Synthesis and properties of 2′- O,4′- C -ethyleneoxy bridged 5-methyluridine

Article abstract of DOI:10.1021/ol401566r

2′-O,4′-C-Ethyleneoxy bridged 5-methyluridine (EoNA-T), possessing a seven-membered linkage and an anomeric 4′-carbon, was synthesized and introduced into oligonucleotides by using an automated DNA synthesizer. The EoNA-modified oligonucleotides significantly stabilized the duplexes with single-stranded RNA and triplexes with double-stranded DNA relative to the natural oligonucleotide and oligonucleotides modified by another seven-membered bridged 5-methyluridine, 2′,4′-BNA^COC-T. In addition, EoNA-T showed excellent nuclease resistance.

Full text of DOI:10.1021/ol401566r

ORGANIC
LETTERS
2013
Vol. 15, No. 14
3702–3705
Synthesis and Properties of
20‑O,40‑C‑Ethyleneoxy Bridged
5‑Methyluridine
Yoshiyuki Hari,* Tomohiko Morikawa, Takashi Osawa, and Satoshi Obika*
Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka,
Suita 565-0871, Japan
hari@phs.osaka-u.ac.jp; obika@phs.osaka-u.ac.jp
Received June 4, 2013
ABSTRACT
20-O,40-C-Ethyleneoxy bridged 5-methyluridine (EoNA-T), possessing a seven-membered linkage and an anomeric 40-carbon, was synthesized and
introduced into oligonucleotides by using an automated DNA synthesizer. The EoNA-modified oligonucleotides significantly stabilized the
duplexes with single-stranded RNA and triplexes with double-stranded DNA relative to the natural oligonucleotide and oligonucleotides modified
by another seven-membered bridged 5-methyluridine, 20,40-BNACOC-T. In addition, EoNA-T showed excellent nuclease resistance.
Artificial nucleic acids that stabilize complexes with
target nucleic acids are useful materials for various nucleic
acid technologies such as gene therapy and genetic diag-
nosis. Among numerous analogs developed to date, nucleic
acids bridged between the 20- and 40-positions generally lead
to an increased affinity to single-stranded RNA (ssRNA) or
double-stranded DNA (dsDNA), or both.1ꢀ6 Moreover,
the bridged nucleic acids have increased resistance to nucle-
ase degradation when compared with a natural nucleic acid.
Thebridgesizebetweenthe20-and40-positions is considered
to crucially affect the binding affinity and nuclease resis-
tance. 20,40-Methylene-bridged nucleic acid (BNA/LNA)
with a five-membered bridge has outstanding high-binding
affinities to ssRNA and dsDNA, as well as improved
(1) Reviews: Kaur, H.; Babu, B. R.; Maiti, S. Chem. Rev. 2007, 107,
4672. Obika, S.; Rahman, S. M. A.; Fujisaka, A.; Kawada, Y.; Baba, T.;
Imanishi, T. Heterocycles 2010, 81, 1347.
(6) For other nucleic acids bridged between 20- and 40-positions, see: (a)
Kumar, R.; Singh, S. K.; Koshkin, A. A.; Rajwanshi, V. K.; Meldgaard, M.;
Wengel, J. Bioorg. Med. Chem. Lett. 1998, 8, 2219. (b) Singh, S. K.; Kumar,
R.; Wengel, J. J. Org. Chem. 1998, 63, 10035. (c) Varghese, O. P.; Barman, J.;
Pathmasiri, W.; Plashkevych, O.; Honcharenko, D.; Chattopadhyaya, J.
J. Am. Chem. Soc. 2006, 128, 15173. (d) Morita, K.; Hasegawa, C.; Kaneko,
M.; Tsutsumi, S.; Sone, J.; Ishikawa, T.; Imanishi, T.; Koizumi, M. Bioorg.
Med. Chem. Lett. 2002, 12, 73. (e) Rahman, S. M. A.; Seki, S.; Obika, S.;
Yoshikawa, H.; Miyashita, K.; Imanishi, T. J. Am. Chem. Soc. 2008, 130,
4886. (f) Seth, P. P.; Siwkowski, A.; Allerson, C. R.; Vasquez, G.; Lee, S.;
Prakash, T. P.; Wancewicz, E. V.; Witchell, D.; Swayze, E. E. J. Med. Chem.
2009, 52, 10. (g) Seth, P. P.; Vasquez, G.; Allerson, C. A.; Berdeja, A.; Gaus,
H.; Kinberger, G. A.; Prakash, T. P.; Migawa, M. T.; Bhat, B.; Swayze, E. E.
J. Org. Chem. 2010, 75, 1569. (h) Seth, P. P.; Allerson, C. R.; Berdeja, A.;
Siwkowski, A.; Pallan, P. S.; Gaus, H.; Prakash, T. P.; Watt, A. T.; Egli, M.;
Swayze, E. E. J. Am. Chem. Soc. 2010, 132, 14942. (i) Shrestha, A. R.; Hari,
Y.;Yahara, A.;Osawa, T.;Obika, S.J. Org. Chem. 2011, 76, 9891. (j) Yahara,
A.; Shrestha, A. R.; Yamamoto, T.; Hari, Y.; Osawa, T.; Yamaguchi, M.;
Nishida, M.; Kodama, T.; Obika, S. ChemBioChem 2012, 13, 2513. (k) Hari,
Y.; Osawa, T.; Kotobuki, Y.; Shrestha, A. R.; Yahara, A.; Obika, S. Bioorg.
Med. Chem. 2013, 21, 4405.
(2) (a) Obika, S.; Nanbu, D.; Hari, Y.; Morio, K.; In, Y.; Ishida, T.;
Imanishi, T. Tetrahedron Lett. 1997, 38, 8735. (b) Nielsen, P.; Wengel, J.
Chem. Commun. 1998, 455. (c) Koshkin, A. A.; Singh, S. K.; Nielsen, P.;
Rajwanshi, V. K.; Kumar, R.; Meldgaard, M.; Olsen, C. E.; Wengel, J.
Tetrahedron 1998, 54, 3607. (d) Obika, S.; Nanbu, D.; Hari, Y.; Andoh,
J.; Morio, K.; Doi, T.; Imanishi, T. Tetrahedron Lett. 1998, 39, 5401. (e)
Obika, S.; Hari, Y.; Sugimoto, T.; Sekiguchi, M.; Imanishi, T. Tetra-
hedron Lett. 2000, 41, 8923. (f) Obika, S.; Uneda, T.; Sugimoto, T.;
Nanbu, D.; Minami, T.; Doi, T.; Imanishi, T. Bioorg. Med. Chem. 2001,
9, 1001. (g) Torigoe, H.; Hari, Y.; Sekiguchi, M.; Obika, S.; Imanishi, T.
J. Biol. Chem. 2001, 276, 2354.
(3) Morita, K.; Takagi, M.; Hasegawa, C.; Kaneko, M.; Tsutsumi,
S.; Sone, J.; Ishikawa, T.; Imanishi, T.; Koizumi, M. Bioorg. Med. Chem.
2003, 11, 2211.
(4) (a) Hari, Y.; Obika, S.; Ohnishi, R.; Eguchi, K.; Osaki, T.; Ohishi,
H.; Imanishi, T. Bioorg. Med. Chem. 2006, 14, 1029. (b) Mitsuoka, Y.;
Kodama, T.; Ohnishi, R.; Hari, Y.; Imanishi, T.; Obika, S. Nucleic Acids
Res. 2009, 37, 1225.
(5) Nishida, M.; Baba, T.; Kodama, T.; Yahara, A.; Imanishi, T.;
Obika, S. Chem. Commun. 2010, 46, 5283.
r
10.1021/ol401566r
Published on Web 07/01/2013
2013 American Chemical Society

nuclease resistance.2 In contrast, seven-membered bridge
analogs such as PrNA,3 20,40-BNACOC,4 and urea-BNA5
have excellent nuclease resistance because of the sterically
large bridge structure, although they lack the high binding
affinities probably due to fixation of their sugar conforma-
tion being incomplete (Figure 1).
Scheme 1. Synthesis of Intermediates and Attempted Bridge
Construction
40-Alkoxynucleosides tend toward the N-type sugar
conformation presumably because of the anomeric effect
on the 40-carbon atom.7,8 Recently, Rosenberg’s group re-
ported that oligonucleotides modified by 40-alkoxythymi-
dines increased the Tm value of duplexes with ssRNA by
approximately 1 °C per modification.8 Thus, we designed
a 20-O,40-C-ethyleneoxy bridged nucleic acid (EoNA) with
a seven-membered bridged structure between the 20- and
40-positions and an anomeric carbon at the 40-position. Its
sugar conformation is anticipated to be sufficiently re-
stricted to the N-form by the additional anomeric effect
despite the large, seven-membered bridge (Figure 1). This
can contribute not only to high nuclease resistance but also
to acquisition of high duplex- or triplex-forming ability.
Furthermore, as far as we know, there are no reports on
20,40-bridged nucleic acids with an additional heteroatom
on the 40-carbon atom, which motivated us to conduct
the present study. Here, 20-O,40-C-ethyleneoxy bridged
5-methyluridine (EoNA-T) was synthesized, and evalua-
tion of its oligonucleotides was carried out.
construct the bridged structure.9 In the former reaction,
3-benzyloxymethylthymine (BOM-T) was the only iso-
lated product (83% yield). The reaction using NBS af-
forded dioxane 9 in 24% yield via attack of hydroxyl group
on the 10-carbon, as shown in Scheme 2. In both cases, no
desiredproductwasdetected atall. Theseresults implythat
construction of the bridged structure by the attack on the
40-carbon is difficult.
Table 1. Benzylation of 4a
yield of 5 and 6
(5:6)
yield
conditions
of 7
Figure 1. Structures of PrNA, 20,40-BNACOC, urea-BNA, and
EoNA designed in the present study.
NaH, BnBr, DMF, 0 °C, 0.5 h
Bu2SnO, BnBr, DMF, 80 °C, 19 h
Ag2O, BnBr, CH2Cl2, rt, 16 h
45% (7:1)
47% (8:10)
75% (9:10)
30%
3%
6%
The synthesis of EoNA-T phosphoramidite 1 was ex-
amined (Schemes 1 and 3). After conversion from com-
mercially available 5-methyluridine 2 into exo-olefin 3, 4
was obtained by BOM-protection. Benzylation of 4 was
examined (Table 1). A conventional method using NaH
and BnBr was used for the preferential 20-O-benzylation
reaction leading to the 7:1 separable mixture of 20-O-
benzylated 5 and 30-O-benzylated 6. Dibenzylated com-
pound 7 was also obtained in 30% yield. In contrast, a
reaction system using Bu2SnO/BnBr or Ag2O/BnBr pro-
ceeded in a monobenzylation reaction without regioselec-
tivity. Consequently, in a reaction using Ag2O/BnBr, the
desired product 6 was isolated in 30% yield after purifica-
tion by silica gel column chromatography (Scheme 1).
After bonding of the 2-hydroxyethyl unit to 20-oxygen of
6 via two steps, 8 was treated with mCPBA or NBS to
a Recovery yields of starting material were 19% in NaH/BnBr, 28%
in Bu3SnO/BnBr, or 17% in Ag2O/BnBr.
Scheme 2. Possible Reaction Mechanism
As an alternative route, construction of the bridged
structure after introduction of the 2-hydroxyethoxy unit
(9) For examples of synthesis of 40-substituted nucleosides from 40,50-
unsaturated nucleosides, see: (a) Verheyden, J. P.; Moffatt, J. G. J. Am.
Chem. Soc. 1975, 97, 4386. (b) Maag, H.; Rydzewski, R. M.; McRoberts,
M. J.; Crawford-Ruth, D.; Verheyden, J. P. H.; Prisbe, E. J. J. Med.
Chem. 1992, 35, 1440. (c) Haraguchi, K.; Takeda, S.; Tanaka, H. Org.
Lett. 2003, 5, 1399. (d) Haraguchi, K.; Sumino, M.; Tanaka, H. J. Org.
Chem. 2006, 71, 4433.
(7) Tong, W.; Agback, P.; Chattopadhyaya, J. Acta Chem. Scand.
1993, 47, 145.
ꢀꢁ
(8) Liboska, R.; Snasel, J.; Barvı
k, Z.; Pav, O.; Rejman, D.; Novak, P.; Rosenberg, I. Org. Biomol.
ꢂꢁ
ꢀ
´
k, I.; Budesı
´
nsky, M.; Pohl, R.;
ꢁ
ꢀ
ꢀ
Tocı
´
Chem. 2011, 9, 8261.
Org. Lett., Vol. 15, No. 14, 2013
3703

Table 2. Duplex- and Triplex-Forming Abilities of Modified
Oligonucleotides with ssDNA, ssRNA, and dsDNAa
Scheme 3. Synthesis of Phosphoramidite 1
ssDNA
ssRNA
dsDNA
oligonucleotide
Tm (°C)
Tm (°C)
Tm (°C)
50-TCTTCTTTTTCTCT-30 (16) 50
51
31
50-TCTTCTTTTTCTCT-30 (17) 48 (ꢀ2.0) 52 (þ1.0) 32 (þ1.0)
50-TCTTCTTTTTCTCT-30 (18) 47 (ꢀ1.0) 59 (þ2.7) 37 (þ2.0)
50-TCTTCTTTTTCTCT-30 (19) 47 (ꢀ1.0) 60 (þ3.0) 41 (þ3.3)
50-TCTTCTTTTTCTCT-30 (20) 48 (ꢀ0.4) 69 (þ3.6) 50 (þ3.8)
50-TCTTCTTTTTCTCT-30 (21) 48 (ꢀ2.0) 52 (þ1.0) 31 (0)
50-TCTTCTTTTTCTCT-30 (22) 45 (ꢀ1.7) 57 (þ2.0) 31 (0)
50-TCTTCTTTTTCTCT-30 (23) 45 (ꢀ1.7) 57 (þ2.0) 33 (þ0.7)
50-TCTTCTTTTTCTCT-30 (24) 42 (ꢀ1.6) 62 (þ2.2) 33 (þ0.4)
a Conditions: 10 mM sodium cacodylate buffer (pH 7.2), 140 mM
KCl, and 4 μM of each oligonucleotide for duplex; and 10 mM sodium
cacodylate buffer (pH 7.2), 140 mM KCl, 5 mM MgCl2, and 1.5 μM of
each oligonucleotide for triplex. T = EoNA-T. T = 20,40-BNACOC-T.
C = 20-deoxy-5-methylcytidine. The sequences of ssDNA, ssRNA, and
dsDNA are 50-d(AGAGAAAAAGAAGA)-30, 50-r(AGAGAAAAA-
GAAGA)-30, and 50-d(GGCAGAAGAAAAAGAGACGC)-spacer18-
d(GCGTCTTCTTTTTCTCTGCC)-30, respectively.
on the 40-carbon was investigated (Scheme 3). Treatment
of 6 with mCPBA and an excess amount of siloxyethanol
in a solvent-free system led to compound 10 as the sole
isolated product. This stereoselectivity might be caused by
the less hindered β-face attack of mCPBA on the olefin.
Protection of the primary alcohol of 10 by 4,40-dimethoxy-
trityl triflate (DMTrOTf)10 followed by desilylation of
11 afforded diol 12. Although no ring closure of 12 proceeded
under Mitsunobu conditions using TMAD and Bu3P,11
the tosylated compound 13 prepared from 12 was treated
with NaH to give the desired product 14 in 91% yield. All
protecting groups were removed by hydrogenolysis to
obtain EoNA-T monomer 15. The 1H NMR measurement
(Table 2; see Figure 1 for the structure of 20,40-BNACOC).
The duplex-forming ability of 17ꢀ20 with ssDNA and
ssRNA showed the same tendency as that of the 20,40-
BNACOC-modified congeners 21ꢀ24; the duplexes with
ssDNA were destabilized relative to that of 16, and the
duplexes with ssRNA were stabilized. However, this mod-
ification rather than the 20,40-BNACOC modification en-
abled the stable formation of the duplexes with ssRNA.
Interestingly, stabilization by this modified nucleic acid
was apparently synergistic, and the quintuple-modified
oligonucleotide 20 stabilized the duplex with ssRNA by
þ3.6 °C per modification, the Tm value of which was 69°C.
In triplexes formed with dsDNA, 20,40-BNACOC-modified
oligonucleotides 21ꢀ24 showed almost no stabilization. In
contrast, oligonucleotides 17ꢀ20 showed significant stabi-
lization of the triplexes formed, and up to þ3.8 °C per
modification was observed. These results may imply that
the N-typesugar conformationconstrainedby notonly the
bridge structure but also an anomeric effect contributes
to significant stabilization of the duplexes and triplexes
formed with ssRNA and dsDNA, as expected.
The enzymatic stability of the modified oligonucleotides
was evaluated using 30-exonuclease. A comparison of
oligonucleotides 25ꢀ29 is shown in Figure 2a. Although
the 20,40-BNA/LNA-modified compound 28 and the nat-
ural compound 29 were quickly degraded, 25, which had
this analog, showed high resistance against the nuclease, as
we expected. The ability was comparable to that observed
by 20,40-BNACOC modification (26) and was better than
that of 27, which had a chiral phosphorothioate linkage,
i.e., an Sp-isomer possessing a highly nuclease-resistant
property.15 Moreover, examination of the oligonucleotides
modified at the 30-terminus demonstrated that modifica-
tion by this analog significantly suppressed degradation of
0
0
0
0
demonstrated that the J1 ,2 and J2 ,3 values of 15 were 0
and 6 Hz, respectively, which coincided with those of 20,40-
BNACOC-T monomer.4a,12 Afterward, the desired phos-
phoramidite 1 was obtained according to common meth-
ods toprepare a suitablebuilding block for oligonucleotide
synthesis. The oligonucleotide synthesis was performed on
an automated DNA synthesizer using common phosphor-
amidite chemistry with a prolonged coupling time (20 min)
for the introduction of the analog 1.13 Concerning the
oligonucleotide 18 with three consecutive modifications
shown in Table 1, successful synthesis was achieved using
double-coupling cycles14 together with the prolonged cou-
pling time.13
The duplex- and triplex-forming abilities of the modified
oligonucleotides17ꢀ20withssDNA, ssRNA, and dsDNA
were evaluated by UV melting experiments and compared
with those of the corresponding natural counterparts
16 and 20,40-BNACOC-modified oligonucleotides 21ꢀ24
€
(10) Tarkoy, M.; Bolli, M.; Leumann, C. Helv. Chim. Acta 1994, 77, 716.
^
(11) Tsunoda, T.; Otsuka, J.; Yamamiya, Y.; Ito, S. Chem. Lett. 1994,
539.
0
0
(12) The J1 ,2 value (0 Hz) indicates that the sugar conformation of
EoNA-T monomer 15 adopts the N-form. Altona, C.; Sundaralingam,
M. J. Am. Chem. Soc. 1973, 95, 2333.
(13) By means of monitoring the DMTr cation, the average coupling
yield for incorporation of 1 into oligonucleotides was estimated to be
90ꢀ95%.
(14) A double-coupling and waiting cycle was carried out prior to the
oxidation step.
(15) Burgers, P. M. J.; Eckstein, F. Biochemistry 1979, 18, 592.
Org. Lett., Vol. 15, No. 14, 2013
3704

the 50-site by the nuclease compared with 20,40-BNACOC
although the reason for this suppression is unclear (Figure 2b).
,
from 5-methyluridine). The modified oligonucleotides
showed stabilization of complexes with ssRNA and
dsDNA and increased stability against nuclease degra-
dation. These properties were superior to those of 20,40-
BNACOC that are most excellent among a series of
seven-membered bridged nucleic acids. These modified
oligonucleotides are advantageous in the development
of applications in which mRNA and genomic DNA are
targeted. Moreover, this result suggests that the design
concept of addition of a heteroatom at the 40-carbon atom
in the bridged structure is valuable to the development of
prominent tools for nucleic acid based technologies.
Acknowledgment. This work was supported in part by
a Grant-in-Aid for Scientific Research on Innovative
Areas (No. 22136006) from the Ministry of Education,
Culture, Sports, Science and Technology, Japan (MEXT)
and Takeda Science Foundation.
Figure 2. Degradation experiments by nuclease. Conditions:
2 μg/mL Crotalus admanteus venom phosphodiesterase (CAVP),
10 mM MgCl2, 50 mM Tris-HCl (pH 8.0), 7.5 μM each oligonu-
cleotide at 37 °C. (a) 50-TTTTTTTTTT-30 [T = EoNA-T (25, red),
20,40-BNACOC-T (26, blue), 30-Sp-phosphorothioate-T (27, green),
20,40-BNA/LNA-T (28, pink), and natural T (29, black)]. (b)
50-TTTTTTTTTT-30 [T = EoNA-T (30, red), 20,40-BNACOC-T
(31, blue), and natural T (29, black)].
Supporting Information Available. Full experimental
details, representative UV melting data, representative
1
HPLC data of nuclease experiments, H, 13C, and 31P
spectra of all new compounds, and HPLC charts and
MALDI-TOF-MS spectra of new oligonucleotides. This
material is available free of charge via the Internet at
http://pubs.acs.org.
In conclusion, we designed and synthesized a 20-O,40-C-
ethyleneoxy bridged 5-methyluridine. The synthetic pro-
cess for the desired phosphoramidite was short (12 steps
The authors declare no competing financial interest.
Org. Lett., Vol. 15, No. 14, 2013
3705