Loop residues and catalysis in OMP synthase

Article abstract of DOI:10.1021/bi300082s

Residue-to-alanine mutations and a two-amino acid deletion have been made in the highly conserved catalytic loop (residues 100-109) of Salmonella typhimurium OMP synthase (orotate phosphoribosyltransferase, EC 2.4.2.10). As described previously, the K103A mutant enzyme exhibited a 10⁴-fold decrease in k_cat/K_M for PRPP; the K100A enzyme suffered a 50-fold decrease. Alanine mutations at His105 and Glu107 produced 40- and 7-fold decreases in k_cat/K_M, respectively, and E101A, D104A, and G106A were slightly faster than the wild-type (WT) in terms of k_cat, with minor effects on k_cat/K_M. Equilibrium binding of OMP or PRPP in binary complexes was affected little by loop mutation, suggesting that the energetics of ground-state binding have little contribution from the catalytic loop, or that a favorable binding energy is offset by costs of loop reorganization. Pre-steady-state kinetics for mutants showed that K103A and E107A had lost the burst of product formation in each direction that indicated rapid on-enzyme chemistry for WT, but that the burst was retained by H105A. Δ102Δ106, a loop-shortened enzyme with Ala102 and Gly106 deleted, showed a 10⁴-fold reduction of k_cat but almost unaltered K_D values for all four substrate molecules. The 20% (i.e., 1.20) intrinsic [1′-³H]OMP kinetic isotope effect (KIE) for WT is masked because of high forward and reverse commitment factors. K103A failed to express intrinsic KIEs fully (1.095 ± 0.013). In contrast, H105A, which has a smaller catalytic lesion, gave a [1′-³H]OMP KIE of 1.21 ± 0.0005, and E107A (1.179 ± 0.0049) also gave high values. These results are interpreted in the context of the X-ray structure of the complete substrate complex for the enzyme [Grubmeyer, C., Hansen, M. R., Fedorov, A. A., and Almo, S. C. (2012) Biochemistry 51 (preceding paper in this issue, DOI 10.1021/bi300083p)]. The full expression of KIEs by H105A and E107A may result from a less secure closure of the catalytic loop. The lower level of expression of the KIE by K103A suggests that in these mutant proteins the major barrier to catalysis is successful closure of the catalytic loop, which when closed, produces rapid and reversible catalysis. (Graph Presented).

Full text of DOI:10.1021/bi300082s

Article
pubs.acs.org/biochemistry
Loop Residues and Catalysis in OMP Synthase
Gary P. Wang,†,§ Michael Riis Hansen,‡ and Charles Grubmeyer*,†
†Department of Biochemistry and Fels Research Institute, Temple University School of Medicine, 3307 North Broad Street,
Philadelphia, Pennsylvania 19140, United States
‡Department of Biology, University of Copenhagen, Ole Maaløes Vej 5, DK-2200 Copenhagen N, Denmark
ABSTRACT: Residue-to-alanine mutations and a two-amino acid deletion
have been made in the highly conserved catalytic loop (residues 100−109) of
Salmonella typhimurium OMP synthase (orotate phosphoribosyltransferase, EC
2.4.2.10). As described previously, the K103A mutant enzyme exhibited a 104-
fold decrease in kcat/KM for PRPP; the K100A enzyme suffered a 50-fold
decrease. Alanine mutations at His105 and Glu107 produced 40- and 7-fold
decreases in kcat/KM, respectively, and E101A, D104A, and G106A were slightly
faster than the wild-type (WT) in terms of kcat, with minor effects on kcat/KM.
Equilibrium binding of OMP or PRPP in binary complexes was affected little by
loop mutation, suggesting that the energetics of ground-state binding have little
contribution from the catalytic loop, or that a favorable binding energy is offset
by costs of loop reorganization. Pre-steady-state kinetics for mutants showed
that K103A and E107A had lost the burst of product formation in each
direction that indicated rapid on-enzyme chemistry for WT, but that the burst was retained by H105A. Δ102Δ106, a loop-
shortened enzyme with Ala102 and Gly106 deleted, showed a 104-fold reduction of kcat but almost unaltered KD values for all
four substrate molecules. The 20% (i.e., 1.20) intrinsic [1′-3H]OMP kinetic isotope effect (KIE) for WT is masked because of
high forward and reverse commitment factors. K103A failed to express intrinsic KIEs fully (1.095 0.013). In contrast, H105A,
which has a smaller catalytic lesion, gave a [1′-3H]OMP KIE of 1.21 0.0005, and E107A (1.179 0.0049) also gave high
values. These results are interpreted in the context of the X-ray structure of the complete substrate complex for the enzyme
[Grubmeyer, C., Hansen, M. R., Fedorov, A. A., and Almo, S. C. (2012) Biochemistry 51 (preceding paper in this issue, DOI
10.1021/bi300083p)]. The full expression of KIEs by H105A and E107A may result from a less secure closure of the catalytic
loop. The lower level of expression of the KIE by K103A suggests that in these mutant proteins the major barrier to catalysis is
successful closure of the catalytic loop, which when closed, produces rapid and reversible catalysis.
MP synthase (orotate phosphoribosyltransferase, EC
2.4.2.10), like other members of the type I PRTase
occlude the active site and prevent an alternative net
elimination reaction from the ene−diol intermediate.8 In that
case, solid-state NMR indicated that loop movement rates are
not affected by the occupancy of the active site, suggesting that
loop movement is not gated by substrate.9 In other enzymes,
loop movement proceeds from an unstructured loop-open form
to one that becomes structured over the active site. This is the
case in GPAT10 and HGPRTase,11 two type I PRTases, both of
which show highly structured “closed” forms of the loop, which
also capture and immobilize bound water molecules, and
relatively unstructured “open” forms. In OMP synthase, as
shown in the preceding paper (DOI 10.1021/bi300083p), loop
closure also is a reordering event rather than rigid-body motion
about a hinge. For this type of movement to occur, there must
be a dynamic energetic balance between the energy-demanding
events of peptide ordering and the energy-yielding formation of
intraloop, loop−core, and loop−ligand hydrogen bonds. The
30:1 equilibrium of closed to open forms in binary E·MgPRPP
complexes6 suggests that the balance is only slightly in favor of
O
evolutionary family, is notable for the prominent peptide loop
adjacent to the active site. This loop is highly flexible in its open
state and is not visualized in electron density maps for some
OMP synthase structures (DOI 10.1021/bi300083p and refs
1−3). For catalysis to occur, the loop from one subunit must
descend to cover the active site formed by the adjacent
subunit.4 In its down position, as described for the yeast
enzyme by Gonzalez-Segura et al.5 and for the Salmonella
typhimurium enzyme in the preceding paper (DOI 10.1021/
bi300083p), the loop forms a pair of antiparallel β-strands, and
loop residue B factors resemble those for bulk protein atoms.
Five new interatomic contacts form within the loop, between
the loop and the remainder of the protein, and between the
loop and bound ligands. Previously, we measured loop
dynamics using nuclear magnetic resonance (NMR) and
found that loop movement from open to closed occurred
with a rate of ∼12000 s−1 when PRPP occupied the active site,
and that loop opening in this complex occurred at ∼400 s−1.6
Loop movements are recognized as an integral part of
Received: January 18, 2012
Revised: April 24, 2012
chemical catalysis by enzymes.7 One archetype for loop
movement is TIM, whose loop moves as a rigid body to
© XXXX American Chemical Society
A
dx.doi.org/10.1021/bi300082s | Biochemistry XXXX, XXX, XXX−XXX

Biochemistry
Article
loop closing, in keeping with the enzyme’s need to reopen to
release products. Interactions that favor or disfavor each of the
loop-open and loop-closed states will be important in
determining the equilibrium between them. As yet, we have
been unable to observe residue interactions in the loop-open
state.
competitive kinetic isotope effects (KIEs). In competitive KIE
measurements, we obtain a ratio that expresses the relative
success rates of different isotopically labeled substrates in
traversing the transition-state barrier. This ratio is partly
governed by the transition-state structure, which causes less
efficient catalysis with a particular labeled substrate. When a
Michaelis complex that has embarked along the reaction
coordinate encounters the energy barrier imposed by the
transition state, it may either traverse it or fall back to its
ground state. If escape of the labeled substrate is allowed, the
enzyme will discriminate against the heavy-atom label. If escape
is not allowed, no KIE will be expressed. In OMP synthase,
loop closure appears to physically block the egress of bound
substrates from the active site. Thus, loop opening would be
required for a KIE to be observed. If loop closure precedes
transition-state formation, then we would expect that mutants
with slow on-enzyme chemistry (i.e., a high barrier for the
chemical transition state) would allow for relatively frequent
loop opening on bound complexes, allowing full expression of
the KIE. In a similar way, mutants that have rapid chemistry
would not express a KIE. KIE studies have been conducted with
several enzymes with mobile elements and support the close
relationship between movement and catalysis.17−19
In OMP synthase, loop residues are known to be essential for
catalytic chemistry,4,12 and loop movement is thus responsible
for recruiting these essential residues to the active site. Several
chemical roles could be proposed. In the forward direction, the
transfer of a proton to the leaving pyrophosphate could
minimize accumulation of negative charge. Although the pKa
for PPi is only 9,13 protonation may provide slight assistance. At
the α-phosphate position, Lys26, His105, and Lys103 could
each perform proton transfer. Protonation may not be
necessary, in that positive charges provided by side chains
and metal ions may also neutralize some of the developing
electron density on leaving PPi. To some extent, this is clearly
the case, because the loop-closed active site surrounds the
pyrophosphate moiety with positive charges from Lys103,
Lys100, Arg99, and Lys26. A second mode of catalytic
participation would be for loop residues to participate in
geometric stabilization of the transition state, promoting the
straight line geometry of incoming and leaving ligands about
C1 of PRPP and OMP.14,15
It is also clear that large motions of bound substrates occur
leading up to transition-state formation. As discussed in the
preceding paper (DOI 10.1021/bi300083p), a 7 Å movement
of the ribosyl C1 atom is noted between its position in OMP
and PRPP complexes, and the preceding paper suggested that
1−2 Å of additional movement of C1 remains to be achieved. It
appears that as the loop undergoes its major closing movement,
the bound substrates move into position for catalysis.
One can inquire about the degree of coupling between
movement and chemistry. Bulk loop movement in OMP
synthase is relatively slow (values of 102−104 Hz were recorded
by Wang et al.6 for overall opening and closing) compared to
bond vibration frequencies (1012 Hz) that govern the lifetime of
transition states. This 8 order of magnitude difference in rates
suggests that coupling would be impossible. However, the
transition state involves a suite of atoms contributed by both
the substrate and the protein. In a completely concerted
mechanism, the transition state proper would be achieved as
movement of atoms from the bound substrate and from the
loop permitted the formation of intraloop, loop−core, and
loop−transition state hydrogen bonds. To the extent that these
final movements could be achieved only at the culmination of
the bulk motion of the loop, then the enzyme would efficiently
direct bulk loop motion into the reaction coordinate motion
required for catalysis. An alternative view is that the final steps
of loop movement set up a relatively long-lived (i.e.,
nanoseconds to milliseconds) state within which random
thermal movements allow for achievement of the transition
state. An analysis of hydrogen−deuterium amide exchange rates
in HGPRTase16 showed that a complex of that enzyme with a
transition-state analogue slowed exchange of loop (and
nonloop) amide protons far more efficiently than an
equilibrating Michaelis complex, suggesting specific and
widespread structural stiffening at or near the transition state
itself.
In this study, we have mutated each of the residues of the
catalytic loop of S. typhimurium OMP synthase. The mutant
enzymes show a range of catalytic lesion, from slight increases
in kcat to a 105-fold reduction. Chemical quench experiments
allow us to measure rates of on-enzyme chemistry. When KIE
experiments are performed with these mutant enzymes, several
show unexpected behavior.
MATERIALS AND METHODS
■
Materials. [2-14C]Orotic acid was a product of Moravek
Biochemicals, Inc. (Brea, CA). [γ-32P]ATP was from
Amersham. [32P]PPi was from Dupont NEN Research
Products. Thin layer chromatography plates of polyethylenei-
mine cellulose were obtained from Alltech (Deerfield, IL).
Yeast inorganic pyrophosphatase was purchased from Boeh-
ringer-Mannheim Corp. Inorganic chemicals and chromatog-
raphy solvents were purchased from Fisher. Mutagenic primers
were synthesized by Ransom Hill Bioscience, Inc. Materials for
mutagenesis and DNA sequencing procedures were purchased
from U.S. Biochemicals and New England Biolabs Inc. DTT
was from U.S. Biochemicals. Buffers, orotic acid, PRPP, OMP,
amino acids, other reagent grade biochemicals, and bacterial
culture media were obtained from Sigma. Sephadex G-50 resin
was from Pharmacia.
Synthesis of Radiolabeled Substrates. [2-14C]OMP was
prepared from [2-14C]orotate using OMP synthase.20
[β-32P]PRPP was prepared from [γ-32P]ATP using PRPP
synthase (a gift of R. Switzer) as previously described.21
[5-32P]PRPP was also prepared enzymatically. [γ-32P]ATP (40
μCi) was incubated with 200 μM ribose, 3 mM MgCl2, 5 mM
phosphoenolpyruvate, 25 units of ribokinase, and 10 units of
pyruvate kinase in 200 μL of 50 mM potassium phosphate and
50 mM Tricine (pH 8) at 30 °C for 1 h. Ribokinase and
pyruvate kinase were then removed from the reaction mixture
using a Centricon-10 apparatus. ATP was removed using a 1
mL column of charcoal/Whatman CF11 cellulose (1:4), and
ribose 5-phosphate was eluted with 50 mM potassium
phosphate (pH 8.0). The two 1 mL fractions containing
[5-32P]ribose 5-phosphate were incubated with 4.4 mM ATP,
4.4 mM MgCl2, 10 μg of pyruvate kinase, 2.2 mM
Few techniques allow us to view protein dynamics at the high
frequency or small distance range demanded by the transition
state. One technique available to enzymologists is that of
B
dx.doi.org/10.1021/bi300082s | Biochemistry XXXX, XXX, XXX−XXX

Biochemistry
Article
phosphoenolpyruvate, 1 unit of rabbit muscle adenylate kinase,
and 1 flake (∼0.1 mg) of freeze-dried PRPP synthase for 30
min at 30 °C. Enzymes and ATP were removed as described
above. The fractions from the charcoal column containing
[5-32P]PRPP were pooled and applied to a Mono-Q column
(Pharmacia, 0.5 cm × 5 cm). The column was eluted at 1 mL/
min with a 60 mL linear gradient from 0 to 1 M NaCl in 20
mM sodium phosphate (pH 7.4). The fractions containing
radiolabeled PRPP were detected by Cerenkov radiation in a
liquid scintillation counter, pooled, aliquoted, and stored at
−80 °C until they were used.
To construct the loop mutants, overlap PCR was similarly
employed using pGW01 as a template. Oligonucleotide primers
for the mutagenesis procedures are listed in Table 1. To
Table 1. Oligonucleotide Primers for the Site-Directed
Mutagenesis Procedure
mutant
E101A
mutagenic primer
5′ CCGCAAAGCGGCAAAAGATCATG 3′
5′ CTTTTGCCGCTTTGCGGTTAAAG 3′
5′ GGCAAAAGCTCATGGTGAAGGC 3′
5′ CACCATGAGCTTTTGCCTCTTTG 3′
5′ CAAAAGATGCTGGTGAAGGCGG 3′
5′ CTTCACCAGCATCTTTTGCCTCT 3′
5′ AGATCATGCTGAAGGCGGGAGC 3′
5′ CGCCTTCAGCATGATCTTTTGCC 3′
5′ TCATGGTGCAGGCGGGAGCCT 3′
5′ TCCCGCCTGCACCATGATCTTTT 3′
5′ ATGGTGAAGCCGGGAGCCT 3′
D104A
H105A
G106A
E107A
[1-3H]PRPP was prepared from [1-3H]ribose (Moravek)
using ribokinase and PRPP synthase in a single reaction mix.
Reaction mixtures (1 mL) contained 3.3 mM ATP, 1 mM
MgCl2, 100 μM ribose, [1-3H]ribose, 10 μg of pyruvate kinase,
2.5 mM phosphoenolpyruvate, 1 unit of rabbit muscle
adenylate kinase, and 25 units of ribokinase. One flake of
PRPP synthase was added, and reaction was allowed to
continue at 30 °C for 60 min. Enzymes and ATP were
removed, and the labeled PRPP was purified as described above
for [5-32P]PRPP. For synthesis of [4,5-14C]PRPP, [5,6-14C]-
glucose (American Radiolabeled Compounds) (60 mCi/mmol)
was used as the precursor in a single reaction taken from Li.22
Reaction mixtures (1 mL) in 50 mM potassium phosphate (pH
7.8) contained 10 mM MgCl2, 1 mM ATP, 10 μCi of
[5,6-14C]glucose, 20 mM phosphoenolpyruvate, 5 mM NADP,
10 mM α-ketoglutarate, 5 units of yeast hexokinase, 1 unit of
rabbit muscle pyruvate kinase, 5 units of yeast glucose-6-
phosphate dehydrogenase, 0.5 unit of yeast 6-phosphogluco-
nate dehydrogenase, 1 unit of Torula phosphoriboisomerase, 1
flake of PRPP synthase, and 1 unit of beef liver L-glutamate
dehydrogenase. Precipitated ammonium sulfate suspensions
used for pyruvate kinase and glutamate dehydrogenase
provided sufficient ammonium ion for the glutamate dehydro-
genase reaction. After reaction, enzyme protein was removed
with a Centricon device, and the PRPP was purified by Mono-
Q chromatography as described above.
G108A
G109A
Δ102Δ106
5′ GGCTCCCGGCTTCACCATGA 3′
5′ AAGGCGCGAGCCTGGTGGG 3′
5′ AGGCTCGCGCCTTCACCATG 3′
5′ AAGAGAAAGATCATGAAGGCGGGA 3′
5′ CCTTCATGATCTTTCTCTTTGCGG 3′
5′ GCGAATCCATATGAAACCGTATC 3′
5′ CCGGCAGGATCCGCTTACAC 3′
5′ flanking primer
3′ flanking primer
minimize subsequent DNA sequencing, the 0.7 kb PCR
product carrying the mutation was digested with BglII and
BssHII, and the 68 bp fragment was ligated with pGW01
previously cut with the same restriction endonucleases,
resulting in a recombinant plasmid carrying the mutation in
the coding sequence. All desired mutations were confirmed by
DNA sequencing of the 68 bp insert.
To overexpress WT and mutant OMP synthase, the
recombinant plasmid was transformed into Escherichia coli
host BL21(DE3). Both WT and mutant constructs produced a
high level of expression. Enzymes were purified from 6 L
cultures using the protocol described by Bhatia et al.24 with
modification,25 except that 0.1 mM phenylmethanesulfonyl
fluoride (PMSF) was added to the cells immediately prior to
sonication. Approximately 200−250 mg of highly homoge-
neous OMP synthase was typically isolated from 20 g of cells.
Enzyme Preparation. OMP synthase mutant proteins were
prepared using the procedure described previously for the WT
enzyme12 and were highly homogeneous. Prior to enzymatic
assays, enzymes stored in 65% saturation (NH4)2SO4 at 4 °C
were centrifuged and desalted using centrifuge columns.26 The
revised extinction coefficient of 0.51 for a 1 mg/mL solution at
280 nm20 was used throughout this work. The molecular
weight of the enzyme, 23561,27 was used to calculate the
molarity of the enzyme subunit.
Enzyme Assays. Pyrophosphorolysis of OMP (the stand-
ard reverse OMP synthase reaction) was monitored in the
thermostated cuvette holder of a spectrophotometer as an
increase in absorbance at 302−304 nm as previously
described.25 The standard forward reaction using orotate and
PRPP as substrates was monitored as a decrease in absorbance
over the same wavelength region. Buildup of inhibitory OMP
limits the extent of the linear portion of progress curves. For
each assay, the buffer mixture was allowed to reach thermal
equilibrium in a 30 °C dry bath before addition of substrates
followed by 0.05−0.1 μg of WT enzyme. For the less active
[1′-3H]OMP and [4′,5′-14C]OMP were prepared from the
cognate-labeled and purified PRPP molecules using OMP
synthase. Reaction mixtures (1 mL) in 50 mM potassium
phosphate (pH 7.4) contained 6 mM MgCl2, 0.3 mM orotate, 2
units of yeast pyrophosphatase, and labeled PRPP (5 μCi). The
reaction was started by addition of 20−50 μg of K26A OMP
synthase, previously dissolved in the same buffer. After 30 min
at 30 °C, enzymes were removed with a Microcon device, and
the OMP was purified by Mono-Q chromatography as
described for PRPP, except that a 120 mL gradient was
employed.
Construction and Purification of OMP Synthase Loop
Mutants. A silent mutation 5′ of the loop coding sequence
generated using overlap PCR23 introduced a BglII site. This
BglII restriction site and a naturally occurring BssHII site 3′ of
the loop coding sequence allowed insertion of PCR fragments
encoding any desired loop sequence. A 1 kb EcoRI−PstI
fragment from pCG1324 encoding the entire pyrE gene of S.
typhimurium OMP synthase was used as the template. The
following oligonucleotide primers were used: 5′ CACGA-
TAAAGATCTGCCGTACTGC 3′ and 5′ GCAGTACGGCA-
GATCTTTATCGTG 3′. The 0.7 kb PCR product, containing
the new BglII site, was digested with NdeI and BamHI and
ligated with T7 promoter vector pRSET C (Stratagene)
previously digested with NdeI and BglII, yielding pGW01.
The entire coding sequence was subjected to DNA sequencing.
C
dx.doi.org/10.1021/bi300082s | Biochemistry XXXX, XXX, XXX−XXX

Biochemistry
Article
mutant OMP synthases, the quantity of enzyme was increased
as needed to produce measurable linear initial rates. One unit of
activity was defined as the amount of enzyme needed to
convert 1 μmol of orotate to OMP (or 1 μmol of OMP to
orotate) per minute at 30 °C. For the calculation of kcat, the
subunit Mr was employed as noted in the legends of the tables
and figures.
Steady-state kinetic experiments were conducted for WT and
mutant enzymes by monitoring absorbance changes at 302−
304 nm at 30 °C in both the forward phosphoribosyltransferase
and the reverse pyrophosphorolysis reactions.12 Assay mixtures
for the forward reaction contained 75 mM Tris-HCl, 6 mM
MgCl2 (pH 8.0), and 10−300 μM orotate at 1 mM PRPP, or
20−1000 μM PRPP at 300 μM orotate in a 1.0 mL final
volume. For the reverse reaction, assay mixtures were
composed of 80 mM Tris-HCl, 3 mM MgCl2 (pH 8.0), and
1.5−100 μM OMP at 2 mM PPi, or 20−2000 μM PPi at 100
μM OMP in the same final volume. The use of 0.05−0.1 μg of
WT or 0.05−50 μg of mutant OMP synthase provided
quantifiable linear initial rates for the calculation of kinetic
parameters. All kinetic data were analyzed as described
previously,24 and KM and Vmax are reported with their standard
errors.
every experiment, a separate reaction was performed in which
no enzyme was added (designated 0% reaction) and one in
which 0.25 mM hypoxanthine and 200 μg of human
HGPRTase were present (100% reaction). Two 50%
conversion reactions were run. Reactions were terminated by
the addition of EDTA (pH 8.0) to a final concentration of 50
mM (resulting in 1.1 mL); a 0.05 mL sample was taken to
determine the total counts per minute, and 1.0 mL of the
remaining mixture was applied to columns (5−6 cm in pasteur
pipettes plugged with glass wool) of a Whatman CF11
cellulose/activated charcoal mixture (4:1, w:w), previously
equilibrated with 50 mM potassium phosphate (pH 7.4). Three
1 mL washes with 50 mM potassium phosphate (pH 7.4) were
used to produce a total of four fractions, collected in Research
Products International 20 mL glass scintillation vials. To each
fraction was added 15 mL of ICN Eco-Lite(+) liquid
scintillation cocktail. The contents of the vials were mixed,
and the radioactivity in each was measured using a Beckman
LS6500 liquid scintillation counter. The dual-channel program
employed was uncorrected for quenching. Separate determi-
3
nations verified that no spillover from the H channel into the
14C channel occurred and quantitated the spillover of counts
3
from 14C into the H channel. The complete sequence of vials
Equilibrium Binding. For the binding of PRPP, OMP,
orotate, and PPi, a centrifugal filtration method using
Centricon-10 or Microcon-10 apparatus (Amicon) was
employed.20 The buffer consisted of 80 mM Tris-HCl or Na-
Tricine (pH 8.0) in the presence of MgCl2 (3−15 mM, as
noted). All binding data were subsequently fit to a single-site
model using UltraFit (Biosoft). KD and n values are reported.
Chemical Quench Experiments. Pre-steady-state analyses
for selected OMP synthase mutants were performed in an
Update Instruments (Madison, WI) Precision Syringe Ram,
model 1010, equipped with a grid-type mixer, following the
protocols described previously for the WT enzyme.20 For the
analysis of the reaction kinetics in K103A, E107A, and H105A,
concentrations of the reaction components are given in the
figure legends. Mixtures for reactions quenched in 0.9 N
perchloric acid were centrifuged to remove denatured protein,
neutralized with 6 N KOH, and chilled on ice. KClO4
precipitate was removed by centrifugation, and the samples
were stored at −20 °C overnight. Prior to the chromatographic
analysis, the reaction mixtures were thawed on ice, and
additional KClO4 precipitate was again removed by centrifu-
gation. A sample of the supernatant (200 μL) was applied to an
anion exchange column (0.4 cm × 25 cm, Alltech or ISCO
SAX, 5 μm) with isocratic elution at 1 mL/min in 20 mM
sodium phosphate (pH 6.1). Under these conditions, OMP
elutes at 8 min and orotate elutes at 3.5−5 min. Radioactive
orotate and OMP were quantitated by liquid scintillation
counting.
Kinetic Isotope Effects. For the forward reaction, 1.0 mL
mixtures contained 50 mM potassium phosphate buffer (pH
7.4), 3 mM MgCl2, 0.6 mM orotate, 1.5 units of yeast OMP
decarboxylase (Sigma product O-9251), 2 units of yeast
inorganic pyrophosphatase (Boehringer product 108987), and
100 μM PRPP, containing ∼10000 cpm each of [1-3H]PRPP
and either [5-14C]PRPP or [5-32P]PRPP. Reactions were
initiated by the addition of enzyme and preceded for 20−30
min at 30 °C, using a quantity of WT or mutant OMP synthase
sufficient to produce ∼50% conversion of labeled PRPP to
OMP, an extent of conversion that gives optimal accuracy in
quantitating KIE values from the remaining substrate.28 For
for each entire experiment was counted 10 times. In some
cases, the first several rounds of counting appeared to show
minor luminescence (anomalously high or erratic 3H:14C
ratios), and the data were rejected. Data from each count
cycle were analyzed by separately summing 3H and 14C
radioactivity from those background-corrected fractions that
contained radiolabel from remaining PRPP, typically fractions 2
and 3. Comparing the 50% conversion radioactivity with that
for 0% (which typically contained 1−2% of the expected
radioactivity for each isotope) and 100% (which typically
contained 98−101% of the expected radioactivity for each
isotope) allowed an accurate calculation of the percent
conversion of each isotopically labeled PRPP to OMP. In
most experiments, the 0% and 100% values for the entire series
of 10 count cycles were averaged and the mean value was used
for the calculation of the individual KIEs in the next step. The
equations given by Parkin28 were used in a computer
spreadsheet used to calculate the KIE for each count cycle.
The mean of all the KIE values for the 10 cycles was calculated,
together with the standard deviation. Data from two to five
experiments were averaged, and a standard deviation was
calculated. Low standard deviations within an experiment, and
reproducibility, were critically dependent on several of the
procedures employed here, including the use of glass vials, a
high-quality cocktail, and the use of repeated count cycles.
For the reverse reaction, the procedure differed in only a few
respects. Reaction mixtures (1 mL) contained 50 mM
potassium phosphate (pH 7.4), 3 mM MgCl2, 0.25 mM
NaPPi, and 100 μM OMP with no coupling enzymes present.
The radioactive label was a mixture of [1′-3H]OMP and
[5′-14C]OMP. Reactions (20−30 min) were set up to give 25−
30% conversion of OMP to PRPP. A 0% conversion sample
contained no enzyme, and a 100% conversion was performed
with WT OMP synthase. Sample workup and calculations were
identical to those described above.
RESULTS
■
Site-Directed Mutagenesis of Surface Loop Residues.
Comparison of sequences among pyrE genes encoding OMP
synthase reveals a high degree of sequence conservation in the
D
dx.doi.org/10.1021/bi300082s | Biochemistry XXXX, XXX, XXX−XXX

Biochemistry
Article
a
Table 2. Steady-State Kinetic Parameters of Catalytic Loop Mutants of S. typhimurium OMP Synthase at 30 °C in the Forward
Phosphoribosyltransferase Reaction
PRPP
kcat/KM (mM−1 s−1
orotate
kcat/KM (mM−1 s−1
)
enzyme
WT
kcat (s−1
)
KM (μM)
18
179 11
)
KM (μM)
56 2.5
12 0.2
72 4.5
0.05 0.002
64 2.5
5.3 0.8
57 1.5
2.4 0.3
28 2.0
5
3100
64
19
72
3
4
3000
160
1150
1
b
K100A
E101A
26
285
42
66
38
6
4
4
6
8
7
3
2750
62 11
b
K103A
0.2
42
26
3
4
D104A
H105A
G106A
E107A
G109A
1500
80
2500
30
179 10
87
1500
420
670
6
650
6
380 100
137 26
42 10
205
a
b
For the calculation of kcat, the subunit Mr was employed. Data from ref 12.
a
Table 3. Steady-State Kinetic Parameters of Catalytic Loop Mutants of S. typhimurium OMP Synthase at 30 °C in the Reverse
Pyrophosphorolysis Reaction
OMP
kcat/KM (mM−1 s−1
PPi
enzyme
WT
kcat (s−1
)
KM (μM)
)
KM (μM)
31
958 40
kcat/KM (mM−1 s−1
)
18 0.3
12 0.2
3
13
4
0.3
1
5200
920
3
580
13
b
K100A
E101A
25 1.8
1
7040
86
146
28
6
1
3
295
0.3
670
2.6
165
1
b
K103A
0.05 0.001
18 0.5
20
16
7
1
2.5
D104A
H105A
G106A
E107A
G109A
9
1160
300
2.2 0.2
17 1.8
1
822 27
100 11
297 76
627 90
11
14
8
4
1560
21
0.3 0.04
13 0.7
6
1
1610
20
a
b
For the calculation of kcat, the subunit Mr was employed. Data from ref 12.
region between Arg99 and Gly109. Identification of the
conserved surface mobile loop prompted us to investigate the
catalytic roles of individual loop residues by alanine scanning.29
A deletion mutant, designated Δ102Δ106, was also constructed
in which two residues, Ala102 and Gly106, that flank the
catalytically essential Lys103 were removed.
Expression and Purification of Mutant OMP Syn-
thases. All mutant constructs produced high levels of
expression in E. coli BL21(DE3) and gave large quantities of
highly purified enzyme. No stability problems were noted with
any of the mutant enzymes.
Steady-State Kinetics of Loop Mutants. Steady-state
kinetic parameters were determined for each loop mutant
(Tables 2 and 3). Previously published data for K100A and
K103A12 are included for comparison. The most dramatic effect
on enzymatic activity upon alanine substitution was observed in
the K103A mutant. The kcat values for the forward and reverse
reactions decreased 1000- and 350-fold relative to the value for
WT, respectively. The catalytic efficiency, kcat/KM, for each of
the four substrates was also severely decreased.
pronounced effects (5−50-fold decreases) on the kcat/KM
values.
The H105A mutant enzyme suffered a 10-fold decrease in
kcat values in each direction. The kcat/KM values displayed 20−
200-fold decreases. The G109A mutant showed 1.5- and 2-fold
decreases in kcat and 3−30-fold decreases in kcat/KM. Alanine
substitution at Glu101, Asp104, or Gly106 resulted in no
change (G106A) or even a slight increase (E101A and D104A)
in activity. In these mutants, only small changes (<5-fold) in
the kcat/KM values were observed for each of the four substrates.
Equilibrium Binding Measurements. The KD values for
OMP and PRPP for the mutant enzymes (Table 4) showed few
significant effects. D104A showed tighter binding of PRPP.
Table 4. Equilibrium Binding Constants for Selected S.
a
typhimurium OMP Synthase Mutants
KD (μM)
enzyme
OMP
PRPP
The smaller changes in the steady-state kinetic parameters
for the E107A mutant paralleled those of K103A. The kcat
values for the E107A mutant exhibited a 23- and 60-fold
decreases for the forward and reverse reactions, respectively.
The kcat/KM value for PPi decreased 600-fold, whereas that for
OMP dropped 250-fold relative to the WT value. The mutation
also produced a 500-fold decrease in the catalytic efficiency for
orotate, whereas the value for PRPP decreased only 7-fold.
Alanine substitution at Lys100 produced mild (1.5- and 5-
fold) changes in the steady-state kcat values, but more
WT
3
12
3
0.1
33 0.5
E101A
K103A
D104A
H105A
E107A
2
36
3
0.1
b
125 11
13 0.7
ND
4
0.3
92 11
c
6.5 0.8
7.1
0.5
a
Experiments performed in 80 mM Tris-HCl (pH 8). The
stoichiometry (n) was close to 1 mol of ligand/mol of subunit for
all enzymes. Not determined. Experiment performed in 80 mM Na-
b
c
Tricine (pH 8).
E
dx.doi.org/10.1021/bi300082s | Biochemistry XXXX, XXX, XXX−XXX

Biochemistry
Article
Pre-Steady-State Analysis. The pre-steady-state kinetics
of the WT enzyme showed that overall forward or reverse
catalysis proceeds with a rapid (>300 s−1) on-enzyme chemistry
followed by a slower step involving product release through
loop opening and partitioning between loop reclosure and
product release.6,20 Mutants in which on-enzyme chemistry is
no longer fast relative to the release of products should fail to
show pre-steady-state bursts, whereas a burst of product
formation is expected if product release remains rate-limiting.
K103A showed no evidence of a pre-steady-state burst
(Figure 1). In the forward reaction at 22 °C, the steady-state
Figure 2. Rate of product formation for the E107A mutant in the
reverse pyrophosphorolysis reaction at 22 °C. The chemical quench
study was conducted as described in Materials and Methods. The
reaction mixture contained 300 μM [14C]OMP, 2 mM PPi, 3 mM
MgCl2, and 30 μM E107A mutant enzyme in 80 mM Tris-HCl (pH
8.0). No burst of product formation was observed. The calculated
steady-state rate was 0.4 s−1 (see the text). Note that the y-axis
represents catalysis on a per dimer basis.
Figure 1. Rate of product formation for K103A in the forward
phosphoribosyltransferase reaction at 22 °C. The chemical quench
study was conducted as described in Materials and Methods. The
reaction mixture contained 1014 μM [2-14C]orotate, 6 mM PRPP, 12
mM MgCl2, and 45 μM K103A mutant enzyme in 80 mM Tris-HCl
(pH 8.0). No burst of product formation was observed. The calculated
steady-state rate was 0.02 s−1 (see the text). Note that the y-axis
represents catalysis on a per dimer basis.
rate was 0.02 s−1, comparable to the kcat value (0.05 s−1)
determined at 30 °C. These results appear to indicate that
K103A undergoes a rate-limiting on-enzyme step that could be
phosphoribosyl transfer chemistry, or a step preceding it.
For the E107A mutant in which a significant reduction in the
kcat value was observed, the chemical quench analysis in the
reverse reaction showed no pre-steady-state burst of orotate
formation (Figure 2). The steady-state rate was 0.4 s−1,
comparable to the kcat value determined at 30 °C (0.3 s−1).
For the H105A mutant, transient kinetic experiments
performed in the forward and reverse reactions revealed pre-
steady-state bursts of OMP formation followed by a slower
steady-state phase (Figure 3, reverse reaction not shown). The
pre-steady-state phase was fit to a rate constant of 200 s−1. The
magnitude of the burst was 0.64 0.08 mol of [14C]OMP/mol
of enzyme dimer. The steady-state phase (6.4 s−1) was
comparable to the kcat value (5.3 s−1) determined spectrophoto-
metrically at 30 °C. Thus, catalysis of the H105A mutant, like
that of the WT enzyme, proceeds with a relatively rapid on-
enzyme chemistry followed by a slow step, probably associated
with the overall product release process.
Figure 3. Rate of product formation for the H105A mutant in the
forward phosphoribosyltransferase reaction at 22 °C. The reaction
mixture contained 405 μM [2-14C]orotate, 2 mM PRPP, 6 mM MgCl2,
and 40.5 μM H105A mutant enzyme in 80 mM Tris-HCl (pH 8.0). A
burst of product formation followed by a steady-state phase was
obst
observed. The data were fit to the equation y = N(1 − e−k ) + kt
[using SigmaPlot (SPSS, Inc.)]. The burst phase was fit to a rate (kobs
)
of 200 s−1. The magnitude of the burst (N) was 0.64 mol of
[14C]OMP/mol of dimer. The calculated steady-state rate (6.4 s−1)
was comparable to the value of kcat obtained at 30 °C (5.3 s−1) from
spectrophotometric measurements. Note that the y-axis represents
catalysis on a per dimer basis.
binding constants (KD) for all four ligands are listed in Table 5.
Only minor changes in the KD values for PRPP and OMP were
noted.
Kinetic Isotope Effect Studies. Competitive kinetic
isotope effects provide a view of the transition state.30 The
use of the slowly utilized substrate phosphonoacetate allowed
measurement14,15 of an intrinsic [1′-3H]OMP KIE of 1.20 for
the reverse reaction, which together with other KIE values led
to the structure of an oxocarbenium-like transition state for
group transfer. Such SN1-like transition states are very frequent
among ribosyl transfers31 and uniformly give rise to similarly
significant intrinsic 1-3H α-secondary isotope effects. In this
Δ102Δ106, a Loop-Deleted OMP Synthase. The
deletion mutant, Δ102Δ106, suffered the largest decrease in
the values of kcat: 56000- and 29000-fold for the forward and
reverse reactions, respectively. The marked reduction in the kcat
values for Δ102Δ106 emphasizes that the loop is extremely
important, although not absolutely essential. The equilibrium
F
dx.doi.org/10.1021/bi300082s | Biochemistry XXXX, XXX, XXX−XXX

Biochemistry
Article
values determined previously,14,15 and the [1′-3H]PRPP value
Table 5. Equilibrium Binding Constants for WT S.
typhimurium OMP Synthase and the Loop Deletant
Δ102Δ106
of 1.019
0.007 is that expected for the high commitment
factors for that substrate. G106A and D104A also show low
KIEs. However, the behavior of H105A differs: the value of
1.21 0.005 for [1′-3H]OMP is identical to the intrinsic KIE
measured previously,14,15 and the value of 1.136 0.0071 for
[1-3H]PRPP is the highest of any of the values seen here. In a
similar although less pronounced fashion, the reverse reaction
for E101A and both reactions of E107A also show pronounced
KIE values.
More surprising was the finding that K103A, the slowest
single-point mutant, gave a WT-like KIE in the forward
direction and a KIE of 1.095 0.013 in the reverse. This latter
measurement was repeated many times, and special caution was
taken to avoid contamination with the WT E. coli enzyme.
WT
KD (μM)
Δ102Δ106
KD (μM)
a
a
ligand
n
n
orotate
PRPP
OMP
280 30
33 0.5
3.1 0.1
960 120
0.90
0.85
0.90
0.86
340 50
80 17
0.71
0.90
0.75
0.66
2.0 0.1
900 300
b
PPi
a
Expressed as moles of ligand bound per mole of subunit. Values
10%. Values were extrapolated from Scatchard plots due to weak
b
binding.
work, the transition-state structures for mutant enzymes were
not determined and were assumed to be similar to WT. This
assumption may be incorrect, in that mutation of key residues
or even at remote sites has been shown to alter transition-state
structure.19,32 In addition to the intrinsic KIE, three other
components determine observed competitive KIE values. The
forward and reverse commitment factors (cf and cr,
respectively30) quantitate the extent to which the labeled
substrate and product have an opportunity to dissociate from
complexes that are in equilibrium with the transition state.
Finally, the isotopic equilibrium constant (TKeq) for the
isotopically sensitive step also participates. In OMP synthase,
both forward and reverse commitment factors for KIE
experiments using PRPP and OMP are substantial and mask
intrinsic KIEs. Any change that lowers these commitments will
allow the expression of intrinsic KIEs. Because movement of
the flexible loop is essential for closing the active site, and for
either subsequent or concerted development of the transition
state, it was of interest to determine the observed KIE for loop
mutants.
DISCUSSION
■
Our findings here can be discussed in two parts. First, it is clear
that several loop residues are important to the OMP synthase
reaction, and that these residues must exercise their function in
loop-closed complexes. Second, loop mutation produced a
somewhat unexpected pattern of KIE effects, which may
provide insights into the role of loop residues in catalysis.
Our previous chemical modification and mutagenesis studies
of Lys100 and Lys103 revealed that these residues were
important.12,25 For Lys100, the structure of the asymmetric
loop-closed enzyme (DOI 10.1021/bi300083p and ref 5)
revealed a potential role in intersubunit communication.
Ground-state binding of both PRPP and PPi is affected, with
1.5−5-fold decreases in kcat.
Lys103 is clearly more important to catalysis. K103A suffered
2000−15000-fold decreases in kcat/KM in both directions. The
mutant enzyme also has slow on-enzyme chemistry, as revealed
by pre-steady-state kinetics. Given the formation of three
hydrogen bonds to the α- and β-phosphates of PRPP in the
closed structure (DOI 10.1021/bi300083p and ref 5), Lys103
appears poised to provide geometric stabilization, proton
transfer, or charge neutralization at the transition state. This
interaction is only of moderate importance in the binary
complex with MgPRPP, where a 4-fold increase in KD was
recorded, or with OMP, whose KD was unchanged by the
mutation.
From the position of His105 at the tip of the loop, and its
relatively high degree of conservation among OMP synthases
(in bifunctional UMP synthases, His105 is replaced with
tyrosine), it appeared that this residue might have an essential
role in catalysis. The structure of the loop-closed form (DOI
10.1021/bi300083p and ref 5) suggests a direct role for His105
in binding to the α-phosphate, perhaps protonation or
deprotonation of the leaving or attacking pyrophosphate,
respectively. The H105A enzyme preserved a catalytic burst
in pre-steady-state chemical quench experiments with a 10-fold
reduction in kcat. Binding of PRPP and OMP in binary
complexes was affected little by the mutation.
Because Lys103 was the most critical residue, we sought to
alter its position in the complete Michaelis complex by
removing flanking residues Ala102 and Gly106 to produce
Δ102Δ106. From the WT structure, it is likely that three
hydrogen bonds from Lys103 to PRPP and one from His105 to
PRPP will be lost, as well as intraloop hydrogen bonds between
the Lys103 peptide nitrogen and the Gly109 carbonyl oxygen,
between the Lys103 ε-amino and the carboxylate of Glu107,
and between the His105 carbonyl oxygen and Gly108 peptide
For conversion of OMP to PRPP, the competitive KIE28
3
method measures enrichment of 14C over H in the product
PRPP. For the forward KIE using [1-3H]PRPP, what is
measured is enrichment of 3H over 14C in the remaining PRPP.
In each case, a trapping system (PPiase or OMP decarboxylase)
was used to capture one released product and render the net
reaction irreversible.
KIE data are listed in Table 6. For WT, the observation of a
modest KIE of 1.059 0.004 in the reverse reaction duplicates
Table 6. 1′-3H Kinetic Isotope Effects on S. typhimurium
a
Mutant OMP synthases
forward
reverse
kcat/KM for
PRPP (x-
kcat/KM for
OMP (x-
fold
fold
b
c
enzyme
decrease)
KIE
decrease)
KIE
WT
(1)
1.1
1.019 0.0069
1.016 0.0025
1.020 0.0079
1.012 0.0031
1.136 0.0071
1.057 0.0138
1.111 0.0038
1.118 0.0074
(1)
0.74
2080
4.5
1.059 0.0038
1.155 0.0064
1.095 0.013
1.026 0.0095
1.210 0.0050
1.057 0.0043
1.179 0.0049
1.153 0.0028
E101A
K103A
D104A
H105A
G106A
E107A
G109A
15500
2.1
39
17
2.1
3.4
7.4
248
3.3
4.6
a
Kinetic isotope effects for the forward direction with [1-3H]PRPP
and for the reverse reaction with [1′-3H]OMP were measured as
described in Materials and Methods. From Table 2. From Table 3.
b
c
G
dx.doi.org/10.1021/bi300082s | Biochemistry XXXX, XXX, XXX−XXX

Biochemistry
Article
nitrogen. One would predict that the closed loop of Δ102Δ106
would be far looser in structure than WT and would need to be
deformed if Lys103 and His105 of the truncated loop are to
reach the α-phosphate of PRPP. This mutant was severely
crippled, suffering a 105-fold reduction in kcat, suggesting the
interactions of Lys103 and perhaps His105 in stabilizing the
transition state are worth up to 6.4 kcal/mol.
Glu107 also participates in hydrogen bonds that appear to be
important for productive loop closing, including a 2.7 Å bond
to the ε-amino of Lys103 and a 2.7 Å interaction with the ε-
amino of Lys73 provided by the other subunit of the dimer. In
E107A, kcat values were correspondingly reduced by 25−60-fold
and kcat/KM values were reduced by 7−500-fold.
The behavior of some of the other loop residues is puzzling.
Asp104 makes no interactions that can be seen in the loop-
closed structure. However, the residue is well-conserved, being
replaced with alanine in a few bifunctional UMP synthases.
Kinetic data show that the D104A enzyme is slightly faster than
WT, with minor decreases in kcat/KM values. We note that
Asp104 is at the interface of the two open loops of previous
structures (e.g., Protein Data Bank entry 1OPR2), and although
side chains were too mobile to be assigned in those complexes,
it may be that Asp104 from one loop and Lys103 from the
other loop can pair to stabilize the loop-open conformation of
the dimer.
Like D104A, E101A was reproducibly faster in catalysis than
WT, with no change in KD for PRPP and a 4-fold increase for
OMP. No hydrogen bonds, other than a long backbone amide
bond to Arg99, can be seen in the loop-closed structure. It
again appears that loop-open structures may prove to be more
valuable in revealing the role for Glu101.
The picture we get from the catalytic effects of loop mutation
is that loop residues may be responsible for a considerable
contribution to catalysis, stabilizing the transition state by ∼6
kcal/mol. The simple and naive way to think about this
stabilization is that loop movement and chemistry are
concerted processes: substrates bind to an open active site,
and then as the loop closes, ligand movement and residue
movement occur and reach their culmination as the transition
state is reached. What is pleasing about this proposal is its
continuous nature: once loop closure begins, there is no reason
why it should stop until opposing steric forces or the height of
the combined motional and chemical transition-state barrier
stops it. This kind of coupling contains the idea that the
chemical barrier to catalysis is only one component of the many
bonding interactions that change as the motion reaches its
culmination. What is less pleasing about this proposal is the
rates of events. Because overall loop closing may occur at 12000
s−1,6 but the lifetime of a transition state is less than that of a
bond vibration, 10−12 s, this analysis is clearly limited.
Another analysis suggests that the ligand-bound loop-open
state is followed by a discrete loop-closed intermediate, like that
described in the crystal structure. In this state, catalysis awaits
minor adjustments of residues to occur in the transition state.
This model resembles the “near attack conformers” (NACS)
proposed by Bruice and Benkovic.33 Because we can observe
such a loop-closed state in the crystal structure, it is clearly
achievable.
transition-state barrier at which the isotope effect occurs,
3
designated k in this case) into an observed competitive KIE
is34
KIE = [3k + cf + cr(3Keq)]/(1 + cr + cf)
If 3Keq, the isotopic equilibrium, is assumed to be close to 1, the
equation simplifies to
KIE = (3kk + cf + cr)/(1 + cr + cf)
in which cf and cr are commitment factors that represent the
partitioning of bound substrate between net forward catalysis
and dissociation (cf) and of bound product between
dissociation and recrossing of the transition-state barrier (cr),
respectively. Here, we make an assumption that the transition
3
state, and thus k, will remain relatively constant among the
mutant enzymes and that only alterations in commitment
3
factors have changed. Because the origin of the k of 1.20 for
OMP synthase is the oxocarbenium ion character of the
transition state, which is in large part a result of the character of
the ribosyl substrates, this is likely. However, it may be that in
the absence of key residues for generating or stabilizing the
oxocarbenium-like transition state, the transition state itself
3
becomes more Sn2-like, with a 1-3H k approaching 1. This
outcome has been observed for the human purine nucleoside
phosphorylase, even with remote mutation.19,32 No further
experiments were undertaken to rule out such changes in the
transition state with mutant OMP synthases.
When 3k has a value of >1, but bound substrate (or product)
does not have an opportunity to dissociate before crossing the
transition-state barrier, the 3k is masked, and not revealed in the
observed KIE. This is the situation for WT OMP synthase.
Isotope trapping experiments confirm that commitments for
bound OMP and PRPP are high.20 In WT, KIE values for
reverse catalysis were measurable when a slowly utilized PPi
analogue was employed, but with the two natural substrates
OMP and PPi, KIE values were near one. This masking effect
arises from the sequestered active site that results from loop
closing. As a labeled substrate molecule encounters the barrier
and fails to cross it, it remains bound in the loop-closed state
until the eventual crossing.
In this context, the E107A enzyme provided predictable KIE
data. The residue makes two side chain hydrogen bonds (to
Lys103 and Lys73) in the loop-closed structure that appear to
help close the loop successfully. In the absence of these bonds,
the transition-state barrier for chemistry may be higher, and
loop opening and substrate dissociation may be faster, lowering
commitment factors. Consistent with these expectations, the
[1-3H]OMP and PRPP KIE values are higher than that of WT.
The case of H105A is also interesting. The structure (DOI
10.1021/bi300083p) suggests that His105 makes only one side
chain hydrogen bond in the closed complex, that to PRPP. In
each direction, a burst of product formation was noted, showing
that on-enzyme chemistry occurs with rate constants close to
WT (Figure 3, data for reverse reaction not shown). However,
this mutant shows high KIE values in the forward and reverse
reactions, and thus very low apparent commitments. Thus, a
label-bearing substrate molecule explores the transition-state
barrier, fails to cross it, and by dissociation is discriminated
against.
One way to look at the relative energetics of the chemical
transition-state barrier and the loop-open state is through KIE
experiments. The basic equation for translating an on-enzyme
(intrinsic) isotope effect (i.e., the magnitude of the effect of
isotopic substitution on the rate constant for crossing the
It is more difficult to explain the behavior of other mutant
OMP synthases. In essence, when the chemical transition state
is able to equilibrate with the dissociated substrate, intrinsic
H
dx.doi.org/10.1021/bi300082s | Biochemistry XXXX, XXX, XXX−XXX

Biochemistry
Article
values should be fully expressed. For K103A, this does not seem
to be the case. Because the on-enzyme conversion of the
E·MgPRPP·orotate complex to the E·OMP·MgPPi complex
was shown to be slow, and KD values for OMP and PRPP are
slightly elevated, we would expect that observed KIE values
would be high. Instead, they are well below those seen with
H105A, and close to unity for Δ102Δ106. Taking K103A, if we
accept the reasonable assumption that bound substrates can
escape the active site of the ternary substrate complexes
minimally at the rate of WT (20 and 80 s−1 for PRPP and
OMP, respectively20), and that on-enzyme chemistry proceeds
at 0.05 s−1, we find the 3k should be fully expressed. If we follow
REFERENCES
■
(1) Scapin, G., Grubmeyer, C., and Sacchettini, J. C. (1994) Crystal
structure of orotate phosphoribosyltransferase. Biochemistry 33, 1287−
1294.
(2) Scapin, G., Ozturk, D. H., Grubmeyer, C., and Sacchettini, J. C.
(1995) The crystal structure of the orotate phosphoribosyltransferase
complexed with orotate and α-D-5-phosphoribosyl-1-pyrophosphate.
Biochemistry 34, 10744−10754.
(3) Henriksen, A., Aghajari, N., Jensen, K. F., and Gajhede, M.
(1996) A flexible loop at the dimer interface is a part of the active site
of the adjacent monomer of Escherichia coli orotate phosphoribosyl-
transferase. Biochemistry 35, 3803−3809.
(4) Ozturk, D. H., Dorfman, R. H., Scapin, G., Sacchettini, J. C., and
Grubmeyer, C. (1995) Structure and function of Salmonella
typhimurium orotate phosphoribosyltransferase: Protein complemen-
tation reveals shared active sites. Biochemistry 34, 10764−10770.
3
the assumption that k is not greatly altered, we must then
assume that substrate complexes exploring the transition-state
barrier are not in equilibrium with the free substrate. It may be
that loop-closed complexes of Lys103 or Δ102Δ106 can
achieve chemistry at reasonable rates, but that these competent
complexes form only rarely. This could occur if a dominant role
for Lys103 is to guide the flexible loop into a catalytically
competent position, so that the apparent slow enzyme
chemistry of K103A ternary substrate complexes is in fact a
result of very infrequent successful loop movement. Via
comparison of WT and K103A or Δ102Δ106, it is not unlikely
that the barriers for successful loop closure are higher for the
mutants than for WT. However, we also need to assume that
the barrier to the chemical transition state is relatively low
within loop-closed complexes, which is not appealing, because
Lys103 clearly makes a number of important hydrogen bonds.
We also need to assume that the barrier to loop reopening is
high within complexes that are exploring the transition-state
barrier, so that such complexes do not dissociate before they
cross the transition-state barrier. Solutions of the structures for
loop-closed complexes of these mutants may be valuable in
understanding the origin of these unexpected KIE results.
́
(5) Gonzalez-Segura, L., McClard, R. W., and Hurley, T. D. (2007)
Ternary complex formation and induced asymmetry in orotate
phosphoribosyltransferase. Biochemistry 46, 14075−14086.
(6) Wang, G. P., Cahill, S. M., Liu., X., Girvin, M. E., and Grubmeyer,
C. (1999) Motional dynamics of the catalytic loop in OMP synthase.
Biochemistry 38, 284−295.
(7) Callender, R., and Dyer, R. B. (2006) Advances in time-resolved
approaches to study the dynamical nature of enzyme catalysis. Chem.
Rev. 106, 3031−3042.
(8) Pompliano, D. L., Peyman, A., and Knowles, J. R. (1990)
Stabilization of a reaction intermediate as a catalytic device: Definition
of the functional role of the flexible loop in triosephosphate isomerase.
Biochemistry 29, 3186−3194.
(9) Williams, J. C., and McDermott, A. E. (1995) Dynamics of the
flexible loop of triosephosphate isomerase: The loop motion is not
ligand gated. Biochemistry 34, 8309−8319.
(10) Smith, J. L. (1998) Glutamine PRPP amidotransferase:
Snapshots of an enzyme in action. Curr. Opin. Struct. Biol. 8, 686−694.
(11) Shi, W., Li, C. M., Tyler, P. C., Furneaux, R. H., Grubmeyer, C.,
Schramm, V. L., and Almo, S. C. (1999) The 2.0 Å structure of human
hypoxanthine-guanine phosphoribosyl-transferase in complex with a
transition-state analog inhibitor. Nat. Struct. Biol. 6, 588−593.
(12) Ozturk, D. H., Dorfman, R. H., Scapin, G., Sacchettini, J. C., and
Grubmeyer, C. (1995) Locations and functional roles of conserved
lysine residues in Salmonella typhimurium orotate phosphoribosyl-
transferase. Biochemistry 34, 10755−10763.
(13) Dawson, R. M. C., Elliott, D. C., Elliott, W. H., and Jones, K. M.
(1986) Data for Biochemical Research, 3rd ed., Oxford Science
Publications, Oxford, U.K.
(14) Tao, W., Grubmeyer, C., and Blanchard, J. S. (1996) Transition
state structure of Salmonella typhimurium orotate phosphoribosyl-
transferase. Biochemistry 35, 14−21.
(15) Zhang, Y., Luo, M., and Schramm, V. L. (2009) Transition states
of Plasmodium falciparum and human orotate phosphoribosyltrans-
ferases. J. Am. Chem. Soc. 131, 4685−4694.
AUTHOR INFORMATION
■
Corresponding Author
*Telephone: (215) 707-4495. E-mail: ctg@temple.edu.
Present Address
§Department of Medicine, University of Florida, 1600 SW
Archer Rd., Gainesville, FL 32610.
Funding
This research was supported by National Institutes of Health
Grant GM48623 to C.G.
(16) Wang, F., Shi, W., Nieves, E., Angeletti, R. H., Schramm, V. L.,
and Grubmeyer, C. (2001) A transition-state analogue reduces protein
dynamics in hypoxanthine-guanine phosphoribosyltransferase. Bio-
chemistry 40, 8043−8054.
Notes
The authors declare no competing financial interest.
(17) Ramaswamy, S., Park, D. H., and Plapp, B. V. (1999)
Substitutions in a flexible loop of horse liver alcohol dehydrogenase
hinder the conformational change and unmask hydrogen transfer.
Biochemistry 38, 13951−13959.
(18) Miller, G. P., Wahnon, D. C., and Benkovic, S. J. (2001)
Interloop contacts modulate ligand cycling during catalysis by
Escherichia coli dihydrofolate reductase. Biochemistry 40, 867−875.
(19) Bhabha, G., Lee, J., Ekiert, D. C., Gam, J., Wilson, I. A., Dyson,
H. J., Benkovic, S. J., and Wright, P. E. (2011) A dynamic knockout
reveals that conformational fluctuations influence the chemical step of
enzyme catalysis. Science 332, 234−238.
(20) Wang., G. P., Lundegaard, C., Jensen., K. F., and Grubmeyer, C.
(1999) Kinetic mechanism of OMP synthase: A slow physical step
following group transfer limits catalytic rate. Biochemistry 38, 275−283.
ACKNOWLEDGMENTS
■
We thank Vern L. Schramm for helpful advice. Most of the KIE
work was performed by Bradley A. Bizzle.
ABBREVIATIONS
■
OMP synthase, orotate phosphoribosyltransferase; WT, wild-
type; OMP, orotidine 5′-monophosphate; KIE, kinetic isotope
effect; GPAT, glutamine PRPP amidotransferase; HGPRTase,
hypoxanthine-guanine phosphoribosyltransferase; TIM, triose-
phosphate isomerase; PRPP, 5-phosphoribosyl 1-pyrophos-
phate.
I
dx.doi.org/10.1021/bi300082s | Biochemistry XXXX, XXX, XXX−XXX

Biochemistry
Article
(21) Xu, Y., Eads, J. C., Sacchettini, J. C., and Grubmeyer, C. (1997)
Kinetic mechanism of human hypoxanthine-guanine phosphoribosyl-
transferase: Rapid phosphoribosyl transfer chemistry. Biochemistry 36,
3700−3712.
(22) Li, C. (1999) Transition State Inhibitors of 6-Oxopurine
Phosphoribosyltransferases. Ph.D. Thesis, Albert Einstein College of
Medicine, Bronx, NY.
(23) Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease,
L. R. (1989) Site-directed mutagenesis by overlap extension using the
polymerase chain reaction. Gene 77, 51−59.
(24) Bhatia, M., Vinitsky, A., and Grubmeyer, C. (1990) Kinetic
mechanism of orotate phosphoribosyltransferase from Salmonella
typhimurium. Biochemistry 29, 10480−10487.
(25) Grubmeyer, C., Segura, E., and Dorfman, R. (1993) Active site
lysines in orotate phosphoribosyltransferase. J. Biol. Chem. 268,
20299−20304.
(26) Penefsky, H. S. (1979) A centrifuged-column procedure for the
measurement of ligand binding by beef heart F1. Methods Enzymol. 56,
527−530.
(27) Scapin, G., Sacchettini, J. C., Dessen, A., Bhatia, M., and
Grubmeyer, C. (1993) Primary structure and crystallization of orotate
phosphoribosyltransferase from Salmonella typhimurium. J. Mol. Biol.
230, 1304−1308.
(28) Parkin, D. W. (1991) Methods for the determination of
competitive and noncompetitive kinetic isotope effects. In Enzyme
Mechanism from Isotope Effects (Cook, P. F., Ed.) pp 269−290, CRC
Press, Boca Raton, FL.
(29) Cunningham, B. C., and Wells, J. A. (1989) High-resolution
epitope mapping of hGH-receptor interactions by alanine-scanning
mutagenesis. Science 244, 1081−1085.
(30) Cleland, W. W. (1982) The use of isotope effects to determine
transition-state structures for enzymic reactions. Methods Enzymol. 87,
625−641.
(31) Fedorov, A., Shi, W., Kicska, G., Fedorov, E., Tyler, P. C.,
Furneaux, R. H., Hanson, J. C., Gainsford, G. J., Larese, J. Z., Schramm,
V. L., and Almo, S. C. (2001) Transition state structure of purine
nucleoside phosphorylase and principles of atomic motion in
enzymatic catalysis. Biochemistry 40, 853−860.
(32) Luo, M., Li, L., and Schramm, V. L. (2008) Remote mutations
alter transition-state structure of human purine nucleoside phosphor-
ylase. Biochemistry 47, 2565−2576.
(33) Bruice, T. C., and Benkovic, S. J. (2000) Chemical basis for
enzyme catalysis. Biochemistry 39, 6267−6274.
(34) Northrop, D. B. (1991) Intrinsic isotope effects in enzyme-
catalyzed reactions. In Enzyme Mechanism from Isotope Effects (Cook,
P. F., Ed.) pp 181−202, CRC Press, Boca Raton, FL.
J
dx.doi.org/10.1021/bi300082s | Biochemistry XXXX, XXX, XXX−XXX