A novel tricyclic polyketide and its biosynthetic precursor azaphilone derivatives from the endophytic fungus Dothideomycete sp

Article abstract of DOI:10.1039/c2ob25959a

Azaphilone derivatives 1 and 2 and a novel tricyclic polyketide 3, together with a known azaphilone, austdiol (4), were isolated from the endophytic fungus Dothideomycete sp., which was isolated from a Thai medicinal plant, Tiliacora triandra. Compound 3 is the first polyketide having a tricyclic 6,6,6 ring system, which is similar to that of a terpenoid skeleton. The absolute configurations of stereogenic centers in 1-3 were addressed by Mosher's method and biosynthetic analogy with a known azaphilone isolated from the same fungus. Cytotoxic and antimicrobial activities of the isolated compounds were evaluated.

Full text of DOI:10.1039/c2ob25959a

View Online / Journal Homepage / Table of Contents for this issue
Organic &
Biomolecular
Chemistry
www.rsc.org/obc
Volume 10 | Number 35 | 21 September 2012 | Pages 7017–7228
ISSN 1477-0520
PAPER
Prasat Kittakoop et al.
A novel tricyclic polyketide and its biosynthetic precursor azaphilone
derivatives from the endophytic fungus Dothideomycete sp

Dynamic Article Links
Organic &
View Online
Biomolecular
Chemistry
Cite this: Org. Biomol. Chem., 2012, 10, 7220
www.rsc.org/obc
PAPER
A novel tricyclic polyketide and its biosynthetic precursor azaphilone
derivatives from the endophytic fungus Dothideomycete sp†
Sarath P. D. Senadeera,a Suthep Wiyakrutta,b Chulabhorn Mahidol,a,c Somsak Ruchirawata,c,d and
Prasat Kittakoop*a,c,d
Received 18th May 2012, Accepted 5th July 2012
DOI: 10.1039/c2ob25959a
Azaphilone derivatives 1 and 2 and a novel tricyclic polyketide 3, together with a known azaphilone,
austdiol (4), were isolated from the endophytic fungus Dothideomycete sp., which was isolated from a
Thai medicinal plant, Tiliacora triandra. Compound 3 is the first polyketide having a tricyclic 6,6,6 ring
system, which is similar to that of a terpenoid skeleton. The absolute configurations of stereogenic centers
in 1–3 were addressed by Mosher’s method and biosynthetic analogy with a known azaphilone isolated
from the same fungus. Cytotoxic and antimicrobial activities of the isolated compounds were evaluated.
Introduction
Endophytic fungi are rich sources of bioactive compounds with
pharmaceutical interest, and some metabolites from the endophy-
tic fungi are in clinical trials.1–4 As part of our on-going research
on bioactive metabolites from endophytic fungi isolated from
Thai medicinal plants,5,6 we report herein the isolation, charac-
terization, and biological activities of the metabolites 1–4, which
were isolated from the endophytic fungus Dothideomycete sp.
Fig. 1 Ring system of tricyclic polyketides.
polyketide skeleton (Fig. 1), which shares a great similarity with
a terpenoid skeleton. The present work reveals for the first time
that a tricyclic 6,6,6 ring system, which is normally found in a
terpenoid skeleton, is derived from a polyketide biosynthetic
pathway.
(isolated from a Thai medicinal plant, Tiliacora triandra). Com-
pound 3 was a novel terpene-like tricyclic polyketide, which was
co-isolated with its biosynthetic congeners 1 and 2, as well as a
known azaphilone, austdiol (4). A skeleton of a tricyclic 3 is
similar to that of a terpenoid, however, careful analysis reveals
that it is biosynthetically related to azaphilone derivatives 1 and
2, which are derived from polyketide biosynthetic pathway. Nor-
mally, skeletons of tricyclic polyketides are a linear 6,6,6 ring
system, while other systems, such as 5,6,5 and 6,5,6, are excep-
tionally rare in nature (Fig. 1). Examples of a linear 6,6,6 ring
system are mithramycin and chromomycin, which are biosynthe-
sized by type II polyketide synthases.7 Rare 5,6,5 and 6,5,6 ring
systems are found in spinosyns8,9 and hirsutellones10,11 (Fig. 1).
A terpene-like 6,6,6 ring system in 3 is the first tricyclic
aChulabhorn Graduate Institute, Chemical Biology Program, Vibhavadi-
Rangsit Road, Laksi, Bangkok 10210, Thailand
bDepartment of Microbiology, Faculty of Science, Mahidol University,
Bangkok 10400, Thailand
Results and discussion
cChulabhorn Research Institute, Vibhavadi-Rangsit Road, Laksi,
Bangkok 10210, Thailand. E-mail: prasat@cri.or.th;
Fax: +66-2-5740622 ext.1513; Tel: +66-86-9755777
dCenter of Excellence on Environmental Health and Toxicology, CHE,
Ministry of Education, Thailand
The extracts of fermentation broth and cells of the endophytic
fungus Dothideomycete sp. CRI7 were purified by Sephadex
LH-20 and silica gel column chromatography, as well as by
reversed-phase C18 HPLC, to yield new azaphilone derivatives
1 and 2, a novel compound 3, and a known azaphilone 4.
†Electronic supplementary information (ESI) available: 1D and 2D
NMR spectra of 1–3. See DOI: 10.1039/c2ob25959a
7220 | Org. Biomol. Chem., 2012, 10, 7220–7226
This journal is © The Royal Society of Chemistry 2012

View Online
Spectroscopic data of a known azaphilone, austdiol (4), were
identical to those reported in the literature.12,13
Compound 1, named dothideomycetone A, had a molecular
formula C25H40O7 (by HRESI-MS). The IR spectrum of 1
showed absorption bands for carbonyl peaks at 1712, 1676 and
1640 cm−1, while 13C NMR demonstrated signals for two
ketones (δC 200.5 and 209.9) and a carbonyl ester (δC 175.3).
13C NMR and DEPT experiments revealed 25 signals ascribable
to 6 methyl, 6 methylene, 7 sp3 methine, and 6 non-protonated
Fig. 3 Proposed biosynthetic pathway of 1 from austdiol.
1
carbons. H–1H COSY spectrum of 1 established a partial struc-
ture from H-9 to H-14, and showed correlations of H-14/H3-17,
1
and H2-4/H-5. The H–1H COSY spectrum established a struc-
by biosynthetic analogy with austdiol (4), a known azaphilone
isolated from the same fungus. It is more likely that the cyclo-
hexenone, dothideomycetone A (1), is biosynthetically derived
from azaphilones (i.e., 4). Previously azaphilones were co-iso-
lated with their corresponding cyclohexenone congeners.17 As
shown in Fig. 3, austdiol derivative A was oxidized, decarboxy-
lated, followed by allylic shift to give an intermediate B; ring
opening of B followed by reduction at C-5/C-6 furnish an inter-
mediate C. Esterification of C gives rise to dothideomycetone A
(1). Previously, azaphilones functionalized with a methylcyclo-
hexane unit were isolated from the fungus Hypoxylon multi-
forme.18 Upon the biosynthetic pathway in Fig. 3, the C-6
absolute configuration of 1 (C-7 of C, Fig. 3) was tentatively
assigned to be S; accordingly, C-5 of 1 was S. Assignments of
1H and 13C resonances for 1 are in Table 1.
ture of 3-hydroxy-2,4-dimethylhexanoic acid unit in 1, showing
correlations from H-2′ along the chain to H3-6′, and correlations
of H-2′/H3-7′, and H-4′/H3-8′. Allylic couplings between H3-15
and H2-4 and between H3-15 and H2-7 were evident from the
1H–1H COSY spectrum. HMBC spectrum was very useful for
structural assembling in dothideomycetone A (1), particularly
the HMBC correlations of protons to non-protonated carbons;
key HMBC correlations in 1 were as follows: H-9 to C-7, C-8,
and C-17; H-10 to C-8; H2-7 to C-2, C-3, C-4, C-8, and C-9;
H2-4 to C-2, C-3, C-6, and C-7; H3-15 to C-1, C-2, and C-3; H3-
16 to C-1, C-5, and C-6; H-5 to C-1, C-3, C-6, C-16, and C-1′;
and H-2′, H-3′, and H3-7′ to C-1′. Upon these spectroscopic
data, a gross structure of 1 was established. Relative configur-
ation of 1 was established by analysis of coupling constants and
NOESY spectrum. Large coupling constants (JH-9,H-10 and JH-9,H-14
= 10.4 Hz) of H-9 indicated trans orientation between H-9
and H-10 and between H-9 and H-14, while the NOESY corre-
lation between H-5 and H3-16 revealed cis relationship between
these two protons. It is known that the vicinal coupling constants
(i.e., JH-2′,H-3′ for 3-hydroxy-2,4-dimethylhexanoic acid unit) for
anti diastereoisomer (7.0–9.0 Hz) are larger than those for the
syn one (5.9–6.3 Hz).14,15 The JH-2′,H-3′ of 9.6 Hz for 3-hydroxy-
2,4-dimethylhexanoic acid unit in 1 indicated anti orientation of
H-2′ and H-3′. Again the JH-3′,H-4′ for 3-hydroxy-2,4-dimethyl-
hexanoic acid derivatives of anti diastereoisomer (8.5 Hz) are
also larger than those of syn isomer (5.7 Hz).16 Therefore, the
JH-3′,H-4′ of 4.2 Hz in 1 suggested syn relationship between H-3′
and H-4′. On the basis of these data, the relative configurations
of 1 were secured. The absolute configuration of 1 was addressed
by Mosher’s method. Accordingly, Mosher’s (MTPA) esters 1a
and 1b were prepared, and the Δδ values (δ(S) − δ(R)) indicated
that the absolute configurations at C-3′ and C-10 in 1 were R and
S, respectively (Fig. 2).
Dothideomycetone B (2) had the same molecular formula,
C25H40O7 (by HRESI-MS), as that of 1. 1H and 13C NMR
spectra of 2 and 1 were nearly superimposed, suggesting that 2
was a derivative of 1. Detailed analysis of NMR spectra revealed
that dothideomycetone B (2) was a diastereomer of 1; small
coupling constants (JH-9,H-10 and JH-9,H-14 = 0.5 Hz) of H-9
suggested cis relationships between H-9 and H-10 and between
1
H-9 and H-14. H–1H COSY and HMBC correlations of 2 were
similar to those of 1. On the basis of these data, the structure of
2 was established as shown. Protons and carbons in 2 are
assigned by analysis of 2D NMR data (Table 1).
Dothideomycetide A (3) exhibited a molecular formula
C25H34O7 as determined by HRESI-MS. 1H NMR spectrum of 3
showed signals of a singlet aromatic proton (δH 7.08), six
methyls, and a number of methine and methylene protons. 13C
and DEPTs NMR data revealed the presence of 25 carbons in 3,
which were classified as 6 methyl carbons, 4 methylene carbons,
5 methine (4 sp3 and 1sp2) carbons, and 10 quaternary carbons.
1
Detailed analysis of H and 13C NMR data revealed that 3 had
the same 3-hydroxy-2,4-dimethylhexanoic acid unit as that in 1
and 2, and the structure elucidation of this moiety was carried
out in the same fashion as that for 1 and 2. Chemical shifts of
the methyl groups at δH 1.67 (s, H3-16) and 1.46 (s, H3-15)
suggested that they were attached to oxygenated sp3 quaternary
Therefore, the absolute configurations at C-2′, C-4′, C-9, and
C-14 were assigned as R, S, S, and R, respectively. The absolute
configuration at C-6 in dothideomycetone A (1) was addressed
1
carbons (C-12 and C-14). H–1H COSY spectrum of 3 estab-
lished a partial structure of H2-1/H2-2/H2-3/H-4/H3-17. The
HMBC correlations from H2-1 to C-5, C-9, and C-10; H-4 to
C-5, C-6, and C-10; and H3-17 to C-5 suggested the attachment
of the substructure H2-1/H2-2/H2-3/H-4/H3-17 to C-5/C10 of an
aromatic ring. The HMBC correlations from H-7 to C-5, C-6,
C-8, C-9, and C-14 and from H3-15 to C-8, C-13, and C-14
placed the singlet aromatic proton at C-7 and established both
the linkage at C-8/C-14 and the position of C-13 ketone. The
Fig. 2 Δδ values for the MTPA esters 1a and 1b.
This journal is © The Royal Society of Chemistry 2012
Org. Biomol. Chem., 2012, 10, 7220–7226 | 7221

View Online
Table 1 NMR data (CDCl3, 600 MHz) of compounds 1–3
1
2
3
Carbon no.
1
δC
δH, mult. (J in Hz)
δC
δH, mult. (J in Hz)
δC
δH, mult. (J in Hz)
200.5
200.4
27.4
2.48, ddd (16.6, 9.4, 9.3); 3.63,
ddd (16.6, 4.6, 4.4)
1.62, m; 1.83, m
1.65, m; 1.75, m
3.14, m
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
1′
2′
3′
4′
5′
6′
7′
8′
130.1
145.7
35.3
74.8
74.3
51.5
209.9
65.3
73.2
35.5
23.4
33.6
34.2
11.6
23.6
19.9
175.3
43.7
75.6
36.3
26.7
11.7
14.3
12.3
130.4
145.7
35.7
74.8
74.1
52.3
209.4
56.8
71.4
30.4
23.7
29.0
33.3
11.6
23.7
18.9
175.2
43.7
75.6
36.3
26.7
11.7
14.2
12.2
29.3
18.2
27.2
2.88, br d (17.5); 2.55, br d (17.5)
5.29, dd (2.2, 2.3)
2.85, d (19.5); 2.48, d (19.5)
5.31, dd (2.2, 2.2)
130.7
159.4
109.5
143.9
119.6
142.4
191.8
83.3
206.2
76.2
34.7
23.4
20.5
174.4
43.5
76.1
36.1
26.8
12.2
13.8
11.8
3.46, d (17.0); 3.56, d (17.0)
3.33, d (17.5); 3.66, d (17.5)
7.08, s
2.20, t (10.4)
3.70, ddd (10.4, 10.4, 4.1)
1.95, m; 1.29, m
1.30, m
0.95, m
1.70, m
1.83, s
1.42, s
0.88, d, (6.1)
3.14, br t (0.5)
3.88, br dd (11.6, 4.7)
1.60, m; 1.83, m
1.30, m
1.28, m; 1.40, m
1.80, m
1.80, s
1.42, s
1.00, d (7.0)
1.67, s
1.46, s
1.22, d (6.9)
2.58, quin (7.0)
3.57, dd (9.0, 3.0)
1.42, m
1.27, m; 1.43, m
0.88, t (7.0)
1.07, d (7.1)
0.82, d (6.5)
2.57, quin (7.1)
3.56, br d (7.7)
1.45, m
1.27, m; 1.40, m
0.89, t (7.1)
1.07, d (7.2)
0.84, d (6.8)
2.85, quin (7.1)
3.78, dd (8.5, 2.3)
1.56, m
1.37, m; 1.54, m
0.93, t (7.4)
1.25, d (7.0)
0.90, d (6.5)
Fig. 5 Proposed biosynthetic pathway of dothideomycetide A (3).
Fig. 4 Δδ values for the MTPA esters 5a and 5b. (i) MeI, K2CO3,
acetone, 81%; (ii) a. (R)- or (S)-MTPA, DMAP, CDCl3, 0 °C; b. DCC,
31%.
dothideomycetone A (1) is migrated from C-5 to C-6 with con-
comitant oxidation of C-5 alcohol to ketone (Fig. 5). Epoxida-
tion of a double bond, followed by epoxide ring opening, gives
rise to an intermediate D. Loss of H2O from the intermediate D,
intramolecular Michael addition, and aromatization lead to the
formation of dothideomycetide A (3) (Fig. 5). The proposed bio-
synthetic pathway establishes the absolute configurations at C-4
and C-12 in 3 as R and S, respectively. However, the C-14 absol-
ute configuration in 3 could not be established based on available
spectral data. Upon these spectroscopic data, the structure of 3
was secured.
HMBC correlations from H3-16 to C-11, C-12, and C-13
suggested that the C-16 methyl group was flanked by C-11 and
C-13 ketones. Chemical shift implied that C-11 (δC 191.8) was a
conjugated ketone, which attached to an aromatic ring. On the
basis of these data, a core structure of 3 was established. A
downfield shift (δC 83.3) of C-12 suggested that 3-hydroxy-2,4-
dimethylhexanoic acid unit was esterified at the C-12 hydroxyl
group. Mosher’s method was used to determine the absolute
configuration of 3′-OH in 3. A phenolic 6-OH of 3 was first pro-
tected by methylation to give 5, which was esterified with
Mosher’s reagents, furnishing MTPA esters 5a and 5b (Fig. 4).
As expected, the Δδ values indicated the R configuration of C-3′
in 3 (Fig. 4), which was the same as that in 1. Dothideomycetide
A (3) was possibly biosynthetically derived from the azaphilone
derivative 1, and its configurations at C-4 and C-12 were inferred
from biosynthetic analogy with 1. The acyl side chain in
Dothideomycetone A (1) exhibited cytotoxic activity against
MOLT-3 (acute lymphoblastic leukemia) cancer cell line with
IC50 value of 24 μg mL−1, but it was not active (at 50 μg mL−1
)
toward HuCCA-1 (human cholangiocarcinoma), A549 (human
lung carcinoma), and HepG2 (human hepatocellular liver carci-
noma) cancer cell lines. While dothideomycetone B (2) did not
exhibit cytotoxicity, dothideomycetide A (3) showed cytotoxic
7222 | Org. Biomol. Chem., 2012, 10, 7220–7226
This journal is © The Royal Society of Chemistry 2012

View Online
activity against HuCCA-1, A549, HepG2, and MOLT-3 cell lines
with IC50 values of 33, 36, 35, and 15 μg mL−1, respectively.
Dothideomycetide A (3) showed antibacterial activity against
Staphylococcus aureus ATCC 25923 and ATCC 33591 (methi-
cillin resistant strain) with respective MIC values of 128 and
256 μg mL−1, but dothideomycetones A (1) and B (2) were
inactive.
strands using the NS1, NS2, NS3, NS4, NS5, NS6, NS7 and
NS8 primers.20
The DNA sequences of the ITS1-5.8S-ITS2 (549 nucleotides)
and that of the 18S rRNA gene (1755 nucleotides) obtained
were submitted to BLASTN 2.2.26+ program21 to search for
similar sequences in GenBank. DNA sequences were aligned
using the Clustal W multiple sequence alignment program in the
CLC Main Workbench software package version 6.6.2 (CLC
bio, Denmark) with manual final adjustment. Phylogenetic
relationship was estimated using the neighbor-joining method.
Bootstrap analysis was performed with 1000 replications to
determine the support for each clade.
Experimental section
General
The ITS1-5.8S-ITS2 DNA sequence of the CRI7 was shown
to be similar to those of some Mycoleptodiscus indicus strains
(GenBank accession number GU220382, GU980696, JF736515)
with 94% sequence identity. No other sequence of higher per
cent identity could be found in the GenBank. Comparison of
18S rRNA gene revealed that the CRI7 fungus was related to
fungi in the class Dothideomycetes with 94–96% DNA sequence
identity. A phylogenetic tree constructed from 18S rRNA
sequence alignments showed that the CRI7 fungus formed a
cluster with Acrospermum compressum UME 31704 and A. gra-
mineum UME 31190 (GenBank accession number AF242258
and AF242259, respectively). However, the sequence identity of
96% was too low to reliably place the CRI7 fungus in this
genus. Based on the above data and the current Ascomycota sys-
tematics,22 the strain CRI7 was classified as a mycelia sterilia
fungus Dothideomycete sp., belonging to the class Dothideomy-
cetes, subphylum Pezizomycotina. The DNA sequence of
18S-ITS1-5.8S-ITS2rRNA gene region of the CRI7 fungus has
been submitted to GenBank with an accession number of
JQ867364. Culture of the CRI7 has been deposited at Chulab-
horn Research Institute.
Optical rotations were measured with sodium D line (590 nm)
on JASCO DIP-370 digital polarimeter. UV-Vis spectra were
obtained using a Shimadzu UV-1700 PharmaSpec spectropho-
tometer. FT-IR data were recorded on a universal attenuated total
reflectance (UATR) attachment on a Perkin-Elmer Spectrum One
1
spectrometer. H, 13C and 2D NMR spectra were acquired on a
Bruker AVANCE 600 spectrometer (operating at 600 MHz for 1H
and 150 MHz for 13C). HRESI-MS spectra were recorded on a
Bruker MicroTOF-LC spectrometer.
Fungal material and identification of the fungus
Roots of Tiliacora triandra were collected from Nakhonsawan
Province, Thailand, and they were cleaned under running tap
water. The cleaned roots of T. triandra were surface-sterilized,
and the isolation of endophytic fungi was carried out according
to the method previously described by Schulz and co-workers.19
The CRI7 fungus was cultured on potato dextrose agar and
banana leaf agar at 25 °C in 12 h light–12 h light cycle and in
darkness. The fungus grew as sterile mycelium without any
reproductive structure or characteristic morphology formed
during cultivation for up to 60 days. The CRI7 fungus was sub-
jected to DNA sequence-based identification. The CRI7 fungus
was cultivated in potato dextrose broth for 7 days, the mycelium
was collected and washed with sterile water. Total cellular DNA
was extracted from the washed fungal mycelium using FTA®
Plant Kit (Whatman®, USA) according to the manufacturer’s
instructions. The ITS1-5.8S-ITS2 of the ribosomal RNA gene
region was amplified from the fungal genomic DNA by PCR
(GoTaq® Colorless Master Mix, Promega) using the ITS5
Extraction and isolation of the metabolites 1–4 from the
endophytic fungus Dothideomycete sp. CRI7
The fungus Dothideomycete sp. CRI7 grown in PDB was filtered
to obtain fermentation broth (15 L) and mycelia. Fermentation
broth of the fungus was extracted with an equal volume of
EtOAc, to obtain a crude broth extract (3.5 g). This crude extract
was divided into two fractions, methanol soluble and methanol
insoluble materials. Methanol insoluble fraction was found to be
austdiol (4, 540 mg). Methanol soluble part was fractionated
(approximately 25 mL for each fraction collected) on Sephadex
LH-20 column chromatography (4 × 58 cm), eluted with MeOH,
to yield 14 fractions (F1–F14). Each fraction was monitored by
(GGAAGTAAAAGTCGTAACAAGG)
and
ITS4
(TCCTCCGCTTATTGATATGC) primers.20 The thermal cycle
program was as follows: 5 min at 95 °C followed by 30 cycles
of 50 s at 95 °C, 40 s at 45 °C and 40 s at 72 °C, with a final
extension period of 10 min at 72 °C (GeneAmp® PCR System
9700, Applied Biosystems). The amplified DNA fragment was
purified and subjected to DNA sequencing on both strands using
primers ITS5 and ITS4.
1
TLC and H NMR spectrum. Fractions with same TLC patterns
1
and H NMR spectrum were pooled together to obtain six main
fractions (A/I–A/VI). Fraction A/II (478 mg) was further fractio-
nated using Sephadex LH-20 column chromatography (2 cm ×
125 cm) to obtain 14 fractions (15 mL each), and fractions with
similar TLC patterns were combined to yield five main fractions
(B/I–B/V). Fraction B/II (74 mg) was purified by preparative
TLC, developed with a solvent system of 50% EtOAc in hexane,
yielding compound 1 (25 mg). Fraction B/III (230 mg) was
further purified by silica gel column chromatography (3 cm ×
35 cm) using a gradient system of EtOAc and hexane (150 mL)
The NS1 (GTAGTCATATGCTTGTCTC) and NS8
(TCCGCAGGTTCACCTACGGA) primers were used to amplify
the 18S rRNA gene from total DNA extracts using the PCR
reagents and the thermal cycler as mentioned above.20 The
thermal cycle program was as follows: 5 min at 95 °C followed
by 30 cycles of 50 s at 95 °C, 40 s at 42 °C, and 2 min at 72 °C,
with a final extension period of 10 min at 72 °C. The amplified
DNA was purified and subjected to DNA sequencing on both
This journal is © The Royal Society of Chemistry 2012
Org. Biomol. Chem., 2012, 10, 7220–7226 | 7223

View Online
Methylation of compound 3
(3 : 7, 4 : 6, 5 : 5, 6 : 4, 7 : 3, 8 : 2, 9 : 1 and 100 : 0), giving three
fractions (C/I–C/III). The fraction C/II (120 mg) was further sep-
arated by reversed-phase (C18) HPLC, eluted with the solvent
system of 70% MeOH in water, to yield compound 1 (40 mg)
and compound 2 (5 mg). Fraction A/IV (740 mg) was further
fractionated using Sephadex LH-20 column chromatography
(75 cm × 3 cm), to obtain 18 fractions (15 mL each). These frac-
tions were combined on the basis of TLC pattern, to yield six
main fractions (D/I–D/VI). Fraction D/IV (300 mg) was further
divided into hexane soluble (170 mg) and hexane insoluble
(130 mg) materials. The hexane soluble part was further purified
using silica column chromatography, eluted with a mixture of
hexane and EtOAc with an increasing polarity (7 : 3, 6 : 4, 5 : 5,
4 : 6, 3 : 7, 2 : 8, 1 : 9 and finally with 100% EtOAc), to yield
compound 3 (39 mg).
Fungal mycelia were extracted sequentially with MeOH
(500 mL × 2) and CH2Cl2 (500 mL × 2). The MeOH and
CH2Cl2 extracts were combined and extracted with EtOAc
(500 mL × 3), yielding a crude cell extract (9 g). The cell extract
was divided into two parts, hexane soluble and hexane insoluble
materials. The hexane soluble material was further fractionated
using Sephadex LH-20 column chromatography (4 cm × 58 cm),
eluted with MeOH, to obtain 21 fractions (25 mL each). After
monitoring TLC patterns of each fraction, fractions 7 and 8 were
combined, and this material (320 mg) was further purified by
silica gel column chromatography (35 cm × 3 cm), eluted with a
mixture of hexane and EtOAc with an increasing polarity (7 : 3,
3 : 2, 5 : 5, 2 : 3, 3 : 7, 1 : 4, 1 : 9, and finally with 100% EtOAc),
to yield 64 fractions (10 mL each). Fractions 48–55 were com-
bined based on TLC profile, and this combined fraction con-
tained compound 3 (90 mg).
To compound 3 (30 mg) in acetone (1 mL), K2CO3 (10 mg) and
MeI (3.5 mL) were added, and the mixture was stirred at room
temperature for overnight. Then, the reaction mixture was evap-
orated to dryness, dissolved in EtOAc (10 mL), and washed with
H2O (5 × 8 mL). The crude product was further purified by pre-
parative TLC, developed with a solvent system of 50% EtOAc in
hexane, to obtain a methylated product 5 (25 mg): [α]2D7 +23.0 (c
0.60, MeOH); UV (MeOH) λmax (log ε) 290 (3.7) nm; FT-IR
νmax 3365, 2961, 2937, 1736, 1684, 1573, 1368, 1345, 1292,
1277, 1162, 1133, 1091 cm−1; H NMR (CDCl3, 400 MHz) δH:
1
0.92 (3H, d, J = 6.5 Hz, 4′-Me), 0.95 (3H, t, J = 7.2 Hz, H-6′),
1.21 (3H, d, J = 6.8 Hz, H-17), 1.27 (3H, d, J = 7 Hz, 2′-Me),
1.47 (3H, s, H-16), 2.81 (1H, quin, J = 7 Hz, H-2′), 3.14 (1H,
m, H-4), 3.66 (1H, m, H-1), 3.76 (1H, dd, J = 8.5 Hz, 2.3 Hz,
H-3′), 3.95 (3H, s, 6-OMe), 7.14 (1H, s, H-7); HRESI-MS m/z
461.2532 [M + H]+ (calcd for C26H37O7, 461.2539).
Preparation of (R)- and (S)-MTPA esters of compounds 1 and 5
To compound 1 (ca. 6 mg) in NMR tube, 11.5 mg of (S)-3,3,3-
trifluoro-2-methoxy-2-phenylpropanoic acid (MTPA) in CDCl3
(0.3 mL) and 1.05 mg of 4-dimethylaminopyridine (DMAP)
were added. The mixture was shaken vigorously and cooled to
0 °C, and 20 mg of N,N′-dicyclohexylcarbodiimide (DCC) was
added. Completion of the reaction was indicated by analysis of
1H NMR spectrum. A reaction mixture was purified by prepara-
tive TLC, developed with a solvent system of 30% EtOAC in
hexane, to give 1a (2.2 mg), or (S)-MTPA ester of 1. (R)-MTPA
ester (1b, 1.8 mg) was prepared in the same manner as that of
(S)-MTPA ester.
Dothideomycetone A (1). Pale yellow amorphous solid; [α]D27
+56.2 (c 0.50, MeOH); UV (MeOH) λmax (log ε) 248 (3.9) nm;
FT-IR νmax 3464, 2953, 2931, 2873, 1712, 1676, 1640, 1458,
(S)-MTPA ester 1a. [α]2D7 +13.2 (c 0.09, MeOH); UV
(MeOH) λmax (log ε) 245 (3.8), 275 (3.1) nm; FT-IR νmax 3351,
2942, 2923, 1723, 1707, 1671, 1643, 1372, 1177, 1039 cm−1
;
1379, 1173, 1042 cm−1 1H and 13C NMR, see Table 1;
;
1H NMR (CDCl3, 400 MHz) δH: 0.83 (3H, d, J = 6.8 Hz, H-8′),
0.91 (3H, t, J = 7.3 Hz, H-6′), 0.98 (3H, d, J = 6.5 Hz, H-17),
1.05 (3H, d, J = 6.94, H-7′), 1.07 (2H, m, H-13), 1.30 (2H, m,
H-11), 1.35 (2H, m, H-5′), 1.35 (2H, m, H-12), 1.40 (3H, s,
H-16), 1.65 (1H, m, H-4′), 1.75 (1H, m, H-14), 1.93 (1H, m,
H-4a), 2.38 (1H, m, H-4b), 2.49 (1H, t, J = 10.4 Hz, H-9), 2.73
(1H, quin, J = 7.2 Hz, H-2′), 3.10 (1H, d, J = 18.0 Hz, H-7a),
3.42 (3H, brs, OCH3 of MTPA) 3.64 (1H, d, J = 18.4 Hz, H-7b),
5.08 (1H, ddd, J = 10.8, 10.8, 4.2 Hz, H-10), 5.12 (1H, dd, J =
3.0, 3.6 Hz, H-5), 5.38 (1H, dd, J = 8.6, 3.0 Hz, H-3′), 7.41 (8H,
m, aromatic signals of MTPA), 7.57 (2H, m, aromatic signals of
MTPA); HRESI-MS m/z 907.3479 [M + Na]+ (calcd for
C45H54F6NaO11, 907.3468).
HRESI-MS m/z 453.2847 [M + H]+ (calcd for C25H41O7,
453.2852).
Dothideomycetone B (2). Pale yellow amorphous solid; [α]D27
+33.0 (c 0.43, MeOH); UV (MeOH) λmax (log ε) 249 (4.0) nm;
FT-IR νmax 3446, 2953, 2932, 2866, 1726, 1712, 1675, 1458,
1379, 1242, 1171, 1097, 1041 cm−1 1H and 13C NMR, see
;
Table 1; HRESI-MS m/z 453.2852 [M + H]+ (calcd for
C25H41O7, 453.2852).
Dothideomycetide A (3). Pale yellow amorphous solid; [α]D27
+47.0 (c 1.8, MeOH); UV (MeOH) λmax (log ε) 293 (3.8) nm;
FT-IR νmax 3372, 2960, 2934, 2873, 1732, 1688, 1579, 1455,
1421.65, 1371, 1340, 1295, 1273, 1243, 1169, 1136, 1097,
(R)-MTPA ester 1b. [α]2D7 +12.7 (c 0.08, MeOH); UV
(MeOH) λmax (log ε) 249 (3.9), 272 (3.2) nm; FT-IR νmax 3349,
1053, 1024, 962, 890 cm−1 1H and 13C NMR, see Table 1;
;
HRESI-MS m/z 447.2369 [M + H]+ (calcd for C25H41O7,
2946, 2922, 1726, 1702, 1674, 1647, 1368, 1170, 1042 cm−1
;
447.2383).
1H NMR (CDCl3, 400 MHz) δH: 0.72 (3H, d, J = 6.8 Hz, H-8′),
0.86 (3H, t, J = 6.0 Hz, H-6′), 0.92 (3H, d, J = 6.4 Hz, H-17),
1.02 (2H, m, H-12), 1.05 (2H, m, H-13), 1.11 (3H, d, J = 7.2
Hz, H-7′), 1.30 (2H, m, H-5′), 1.35 (2H, m, H-11), 1.40 (3H, s,
H-16), 1.64 (1H, m, H-4′), 1.70 (1H, m, H-14), 1.93 (1H, m,
H-4a), 2.31 (1H, m, H-4b), 2.46 (1H, t, J = 10.6 Hz, H-9), 2.76
(1H, quin, J = 7.2, H-2′), 3.01 (1H, d, J = 18.1 Hz, H-7a), 3.42
Austdiol (4). [α]D27 +106.7 (c 1.0, pyridine), Lit.12 [α]2D6
+160.3 (c 1.25, pyridine); UV (MeOH) λmax (log ε) 256 (3.87),
380.5 (4.1) nm; FT-IR νmax 3473, 3377, 1604, 1470, 1412,
1287, 1259, 1198, 1174, 1095, 1069, 1044, 932, 879, 852 cm−1
;
1H and 13C NMR data were in good agreement with those
reported in the literature.12,13
7224 | Org. Biomol. Chem., 2012, 10, 7220–7226
This journal is © The Royal Society of Chemistry 2012

View Online
Antimicrobial activity. Antibacterial activities of the purified
compounds against Staphylococcus aureus ATCC 25923, methi-
cillin resistant Staphylococcus aureus ATCC 33591 and Escheri-
chia coli ATCC 25922 were determined using the Clinical and
Laboratory Standards Institute (CLSI) M7-A4 method (National
Committee for Clinical Laboratory Standards, 1997).25 Suspen-
sion of each bacterial strain was prepared and diluted in Mueller-
Hinton broth to 106 CFU mL−1. A 50 μL bacterial inoculum
was dispensed into each well containing 50 μL of serially diluted
test compound. All compounds were tested in duplicates at up to
a maximum concentration of 256 μg mL−1. Sample solutions
were prepared immediately before use. After incubation at 37 °C
for 24 h, a 20 μL aliquot of p-iodonitrotetrazolium (INT) solu-
tion (1 mg mL−1) was added into each well. The assay plates
were further incubated for 1 h. Violet color developed in the well
indicated growth of the test organism. No change in color indi-
cated no growth, and thus no antibacterial activity of the test
compound. Minimum inhibitory concentration (MIC) was
defined as the lowest concentration that inhibited growth of the
test bacteria. Ampicillin was used as a positive control, exhibit-
ing respective MIC values of 0.125, 256, and 4.0 μg mL−1
against S. aureus ATCC 25923, S. aureus ATCC 33591 (methi-
cillin resistant strain), and E. coli ATCC 25922.
(3H, brs, OCH3 of MTPA), 3.53 (1H, d, J = 16.4 Hz, H-7b),
5.01 (1H, ddd, J = 10.8, 10.7, 4.1 Hz, H-10), 5.10 (1H, dd, J =
3.0, 3.6 Hz, H-5), 5.32 (1H, dd, J = 8.6, 3.0 Hz, H-3′), 7.41
(10H, m, aromatic signals of MTPA), 7.57 (3H, m, aromatic
signals of MTPA); HRESI-MS m/z 907.3482 [M + Na]+ (calcd
for C45H54F6NaO11, 907.3468).
(R)- and (S)-MTPA esters 5a and 5b were prepared from com-
pound 5, using the same method as those for 1a and 1b. To com-
pound 5 (ca. 5.0 mg) in NMR tube, 7.0 mg of (S)- MTPA in
CDCl3 (0.3 mL) and 1.00 mg of DMAP were added. The
mixture was shaken and cooled to 0 °C, then DCC (15 mg) was
added to the reaction mixture. Completion of the reaction was
1
indicated by analysis of H NMR spectrum. A reaction mixture
was purified by preparative TLC, eluted with 30% EtOAC in
hexane, affording 5a (2.3 mg), or (S)-MTPA ester of 5. (R)-
MTPA ester (5b, 2.0 mg) was prepared in the same manner as
that of (S)-MTPA ester.
(S)-MTPA ester 5a. [α]2D7 +13.0 (c 0.10, MeOH); UV
(MeOH) λmax (log ε) 272 (3.3), 293 (3.4) nm; FT-IR νmax 3347,
2965, 2940, 1731, 1710, 1681, 1577, 1356, 1341, 1290, 1273,
1
1
1160, 1134, 1089 cm−1; H NMR (CDCl3, 400 MHz) δH: H
NMR (CDCl3, 400 MHz) δH: 0.93 (3H, d, J = 6.8 Hz, H-8′),
0.97 (3H, t, J = 7.3 Hz, H-6′), 1.20 (3H, d, J = 6.8 Hz, H-17),
1.32 (3H, d, J = 7.3 Hz, H-7′), 1.39 (3H, s, H-16), 1.50 (2H, m,
H-5′), 1.60 (1H, m, H-3a), 1.60 (1H, m, H-2a), 1.70 (1H, m,
H-3b), 1.85 (1H, m, H-2b), 1.85 (1H, m, H-4′), 2.43 (1H, ddd,
J = 18.3, 9.8, 6 Hz, H-1a), 3.13 (1H, quin, J = 7.2 Hz, H-2′),
3.19 (1H, m, H-4), 3.50 (3H, s, OCH3 of MTPA), 3.65 (1H, m,
H-1b), 3.93 (3H, s, 6-OMe), 5.43 (1H, dd, J = 7.0, 4.5 Hz,
H-3′), 7.09 (1H, s, H-7), 7.40 (3H, m, aromatic signals of
MTPA), 7.64 (2H, m, aromatic signals of MTPA); HRESI-MS
m/z 699.2735 [M + Na]+ (calcd for C36H43F3NaO9, 699.2757).
Conclusions
We have isolated the novel tricyclic polyketide 3, together with
its congeners 1 and 2, from the endophytic fungus Dothideomy-
cete sp. CRI7. Compound 3 is the first polyketide furnished with
the 6,6,6 ring system, similar to a terpenoid skeleton. The novel
polyketide 3 is more likely derived from azaphilone derivatives 1
and 2 which are co-metabolites isolated from the same fungus.
(R)-MTPA ester 5b. [α]2D7 +15.0 (c 0.11, MeOH); UV
(MeOH) λmax (log ε) 275 (3.3), 291 (3.6) nm; FT-IR νmax 3342,
2961, 2939, 1733, 1715, 1684, 1573, 1358, 1344, 1293, 1271,
Acknowledgements
P.K. is supported by The Thailand Research Fund and the Center
of Excellence on Environmental Health and Toxicology, Science
& Technology Postgraduate Education and Research Develop-
ment Office (PERDO), Ministry of Education. C.M. and S.W.
are partially supported by Mahidol University research grants.
1
1164, 1137, 1082 cm−1; H NMR (CDCl3, 400 MHz) δH: 0.77
(3H, d, J = 6.7 Hz, H-8′), 0.89 (3H, t, J = 7.1 Hz, H-6′), 1.10
(1H, m, H-3a), 1.21 (3H, d, J = 6.8 Hz, H-17), 1.30 (1H, m,
H-3b),1.30 (2H, m, H-5′), 1.35 (3H, d, J = 7.4 Hz, H-7′), 1.43
(3H, s, H-16), 1.60 (1H, m, H-2a), 1.68 (3H, s, H-15), 1.80 (1H,
m, H-4′), 1.85 (1H, m, H-2b), 2.47 (1H, ddd, J = 17.2, 10.0. 6,0
Hz, H-1a), 3.12 (1H, quin, J = 7.1 Hz, H-2′), 3.20 (1H, m, H-4),
3.58 (3H, brs, OCH3 of MTPA), 3.65 (1H, m, H-1b), 3.95 (3H,
s, 6-OMe), 5.42 (1H, dd, J = 6.8, 4.7 Hz, H-3′), 7.12 (1H, brs,
H-7), 7.39 (3H, m, aromatic signals of MTPA), 7.64 (2H, m, aro-
matic signals of MTPA); HRESI-MS m/z 699.2743 [M + Na]+
(calcd for C36H43F3NaO9, 699.2757).
Notes and references
1 R. X. Tan and W. X. Zou, Nat. Prod. Rep., 2001, 18, 448–459.
2 S. X. Yang, H. P. Wang, J. M. Gao, Q. Zhang, H. Laatsch and Y. Kuang,
Org. Biomol. Chem., 2012, 10, 819–824.
3 R. A. Davis, A. R. Carroll, K. T. Andrews, G. M. Boyle, T. L. Tran,
P. C. Healy, J. A. Kalaitzis and R. G. Shivas, Org. Biomol. Chem., 2010,
8, 1785–1790.
4 H. Hussain, K. Krohn, I. Ahmed, S. Draeger, B. Schulz, S. D. Pietro and
G. Pescitelli, Eur. J. Org. Chem., 2012, 1783–1789.
5 P. Chomcheon, S. Wiyakrutta, T. Aree, N. Sriubolmas,
N. Ngamrojanavanich, C. Mahidol, S. Ruchirawat and P. Kittakoop,
Chem.–Eur. J., 2010, 16, 11178–11185.
6 K. Tianpanich, S. Prachya, S. Wiyakrutta, C. Mahidol, S. Ruchirawat and
P. Kittakoop, J. Nat. Prod., 2011, 74, 79–81.
7 C. Hertweck, A. Luzhetskyy, Y. Rebets and A. Bechthold, Nat. Prod.
Rep., 2007, 24, 162–190.
8 H. J. Kim, M. W. Ruszczycky, S. H. Choi, Y. N. Liu and H. W. Liu,
Nature, 2011, 473, 109–112.
Bioassays
Cytotoxicity. Cytotoxic activity for HuCCA-1, HepG2, A549,
and MOLT-3, cell lines was evaluated with MTT23 and XTT24
assays. Etoposide and doxorubicin were used as the reference
drugs. Doxorubicin exhibited IC50 values of 0.4, 0.2, and 0.3 μg mL−1
against HuCCA-1, HepG2, and A549 cell lines, respectively,
while etoposide showed cytotoxic activity toward MOLT-3 cell
9 H. J. Kim, R. Pongdee, Q. Wu, L. Hong and H. W. Liu, J. Am. Chem.
Soc., 2007, 129, 14582–14584.
line with the IC50 value of 0.02 μg mL−1
.
This journal is © The Royal Society of Chemistry 2012
Org. Biomol. Chem., 2012, 10, 7220–7226 | 7225

View Online
10 M. Huang, C. Huang and B. Liu, Tetrahedron Lett., 2009, 50, 2797–2800.
11 M. Isaka, W. Prathumpai, P. Wongsa and M. Tanticharoen, Org. Lett.,
2006, 8, 2815–2817.
12 R. Vleggaar, P. S. Steyn and D. W. Nagel, J. Chem. Soc., Perkin Trans. 1,
1974, 45–49.
19 B. Schulz, J. Sucker, H. J. Aust, K. Krohn, K. Ludewig, P. G. Jone and
D. Doring, Mycol. Res., 1995, 99, 1007–1015.
20 T. J. White, T. Bruns, S. Lee and J. Taylor, in PCR Protocols: A Guide to
Methods and Applications, ed. M. A. Innis, D. H. Gelfand, J. J. Sninsky
and T. J. White, Academic Press, San Diego, 1990, pp. 315–322.
21 Z. Zhang, S. Schwartz, L. Wagner and W. Miller, J. Comput. Biol., 2000,
7, 203–214.
13 A. E. Pohland, P. L. Schuller, P. S. Steyn and H. P. Van Egmond, Pure
Appl. Chem., 1982, 54, 2219–2284.
14 C. H. Heathcock, in Asymmetric Synthesis, ed. J. D. Morrison, Academic
Press, New York, 1984, vol. 3 ( (Part B)).
22 H. T. Lumbsch and S. M. Huhndorf, ed., Outline of Ascomycota–2007,
Myconet, 2007, 13, 1–58.
15 C. R. Mateus, M. P. Feltrin, A. M. Costa, F. Coelho and W. P. Almeida,
Tetrahedron, 2001, 57, 6901–6908.
16 K. Kinoshita, C. Khosla and D. E. Cane, Helv. Chim. Acta, 2003, 86,
3889–3907.
23 H. Tominaga, M. Ishiyama, F. Ohseto, K. Sasamoto, T. Hamamoto,
K. Suzuki and M. Watanabe, Anal. Commun., 1999, 36, 47–50.
24 A. Doyle and J. B. Griffiths, in Mammalian Cell Culture: Essential
Techniques, John Wiley & Sons, Chichester, UK, 1997.
17 Y. W. Hsu, L. C. Hsu, Y. H. Liang, Y. H. Kuo and T. M. Pan, J. Agric.
Food Chem., 2010, 58, 8211–8216.
25 National Committee for Clinical Laboratory Standards. Methods for
Dilution: Antimicrobial Susceptibility Tests for Bacteria that Grow Aero-
bically, NCCLS document M7-A4. National Committee for Clinical Lab-
oratory Standards, Wayne, PA, 4th edn, 1997.
18 D. N. Quang, T. Hashimoto, M. Stadler, N. Radulović and Y. Asakawa,
Planta Med., 2005, 71, 1058–1062.
7226 | Org. Biomol. Chem., 2012, 10, 7220–7226
This journal is © The Royal Society of Chemistry 2012