Efficient Synthesis of β-(1Ǟ3)-Glycosides
FULL PAPER
correlations). The spectra were recorded with a Bruker AX 500
spectrometer operating at 500 MHz for 1H and 126 MHz for 13C
or on a Bruker AX 400 spectrometer operating at 400 MHz for 1H
and 100.6 MHz for 13C. In all cases, chemical shifts in ppm are
quoted from the resonance of methyl protons of sodium 3-(trimeth-
ylsilyl)propanesulfonate (DSS) used as an internal reference.
be explained by the important stacking between this phenyl
group and the tryptophan 312 residue, which was mainly
responsible for the energy stabilization. Moreover, the rela-
tive positions of the two monosaccharides stabilized by se-
veral hydrogen bonds are consistent with the complete β-
(1Ǟ3)-regioselectivity observed for this reaction. In con-
trast, when the acceptors are cellobiose or lactose the site
+2 is occupied by a glucosyl unit. As a result, a lower con-
formational constraint is probably imposed on the orienta-
tion of the disaccharide within the active site by Trp 312.
This may explain the relatively low regioselectivity observed
with these acceptors.
Determination of Yields by Proton NMR Spectroscopy
Use of E338S and E338G Glycosynthases: The donor (30 μmol) and
the acceptor (30 μmol) were dissolved in ammonium/hydrogen car-
bonate buffer in D2O (pH = 7.8, 510 μL, 150 mmolL–1) and the
mutant solution, prepared as described above (90 μL, 125 μg of
enzyme, 100 mmolL–1 phosphate buffer in H2O, pH = 7.0), was
added. The reactions were allowed to proceed at 55 °C until the
donor had completely disappeared. The reaction mixture was then
subjected to proton NMR spectroscopy. Experiments with three-
fold amounts of enzymatic solutions were carried out similarly, but
the reaction mixture was evaporated under reduced pressure and
redissolved in D2O before NMR analysis.
Conclusion
In summary, we have shown that three Tt-β-Gly glyco-
synthases, designed according to the strategy developed by
Withers, circumvented the drawbacks of wild-type retaining Use of E338A Glycosynthase: The donor (30 μmol) and the ac-
ceptor (30 μmol) were dissolved in ammonium hydrogen carbonate
buffer in D2O (pH = 7.8, 550 μL of 150 mmolL–1), and the mutant
solution, prepared as described above (50 μL, 125 μg of enzyme),
was added. The reactions were allowed to proceed at 55 °C until
the donor had completely disappeared. The reaction mixture was
glycosidases in terms of their transglycosidation ability,
since:
a) no hydrolytic activity towards the product and the sub-
strate was detectable,
b) the regioselectivity was almost total, at least for the syn-
thesis of β-(1Ǟ3)-disaccharides, and
c) no donor self-condensation products were synthesized.
Optimization of the reaction to produce yields of up to
90% was also possible through the use of appropriate
amounts of enzymes to enhance transglycosidation rates
relative to those of spontaneous hydrolysis of the glycosyl
fluorides. An interpretation of the properties of the mutant
glycosynthases based on molecular modeling studies has
also been proposed. Moreover, directed evolution of
Thermus thermophilus glycosidase is currently under investi-
gation in order to increase its catalytic activities and expand
its substrate repertoire.
1
then subjected to H NMR spectroscopy. Experiments with three-
fold amounts of enzymatic solutions were carried out similarly but
the reaction mixture was evaporated under reduced pressure and
redissolved in D2O before NMR analysis.
Kinetics of Hydrolysis of α-Glycosyl Fluorides: Experiments were
performed directly in the NMR tube at 55 °C. 1H NMR spectra
were recorded each hour for 9 h.
Enzymatic Hydrolysis: α-GlcF or -GalF (30 μmol) was dissolved in
ammonium hydrogen carbonate buffer in D2O (pH = 7.8, 510 μL
of 150 mmolL–1). The glycosynthase E338G solution, prepared as
described above (90 μL, 125 μg of enzyme), was then added.
Spontaneous Hydrolysis: α-GlcF or -GalF (30 μmol) was dissolved
in ammonium hydrogen carbonate buffer in D2O (pH = 7.8,
600 μL, 150 mmolL–1).
Experimental Section
General Optimized Procedure for the Synthesis of β-(1Ǟ3) Disac-
charides with Use of the Tt-β-Gly E338S Mutant: α-d-Glucopyr-
anosyl (or -galactopyranosyl) fluoride (18.2 mg, 0.1 mmol) and an
appropriate acceptor (0.1 mmol) were dissolved in ammonium car-
bonate buffer (pH = 7.8, 2 mL, 150 mmolL–1). The Tt-β-Gly
E338S mutant (0.126 mg, 0.9 mL), prepared as described above,
was then added and the mixture was stirred overnight at 55 °C.
After solvent removal under vacuum, the residue was purified by
flash chromatography to afford the corresponding disaccharides.
General: Directed mutagenesis of gene ttβGly was carried out by
PCR with overlapping extension, and cloning was done into the
pBtac2 vector at sites EcoRI-PstI. The primers Nphi1/Nphi2 (5Ј-
gtcacggcgaacggggccgcctac; 5Ј-gtaggcggccccgttcgccgtgac), Nphi3/
Nphi4 (5Ј-gtcacgtctaacggggccgcctac, 5Ј-gtaggcggccccgttagacgtgac),
and
Nphi5/Nphi6
(5Ј-gtcacgggtaacggggccgcctac,
5Јgtaggcggccccgttacccgtgac) were used to generate the mutant en-
zymes E338A, E338S, and E338G, respectively. Overexpression of
the different β-glycosidases was performed in E. coli strain XL1
Blue MRFЈ. After overnight cultivation in LB medium, cells were
harvested, lysed, and heated for 1 h at 70 °C to remove E. coli ther-
molabile proteins. Supernatants of centrifuged extracts were used
as biocatalysts in transglycosylation reactions.
Phenyl β-D-Glucopyranosyl-(1Ǟ3)-β-D-glucopyranoside: Flash
chromatography (AcOEt/MeOH/water, 17:2:1) gave the disaccha-
ride (33 mg, 75%) as a white solid. M.p. 77 °C. [α]2D0 = –39.1 (c =
1.067, H2O). Rf 0.62 (AcOEt/MeOH/water, 7:2:1). HRMS (CI/glyc-
erol) calcd. for C18H27O11 [M + H]+: 419.1475, found 419.1578.
NMR: see Table 2, Table 3, and Table 4.
Chemicals supplied by Aldrich were used without further purifica-
tion. The courses of the reactions were followed by TLC
(Merck F254 precoated silica gel 60 sheets) and proton NMR spec-
troscopy. The components of the reaction mixtures were separated
by silica gel chromatography. Complete analysis of the NMR 1H
and 13C resonances and subsequent structure assignments were car-
ried out by use of standard 2D sequences (COSY HH and HC
Phenyl β-D-Glucopyranosyl-(1Ǟ3)-β-D-galactopyranoside: Flash
chromatography (AcOEt/MeOH/water, 15:2:1) gave the disaccha-
ride (31 mg, 70%) as a white solid. M.p. 142 °C. [α]2D0 = +6.5 (c =
0.467, H2O). Rf = 0.51 (AcOEt/MeOH/water, 7:2:1). HRMS (CI/
glycerol) calcd. for C18H27O11 [M + H]+: 419.1475; found 419.1604.
NMR: see Table 5, Table 6, and Table 7.
Eur. J. Org. Chem. 2005, 1977–1983
© 2005 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
1981