢁ), δ 3.53 (dd, 1H, J = 7.8 Hz,
9.8 Hz, H-2ꢁ), δ 1.26 (d, 3H, J = 6.6 Hz, 6-CH3), δ 1.24 (d, 3H,
J = 6.5 Hz, 6ꢁ-CH3).
Identification and characterization of transglycosylation
products by mass spectrometry and NMR spectroscopy analysis
All transglycosylation products, obtained from transfucosyla-
tion reactions using p-nitrophenyl glycopyranosides and alco-
hols as acceptors, were confirmed by mass spectrometry analysis
in mode ESI+ (Q-Tof micro mass spectrometer, Waters Micro-
mass, USA) with direct inlet. In the case of alcohol acceptors
the whole reaction mixture (enzyme removed by filtration on
Vecta Spin Micro filters) was analyzed. Inasmuch as the re-
action mechanism allows only the formation of one type of
glycosidic bond (between the alcohol hydroxyl group and C1
of the fucosyl moiety), it was not necessary to analyze these
products by NMR spectroscopy. Products of transglycosyla-
tion reactions with p-nitrophenyl glycopyranosides as acceptors
were prepared by extraction into methanol directly from TLC
plates after separation. Methanol was evaporated for decreasing
the volume and samples were filtered using syringe filters with
the polytetrafluoroethylene membrane (0.45 μm) (Whatmann
International Ltd). Remaining methanol was evaporated and the
samples were dissolved in D2O, so that they were suitable not
only for mass spectrometry analysis, but also for NMR spec-
13C NMR: δ 161.8 (p-NO2Ph-1ꢁꢁ), 142.5 (p-NO2Ph-4ꢁꢁ),
126.1 (p-NO2Ph-3ꢁꢁ), 116.3 (p-NO2Ph-2ꢁꢁ), 104.1 (C-1ꢁ), 99.4
(C-1), 81.8 (C-3), 72.7 (C-3ꢁ), 71.3 (C-4ꢁ), 71.2 (C-2ꢁ), 70.9
(C-5), 70.8 (C-4, C-5ꢁ), 69.3 (C-2), 15.5, 15.3 (6-CH3, 6ꢁ-CH3).
p-Nitrophenyl β-D-fucopyranosyl-(1,3)-α-D-glucopyrano-
side: 1H NMR: δ 8.22 (d, 2H, J = 9.3 Hz, p-NO2Ph), δ 7.25 (d,
2H, J = 9.3 Hz, p-NO2Ph), δ 5.80 (d, 1H, J = 3.5 Hz, H-1),
δ 4.60 (d, 1H, J = 7.8 Hz, H-1ꢁ), δ 4.05 (dd, 1H, J = 9.3 Hz,
H-3), δ 3.92 (dd, 1H, J = 3.5 Hz, 9.7 Hz, H-2), δ 3.80 (q, 1H,
J = 6.5 Hz, H-5ꢁ), δ 3.73 (d, 1H, J = 3.0 Hz, H-4ꢁ), δ 3.62–3.70
(m, 4H, H-6a, H-5, H-6b, H-3ꢁ, overlapped with impurity), δ
3.45–3.60 (m, 2H, H-2ꢁ, H-4, overlapped with impurity), δ 1.23
(d, 3H, J = 6.5 Hz, 6ꢁ-CH3).
13C NMR: δ 161.2 (p-NO2Ph-1ꢁꢁ), 142.4 (p-NO2Ph-4ꢁꢁ),
126.0 (p-NO2Ph-3ꢁꢁ), 116.7 (p-NO2Ph-2ꢁꢁ), 103.2 (C-1ꢁ), 96.5
(C-1), 82.2 (C-3), 72.7 (C-3ꢁ), 72.6 (C-5), 71.2 (C-2ꢁ), 71.0
(C-4ꢁ), 71.0 (C-5ꢁ), 70.2 (C-2), 67.8 (C-4), 60.2 (6-CH2), 15.4
(6-CH3, 6ꢁ-CH3).
1
troscopy analysis. H, 13C, COSY, HMQC and HMBC, NOE,
and TOCSY spectra were measured on a Bruker AdvanceIII
600 (Bruker Corporation, Germany) spectrometer operating at
600.13 MHz for 1H and 150.92 MHz for 13C. All spectra were
acquired at 298 K in D2O. Chemical shifts are given in δ-units
(ppm) and are referenced to TMS.
Funding
The Ministry of Education, Youth and Sports (MSM
6046137305).
p-Nitrophenyl β-D-fucopyranosyl-(1,6)-α-D-galactopyrano-
1
side: H NMR: δ 8.21 (d, 2H, J = 9.2 Hz, p-NO2Ph), δ 7.26
(d, 2H, J = 9.2 Hz, p-NO2Ph), δ 5.79 (d, 1H, J = 3.7 Hz, H-1),
δ 4.23 (d, 1H, J = 7.9 Hz, H-1ꢁ), δ 4.15 (m, 1H, H-5), δ 4.04–4.09
(m, 2H, H-3, H-4), δ 3.98 (dd, 1H, J = 3.7 Hz, 9.7 Hz, H-2),
δ 3.92 (dd, 1H, J = 4.6 Hz, 11.3 Hz, H-6a), δ 3.74 (dd, 1H,
J = 7.3 Hz, 11.3 Hz, H-6b), δ 3.61–3.65 (m, 2H, H-4ꢁ, H-5ꢁ,
overlapped with impurity), δ 3.46 (dd, 1H, J = 3.4 Hz, 9.9 Hz,
H-3ꢁ), δ 3.28 (dd, 1H, J = 7.9 Hz, 9.9 Hz, H-2ꢁ), δ 1.11 (d, 3H,
J = 6.5 Hz, 6ꢁ-CH3).
Abbreviations
CIAP, calf intestinal alkaline phosphatase; DMF, dimethylfor-
mamide; DNA, deoxyribonucleic acid; E. coli, Escherichia coli;
IPTG, isopropyl β-D-thiogalactopyranoside; LBA, ampicillin
containing Luria-Bertani medium; LB, Luria-Bertani medium;
NMR, nuclear magnetic resonance; OD, optical density; P. thi-
aminolyticus, Paenibacillus thiaminolyticus; PAGE, polyacry-
lamide gel; PCR, polymerase chain reaction; pNPβ-D-Fuc,
p-nitrophenyl β-D-fucopyranoside; pNPα-D-Gal, p-nitro-
phenyl α-D-galactopyranoside; pNPβ-D-Gal, p-nitrophenyl
13C NMR: δ 161.7 (p-NO2Ph-1ꢁꢁ), 142.4 (p-NO2Ph-4ꢁꢁ),
126.1 (p-NO2Ph-3ꢁꢁ), 117.0 (p-NO2Ph-2ꢁꢁ), 102.8 (C-1ꢁ), 97.0
(C-1), 72.9 (C-3ꢁ), 71.2 (C-5ꢁ), 70.9 (C-5), 70.8 (C-4ꢁ), 70.4 (C-
2ꢁ), 69.1 (C-3, C-4), 68.6 (6-CH2), 67.8 (C-2), 15.3 (6ꢁ-CH3).
450

Transfucosylation activity of Paenibacillus thiaminolyticus
β-D-galactopyranoside; pNPα-D-Glc, p-nitrophenyl α-D-gluco-
pyranoside; pNPβ-D-Glc, p-nitrophenyl β-D-glucopyranoside;
pNPα-D-GlcA, p-nitrophenyl β-D-glucuronide; pNPα-D-Man,
p-nitrophenyl α-D-mannopyranoside; oNPβ-D-Gal, o-nitro-
phenyl β-D-galactopyranoside; SDS, sodium dodecyl sulfate;
TLC, thin-layer chromatography; X-gal, 5-bromo-4-chloro-3-
indolyl β-D-galactopyranoside; UV, ultraviolet light.
Li J, Robertson DE, Short JM, Wang PG. 1998. Chemical and enzymatic syn-
thesis of glycoconjugates 4. Control of regioselectivity in high yielding
synthesis of (β-D-fucopyranosyl)-O-D-xylopyranosyl disaccharides using a
CLONENZYMETM thermophilic glycosidase. Tetrahedron Lett. 39:8963–
8966.
Li Y, Wang H, Lu L, Zhengyi L, Xu X, Xiao M. 2009. Purification and charac-
terization of a novel β-galactosidase with transglycosylation activity from
Bacillus megaterium 2-37-4-1. Appl Biochem Biotechnol. 158:192–199.
Li L, Zhang M, Jiang Z, Tang L, Cong Q. 2009. Characterisation of a ther-
mostable family 42 β-galactosidase from Thermotoga maritima. Food Chem.
112:844–850.
References
Lirdprapamongkol K, Svasti J. 2000. Alkyl glucoside synthesis using Thai
rosewood β-glucosidase. Biotechnol Lett. 22:1889–1894.
Miyasato M, Ajisaka K. 2004. Regioselectivity in β-galactosidase-catalyzed
transglycosylation for the enzymatic assembly of D-galactosyl-D-mannose.
Biosci Biotechnol Biochem. 68(10):2086–2090.
Nunoura N, Ohdan K, Yano T, Yamamoto K, Kumagai H. 1996. Purification and
characterization of β-D-glucosidase (β-D-fucosidase) from Bifidobacterium
breve clb acclimated to cellobiose. Biosci Biotech Biochem. 60(2):188–193.
Okahata Y, Mori T. 1998. Transglycosylation catalyzed by a lipid-coated β-D-
galactosidase in two-phase aqueous-organic system. J Mol Catal B: Enzym.
5:119–123.
Onishi N, Tanaka T. 1995. Purification and properties of a novel thermostable
galacto-oligosaccharide-producing β-galactosidase from Sterigmatomyces
elviae CBS8119. Appl Environ Microbiol. 61(11):4026–4030.
Palcic MM. 1999. Biocatalytic synthesis of oligosaccharides. Curr Opin
Biotechnol. 10:616–624.
Panesar PS, Panesar R, Singh RS, Kennedy JF, Kumar H. 2006. Microbial
production, immobilization and applications of β-galactosidase. J Chem
Technol Biotechnol. 81:530–543.
Parikh MR, Matsumura I. 2005. Site-saturation mutagenesis is more efficient
than DNA shuffling for the directed evolution of β-fucosidase from β-
galactosidase. J Mol Biol. 352:621–628.
Sakai K, Tachiki T, Kumagai H. 1989. Synthesis of β-D-fucosylglucose by
β-D-glucosidase I of Bifidobacterium breve clb and assimilation by Bifi-
dobacteria. Agric Biol Chem. 53(2):313–318.
Sambrook J, Russel DW. 2001. Molecular Cloning: A Laboratory Manual. 3rd
ed. New York: Cold Spring Harbor Laboratory Press.
Bradford MM. 1976. A rapid and sensitive method for the quantitation of mi-
crogram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem. 72:248–254.
Bru¨ckner J. 1955. Estimation of monosaccharides by the orcinol-sulphuric acid
reaction. Biochem J. 60:200–205.
Cantarel BL, Coutinho PM, Rancurel C, Bernard T, Lombard V,
Henrissat B. 2009. The Carbohydrate-Active EnZymes database (CAZy):
An expert resource for Glycogenomics. Nucleic Acids Res. 37:D233–
D238.
Chang A, Scheer M, Grote A, Schomburg I, Schomburg D. 2009. BRENDA,
AMENDA and FRENDA the enzyme information system: New content and
tools in 2009. Nucleic Acids Res. 37:D588–D592.
Crout DHG, Vic G. 1998. Glycosidases and glycosyl transferases in gly-
coside and oligosaccharide synthesis. Curr Opin Chem Biol. 2:98–
111.
Dwek AR. 1996. Glycobiology: Toward understanding the function of sugars.
Chem Rev. 96:683–720.
Fourage L, Colas B. 2001. Synthesis of β-D-glucosyl- and β-D-fucosyl-glucoses
using β-glycosidase from Thermus thermophilus. Appl Microbiol Biotech-
nol. 56:406–410.
Fujimoto H, Miyasato M, Ito Y, Sasaki T, Ajisaka K. 1998. Purification and
properties of recombinant β-galactosidase from Bacillus circulans. Glyco-
conjugate J. 15:155–160.
Henrissat B. 1991. A classification of glycosyl hydrolases based on amino acid
sequence similarities. Biochem J. 280:309–316.
Henrissat B, Davies G. 1997. Structural and sequence-based classification of
glycoside hydrolases. Curr Opin Struct Biol. 7:637–644.
Sheridan PP, Brenchley JE. 2000. Characterization of a salt-tolerant family
42 β-galactosidase from psychrophilic Antarctic Planococcus isolate. Appl
Environ Microbiol. 66(6):2438–2444.
Varki A. 1993. Biological roles of oligosaccharides: All of the theories are
correct. Glycobiology. 3(2):97–130.
ˇ
Karasova´-Lipovova´ P, Strnad H, Spiwok V, Mala´ S, Kra´lova´ B, Russell NJ.
2003. The cloning, purification and characterisation of a cold-active β-
galactosidase from the psychrotolerant Antarctic bacterium Arthrobacter
sp. C2–2. Enzyme Microb Technol. 33:836–844.
Watt GM, Lowden PAS, Flitsch SL. 1997. Enzyme-catalyzed formation of
glycosidic linkages. Curr Opin Struct Biol. 7:652–660.
Kobayashi T, Adachi S, Matsuno R. 1999. Synthesis of alkyl fucosides through
β-glucosidase-catalyzed condensation of fucose and 1-alcohols. Biotechnol
Lett. 21:105–109.
Zeng X, Yoshino R, Murata T, Ajisaka K, Usui T. 2000. Regioselective syn-
thesis of p-nitrophenyl glycosides of β-D-galactopyranosyl-disaccharides by
transglycosylation with β-D-galactosidases. Carbohydr Res. 325:120–131.
Zhang J-H, Dawes G, Stemmer WPC. 1997. Directed evolution of a fucosidase
from a galactosidase by DNA shuffling and screening. Proc Natl Acad Sci.
94:4504–4509.
Kˇren V, Thiem J. 1997. Glycosylation employing bio-systems: From enzymes
to whole cells. Chem Soc Rev. 26:463–474.
Laemli UK. 1971. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature. 227:680–685.
451