A divalent metal-dependent self-cleaving DNAzyme with a tyrosine side chain

Article abstract of DOI:10.1039/c1ob05359k

The enzymatic incorporation of a phenol-modified 2′-deoxyuridine triphosphate gave rise to a modified DNA library that was subsequently used in an in vitro selection for ribophosphodiester-cleaving DNAzymes in the presence of divalent zinc and magnesium cations. After 11 rounds of selection, cloning and sequencing resulted in 14 distinct sequences, the most active of which was Dz11-17PheO. Dz11-17PheO self-cleaved an embedded ribocytidine with an observed rate constant of 0.20 ± 0.02 min^-1 in the presence of 10 mM Mg²⁺ and 1 mM Zn²⁺ at room temperature. The activity was inhibited at low concentrations of Hg²⁺ cations and somewhat higher concentrations of Eu³⁺ cations.

Full text of DOI:10.1039/c1ob05359k

Organic &
Biomolecular
Chemistry
www.rsc.org/obc
Volume 9 | Number 20 | 21 October 2011 | Pages 6853–7256
ISSN 1477-0520
FULL PAPER
David M. Perrin et al.
A divalent metal-dependent
self-cleaving DNAzyme with
a tyrosine side chain
1477-0520(2011)9:20;1-V

Organic &
Biomolecular
Chemistry
Dynamic Article Links
Cite this: Org. Biomol. Chem., 2011, 9, 6949
www.rsc.org/obc
PAPER
A divalent metal-dependent self-cleaving DNAzyme with a tyrosine side chain†
Curtis H. Lam, Christopher J. Hipolito, Marcel Hollenstein and David M. Perrin*
Received 8th March 2011, Accepted 15th April 2011
DOI: 10.1039/c1ob05359k
The enzymatic incorporation of a phenol-modified 2¢-deoxyuridine triphosphate gave rise to a modified
DNA library that was subsequently used in an in vitro selection for ribophosphodiester-cleaving
DNAzymes in the presence of divalent zinc and magnesium cations. After 11 rounds of selection,
cloning and sequencing resulted in 14 distinct sequences, the most active of which was Dz11-17PheO.
Dz11-17PheO self-cleaved an embedded ribocytidine with an observed rate constant of 0.20
0.02 min-1 in the presence of 10 mM Mg2+ and 1 mM Zn2+ at room temperature. The activity was
inhibited at low concentrations of Hg2+ cations and somewhat higher concentrations of Eu3+ cations.
Dz16.2-11.34 This catalyst utilizes imidazole-modified dU’s in the
presence of Zn2+ cations to catalyze RNA cleavage. It was proposed
Introduction
that the pendant imidazoles chelate a Zn2+ cation to promote
catalysis. Several other selections have been performed using as
many as three different modifications to discover M2+-independent
ribophosphodiester-cleaving DNAzymes.35–39 In particular, Dz925-
11, which contains two modifications: imidazoles and cationic
amines,35 was shown to mimic RNaseA where two imidazoles
appear to be involved in general acid/base catalysis while a single
cationic amine appears to be involved in coulombic stabilization
of the negative charge build-up in the transition state.40
Over the past 30 years, biological catalysis has been extended
from proteins to include nucleic acids. Whereas naturally occur-
ring ribozymes including the hammerhead1 and RNase P were
identified,2,3 powerful in vitro selection techniques (or SELEX)
have led to the discovery of a large number of unnatural nucleic
acid catalysts including deoxyribozymes (DNAzymes).4–7 Hence,
catalytic nucleic acids have been found to catalyze numerous reac-
tions such as RNA/DNA cleavage,8–12 Diels–Alder reactions13–16
and Michael additions, to name just a few.17
Compared to the diversity of side-chain functionality in pro-
teins, nucleic acids are functionally deprived and often rely on
relatively high concentrations of divalent metal cations (M2+)
for folding and catalysis. In order to alleviate the paucity of
chemical diversity believed to undermine the catalytic repertoire
of DNAzymes, many efforts have been made to enzymatically
polymerize modified DNA by using 2¢-deoxynucleoside triphos-
phates (dNTPs) endowed with synthetically-appended functional
groups. Indeed, dNTPs have been successfully functionalized
with almost every amino acid side chain as well as moieties
that cannot be found in proteins.18–27 While modified dNTPs
could potentially enhance the catalytic repertoire of nucleic acid
catalysts, as reviewed recently,28 selections of modified catalysts
remain few in number and scope.
Selection of modified DNAzymes have been focused extensively
on the cleavage of ribophosphodiester bonds.29 Indeed, RNA-
cleaving DNAzymes have been well-studied due to i) the relative
ease of selection and ii) their potential to act as sensors30,31
and to cleave RNA in vivo.32,33 The first DNAzyme that was
obtained from an in vitro selection using modified nucleotides was
One modification that has yet to be explored in the context
of modified DNAzymes is the phenol group, characteristic of
the tyrosine side chain, which is found in the active sites
of many protein enzymes wherein it may act as a catalytic
nucleophile,41,42 general base43 or general acid.44 In order to
evaluate the effect of the addition of a phenol modification on
the activity of selected DNAzymes, an in vitro selection was
performed to discover a DNAzyme bearing phenol residues
and that catalyzes ribophosphodiester cleavage. We synthesized
a phenol-modified dUTP [5-(4-hydroxybenzoylaminomethyl)-2¢-
deoxyuridine triphosphate] and thereby enzymatically polymer-
ized it to produce a modified DNA library. Selection on the
resulting modified single-stranded DNA sequence pool in the
presence of Mg2+ and Zn2+ gave rise to many DNAzymes that
catalyze self-cleavage at an embedded RNA linkage, the most
active sequence of which was characterized in detail. This work
showcases the first example of a phenol-modified DNAzyme that
efficiently self-cleaves in the presence of divalent metal cations
(M2+).
Results and discussion
Chemistry Department, University of British Columbia, 2036 Main Mall,
Vancouver, BC, V6T 1Z1, Canada. E-mail: dperrin@chem.ubc.ca; Fax: +1-
604-822-2847
Synthesis of phenol-modified DNA
† Electronic supplementary information (ESI) available: Synthesis of 1,
incorporation of 2 by Vent (exo-) DNA polymerase, progress of the
selection and cloned selection sequences. See DOI: 10.1039/c1ob05359k
Phenol-modified dUTP (2) was readily obtained by either one
of two methods (Scheme 1). 5-Aminomethyl-dUTP (1)45 (ESI†)
This journal is
The Royal Society of Chemistry 2011
Org. Biomol. Chem., 2011, 9, 6949–6954 | 6949
©

primer extension and PCR conditions. Preliminary kinetic analysis
of the identified clones revealed that 9 of the 14 sequences displayed
self-cleavage activity (ESI†).
Kinetic experiments on the identified active sequences in various
conditions eventually pinpointed two factors that played a signif-
icant role in the final outcome of the selection. Firstly, sequences
that self-cleaved tended to remain bound to the streptavidin
magnetic particles through non-specific interactions instead of
eluting readily from the beads, and secondly, the addition of
stachyose or other saccharides, e.g. sialic acid or D-mannoheptose,
promoted the release of these non-specifically bound sequences
from the streptavidin magnetic particles that were not removed
during the negative selection washes. Consequently, self-cleavage
was found to be sugar-independent while the combination of
these two factors led to the initially misleading impression that
the addition of various sugars promoted sugar-dependent self-
cleavage.
Scheme 1 Reagents and conditions: a) 4-hydroxybenzoyl-N-hydroxy-
succinimide ester, NaHCO3, H2O/DMF; b) i) 4-boronylbenzoyl-
N-hydroxysuccinimide ester, NaHCO3, H2O/DMF, ii) H2O2, H2O.
was mixed with the NHS ester of 4-hydroxybenzoic acid in the
presence of sodium bicarbonate to give the desired product.
Alternatively, triphosphate 1 was reacted with the NHS ester
of 4-carboxyphenylboronic acid. The resulting derivative was
then oxidized to 2 using hydrogen peroxide. Following the prep-
TLC and HPLC purification of 2, polymerase-mediated reactions
revealed that 2 was an excellent substrate for Vent (exo-) DNA
polymerase. Primer extension reactions requiring five consecutive
modified nucleotides to be incorporated were readily accomplished
(ESI†). Triphosphate 2 also successfully supports exponential
PCR (data not shown). Thus the substrate properties of 2 for
DNA polymerases demonstrate that 2 is fully compatible with in
vitro selection conditions and reinforces the fact that 5-modified
dUTP’s are generally good substrates for polymerases.19,23,25,46
Characterization of DNAzyme 11-17PheO
Of the cloned sequences, Dz11-17PheO was the most catalytically
active and was characterized further. The hypothetical secondary
structure of the DNAzyme as predicted by mfold51,52 is shown
in Fig. 1. Eight modified nucleotides and two stem loops can be
found in the random region. A sequence alignment analysis of
the most catalytically active sequences obtained from cloning of
generation 11 showed that the catalytically active sequences share
a common motif with Dz11-17PheO where 19 out of the first 21
residues in the random region are identical (Table S3, ESI†). It
should be noted that mfold structure prediction did not take into
account any effects that may be caused by the modifications on
the dUs, which could dramatically affect the secondary structure.
In vitro selection
The selection was performed using the streptavidin-biotin methods
used by us and many others.7,8,35 Briefly, a 5¢-biotinylated primer
was annealed with a template containing 40 degenerate positions.
Triphosphate 2 and the other three unmodified dNTP’s were
polymerized along the template to give an initial modified
oligonucleotide library of more than 1013 sequences. Following
the removal of the unmodified template strands, the sequence
pool was incubated in buffer consisting of 50 mM HEPES pH
7.4, 200 mM NaCl, 0.5 mM MgCl2 and 0.1 mM ZnSO4 at room
temperature. At the outset, the selection was intended to generate
sugar-sensing DNAzymes because notably tyrosines are relatively
abundant in the active sites of lectins.47 Indeed, the ability of DNA
to recognize sugars has recently gained attention.48–50 Nevertheless,
in our hands the use of several sugars in the selection buffer
(positive selection) only promoted the release of strands from the
streptavidin magnetic particles that had already cleaved in the
negative selection.
Whereas 15 rounds of selection were carried out, cloning was
performed on the material obtained from generation 11 because no
further progress of activity was observed in rounds 12–15 despite
increased selection stringency in these later rounds. Each of the 14
sequences identified was different (ESI†). The average number of
nucleotides corresponding to the random region was 40, and the
average number of modified residues in the random region was 9
(standard deviation of 2), a value that is not substantially lower
than the statistically random number of 10. That the PheO-dU
is represented with statistical normalcy is not surprising since 2
is a good substrate for Vent (exo-) DNA polymerase under both
Fig. 1 Predicted 2D structure of Dz11-17PheO. The construct was
biotinylated at the 5¢ terminus and contained one ribonucleotide which
corresponds to the cleavage location (arrow). Modified nucleotides are
shown as “U” and the structure was obtained with mfold with hybridiza-
tion of the rC disallowed.
The self-cleavage kinetic analysis of Dz11-17PheO is shown in
Fig. 2. The rate of the reaction was found to be very dependent
on the concentrations of the divalent metal cations present.
In the presence of 50 mM HEPES pH 7.4, 200 mM NaCl,
1 mM ZnSO4 and 10 mM MgSO4, self-cleavage was more than
90% complete after an hour at room temperature. Under these
experimental conditions, an average observed rate constant of 0.20
0.02 min-1 was obtained. Based on an estimated background
6950 | Org. Biomol. Chem., 2011, 9, 6949–6954
This journal is
The Royal Society of Chemistry 2011
©

When Dz11-17PheO was synthesized with dTTP in place of
2, the resulting unmodified sequences showed no self-cleavage
activity in the presence of both Mg2+ and Zn2+ suggesting that in
this case, as already observed for other modified DNAzymes, the
functional groups on dU are essential for ensuring a catalytically
competent conformation. Nevertheless, as with all catalytic nucleic
acids, the question of whether the appended functionality of a
modified nucleotide plays a direct role in catalysis as opposed to
an indirect role through folding, or both, is difficult to answer.
Indeed, while the preliminary report of a RNA Diels–Alderase
containing pyridyl-modified dUs did not establish the role of the
pyridine,14 subsequent reports showed that catalysis was absolutely
dependent on a para-substituted pyridine53 and that the pyridine
modifications that are involved provide a hydrophobic effect in
the mechanism of catalysis.54 It therefore is likely that the activity
herein will similarly depend on the modification’s geometry and it
is not impossible that the 5-amido group of the dU may also play
an important role in catalysis or folding.
To further characterize Dz11-17PheO, kinetic experiments were
performed where Mg2+ and Zn2+ were replaced with other metal
cations that included Ca2+, Ba2+, Mn2+, Fe3+, Ni2+, Cu2+, Hg2+, Eu3+
and La3+ (each at 1 mM). Of these cations, only Ca2+ and Mn2+
supported appreciable activity and interestingly, in the presence of
Mn2+ self cleavage was especially rapid (kobs = 0.35 0.03 min-1).
In order to determine whether Dz11-17PheO contained binding
sites for metal cations, inhibition experiments were performed.
It was hypothesized that if the activity of the DNAzyme were
inhibited by one or a few select metal cations, the DNAzyme
could potentially function as a sensor for those metal cations.55
Thus, experiments were carried out by incubating Dz11-17PheO
in a buffer containing 10 mM Mg2+ and 1 mM Zn2+ and 100 mM
of another metal cation. The same 9 metal cations that were
mentioned in the previous paragraph were used for the inhibition
experiments as well. Of all the metal cations used, inhibition
of Dz11-17PheO was observed only with Eu3+ and Hg2+. At
30 mM and 100 mM Hg2+, no appreciable Dz11-17PheO cleavage
was observed after 10 min whereas at 10 mM Hg2+ or less,
the extent of self-cleavage was more than 50% complete over
the same period. Inhibition by Hg2+ is consistent with T-Hg2+-
T interactions56,57 while inhibition by the oxophilic lanthanide
Eu3+ likely reflects phenoxide-Eu3+ interactions that distort the
active conformation. We also investigated the inhibitory effects of
two organophosphate pesticides, fenitrothion and diazinon, which
normally phosphorylate a serine nucleophile at the active site of
acetylcholinesterase.58 As the phenolic groups in Dz11-17PheO
are at least partially ionized at pH 7.5 (4-hydroxybenzamide has
a pKa of 8.56),60 we hypothesized that these agents might have
phosphorylated a critical phenolate in Dz11-17PheO resulting
in inhibition and thereby providing a prototypical nerve agent
sensor. Although these pesticides did not appear to inhibit Dz11-
17PheO, the presence of a phenolate group might eventually
suggest enhanced potential for selecting nerve agent sensors using
modified nucleotides, as unmodified DNA normally lacks a good
oxygen nucleophile for catalytic sensing.
Fig. 2 Self-cleavage kinetics of Dz11-17PheO. A, Denaturing PAGE (7%)
of the reaction showing the relative amounts of uncleaved and cleaved
material over a period of 60 min. Experiment performed with 50 mM
HEPES pH 7.4, 200 mM NaCl, 1 mM ZnSO4, 10 mM MgSO4 at room
temperature. Lanes correspond to reaction aliquots quenched at 0.75, 1.5,
2.25, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 20, 30, 60 min, negative and positive
controls. B, Graphical analysis of the data. A kobs of 0.20 0.02 min-1
was obtained (R2 > 0.99). C, pH rate profile. Reactions were performed
in 50 mM buffer, 200 mM NaCl, 1 mM ZnSO4, 10 mM MgCl2 at room
temperature. The line was fit to the formula of logy = mx + b, a slope of
0.86 was obtained (R2 > 0.99).
rate of 10-5 min-1, the observed rate constant represents a rate
acceleration of 2.0 ¥ 104. Dz11-17PheO was active in the presence
of either Mg2+ or Zn2+, with Zn2+ giving superior reaction rates.
No activity was observed in the absence of divalent metal cations.
Notably, the observed rate constant is comparable to other M2+-
dependent ribophosphodiester-cleaving DNAzymes. The very
thoroughly studied Dz10-23 cleaves RNA with a kcat = 0.49 min-1
Lastly, the self-cleavage of Dz11-17PheO was investigated as
a function of pH. The reaction was monitored at 6 additional
values of pH from 5.9 to 8.9, and the pH rate profile is shown in
Fig. 2C. The shape of the curve is similar to that of several other
ribophosphodiester-cleaving DNAzymes that are dependent on
(10 mM Mg2+, 37 ◦C),9 and Dz16.2-11 cleaves RNA with a kcat
=
1.5 min-1 (1 mM Mg2+ and 0.01 mM Zn2+, 37 ◦C).34
This journal is
The Royal Society of Chemistry 2011
Org. Biomol. Chem., 2011, 9, 6949–6954 | 6951
©

metal cations for activity.10,34,59 Not surprisingly, the rate constant
was highest at pH 7.4, the pH at which the selection was performed.
Between pH 5.9 and 7.4, the log of the observed rate constant
increased linearly with pH. The slope of the line was close to unity
(0.86) and suggests that the rate-determining step involves the
abstraction of a proton. After pH 7.4, the observed rate constant
decreased significantly, possibly due to the deprotonation of a
catalytically essential group such as a phenol group.60
O5; GGGGCGTGCTTTGCACTCGATAGTCAGCAGTGC-
CTTCGTCAACTAGTTTCTGTTGGTAGGGCCCAACAGA-
CGGGCACGCTCTGTGTC, O6.
Buffers/solutions
TEN (Tris, EDTA, NaCl): 40 mM Tris pH 7.5, 1 mM EDTA,
150 mM NaCl. Loading solution: formamide (27 mL), EDTA(aq)
(3 mL, 0.5 M), xylene cyanol(aq) (300 mL, 0.05%) and bromophenol
blue(aq) (300 mL, 0.05%). Elution buffer: 1% LiClO4, 10 mM Tris
pH 7.0 in water. Selection buffer 1: 50 mM HEPES pH 7.4,
200 mM NaCl, 0.1 mM ZnSO4, 0.5 mM MgCl2. Selection buffer
2: 50 mM HEPES pH 7.4, 200 mM NaCl, 0.1 mM ZnSO4, 1 mM
MgCl2. Selection buffer 3: 50 mM HEPES pH 7.4, 200 mM NaCl,
1 mM ZnSO4, 10 mM MgCl2. First amplification cocktail (5X):
O3 (7.5 nmol), O4 (9.0 nmol), dNTP’s (345 nmol each), MgSO4
(1.15 mmol), thermopol (115 mL, 10X) and water for a final volume
of 230 mL. Second amplification cocktail (5X): O4 (20 nmol),
O5 (15 nmol), dNTP’s (690 nmol each), MgSO4 (3.45 mmol),
thermopol (230 mL, 10X) and water for a final volume of 460 mL.
Kinetics quenching buffer: loading solution/100 mM biotin in
DMF (99 : 1).
Conclusions
An in vitro selection carried out using a phenol-modified dUTP
gave rise to Dz11-17PheO, an efficient self-cleaving DNAzyme that
requires Ca2+, Mg2+, Mn2+ or Zn2+ for catalysis. The DNAzyme
was found to be inhibited by the presence of 30 mM Hg2+ or
100 mM Eu3+ and suggests that this strategy may also be used to
expand the sensitivity for detecting either Hg2+ or Eu3+. This work
demonstrates that the phenol functionality is fully compatible
with the selection of an efficient M2+-dependent self-cleaving
DNAzyme that can provide a new chemical handle for post-
synthetic modification.
Experimental
5-(4-Hydroxybenzoylaminomethyl)-2¢-deoxyuridine triphosphate
(2)
General
A solution of 4-hydroxybenzoyl-N-hydroxysuccinimide ester61
(0.24 mg, 1.0 mmol) in DMF (5 mL) was added to 5-aminomethyl-
2¢-deoxyuridine triphosphate (0.25 mmol) in aqueous sodium
bicarbonate (10 mL, 0.4 M). After 3 h of periodic agitation,
the reaction was concentrated, resuspended with water and pu-
rified by preparative-TLC with dioxane/H2O/NH4OH (6 : 4 : 1);
Rf 0.13. Finally, 2 was purified by HPLC (retention time of
8.7 min) using a 50 mM triethylammonium acetate (pH 7.0)
acetonitrile/H2O system (0–10 min, 0–1%; 10–18 min, 1–25%
acetonitrile/H2O). Product (571 nmol, 57% yield) was isolated
as the tetrakis(triethylammonium) salt. e258 = 17 900 cm-1M-1. 1H
NMR (400 MHz, D2O, 25 ◦C, spectrum acquired with solvent
suppression pulse program): d = 7.92 (s, 1H), 7.81–7.75 (m, 2H),
7.06–6.99 (m, 2H), 6.35–6.29 (m, 1H), 4.75–4.60 (m, 1H), 4.42–
4.12 (m, 4H), 2.47–2.39 (m, 2H) MS (MALDI-): m/z = 615.9 (M–
1)-. lmax = 258 nm. Alternately, a solution of 4-boronylbenzoyl-N-
hydroxysuccinimide ester62 (0.24 mg, 1.0 mmol) in DMF (5 mL) was
added in 3 portions over 1 h to 5-aminomethyl-2¢-deoxyuridine
triphosphate (0.25 mmol) in aqueous sodium bicarbonate (10 mL,
0.4 M). After a total reaction time of 2 h with periodic agitation,
the reaction was concentrated, resuspended with water and pu-
rified by preparative-TLC with 8 : 4 : 1 MeCN/H2O/NH4OH. Rf
0.4 (6 : 4 : 1 MeCN/H2O/NH4OH). Half of the isolated material
was dissolved in H2O and mixed with H2O2 (0.75 mL, 1%).
Triphosphate 2 was successfully obtained from this oxidation.
Unless indicated otherwise, all reagents and solvents were obtained
from either Sigma Aldrich or Fisher Scientific. Anhydrous solvents
were prepared by either distillation or treatment with molecular
˚
sieves (4 A). Flash chromatography was performed using silica gel
(230–400 mesh) from Silicycle. Thin layer chromatography was
performed using precoated glass-backed plates of silica gel 60 F254
from EMD Chemicals. NMR spectra were obtained using either
a Bruker AV-300 or inverse AV-400 instrument. Spectra were ref-
erenced to the signal of the solvent. ESI-MS were collected with a
Waters LC/MS instrument, and MALDI-TOF mass spectra were
collected using a Bruker Biflex instrument. HPLC purification was
performed with an Agilent 1100 system and Phenomenex Jupiter
10 m C4 300A column. Metal salts used: Fe(NO3)3·9H2O, BaCl3,
EuCl3·xH2O, CuSO4·5H2O ZnSO4·7H2O, MnCl2, NiCl2·6H2O
CaCl2, La(OAc)3, MgCl2·6H2O, MgSO4·7H2O, Hg(OAc)2.
Vent (exo-) DNA polymerase, Taq DNA polymerase and l-
exonuclease were obtained from New England Biolabs. Oligonu-
cleotides were purchased from Integrated DNA Technologies.
dNTP’s were purchased from Fermentas. a-32P-dGTP was ob-
tained from Perkin Elmer. Acrylamide/bis-acrylamide solution
(40%) was purchased from Bio-Rad Laboratories. Streptavidin
magnetic particles were purchased from Roche and the pGEM-T-
Easy Vector Systems kit was purchased from Promega. Radioac-
tivity was detected with a Typhoon 9200 phosphorimaging scanner
from GE Healthcare. PCR was performed using a Techne TC-312
machine.
In vitro selection
Oligonucleotides
An initial sequence pool was obtained by the primer extension of
O1 (30 pmol) on O2 (30 pmol) in the presence of dATP (2.0 nmol),
2 (2.0 nmol), dCTP (1.0 nmol), dGTP (1.0 nmol), a-32P-dGTP
(2.0 mL), DTT (40 nmol), thermopol buffer (10X) and Vent (exo-)
DNA polymerase (3U). The reaction (final volume of 40 mL) was
incubated at 72 ◦C and then quenched by the addition of EDTA(aq)
Biotin-T20 GCGTGCCrCGTCTGTTGGGCCCTACCAACA,
O1;
GAGCTCGCGGGGCGTGCN40CTGTTGGTAGG-
GCCCAACAGACG, O2; phosphate-CGTCTGTTGGGCC-
CTACCA, O3; GAGCTCGCGGGGCGTGC, O4; phosphate-
ACGACACA GAGCGTGCCCGTCTGTTGGGCCCTACCA,
6952 | Org. Biomol. Chem., 2011, 9, 6949–6954
This journal is
The Royal Society of Chemistry 2011
©

(2.0 mL, 0.5 M). A suspension of streptavidin magnetic particles
was magnetized and then washed with 3 samples of TEN buffer
(100 mL each). The extension reaction was bound to streptavidin
magnetic particles, and the resulting suspension was left at room
temperature with periodic agitation over 30 min. The material
was magnetized and then washed with a series of solutions: 2
solutions of TEN buffer (100 mL each), 5 ¥ 100 mL solutions
containing NaOH (0.1 M) and EDTA (1.0 mM), a solution of
HEPES buffer (200 mL, 50 mM, pH 7.4) and water (100 mL).
The particles were then incubated in selection buffers 1, 2 or
3 in the presence or absence of sugars. Eluted sequences were
precipitated with 1% LiClO4, washed with EtOH and purified by
denaturing PAGE (7%). The properly-sized material was eluted
with elution buffer, precipitated and desalted (G25 Sephadex).
The material was amplified with 2 PCR reactions. Each reaction
was performed for 30 cycles: 15 s at 54 ◦C, 40 s at 75 ◦C and 15 s
at 95 ◦C. First PCR, material was added 1st amplification cocktail
(8 mL), a-32P-dGTP (0.75 mL) and Vent (exo-) DNA polymerase
(1 mL, 2U). After PCR was performed, the reactions were treated
with a phenol/chloroform extraction, washed with EtOH and
digested with l-exonuclease prior to purification on denaturing
PAGE (10%). An aliquot of the gel-purified first PCR product
was added 2nd amplification cocktail (40 mL), water (150 mL) and
Vent (exo-) DNA polymerase (9 mL, 18 U). The 2nd PCR product
was obtained in the same way as the 1st PCR product except that
the product was identified by UV-shadowing. The product was
used as a template for the next round of selection.
for the synthesis of the sequence pool of the selection. The
reaction mixture was then bound to streptavidin magnetic particles
and washed in the same manner as during the selection. The
suspension of streptavidin magnetic particles in the final water
wash was divided into 3 portions for 3 individual reactions, and
the water was decanted after magnetization. Each sample was
incubated with selection buffer 3 (80 mL). Aliquots (4 mL each)
were removed and added directly to quenching buffer (12 mL each).
The quenched aliquots were analyzed by denaturing PAGE (10%).
The relative amounts of uncleaved catalyst and cleaved product
were obtained by autoradiographic densitometry. The data were fit
to a single exponential rate equation. Each observed rate constant
value was the average of at least 3 identical experiments. For the
inhibition experiments, either 100 mM of metal cation or saturated
organophosphate pesticide was used.
pH rate profile
DNAzyme 11-17PheO bound to streptavidin magnetic particles
was incubated in the presence of 50 mM buffer, 200 mM NaCl,
1 mM ZnSO4, 10 mM MgCl2. Experiments were performed at 6
additional values of pH: 5.9, 6.4, 6.9, cacodylic acid; 7.9, HEPES;
8.4, 8.9, TrisHCl. The reaction rate at pH 8.9 was so slow that an
observed rate constant could not be accurately obtained from the
data.
Acknowledgements
Funding for this research was provided by CIHR Operating Funds
and NSERC.
Selection conditions
The selection was performed at room temperature. The negative
selection was performed with selection buffer 1 (rounds 1–3) for
1 h, selection buffer 2 for 1 h (rounds 4–11), selection buffer 2
for 2 h (rounds 12–13) and selection buffer 3 for 2 h (rounds 14–
15). The positive selection was carried out with negative selection
buffer + sugar (rounds 1–9, 1 mM each of stachyose, sialic acid, D-
mannoheptose and ATP; rounds 10–11, 1 mM stachyose; rounds
12–15, 0.2 mM stachyose). Positive selection was carried out with
1 buffer solution sample for 1 h (rounds 1–7) or 3 buffer solutions
for 3 consecutive time intervals (0–1, 1–5, 5–60 min, rounds 8–15).
Notes and references
1 A. C. Forster and R. H. Symons, Cell, 1987, 50, 9–16.
2 P. Nissen, J. Hansen, N. Ban, P. B. Moore and T. A. Steitz, Science,
2000, 289, 920–930.
3 H. F. Noller, V. Hoffarth and L. Zimniak, Science, 1992, 256, 1416–
1419.
4 G. F. Joyce, Annu. Rev. Biochem., 2004, 73, 791–836.
5 J. C. Achenbach, W. Chiuman, R. P. G. Cruz and Y. Li, Curr. Pharm.
Biotechnol., 2004, 5, 321–336.
6 D. S. Wilson and J. W. Szostak, Annu. Rev. Biochem., 1999, 68, 611–647.
7 R. R. Breaker, Chem. Rev., 1997, 97, 371–390.
8 R. R. Breaker and G. F. Joyce, Chem. Biol., 1994, 1, 223–229.
9 S. W. Santoro and G. F. Joyce, Proc. Natl. Acad. Sci. U. S. A., 1997, 94,
4262–4266.
Cloning
The product stemming from the second PCR of generation 11 was
used as template for PCR with Taq DNA polymerase to produce
double stranded material with overhanging 3¢-dA’s. TA-cloning
was then performed on this product using the pGEM-T-Easy
Vector Systems kit. Plasmids were transformed into E. coli DH10B
cells using electroporation, and the cells were spread onto LB
agar containing ampicillin (100 mg L-1). Individual white colonies
were picked and used to inoculate 1 mL samples of TB. Plasmids
were harvested using the Plasmid Miniprep Kit (Invitrogen) and
subjected to restriction enzyme digestion using EcoRI to screen
for appropriately sized inserts. Single insert-containing plasmids
were sequenced by the UBC Nucleic Acid Protein Service Unit.
10 J. Li, W. Zheng, A. H. Kwon and Y. Lu, Nucleic Acids Res., 2000, 28,
481–488.
11 M. Chandra, A. Sachdeva and S. K. Silverman, Nat. Chem. Biol., 2009,
5, 718–720.
12 N. Carmi, L. A. Shultz and R. R. Breaker, Chem. Biol., 1996, 3, 1039–
1046.
13 B. Seelig, S. Keiper, F. Stuhlmann and A. Jaschke, Angew. Chem., Int.
Ed., 2000, 39, 4576–4579.
14 T. M. Tarasow, S. L. Tarasow and B. E. Eaton, Nature, 1997, 389,
54–57.
15 J. J. Agresti, B. T. Kelly, A. Jaschke and A. D. Griffiths, Proc. Natl.
Acad. Sci. U. S. A., 2005, 102, 16170–16175.
16 M. Chandra and S. K. Silverman, J. Am. Chem. Soc., 2008, 130, 2936–
2937.
17 G. Sengle, A. Eisenfuhr, P. S. Arora, J. S. Nowick and M. Famulok,
Chem. Biol., 2001, 8, 459–473.
18 K. Sakthivel and C. F. Barbas, Angew. Chem., Int. Ed., 1998, 37, 2872–
2875.
19 S. Jager, G. Rasched, H. Kornreich-Leshem, M. Engeser, O. Thum and
M. Famulok, J. Am. Chem. Soc., 2005, 127, 15071–15082.
Kinetic analysis of self-cleavage reaction
Primer O1 (30 pmol) and 11-17PheO template O6 (30 pmol) were
annealed and primer extended in the same manner as described
This journal is
The Royal Society of Chemistry 2011
Org. Biomol. Chem., 2011, 9, 6949–6954 | 6953
©

20 M. Kuwahara, K. Hanawa, K. Ohsawa, R. Kitagata, H. Ozaki and H.
Sawai, Bioorg. Med. Chem., 2006, 14, 2518–2526.
21 M. Kuwahara, J. Nagashima, M. Hasegawa, T. Tamura, R. Kitagata,
K. Hanawa, S. Hososhima, T. Kasamatsu, H. Ozaki and H. Sawai,
Nucleic Acids Res., 2006, 34, 5383–5394.
22 D. M. Perrin, T. Garestier and C. Helene, Nucleosides, Nucleotides
Nucleic Acids, 1999, 18, 377–391.
23 J. D. Vaught, C. Bock, J. Carter, T. Fitzwater, M. Otis, D. Schneider, J.
Rolando, S. Waugh, S. K. Wilcox and B. E. Eaton, J. Am. Chem. Soc.,
2010, 132, 4141–4151.
41 R. M. Gronostajski and P. D. Sadowski, Mol. Cell. Biol., 1985, 5,
3274–3279.
42 J. J. Champoux, Annu. Rev. Biochem., 2001, 70, 369–413.
43 J. J. Truglio, B. Rhau, D. L. Croteau, L. Q. Wang, M. Skorvaga, E.
Karakas, M. J. DellaVecchia, H. Wang, B. Van Houten and C. Kisker,
EMBO J., 2005, 24, 885–894.
44 D. F. Aktas and P. F. Cook, Biochemistry, 2009, 48, 3565–3577.
45 D. M. Kolpashchikov, T. M. Ivanova, V. S. Boghachev, H. P. Nasheuer,
K. Weisshart, A. Favre, P. E. Pestryakov and O. I. Lavrik, Bioconjugate
Chem., 2000, 11, 445–451.
T. Gourlain, A. Sidorov, N. Mignet, S. J. Thorpe, S. E. Lee, J. A. Grasby
and D. M. Williams, Nucleic Acids Res., 2001, 29, 1898–1905.
25 V. Borsenberger, M. Kukwikila and S. Howorka, Org. Biomol. Chem.,
2009, 7, 3826–3835.
46 H. Sawai, J. Nagashima, M. Kuwahara, R. Kitagata, T. Tamura and I.
Matsui, Chem. Biodiversity, 2007, 4, 1979–1995.
47 H. Lis and N. Sharon, Chem. Rev., 1998, 98, 637–674.
48 M. Y. Li, N. Lin, Z. Huang, L. P. Du, C. Altier, H. Fang and B. H.
Wang, J. Am. Chem. Soc., 2008, 130, 12636–12638.
49 B. J. Boese and R. R. Breaker, Nucleic Acids Res., 2007, 35, 6378–
6388.
26 A. D. Keefe and S. T. Cload, Curr. Opin. Chem. Biol., 2008, 12, 448–
456.
27 M. Hocek and M. Fojta, Org. Biomol. Chem., 2008, 6, 2233–2241.
28 S. Franzen, Curr. Opin. Mol. Ther., 2010, 12, 223–232.
29 S. K. Silverman, Nucleic Acids Res., 2005, 33, 6151–6163.
30 J. W. Liu, Z. H. Cao and Y. Lu, Chem. Rev., 2009, 109, 1948–1998.
31 I. Willner, B. Shlyahovsky, M. Zayats and B. Willner, Chem. Soc. Rev.,
2008, 37, 1153–1165.
50 W. Sun, L. P. Du and M. Y. Li, Curr. Pharm. Des., 2010, 16, 2269–
2278.
51 D. H. Mathews, J. Sabina, M. Zuker and D. H. Turner, J. Mol. Biol.,
1999, 288, 911–940.
52 M. Zuker, Nucleic Acids Res., 2003, 31, 3406–3415.
53 T. M. Tarasow, S. L. Tarasow, C. Tu, E. Kellogg and B. E. Eaton, J.
Am. Chem. Soc., 1999, 121, 3614–3617.
32 D. A. Baum and S. K. Silverman, Cell. Mol. Life Sci., 2008, 65, 2156–
2174.
33 M. J. Cairns, E. G. Saravolac and L. Q. Sun, Curr. Drug Targets, 2002,
3, 269–279.
34 S. W. Santoro, G. F. Joyce, K. Sakthivel, S. Gramatikova and C. F.
Barbas, J. Am. Chem. Soc., 2000, 122, 2433–2439.
35 D. M. Perrin, T. Garestier and C. Helene, J. Am. Chem. Soc., 2001, 123,
1556–1563.
54 K. T. Gagnon, S. Y. Ju, M. B. Goshe, E. S. Maxwell and S. Franzen,
Nucleic Acids Res., 2009, 37, 3074–3082.
55 J. M. Thomas, R. Ting and D. M. Perrin, Org. Biomol. Chem., 2004, 2,
307–312.
56 G. H. Clever, C. Kaul and T. Carell, Angew. Chem., Int. Ed., 2007, 46,
6226–6236.
36 A. V. Sidorov, J. A. Grasby and D. M. Williams, Nucleic Acids Res.,
57 Y. Tanaka, S. Oda, H. Yamaguchi, Y. Kondo, C. Kojima and A. Ono,
J. Am. Chem. Soc., 2007, 129, 244–245.
2004, 32, 1591–1601.
37 M. Hollenstein, C. Hipolito, C. Lam, D. Dietrich and D. M. Perrin,
Angew. Chem., Int. Ed., 2008, 47, 4346–4350.
38 M. Hollenstein, C. J. Hipolito, C. H. Lam and D. M. Perrin,
ChemBioChem, 2009, 10, 1988–1992.
39 M. Hollenstein, C. J. Hipolito, C. H. Lam and D. M. Perrin, Nucleic
Acids Res., 2009, 37, 1638–1649.
58 W. N. Aldridge, Biochem. J., 1950, 46, 451–460.
59 S. W. Santoro and G. F. Joyce, Biochemistry, 1998, 37, 13330–13342.
60 A. Albert and E. P. Serjeant, The Determination of Ionization Constants,
Chapman and Hall, New York, 1984.
61 Z. F. Guo, Y. R. Sun, S. L. Zheng and Z. H. Guo, Biochemistry, 2009,
48, 1712–1722.
40 J. M. Thomas, J. K. Yoon and D. M. Perrin, J. Am. Chem. Soc., 2009,
131, 5648–5658.
62 T. Masuda, T. Nagasaki and S. Tamagaki, Supramol. Chem., 2000, 11,
301–314.
6954 | Org. Biomol. Chem., 2011, 9, 6949–6954
This journal is
The Royal Society of Chemistry 2011
©