Design and synthesis of heterocyclic cations for specific DNA recognition: From AT-rich to mixed-base-pair DNA sequences

Article abstract of DOI:10.1021/jo402599s

The compounds synthesized in this research were designed with the goal of establishing a new paradigm for mixed-base-pair DNA sequence-specific recognition. The design scheme starts with a cell-permeable heterocyclic cation that binds to AT base pair sites in the DNA minor groove. Modifications were introduced in the original compound to include an H-bond accepting group to specifically recognize the G-NH that projects into the minor groove. Therefore, a series of heterocyclic cations substituted with an azabenzimidazole ring has been designed and synthesized for mixed-base-pair DNA recognition. The most successful compound, 12a, had an azabenzimidazole to recognize G and additional modifications for general minor groove interactions. It binds to the DNA site -AAAGTTT- more strongly than the -AAATTT- site without GC and indicates the design success. Structural modifications of 12a generally weakened binding. The interactions of the new compound with a variety of DNA sequences with and without GC base pairs were evaluated by thermal melting analysis, circular dichroism, fluorescence emission spectroscopy, surface plasmon resonance, and molecular modeling.

Full text of DOI:10.1021/jo402599s

Featured Article
pubs.acs.org/joc
Design and Synthesis of Heterocyclic Cations for Specific DNA
Recognition: From AT-Rich to Mixed-Base-Pair DNA Sequences
Yun Chai, Ananya Paul, Michael Rettig, W. David Wilson,* and David W. Boykin*
*Department of Chemistry, Georgia State University, Atlanta, Georgia 30303, United States
S
* Supporting Information
ABSTRACT: The compounds synthesized in this research were designed with the goal of establishing a new paradigm for
mixed-base-pair DNA sequence-specific recognition. The design scheme starts with a cell-permeable heterocyclic cation that
binds to AT base pair sites in the DNA minor groove. Modifications were introduced in the original compound to include an H-
bond accepting group to specifically recognize the G-NH that projects into the minor groove. Therefore, a series of heterocyclic
cations substituted with an azabenzimidazole ring has been designed and synthesized for mixed-base-pair DNA recognition. The
most successful compound, 12a, had an azabenzimidazole to recognize G and additional modifications for general minor groove
interactions. It binds to the DNA site −AAAGTTT− more strongly than the −AAATTT− site without GC and indicates the
design success. Structural modifications of 12a generally weakened binding. The interactions of the new compound with a variety
of DNA sequences with and without GC base pairs were evaluated by thermal melting analysis, circular dichroism, fluorescence
emission spectroscopy, surface plasmon resonance, and molecular modeling.
Given the excellent biological activities and uptake of these
compounds, we began to consider whether it might be possible
to design modifications of these compounds to give them DNA
sequence-specific recognition abilities.14,15,19,20 The key differ-
ence in DNA sequence that could make this possible is the third
H-bond in GC base pairs that is not present in AT base pairs.
Numerous crystal structures by the Neidle laboratory have
shown that the AT-specific compounds slide deeply into the
minor groove and have H-bond donating groups, such as
benzimidazole and amidine-NHs, that can form strong H-bonds
to the AN3 and TO at the edges of AT base pairs in the minor
groove.4,15,21−23 The extra H-bond in GC base pairs creates a
steric barrier at the floor of the groove that prevents formation of
similar complexes in an AT sequence that contains one or more
GC base pairs.4,15,22 In polyamides, GC recognition can be
designed into the structure by conversion of a pyrrole, with a
−CH at the floor of the groove, to an imidazole, with an −N− in
the same position, to accept an H-bond for the G-NH that
projects into the groove.5−10,24,25
INTRODUCTION
■
A serious barrier to the development of methods for rational
control of gene expression in cells is the lack of a variety of small
molecules that can bind strongly, for example, with nM KD
values, and sequence specifically to a range of DNA sequences.1
Such agents have enormous potential applications in biotechnol-
ogy and therapeutic development.2−10 With the explosion of
genomic information on both sequences and their functions from
bacteria to humans, the potential applications expand daily.11−13
A variety of agents are needed because of variations in cell
uptake potential of different molecule structures as well as
pharmacokinetic differences. Surprisingly, only DNA minor
groove binding polyamides, based on the natural products
netropsin and distamycin, have been developed for designed
recognition of a variety of DNA sequences.6−10 Although
polyamides are now entering animal studies, none have yet gone
into clinical trials.9,10
Our approach to overcome the barrier to external control of
gene expression by small molecules starts from an extensive
library of heterocyclic cations that have AT specific binding in the
DNA minor groove.2,4,14,15 A compound from this library has
entered clinical trials, and others are clinical candidates.4,16−18
Received: November 22, 2013
© XXXX American Chemical Society
A
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX

The Journal of Organic Chemistry
Featured Article
Figure 1. (A) Representative structures of compounds synthesized in this study and classified by the structural similarity. Syntheses for all new
compounds are shown in Schemes 1−5. (B) Full hairpin DNA sequences are shown with the abbreviations.
Scheme 1. Synthesis of Compound 9
In the research reported here, we start with a benzimidazole-
based AT-specific library compound, DB1476 (Figure 1), and
convert the benzimidazole to an azabenzimidazole to evaluate
enhancement in GC recognition.26−28 The initial compound, 21
(Figure 1) has significantly improved GC recognition capability
and forms the basis for the design and synthesis of a related set of
compounds for a structure-binding study. The compounds cover
a broad range of chemical properties and space. 12a (Figure 1),
the best compound of this set, has significant GC recognition
capability with strong binding.
analysis, the binding mode by circular dichroism, the binding
affinity and stoichiometry by surface plasmon resonance, and we
propose a model to explain the GC specificity by molecular
modeling. The results of this study are very encouraging and
show that rational design of exciting new minor groove binding
structures with enhanced sequence recognition capability is
possible.
RESULTS AND DISCUSSION
■
Chemistry. Scheme 1 outlines our approach to synthesis of
the hydrochloride salt of the azabenzimidazole diamidine 9. 2-
Amino-6-chloro-3-nitropyridine (1) was allowed to react with 4-
In this paper, we evaluate the relative affinities of the
synthesized members of this compound set by thermal melting
B
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX

The Journal of Organic Chemistry
Featured Article
Scheme 2. Synthesis of Compounds 12a−c
Scheme 3. Synthesis of Compounds 17a−c
Scheme 4. Synthesis of Compound 21
hydroxymethylbenzonitrile in the presence of sodium hydride in
dry dimethylformamide (DMF) to give compound 2. Sub-
sequently, the reduction of the nitro group of 2 was achieved with
iron dust in a 2-propanol/water mixture at reflux to produce the
diamine 3.29 4-Cyanophenol (4) was reacted with ethyl
bromoacetate to give the O-acetic acid ethyl ester 5, which was
converted to acid 6 by saponification and acidification.30 The
acid 6 was first converted to acid chloride with thionyl chloride in
dry toluene and followed by acylation with the diamine 3 to give
the dinitrile 7. Cyclization of the dinitrile 7 was subsequently
performed by boiling in glacial acetic acid to yield the
azabenzimidazole intermediate 8.28,31,32 Stirring the azabenzi-
midazole 8 in ethanolic HCl, according to the Pinner
methodology,33−35 afforded the bis-imidate ester hydrochloride
which was then converted to the hydrochloride salt of the
diamidine 9 by stirring with ethanol saturated with ammonia gas.
Scheme 2 illustrates the synthetic route for the three
compounds 12a−c. The commercially available substituted
benzaldehydes, 10a−c, were allowed to react with diamine 3 in
the presence of sodium bisulfite in anhydrous DMF at reflux to
afford the azabenzimidazole intermediates 11a−c.36 The bis-
nitrile intermediates, 11a−c, were converted to the hydro-
chloride salts of the diamidines 12a−c by applying the Pinner
approach as discussed above.
Compounds 17a−c were prepared as shown in Scheme 3. 2-
Amino-6-chloro-3-nitropyridine (1) was reduced to give 6-
chloropyridine-2,3-diamine (13) using tin(II) chloride dihydrate
and sodium borohydride in a ethyl acetate/2-propanol (9:1, v/v)
mixture.37 Acylation of the diamine 13 with commercially
available 4-cyanophenylpropionic acid, 4-cyanophenoxyacetic
acid, or 4-cyanophenylglycine in the presence of carbon-
yldiimidazole in dry THF gave the intermediates 14a−c.32 The
dinitriles 15a−c were prepared in good yield by employing a
Suzuki coupling reaction38 between p-cyanophenylboronic acid
and the chloro derivatives 14a−c using 5 mol % of Pd(PPh3)4/
Pd(dppf)Cl2 and 1,4-dioxane as the solvent. Cyclization of 15a−
c was achieved by boiling in glacial acetic acid to yield the
azabenzimidazole intermediates 16a−c, which were then
converted into the diamidines 17a−c by the Pinner proc-
ess.32,33,39
Scheme 4 employs chemistry related to that previously
described for the preparation of the diamidinoazabenzimidazole
21. 4-Cyanobenzoic acid was first converted to its acid chloride
which was allowed to react with the diamine 13 to give
C
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX

The Journal of Organic Chemistry
Featured Article
Scheme 5. Synthesis of Compounds 25a and 27a
compound 18. A Suzuki coupling reaction,38 similar to above,
between 18 and p-cyanophenylboronic acid gave the dinitrile 19.
Ring closure of the dinitrile 19 with glacial acetic acid afforded
the azabenzimidazole dinitrile 20. Again, Pinner methodology
was used to obtain the diamidine 21.
Scheme 5 illustrates the synthesis of compounds 25a and 27a,
which are N-methyl analogues of 17a and 12a, respectively. After
cyclization of compound 14a in acetic acid, the resulting
derivative 22 was methylated using methyl iodide in acetone in
the presence of potassium carbonate, which gave a mixture of
isomers 23a and 23b. The isomers were separated by column
chromatography on silica gel in 67% and 7% isolated yields,
respectively. A Suzuki coupling reaction, then the Pinner process
was applied to 23a to obtain the diamidine 25a. Compound 27a
was prepared using a similar sequence of reactions starting from
11a.
Thermal Melting (Tm): Ranking of Relative DNA Complex
Stabilities. Thermal melting experiments allow a rapid and
robust screening for the relative binding affinity and the sequence
selectivity of the ligands with the different DNA sequences
(Table 1).40,41 In general, the DNA melting transition is
characterized by a single cooperative absorbance change as a
function of temperature. Compound binding to the DNA is
expected to enhance the duplex stability when compared to
single strands, and an increase in the DNA melting temperature
upon drug addition is therefore associated with its relative
binding affinity.42 DNA AT sequences with zero, one, or two GC
base pairs (Figure 1) were used as targets for the designed
compounds, and the results are summarized in Table 1. The
melting profiles are shown in the Supporting Information
(Figure S1). The parent benzimidazole core diamidine, DB1476,
is a reference compound and binds strongly with pure AT-rich
sequences (AATT ΔTm = 11.3 °C and AAATTT ΔTm = 17.2 °C,
in Table 1), but it has a weak affinity toward the mixed DNA
sequences which are separated by a single or two GC base pairs
(AAGTT ΔTm = 4.8 °C, AAAGTTT ΔTm = 9.3 °C, and
AAAGCTTT ΔTm = 6.2 °C). Compound 21 with the
substitution of the benzimidazole core with an azabenzimidazole
showed decreased thermal stabilities with the pure AT rich
sequences (AATT ΔTm = 4.5 °C and AAATTT ΔTm = 8.1 °C)
and slightly increased thermal stabilities with mixed DNA
sequences AAGTT and AAAGTTT (ΔTm = 8.6 and 9.2 °C,
respectively).
The crucial breakthrough in developing strong and selective
GC base pair recognition was achieved with the linker −CH2O−
being inserted between the azabenzimidazole and phenyl of 21 to
yield 12a. In an effort to improve the G-recognition of 21, we
considered introduction of flexible linkers between the phenyl-
amidine and the azabenzimidazole. To maintain curvature to
match the minor groove a two atom linker is required and we
opted to use a −CH2O- linker, as opposed a −CH2CH2− one,
based on modeling studies (not shown). The studies suggest that
the presence of an −O− versus −CH2− allows greater flexibility
for groove-binding and possibly reduces steric hindrance to the
approach of N−H to the pyridine nitrogen. This hypothesis
needs to be tested by synthesis of the −CH2CH2− analogue of
12a which is a part of ongoing studies. Introducing the −CH2O−
linker resulted in a pronounced increase in the thermal stability
of the single GC containing AAGTT (ΔTm = 13.3 °C) and
AAAGTTT (ΔTm = 15.3 °C, Table 1) sequences. Compound
12a also showed sequence selectivity with relatively weak binding
to the pure AT sequences (AATT ΔTm = 6.1 °C and AAATTT
ΔTm = 12.4 °C). The ΔTm values of 12a with AAGTT and
ATGAT sequences are 13.3 and 4.8 °C, while AAAGTTT and
ATAGTAT sequences are 15.3 and 9.4 °C. This suggests more
favorable interactions within the narrow grooves of pure A-tract
DNAs relative to the wider groove in alternating AT sequence
DNAs.12,43,44 Introducing the −CH2O− linker clearly increases
D
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX

The Journal of Organic Chemistry
Featured Article
a
Table 1. Thermal Melting Studies (ΔTm, °C) of the Designed Heterocyclic Amidine Compounds with Mixed DNA Sequences
a
:ΔTm = Tm (the complex) − Tm (the free DNA). The listed values are for 2:1 [ligand]/[DNA] ratio and an average of two independent experiments with a
reproducibility of 0.5 °C.
the conformational mobility of 12a and also opens up the space
for the azabenzimidazole core for the G recognition.
Interestingly, 12a did not show any enhancement in thermal
stabilities for two GC containing sequences (Table 1).
Surprisingly, the structural isomer of 12a, 17a with the
−OCH2− linker attached at the 2-position of the azabenzimi-
dazole core, resulted in a large decrease of the thermal stability of
all the eight tested DNA sequences (ΔTm 1.1−3.9 °C). Similar
weaker thermal stability results relative to 12a were observed
when the −OCH2− linker was replaced with −CH2CH2− (17b)
or −NHCH2− (17c). Also for 9, with the −OCH2− linker
attached at the 2-position of the azabenzimidazole core for 12a,
only moderate DNA binding for a single GC base pair sequences
(AAAGTTT ΔTm = 6.2 °C) was observed. These results indicate
that the rigidity of the amidinium−phenyl−azabenzimidazole
system and the unfavorable twist of the linker−phenyl−
amidinium in part account for the weak binding. The
replacement of the 4-amidinium with 3-amidinium group
(12b) yields a tighter curvature and did not result in any
increase in ΔTm compared to 12a. The amidinium to −COOEt
change (12c), as expected, resulted in a major decrease in the
thermal stability of all the tested DNA sequences. This
E
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX

The Journal of Organic Chemistry
Featured Article
Figure 2. Circular dichroism spectra of representative compounds, 12a and 9, with the AAAGTTT and AAATTT DNA sequences. (A) The ratios of
12a to AAAGTTT from the bottom to the top are 0, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 2.0. (B) The ratios of 9 to AAAGTTT are 0, 0.2, 0.4, 0.6, 1.0, 1.4, 1.6, 1.8.
(C) The ratios of 12a to AAATTT are 0, 0.4, 0.6, 0.8, 1.0, 1.2, 1.6. (D) The ratios of 9 to AAATTT are 0, 0.2, 0.4, 0.6, 0.8, 1.0. Color arrows indicate
positive (green) and negative (red) induced changes. The experiments were conducted in Tris-HCl buffer at 25 °C.
Figure 3. Fluorescence emission spectra for 12a titrated with AAAGTTT (A) and 12a titrated with AAATTT: 2 μM solution of 12a in 10 mM Tris−
HCl, 100 mM NaCl, pH 7.4 buffer at 25 °C. Each addition of hairpin DNA resulted in an increase of DNA concentration of 0.4 μM. Arrows indicate
induced changes in fluorescence. Under these concentration conditions 12a is fully bound to the DNA at the highest concentrations shown in the
Figures.
demonstrates that a dication with specific curvature is needed for
optimizing minor groove binding. 25a and 27a, N-methyl
analogues of 17a and 12a, resulted in significant decreases in
ΔTm values due to steric effects and lack of H-bonding
interactions with the G-NH2 group. All the compounds of this
series showed very weak binding to two GC base pair containing
DNA sequences.
Circular Dichroism (CD): Probing the Binding Mode.
Circular dichroism spectroscopy is a valuable technique for
characterizing DNA minor groove interactions.45 CD titration
experiments as a function of compound concentration were
performed to monitor the induced CD, the binding mode and
the saturation limit for selected compounds (12a and 9) binding
with the AAAGTTT and AAATTT sequences (Figure 2).
F
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX

The Journal of Organic Chemistry
Featured Article
Figure 4. Representative SPR sensorgrams for 12a in the presence of (A) AAAGTT and (B) AAATTT hairpin DNAs. In (A) the solid black lines are
best fit values for global kinetic fitting of the results with a single site function. (C) Binding plots for AAATTT with 12a and the data was fitted to a
steady-state binding function using a 1:1 model to determine equilibrium binding constants.
Figure 5. Design concept of azabenzimidazole-containing heterocyclic diamidines for mixed sequence DNA recognition. Energy minimized structure
and the structural properties of (A) the imidazole motif used in synthetic polyamides that recognizes a G base in a GC base pair and (B) an
azabenzimidazole motif (Spartan 10 software). The angles and distances are shown as arc line and blue dashed line with numbers. (C) The alignment of
the imidazole motif (in green color) and azabenzimidazole motif (in pink color) units using Sybylx1.2 software. The images were drawn with the UCSF
Chimera Software.
Neither the hairpin DNA nor the free compound exhibits CD
signals in the compound absorption region above 300 nm.
Addition of minor groove binders to DNA results in substantial
positive induced CD signals on complex formation with DNA at
the wavelengths between 300 and 400 nm.
no ICDs are observed, in agreement with the Tm results.
Compound 17a and the other analogues show very weak binding
for both AAAGTTT and AAATTT DNAs (Supporting
Information, Figure S3).
Fluorescence Emission Spectroscopy. Fluorescence emission
spectroscopy changes on binding are very informative for the
lead compound 12a. Titrations of 12a with AAAGTTT and
AAATTT sequences are shown in Figure 3, and the compound
has very different induced spectral changes on complex
formation with these two DNA sequences. The fluorescence
intensity of 12a quenched on addition of the AAAGTTT
sequence and slightly increased upon binding to the AAATTT
sequence. The fluorescence quenching by a G base is a well
established phenomenum.46−48 The results suggest that 12a can
interact with both sequences and are in agreement with the Tm
and CD results. Under the conditions of the fluorescence
experiments, 12a is essentially fully bound to the DNAs at a 1:1
ratio.
Biosensor Surface Plasmon Resonance (SPR): Determining
Binding Affinity and Stoichiometry. Biosensor SPR methods
provide an excellent way to quantitatively evaluate the interaction
of small molecules with DNA and other biomolecules.49−51
Because the SPR approach responds to mass, it is an excellent
method for comparative studies of dications that have very large
differences in properties and equilibrium binding constants, K.
Because it responds to mass, the signal at saturation of binding
sites directly provides the stoichiometry. SPR sensorgrams were
collected (Figure 4A,B) and were subjected to steady-state
analyses.49−51 The sensorgrams were fitted to appropriate
Figure 2A,C show the CD spectra of 12a with the AAAGTTT
and AAATTT sequences, respectively. Upon addition of 12a to
the AAAGTTT sequence, the expected strong positive CD
signals in the compound absorption region (300 to 380 nm) are
indicative of a minor groove binding mode, with relatively small
and consistent changes in the DNA CD spectral region (Figure
2A). It seems likely that the shape of 12a does not exactly match
the free DNA minor groove shape. In this case, the compound
induces complementary changes in the DNA structure, and the
CD spectral region, which yield a very favorable final complex
with a high Tm value. In addition, 12a gives significant induced
CD signals with saturation near a 1:1 compound to DNA ratio,
which suggests 12a binds as a monomer in the minor groove of
the AAAGTTT sequence (Supporting Information, Figure S2).
On the other hand, 12a shows a very weak ICD for the AAATTT
sequence, indicating it has much stronger sequence specificity
toward the mixed DNA sequence than pure AT rich sites as
observed in Tm experiments.
Compound 9 shows moderate ICD enhancement with the
AAAGTTT sequence (Figure 2B). Small and consistent changes
in the CD spectral region of DNA (230 to 290 nm) are observed
with incremental titration of ligands indicating only minor
conformational changes in DNA on complex formation.
However, in the presence of a pure AT sequence (Figure 2D)
G
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX

The Journal of Organic Chemistry
Featured Article
Figure 6. (A) Equilibrium geometry of three possible tautomeric forms of 12a calculated by density functional theory (DFT/B3LYP) with the 6-31G*
polarization basis set. (B) The table on the right displays the calculated total energies E (atomic unit) and relative ΔE (kcal/mol) energies of 12a
tautomers.
Figure 7. Molecular models for 12a docked into the d(CCAAAGTTTG)2 sequence. The images are of only the lowest-energy conformation and have
been drawn with the UCSF Chimera Software. View from (A) minor and (B) major groove, the solvent accessible surface is shown as light gray with 70%
transparency to heighten clarity, the GC base pair is in green with 12a in magenta. Note close contact of the surfaces of 12a with the DNA minor groove
wall surfaces. (C) Detailed views from the minor groove of the hydrogen-bond interactions between one amidinium group of 12a and the O2 atom of
thymine 8 (black dashed line). (D) Detailed views from major groove of the hydrogen-bond interactions between the inner-facing azabenzimidazole
−N− and −NH atoms with G NH2 and G N3 groups of 12a (black dashed line).
binding models to determine K values (Experimental Section).
On the basis of Tm and CD studies, compound 12a was selected
for SPR binding studies.
shown in Figure 5A and 5B, and the alignment of their structural
skeletons is shown in Figure 5C to clarify the similarity of these
two units. The inner faces of these two molecules, which face the
floor of the minor groove, have very similar character and can
form hydrogen bond interactions with GC base pairs. These
comparisons illustrate the ability of 12a to recognize a G base in a
similar manner to imidazole.52,26
Since a 2,5-substituted azabenzimidazole ring has three
possible tautomeric forms, 12a was taken as an example for
tautomer energy analysis (Figure 6). Geometry-optimized
models for 12a tautomers are shown in Figure 6A, and the
calculated single-point energy predictions are compared in
Figure 6B. The results show that 12a-1 has the lowest energy
value among the three tautomers. The methylation results of 11a
(in Scheme 5) are consistent with the theoretical calculation
results. We thus used the tautomer where the hydrogen is on the
3-positon of the benzimidazole ring for the following docking
studies.
As can been seen in Figure 4A, compound 12a binds strongly
with the single GC base-pair sequence, AAAGTTT (KD = 0.3 ×
10−9 M), as a monomer. The strong binding observed with this
compound can be attributed to the rapid association and the slow
dissociation rates (Figure 4A). However, the binding affinity of
12a with pure AAATTT is significantly lower, KD = 24 × 10−9 M,
which is 80 fold weaker than the single GC binding (Figure
4B,C). These results also indicate that the compound 12a has
strong sequence selectivity toward single GC mixed sequences.
This supports results from Tm and CD studies.
Molecular Modeling Studies: Visualization of 12a−
AAAGTTT Complex. To better understand the binding of 12a
with the AAAGTTT sequence, it is informative to compare
structural similarities between the azabenzimidazole core of 12a
and the imidazole group of polyamides.52,53 Density functional
theory (DFT) calculations for optimizing geometry for the
azabenzimidazole core and the imidazole-containing amides are
To provide ideas for a better understanding of the observed
strong binding affinity of 12a, it was docked as a monomer into
H
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX

The Journal of Organic Chemistry
Featured Article
[5′-GCCAATTGCCTCTGC AATTGGC-3′], AAAGTTT [5′-
CCAAAGTTTGCTCTCAAACTTTGG-3′], ATAGTAT [5′-CCA-
TAGTATGCTCTCATACTATGG-3′], AAATTT [5′-
CCAAATTTGCCTCTGCAAATTT GG-3′], AAAGCTTT [5′-
CCAAAGCTTTGCTCTCAAAGCTTTGG-3′] and ATAGCTAT
[5′-CCATAGCTATGCTCTCATAGCTATGG-3′] with the hairpin
loop sequences underlined (Figure 1). Lyophilized DNA oligomers
were purchased from Integrated DNA Technologies, Inc., via HPLC
purification. Doubly distilled water was added to the solid DNAs to
bring the concentration to approximately 1.0 mM, based on the reported
amount of DNA from IDT. The molar concentrations of these hairpin
DNAs were then determined using a UV−vis spectrophotometer at 260
nm based on the molar extinction coefficients (ε260) calculated by the
nearest neighbor method.
Thermal Melting (Tm). Thermal melting experiments were
performed on a UV−vis spectrophotometer. The concentration of
each hairpin DNA sequence was 3 μM, and experiments were in buffer
(50 mM Tris−HCl, 100 mM NaCl, 1 mM EDTA, pH 7.4) in 1 cm
quartz cuvettes at various ligand−DNA ratios [0:0 (buffer blank), 0:1
(DNA only, as a control), 1:1 and 2:1]. The DNA solutions were
annealed prior to being tested. The spectrophotometer was set at 260
nm, 0.5 °C/min increase beginning at 25 °C, well below the DNA
melting temperature and ending well above it or at 95.00 °C. The
absorbance of the buffer was subtracted, and a graph of normalized
absorbance vs. temperature was created using Kaleidagraph software.
The ΔTm values were calculated using a combination of the derivative
function and estimation from the normalized graphs.
the central −AAAGTTT− site of the minor groove of the 5′-
d(CCAAAGTTTG)-3′ duplex (Figure 7A,B). As can be seen,
this model predicts that 12a closely matches the minor groove
shape, and the azabenzimidazole module is oriented parallel to
the groove walls in the model in Figure 7. This orientation
provides excellent groove recognition units for both GC
(azabenzimidazole) and AT (phenyl-amidine) base pairs. The
model also predicts that the amidinium group, attached to the
phenyl-CH2O- group, is involved in hydrogen bonding to the O2
atom of thymine 8 (2.4 Å, Figure 7C), while the inner-facing
azabenzimidazole −N− and −NH atoms are involved in
hydrogen bonding to the G NH2 and G N3 groups (2.7 and
2.8 Å, respectively, Figure 7D). The other amidinium group does
not directly participate in hydrogen bonding with the DNA but is
close to the mouth of the minor groove and in close proximity to
DNA phosphates for favorable electrostatic interaction, but
further optimization of the compound for minor groove H-
bonding should be possible.
CONCLUSIONS
■
Design of compounds for recognition of the mixed DNA
sequences has been successfully achieved with minor groove
binding polyamides. While much has been learned from the
studies of a variety of polyamides, effective, specific therapeutic
targeting of DNA would greatly benefit from the availability of
additional sequence-specific molecules. The primary goal of this
project takes advantage of the widely known AT preferences of
many minor groove binders by incorporating an azabenzimida-
zole ring in such a way as to create a motif for GC base-pair
recognition. The data presented in this report indicate that this
series of heterocyclic cations have different DNA binding
properties, which are highly dependent on the structure of
compounds and also on the DNA sequences.
Circular Dichroism Spectroscopy (CD). Circular dichroism
experiments were performed on a CD spectrometer in 1 cm quartz
cell at 25 °C. The hairpin DNA (5 μM) sequence in buffer (50 mM
Tris−HCl, 100 mM NaCl, 1 mM EDTA, pH 7.4) was added to the cell
prior to the experiment and then the compound was added to the
hairpin DNA solution and incubated for 10 min to achieve the
equilibrium binding for the DNA complex. For each titration point four
spectra were averaged from 500 to 220 nm with scan speed 50 nm/min,
and a response time of 1 s. Buffer subtracted graphs were created using
the Kaleidagraph software.
Starting with a classical type, AT-specific minor groove binding
compound, DB1476, the structure was significantly modified to
introduce GC recognition. The design, synthesis, and DNA
interaction studies were successful in producing 12a. Compound
12a is the first designed, nonpolyamide compound that is capable
of selective recognition of sequences with a single GC base pair in
an AT sequence context. It is an important breakthrough in the
rational design of DNA sequence-specific binding compounds.
Molecular modeling has clearly demonstrated the effective
interactions of 12a with a G base. Removal of the GC base pair or
addition of another GC significantly weakens DNA binding of
12a relative to the single G sequence. Isomers and modifications
of 12a also reduced specific GC base pair recognition.
The results presented here clearly show that rational design of
nonpolyamide compounds for binding to mixed DNA sequences
is possible and can potentially produce agents for selective
inhibition of DNA−protein complexes such as transcription
factor (TF) complexes. TFs have been classified as “undrug-
gable” biopolymers for direct inhibition and the approach
represented here suggests a different inhibition route. The
success of 12a with mixed DNA sequence recognition capability
offers important insights and exciting new information that can
be integrated into future compound design efforts and finally in
expanding the DNA targeting field.
Fluorescence Emission Spectroscopy. Fluorescence spectra
were recorded on a Bio Spectrofluorimeter, with excitation and emission
slit width fixed at 5 nm. The free compound solution at concentration of
2 μM was prepared in buffer (10 mM Tris−HCl, 100 mM NaCl, pH
7.4), and DNA aliquots were added from a concentrated stock. The
spectra were collected after allowing an equilibration time of 10 min. 12a
was excited at 330 nm, based on results from UV−vis spectroscopy.
Emission spectra were monitored from 430 to 450 nm. All the
fluorescence titrations were performed at 25 °C.
Biosensor Surface Plasmon Resonance (SPR). SPR measure-
ments were performed with four-channel Biacore T200 and T100
optical biosensor systems. 5′-Biotin-labled DNA sequences
(AAAGTTT and AAATTT hairpins, in Figure 1) were immobilized
onto streptavidin-coated sensor chips as previously described.49,50 The
SPR experiments were performed at 25 °C in degassed and filtered
Tris−HCl buffer (50 mM Tris−HCl, 100 mM NaCl, 1 mM EDTA, pH
7.4). Steady-state binding analysis was performed with multiple
injections of different compound concentrations over the immobilized
DNA surface at a flow rate of 100 μL/min. Solutions of known 12a
concentrations were injected through the flow cells until a constant
steady-state response was obtained. Compound solution flow was then
replaced by buffer flow resulting in dissociation of the complex. After
each cycle, the sensor chip surface was regenerated with a 10 mM glycine
solution at pH 2.5 for 30 s followed by multiple buffer injections to yield
a stable baseline for the following cycles. The reference response from
the blank cell was subtracted from the response in each cell containing
DNA to give a signal (RU, response units) that is directly proportional
to the amount of bound compound. The predicted maximum response
per bound compound in the steady-state region (RUmax) was
determined from the DNA molecular weight, the amount of DNA on
the flow cell, the compound molecular weight, and the refractive index
gradient ratio of the compound and DNA, as previously described.51 RU
was plotted as a function of free ligand concentration (Cfree), and the
EXPERIMENTAL SECTION
■
DNA Oligonucleotides. For the thermal melting, circular
dichroism, and fluorescence emission spectroscopy experiments, hairpin
DNA oligomers used were AAGTT [5′-CCAAGTTGCTCTCAACTT
GG-3′], ATGAT [5′-CCATGATGCTCTCATCATGG-3′], AATT
I
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX

The Journal of Organic Chemistry
Featured Article
Figure 8. NOESY spectra (400 MHz, DMSO-d6) of (A) the pure major isomer 23a showing the lack of correlation between H7 and the methyl protons
(blue dashed circle), (B) the pure minor isomer 23b showing correlation between H7 and the methyl protons (blue solid circle), and (C) the minor
isomer 26b showing correlation between H7 and the methyl protons (blue solid circle), between H6 and the methylene protons (green solid circle).
equilibrium binding constants were determined with a one-site binding
were permitted torsional flexibility in the docking process. Atomic
model (K2 = 0).
charges were computed using Kollman all-atom for DNA and
Gasteiger−Huckel for the ligands. All of the possible hydrogen-bond
̈
2
r = (K1Cfree + 2K1K2Cfree2)/(1 + K1Cfree + K1K2Cfree
)
sites were selected for the DNA−ligand complex. From each docking,
the 20 lowest energy structures were selected.
(1)
Where r represents the moles of bound compound per mole of DNA
hairpin duplex, K1 and K2 are macroscopic binding constants and Cfree is
the free compound concentration in equilibrium with the complex.
RUmax in the equation was used as a fitting parameter, and the obtained
value was compared to the predicted maximal response per bound ligand
to independently evaluate the stoichiometry. Kinetic analysis was
performed by globally fitting the binding results for the entire
concentration series using a standard 1:1 kinetic model with integrated
mass transport-limited binding parameters as described previ-
ously.19,49−51
Structural Model Calculation Methods. Molecular modeling
studies were initiated with conformational analysis of the tested
compounds with a molecular mechanics MMFF approximation level
with the Spartan 10 software package. The software package was
employed to optimize the final geometry by using ab initio calculations
with density functional theory (DFT), B3LYP at the 631G*
approximation level. The molecular energy was calculated by employing
the Hartree−Fock approximation also at the 631G* level. The
alignment of compounds was done using the “Align Database” option
of the QSAR module in SYBYL-X1.2 software package on a windows
workstation.54
Methylation Position of Azabenzimidazole Ring. The isomers
(23a, 23b) were successfully isolated from the mixture by column
chromatography on silica gel. In addition to mass spectrometry and
1H/13C NMR, two-dimensional nuclear overhauser effect spectroscopy
(NOESY) NMR studies were performed. After the signals were fully
assigned by a thorough interpretation of all other spectra, the NOESY
spectra allowed for a detailed characterization of the isomer structures.
The two NOESY spectra of the isomers are presented in Figure 8A,B.
The relative intensity of the NOE crosspeaks between CH2 and H2′,
CH3 and CH2, CH3 and H2′, H2′ and H3′ along with H6 and H7 were
observed in both NOE studies for the two isomers. The most important
diagnostic signal, of particular interest, was the correlation of CH3 and
H7 which is on the pyridine ring. There is a correlation that can be seen
between H7 and CH3 of the minor isomer (blue solid circle in Figure
8B), which leads to the conclusion that the minor isomer has the
stereochemistry indicated as 23b; While no correlation is seen between
H7 and CH3 (blue dashed circle in Figure 8A) in the major isomer, it is
characterized as 23a (Scheme 5).
Based on the results obtained for the isomer 23b, it was found that the
isomer 26b has the same relative configuration, in which the methyl
group is substituted on the N-1 position. The NOESY NMR spectrum
obtained for the isomer 26b is presented in Figure 8C. Thus, we know
the methylation reaction mainly happens in the N-3 position of the
azabenzimidazole ring when using methyl iodide in acetone in the
presence of potassium carbonate.
Chemistry. Procedures for the preparation of all final products are
presented below along with representative procedures for all methods
used in the preparation of intermediates. All solvents and reagents were
used without purification as acquired from commercial sources. Melting
points were measured using a capillary melting point apparatus which
was uncorrected. The progress of the chemical reaction was monitored
by thin-layer chromatography on silica gel 60-F254 aluminum plates and
detected under UV light. All NMR spectra were recorded employing a
400 MHz spectrometer, and chemical shifts (δ) are in ppm relative to
TMS as internal standard. Phase-sensitive 2D NOE experiments were
collected with 2048 × 128 data points in the two dimensions and 8 scans
per t1 increment. A mixing time of 800 ms and recycle delay of 2 s were
used. Spectral width was 3.4 kHz. Electrospray ionization (ESI) Q-Tof
and Orbitrap were used for the high-resolution mass spectra
Molecular docking and visualization studies were performed with the
SYBYL-X1.2 software. The initial DNA duplex 5′-d(CCAAAGTTTG)-
3′ was constructed in the Biopolymer-Build DNA Double Helix module
employing regular B-DNA parameters. The DNA was next energy
minimized for a maximum of 100 iterations using the conjugate gradient
algorithm and Tripos force field, with a termination gradient of 0.1 kcal/
(mol Å). The three-dimensional structure of 12a was built, assigned
Gasteiger−Huckel charges, and minimized using the Tripos force field
̈
until a terminating conjugate gradient of 0.01 kcal/mol Å or the
maximum 1000 iterations was reached.54,19
During the docking process, 12a and the DNA were in separate
molecular areas within the SYBYL graphical user interface. Compound
12a was manually inserted into the DNA minor groove, and the
Flexidock module was then employed. Ten different random numbers
were designed and employed by the genetic algorithm, one at a time, for
a total of 10 docking trials. A total of 456000 generations were calculated
and assigned for docking 12a into the DNA minor groove.54−56 The
large amount of generations ensured that the lowest energy
conformations were obtained. Both the ligand and the bound DNA
J
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX

The Journal of Organic Chemistry
Featured Article
measurements. Elemental analyses are within 0.4 of the theoretical
values. The compounds reported as salts frequently analyzed for
fractional moles of water and/or ethanol and/or ether of solvation. In
each case proton NMR showed the presence of indicated solvent(s).
4-[[(6-Amino-5-nitropyridin-2-yl)oxy]methyl]benzonitrile (2). To a
solution of 4-hydroxymethylbenzonitrile (5.00 g, 37.5 mmol) and 2-
amino-6-chloro-3-nitropyridine (1) (7.10 g, 41.0 mmol) in dimethyl-
formamide (30 mL) was slowly added to sodium hydride (3.00 g, 75.0
mmol, as a 60 wt % dispersion in mineral oil). The resulting mixture was
stirred at room temperature for 3 h and then poured into ice−water. The
resulting precipitate was collected, washed with water, and dried to
provide a yellow solid 2 (9.3 g, 92%). Mp: 182−185 °C. 1H NMR (400
MHz, DMSO-d6): δ 8.29 (d, 1 H, J = 8.8 Hz), 8.18 (br s, 2 H), 7.86 (d, 2
H, J = 8.0 Hz), 7.67 (d, 2 H, J = 8.0 Hz), 6.23 (d, 1 H, J = 8.8 Hz), 5.48 (s,
2 H). 13C NMR (DMSO-d6, 75 MHz) δC 165.4, 154.1, 141.9, 138.2,
132.4, 128.9, 121.3, 118.7, 110.7, 101.0, 66.8. HR-ESI-MS: calcd for
C13H11N4O3, m/z 271.0831 (M + H)+, found m/z 271.0842.
4-[[(5,6-Diaminopyridin-2-yl)oxy]methyl]benzonitrile (3). A mix-
ture of iron dust (3.72 g, 66.6 mmol), ammonium chloride (5.34 g, 99.9
mmol), and 2 (6.00 g, 22.2 mmol) in 96 mL of 2-propanol−water (5:3,
v/v) was heated at reflux for 4 h. The reaction mixture was filtered, and
the dark filtrate was freed from solvent by distillation under reduced
pressure. The resulting residue was diluted with water and extracted with
ethyl acetate (100 mL × 3). The combined organic phases were washed
with brine, dried over anhydrous sodium sulfate, filtered, and
concentrated under reduced pressure. The dark solid was crystallized
with methanol to give 3 (3.6 g, 68%). Mp: 146−149 °C. 1H NMR (400
MHz, DMSO-d6): δ 7.81 (d, 2 H, J = 6.8 Hz), 7.58 (s, 2 H), 6.75 (d, 1 H,
J = 6.8 Hz), 5.87 (d, 1 H, J = 6.8 Hz), 5.36 (s, 2 H), 5.24 (s, 2 H), 4.15 (s,
2 H). 13C NMR (DMSO-d6, 75 MHz): δC 153.7, 146.4, 144.4, 132.2,
128.0, 124.0, 123.2, 118.9, 109.9, 96.0, 65.3. HR-ESI-MS: calcd for
C13H13N4O, m/z 241.1089 (M + H)+, found m/z 241.1082.
MHz): δC 166.4, 161.4, 159.7, 153.2, 143.6, 137.9, 134.1, 132.2, 128.2,
119.0, 118.8, 115.8, 110.2, 109.7, 103.3, 96.3, 66.9, 65.4; HR-ESI-MS:
calcd for C22H18N5O3 m/z 400.1410 (M + H)+, found m/z 400.1412.
4-[[5-(4-Cyanobenzyloxy)-3H-imidazo[4,5-b]pyridin-2-yl]-
methoxy]benzonitrile (8). A solution of 7 (0.32 g, 0.80 mmol) in glacial
acetic acid (15 mL) was heated at reflux for 12 h. The solution was
concentrated to dryness under reduced pressure. The residue was
vigorously stirred in 1 M ammonia solution (30 mL) for 1 h. The
resulting precipitate was collected, washed with water, and purified by
column chromatography (silica gel, using a gradient elution method
with a mixture of dichloromethane and methanol) to afford the title
compound as a light yellow solid 8 (0.26 g, 85%). Mp: 212−213 °C. 1H
NMR (400 MHz, DMSO-d6 + D2O): δ 7.91 (d, 1 H, J = 8.4 Hz), 7.82 (d,
2 H, J = 8.0 Hz), 7.77 (d, 2 H, J = 8.4 Hz), 7.63 (d, 2 H, J = 8.0 Hz), 7.23
(d, 2 H, J = 8.4 Hz), 6.77 (d, 1 H, J = 8.4 Hz), 5.47 (s, 2 H), 5.35 (s, 2 H).
13C NMR (DMSO-d6, 75 MHz): δC 161.4, 159.5, 149.4, 143.6, 134.4,
132.4, 128.2, 119.1, 118.9, 116.1, 110.3, 106.0, 103.6, 66.1, 64.3. HR-
ESI-MS: calcd for C22H16N5O2 m/z 382.1304 (M + H)+, found m/z
382.1305.
General Procedure for the Pinner Method of Synthesis of
Diamidine Hydrochlorides (9, 12a−c, 17a−c, 21, 25a, and 27a).
The dinitrile compounds (0.85 mmol) were suspended in saturated
ethanolic HCl (30 mL) and stirred at room temperature for 3 days,
isolated from air and moisture. Dry ether was added, and the solid was
filtered, dried under vacuum for 5 h, and dissolved in absolute ethanol
(25 mL), ammonia gas was passed for 15 min while cooling in an ice
bath, and the resulting solution was stirred for 3 days at room
temperature. Dry ether was added, and the precipitated solid was
filtered. The crude diamidine salt was purified by neutralization with 1 M
sodium hydroxide followed by filtration of the resultant solid, washed
with water, and dried. Finally, the free base was stirred with anhydrous
ethanolic HCl for 3 days and diluted with ether, and the solid formed
was filtered and dried and crystallized from a methanol/acetone mixture
to give the diamidine HCl salt.
Trihydrochloride Salt of 4-[[5-(4-carbamimidoylbenzyloxy)-3H-
imidazo[4,5-b]pyridine-2-yl]methoxy]benzimidamide (9). White
solid (0.35 g, 71%). Mp >270 °C. 1H NMR (400 MHz, DMSO-d6): δ
9.37 (s, 2 H), 9.23 (s, 2 H), 9.10 (s, 2 H), 8.95 (s, 2 H), 7.99 (d, 1 H, J =
8.8 Hz), 7.86−7.82 (m, 4 H), 7.68 (d, 2 H, J = 8.0 Hz), 7.30 (d, 2 H, J =
8.8 Hz), 6.85 (d, 1 H, J = 8.8 Hz), 5.51 (s, 2 H), 5.45 (s, 2 H). 13C NMR
(DMSO-d6, 75 MHz): δC 165.6, 164.9, 162.0, 160.9, 148.8, 146.2, 143.8,
130.6, 128.6, 128.2, 127.4, 123.3, 120.9, 120.8, 115.6, 108.6, 66.9, 63.0.
HR-ESI-MS: calcd for C22H22N7O2 m/z 416.1835 (M + H)+, found m/z
416.1844. Anal. Calcd for C22H21N7O2·3HCl·2.80H2O: C, 45.93; H,
5.19; N, 17.04. Found: C, 46.26; H, 5.01; N, 16.68.
4-[5-[(4-Cyanobenzyl)oxy]-3H-imidazo[4,5-b]pyridin-2-yl]-
benzonitrile (11a). Sodium bisulfite (0.16 g, 1.5 mmol) was added to a
stirred mixture of 3 (0.24 g, 1.0 mmol) and 4-cyanobenzaldehyde (0.13
g, 1.0 mmol) in dry dimethylformamide. The vigorously stirred mixture
was heated at 140 °C for 12 h under a nitrogen atmosphere. The residue
was poured into water and the precipitated solid was filtered and
crystallized from methanol to give the title compound 11a as a yellow
solid (0.26 g, 75%). Mp: >285 °C 1H NMR (400 MHz, DMSO-d6): δ
13.73 (s, 0.7 H), 13.40 (s, 0.3 H), 8.30 (d, 2 H, J = 8.4 Hz), 8.01−8.12
(m, 3 H), 7.86 (d, 2 H, J = 8.0 Hz), 7.66 (d, 2 H, J = 8.0 Hz), 6.87 (d, 1 H,
J = 8.4 Hz), 5.53 (s, 2 H). 13C NMR (DMSO-d6, 75 MHz) δC 160.3,
150.0, 143.9, 135.0, 133.3, 132.8, 128.5, 127.2, 119.3, 119.2, 112.0, 110.6,
107.1, 66.6. HR-ESI-MS: calcd for C21H14N5O, m/z 352.1198 (M +
H)+, found m/z 352.1203.
3-[5-[(4-Cyanobenzyl)oxy]-3H-imidazo[4,5-b]pyridin-2-yl]-
benzonitrile (11b). This compound was prepared using the same
procedure as for the preparation of 11a. Yellow solid (yield, 83%). Mp:
246−247 °C. 1H NMR (400 MHz, DMSO-d6): δ 13.64 (s, 0.6 H), 13.32
(s, 0.4 H), 8.52 (s, 1 H), 8.45 (d, 1 H, J = 8.4 Hz), 7.96−8.09 (m, 2 H),
7.86 (d, 2 H, J = 8.0 Hz), 7.75−7.77 (m, 1 H), 7.66 (d, 2 H, J = 8.0 Hz),
6.86 (d, 1 H, J = 8.4 Hz), 5.53 (s, 2 H). 13C NMR (DMSO-d6, 75 MHz)
δC 160.4, 154.5, 143.8, 133.7, 132.8, 131.3, 131.1, 130.9, 129.9, 128.6,
119.3, 118.9, 112.6, 110.6, 107.4, 66.6. HR-ESI-MS: calcd for
C21H14N5O m/z 352.1198 (M + H)+, found m/z 352.1188.
Ethyl 2-(4-Cyanophenoxy)acetate (5). To a stirred solution of 4-
cyanophenol 4 (11.9 g, 0.10 mol) in acetone were added potassium
carbonate (24.9 g, 0.18 mol) and ethyl bromoacetate (13.7 mL, 0.14
mmol) at room temperature. The mixture was stirred at room
temperature for 12 h. The mixture was filtered, the filtrate was
evaporated, and the resulting residue was dissolved in water (50 mL).
The aqueous layer was extracted with ethyl acetate (100 mL × 3). The
combined organic phases were washed with brine, dried over anhydrous
sodium sulfate, filtered, and concentrated under reduced pressure.
Crystallization from the hexanes/ethyl acetate (10:1, v/v) mixture gave
1
a white solid 5 (16.0 g, 78%). Mp: 54−55 °C. H NMR (400 MHz,
CDCl3): δ 7.61 (d, 2 H, J = 8.4 Hz), 6.96 (d, 2 H, J = 8.4 Hz), 4.68 (s, 2
H), 4.28 (q, 2 H, J = 7.6 Hz), 1.30 (t, 3 H, J = 7.6 Hz).
(4-Cyanophenoxy)acetic Acid (6). A solution of 2 M sodium
hydroxide (10 mL, 20 mmol) was added dropwise to a solution of ethyl
2-(4-cyanophenoxy)acetate 5 (2.05 g, 10 mmol) in methanol (40 mL) at
room temperature. After 1 h, the solution was concentrated and the
obtained residue was dissolved in water and then acidified with 1 N HCl.
The precipitate was collected and washed with water and afforded a
white solid 6 (1.42 g, 80%). Mp: 178−179 °C (Iit.30 175−178 °C). 1H
NMR (400 MHz, DMSO-d6): δ 13.15 (s, 1H), 7.76 (s, 2 H), 7.09 (s, 2
H), 4.81 (s, 2H).
N-[2-Amino-6-[(4-cyanobenzyl)oxy]pyridin-3-yl]-2-(4-
cyanophenoxy)acetamide (7). A solution of 6 (4.09 g, 23.1 mmol),
thionyl chloride (3.4 mL, 46.2 mmol), and DMF (0.1 mL) in toluene
(50 mL) was heated at reflux for 6 h. The solution was concentrated to
dryness under reduced pressure. Then dichloromethane (15 mL × 2)
was added, and the solvent was distilled in vacuum to yield 4.27 g of the
acid chloride, which was used in the next step without further
purification. The acid chloride was slowly added to the solution of 3
(4.80 g, 20.0 mmol) and triethylamine (3.3 mL, 23.7 mmol) in
dichloromethane (100 mL), and the mixture was stirred at room
temperature overnight. The resulting precipitate was collected, washed
with dichloromethane and water, and dried to provide a light yellow
solid 7 (5.83 g, 73%). Mp: 227−229 °C. 1H NMR (400 MHz, DMSO-
d6): δ 9.26 (s, 1 H), 7.84−7.79 (m, 4 H), 7.60 (d, 2 H, J = 7.4 Hz), 7.30
(d, 1 H, J = 7.6 Hz), 7.17 (d, 2 H, J = 7.4 Hz), 6.03 (d, 1 H, J = 7.6 Hz),
5.85 (s, 2 H), 5.35 (s, 2 H), 4.79 (s, 2 H). 13C NMR (DMSO-d6, 75
K
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX

The Journal of Organic Chemistry
Featured Article
Ethyl 3-[5-[(4-Cyanobenzyl)oxy]-3H-imidazo[4,5-b]pyridin-2-yl]-
benzoate (11c). This compound was prepared using the same
procedure as for the preparation of 11a. Yellow solid (yield, 85%).
Mp: 234−235 °C 1H NMR (400 MHz, DMSO-d6): δ 8.28 (d, 2 H, J =
8.4 Hz), 8.08 (d, 2 H, J = 8.4 Hz), 8.02 (d, 1 H, J = 8.4 Hz), 7.86 (d, 2 H, J
= 8.0 Hz), 7.66 (d, 2 H, J = 8.0 Hz), 6.86 (d, 1 H, J = 8.4 Hz), 5.52 (s, 2
H), 3.88 (s, 3 H). 13C NMR (DMSO-d6, 75 MHz) δC 165.8, 160.0,
149.3, 143.3, 133.9, 132.4, 130.4, 129.8, 128.1, 126.4, 118.8, 110.3, 106.8,
66.2, 52.3. HR-ESI-MS: calcd for C22H17N4O3, m/z 385.1301 (M + H)+,
found m/z 385.1292
Dihydrochloride Salt of 4-[5-[(4-Carbamimidoylbenzyl)oxy]-3H-
imidazo[4,5-b]pyridin-2-yl]benzimidamide (12a). This compound
was prepared using the same procedure as for the preparation of 9.
Yellow solid (0.28 g, 67%). Mp: >290 °C. 1H NMR (400 MHz, DMSO-
d6 + D2O): δ 8.30 (d, 2 H, J = 8.0 Hz), 7.96 (d, 1 H, J = 8.8 Hz), 7.89 (d, 2
H, J = 8.4 Hz), 7.78 (d, 2 H, J = 8.0 Hz), 7.66 (d, 2 H, J = 8.4 Hz), 6.78 (d,
1 H, J = 8.8 Hz), 5.52 (s, 2 H). 13C NMR (DMSO-d6 + D2O, 75 MHz)
δC 165.7, 165.4, 160.5, 149.7, 144.3, 134.9, 129.3, 129.1, 128.6, 128.2,
127.5, 126.9, 107.5, 66.6; HR-ESI-MS: calcd for C21H20N7O m/z
386.1729 (M + H)+, found m/z 386.1736. Anal. Calcd for C21H19N7O·
2HCl·1.97H2O: C, 51.08; H, 5.09; N, 19.85. Found: C, 51.46; H, 4.94;
N, 19.47.
and water (50 mL) were subsequently added, and the precipitate was
collected to afford the title compound 14a as a white solid (1.28 g, 70%).
Mp: 215−217 °C. 1H NMR (400 MHz, DMSO-d6): δ 9.43 (s, 1 H), 7.79
(d, 2 H, J = 8.8 Hz), 7.48 (d, 1 H, J = 8.0 Hz), 7.17 (d, 2 H, J = 8.8 Hz),
6.57 (d, 1 H, J = 8.0 Hz), 6.34 (s, 2 H), 4.83 (s, 2 H). 13C NMR (DMSO-
d6, 75 MHz) δC 166.5, 161.3, 154.3, 144.4, 135.6, 134.1, 119.0, 116.2,
115.8, 110.4, 103.3, 66.8. HR-ESI-MS: calcd for C14H12ClN4O2 m/z
303.0649 (M + H)+, found m/z 303.0647.
N-(2-Amino-6-chloropyridin-3-yl)-3-(4-cyanophenyl)-
propanamide (14b). This compound was prepared using the same
procedure as for the preparation of 14a. White solid (yield, 83%). Mp:
229−230 °C. 1H NMR (400 MHz, DMSO-d6): δ 9.11 (s, 1 H), 7.76 (d,
2 H, J = 8.0 Hz), 7.56 (d, 1 H, J = 8.0 Hz), 7.46 (d, 2 H, J = 8.0 Hz), 6.55
(d, 1 H, J = 8.0 Hz), 6.21 (s, 2 H), 2.98 (t, 2 H, J = 7.4 Hz), 2.67 (t, 2 H, J
= 7.4 Hz). 13C NMR (DMSO-d6, 75 MHz) δC 170.6, 153.5, 147.3, 143.6,
134.5, 132.2, 129.4, 119.0, 117.2, 110.5, 108.9, 36.5, 30.7. HR-ESI-MS:
calcd for C15H14ClN4O m/z 301.0856 (M + H)+, found m/z 301.0858.
N-(2-Amino-6-chloropyridin-3-yl)-2-[(4-cyanophenyl)amino]-
acetamide (14c). This compound was prepared using the same
procedure as for the preparation of 14a. White solid (yield, 65%). Mp:
257−258 °C. 1H NMR (400 MHz, DMSO-d6): δ 9.30 (s, 1 H), 7.53−
7.47 (m, 3 H), 6.97 (s, 1 H), 6.69 (d, 2 H, J = 7.2 Hz), 6.56 (d, 1 H, J = 7.2
Hz), 6.30 (s, 2 H), 4.00 (s, 2 H). 13C NMR (DMSO-d6, 75 MHz) δC
168.8, 154.1, 152.0, 144.1, 135.2, 133.3, 120.5, 116.7, 112.2, 110.5, 96.4,
45.7. HR-ESI-MS: calcd for C14H13ClN5O m/z 302.0809 (M + H)+,
found m/z 302.0799.
Trihydrochloride Salt of 3-[5-[(4-Carbamimidoylbenzyl)oxy]-3H-
imidazo[4,5-b]pyridin-2-yl]benzimidamide (12b). This compound
was prepared using the same procedure as for the preparation of 9.
1
Light-green solid (0.26 g, 61%). Mp: >260 °C. H NMR (400 MHz,
DMSO-d6): δ 13.70 (s, 0.6 H), 13.52 (s, 0.4 H), 9.50 (d, 2 H, J = 9.2 Hz),
9.34 (d, 2 H, J = 7.2 Hz), 9.17 (d, 2 H, J = 9.2 Hz), 9.02 (d, 2 H, J = 10.4
Hz), 8.62 (s, 1 H, J = 8.0 Hz), 8.44 (d, 1 H, J = 8.4 Hz), 8.08, 7.98 (dd, 1
H, J = 8.4 Hz), 7.78−7.89 (m, 4 H), 7.70 (d, 2 H, J = 8.0 Hz), 6.87 (d, 1
H, J = 8.4 Hz), 5.55 (s, 2 H). 13C NMR (DMSO-d6 + D2O, 75 MHz) δC
165.5, 165.4, 160.1, 149.7, 144.0, 131.0, 130.8, 130.1, 129.4, 129.4, 128.4,
127.9, 127.3, 126.2, 106.9, 66.4. HR-ESI-MS: calcd for C21H20N7O m/z
386.1729 (M + H)+, found m/z 386.1723. Anal. Calcd for C21H19N7O·
3HCl·0.5EtOH: C, 51.02; H, 4.87; N, 18.93. Found: C, 50.81; H, 4.98;
N, 18.83.
N-[2-Amino-6-(4-cyanophenyl)pyridin-3-yl]-2-(4-cyanophenoxy)-
acetamide (15a). To a suspension of 4-cyanophenyl boronic acid (0.35
g, 2.4 mmol), an aqueous solution of Na2CO3 (2.3 mL, 2 M, deaireated),
ethanol (3 mL), 14a (0.45 g, 1.5 mmol) in deaireated dioxane (30 mL),
and tetrakistriphenylphosphine palladium [Pd(PPh3)4, 0.14 g, 0.12
mmol] was added under an atmosphere of nitrogen. The vigorously
stirred mixture was warmed to 80 °C for 24 h. The solvent was
evaporated under reduced pressure, and the resulting residue was
diluted with ethyl acetate (50 mL) and 2 M aqueous Na2CO3 (15 mL)
containing 5 mL of concentrated ammonia. The precipitate was
collected to afford the title compound 15a as a yellow solid (0.42 g,
77%). Mp: 222−224 °C. 1H NMR (400 MHz, DMSO-d6): δ 9.52 (s, 1
H), 8.17 (d, 2 H, J = 8.4 Hz), 7.89 (d, 2 H, J = 8.4 Hz), 7.81 (d, 2 H, J =
8.8 Hz), 7.70 (d, 1 H, J = 8.0 Hz), 7.29 (d, 1 H, J = 8.0 Hz), 7.19 (d, 2 H, J
= 8.8 Hz), 6.13 (s, 2 H), 4.89 (s, 2 H). 13C NMR (DMSO-d6, 75 MHz)
δC 166.5, 161.4, 153.5, 148.9, 143.0, 134.1, 133.1, 132.5, 126.8, 119.0,
118.9, 118.0, 115.8, 110.5, 109.7, 103.4, 66.9. HR-ESI-MS: calcd for
C21H16N5O2 m/z 370.1304 (M + H)+, found m/z 370.1299.
N-[2-Amino-6-(4-cyanophenyl)pyridin-3-yl]-3-(4-cyanophenyl)-
propanamide (15b). This compound was prepared using a procedure
similar to that for the preparation of 15a except the catalyst [1,1′-
bis(diphenylphosphino)ferrocene]dichloropalladium(II) [Pd(dppf)-
Cl2] instead of Pd(PPh3)4 was used. Gray solid (yield, 67%). Mp:
241−242 °C. 1H NMR (400 MHz, DMSO-d6): δ 9.33 (s, 1 H), 8.15 (d,
2 H, J = 8.0 Hz), 7.76−7.89 (m, 5 H), 7.48 (d, 2 H, J = 7.6 Hz), 7.27 (d, 1
H, J = 7.6 Hz), 6.06 (s, 2 H), 2.74−2.76 (m, 2 H), 2.63−2.69 (m, 2 H).
13C NMR (DMSO-d6, 75 MHz) δC 170.7, 152.2, 147.5, 147.4, 143.1,
Hydrochloride Salt of Ethyl 4-[5-[(4-Carbamimidoylbenzyl)oxy]-
3H-imidazo[4,5-b]pyridin-2-yl]benzoate (12c). This compound was
prepared using the same procedure as for the preparation of 9. Yellow
1
solid (0.31 g, 75%). Mp: >235 °C. H NMR (400 MHz, DMSO-d6 +
D2O): δ 8.25 (d, 2 H, J = 8.4 Hz), 8.08 (d, 2 H, J = 8.4 Hz), 8.00 (d, 1 H, J
= 8.4 Hz), 7.79 (d, 2 H, J = 8.0 Hz), 7.68 (d, 2 H, J = 8.0 Hz), 6.85 (d, 1
H, J = 8.4 Hz), 5.54 (s, 2 H), 4.33 (q, 2 H, J = 7.2 Hz), 1.33 (t, 3 H, J = 7.2
Hz). 13C NMR (DMSO-d6 + D2O, 75 MHz) δC 165.4, 165.2, 160.3,
149.1, 143.6, 133.0, 131.0, 129.8, 128.3, 127.7, 127.3, 126.6, 107.4, 66.4,
61.0, 14.0. HR-ESI-MS: calcd for C23H22N5O3 m/z 416.1723 (M + H)+,
found m/z 416.1728. Anal. Calcd for C23H21N5O3·HCl·1.9H2O: C,
56.83; H, 5.35; N, 14.41. Found: C, 56.53; H, 5.11; N, 14.25.
6-Chloro-2,3-diaminopyridine (13). A mixture of 2-amino-6-chloro-
3-nitropyridine (1) (6.0 g, 34.6 mmol), tin(II) chloride dihydrate (39.0
g, 0.17 mol), and 180 mL of ethyl acetate and 2-propanol (9:1, v/v) was
stirred at 60 °C for 1 h, after which sodium borohydride (0.66 g, 17.5
mmol) was added at 60 °C, and the mixture was stirred for another 3 h at
the same temperature. The solution was concentrated to dryness under
reduced pressure. The resulting residue was diluted with water,
neutralized by adding aqueous solution of potassium carbonate, and
extracted with ethyl acetate (50 mL × 3). The combined organic phases
were washed with brine, dried over anhydrous sodium sulfate, filtered,
concentrated, and crystallized from ethyl acetate and hexane to give the
title compound 13 as a white solid (3.3 g, 70%). Mp: 119−120 °C (lit.37
mp 120−122 °C). 1H NMR (400 MHz, DMSO-d6): δ 6.68 (d, 2 H, J =
7.6 Hz), 6.34 (d, 1 H, J = 7.6 Hz), 5.78 (s, 2 H), 4.76 (s, 2 H). HR-ESI-
MS: calcd for C5H7N3Cl m/z 144.0329 (M + H)+, found m/z 144.0335.
N-(2-Amino-6-chloropyridin-3-yl)-2-(4-cyanophenoxy)acetamide
(14a). A solution of (4-cyanophenoxy)acetic acid (1.01 g, 6.27 mmol)
and CDI (1.02 g, 6.27 mmol) in 50 mL of tetrahydrofuran (THF) was
stirred at 50 °C for 30 min. The 6-chloro-2,3-diaminopyridine (13)
(0.87 g, 6.08 mmol) in 400 mL of THF was added, and the resulting
solution was stirred for another 6 h at 50 °C. The solution was
concentrated to dryness under reduced pressure. Ethyl acetate (50 mL)
132.4, 132.2, 131.1, 129.5, 126.6, 119.3, 119.0, 110.3, 109.7, 108.8, 36.7,
30.9. HR-ESI-MS: calcd for C22H18N5O m/z 368.1511 (M + H)+, found
m/z 368.1503.
N-[2-Amino-6-(4-cyanophenyl)pyridin-3-yl]-2-[(4-cyanophenyl)-
amino]acetamide (15c). This compound was prepared using the same
procedure as for the preparation of 15a using the catalyst Pd(dppf)Cl2
instead of Pd(PPh3)4. Yellow solid (yield, 62%). Mp: 243−245 °C. 1H
NMR (400 MHz, DMSO-d6): δ 9.41 (s, 1 H), 8.16 (s, 2 H), 7.89 (s, 2
H), 7.77 (s, 1 H), 7.50 (s, 2 H), 7.28 (s, 1 H), 7.02 (s, 1 H), 6.71 (s, 2 H),
6.10 (s, 2 H), 4.05 (s, 2 H). 13C NMR (DMSO-d6, 75 MHz) δC 168.8,
152.9, 152.0, 148.3, 143.0, 133.4, 132.5, 132.1, 126.7, 120.5, 119.0, 118.7,
112.2, 110.4, 109.8, 96.4, 45.9. HR-ESI-MS: calcd for C21H17N6O m/z
369.1464 (M + H)+, found m/z 369.1458.
4-[2-[(4-Cyanophenoxy)methyl]-3H-imidazo[4,5-b]pyridin-5-yl]-
benzonitrile (16a). The dinitrile intermediate 15a (0.31g, 0.84 mmol)
was dissolved in glacial acetic acid (15 mL) heated at refluxed for 6 h.
The solution was then concentrated to dryness, and the residue was
L
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX

The Journal of Organic Chemistry
Featured Article
vigorously stirred in ammonia solution (1 M, 30 mL). The resulting
precipitate was collected, washed with water, and purified by column
chromatography (silica gel, using a gradient elution method with a
mixture of dichloromethane and methanol) to afford the title compound
as a light yellow solid 16a (0.23 g, 78%). Mp: 260−262 °C. 1H NMR
(400 MHz, DMSO-d6+D2O): δ 8.27 (d, 2 H, J = 8.0 Hz), 8.04 (d, 1 H, J
= 8.4 Hz), 7.90 (t, 3 H, J = 8.0 Hz, 8.4 Hz), 7.77 (d, 2 H, J = 8.4 Hz), 7.25
(d, 2 H, J = 8.4 Hz), 5.45 (s, 2 H). 13C NMR (DMSO-d6, 75 MHz) δC
161.8, 155.5, 148.1, 144.4, 134.5, 133.0, 127.5, 124.6, 119.4, 116.3, 115.5,
110.6, 103.6, 65.1. HR-ESI-MS: calcd for C21H14N5O m/z 352.1198 (M
+ H)+, found m/z 352.1206.
4-[2-(4-Cyanophenethyl)-3H-imidazo[4,5-b]pyridin-5-yl]-
benzonitrile (16b). This compound was prepared using the same
procedure as for the preparation of 16a. Brown solid, (yield, 85%). Mp:
235−237 °C. 1H NMR (400 MHz, DMSO-d6): δ 13.07 (s, 0.6 H), 12.67
(s, 0.4 H), 8.7 (d, 2 H, J = 8.0 Hz), 7.89−8.05 (m, 4 H), 7.74 (d, 2 H, J =
8.0 Hz), 7.47 (d, 2 H, J = 8.0 Hz), 3.24 (s, 4 H). 13C NMR (DMSO-d6,
75 MHz) δC 158.2, 148.1, 147.1, 144.1, 133.0, 132.6, 129.8, 127.5, 119.3,
119.3, 115.8, 110.8, 109.3, 33.1, 30.2. HR-ESI-MS: calcd for C22H16N5
m/z 350.1406 (M + H)+, found m/z 350.1412.
solvent was distilled off in vacuo to yield 1.40 g of the acid chloride,
which was used in the next step without further purification. The acid
chloride was slowly added to the solution of 13 (1.0 g, 7.0 mmol) and
triethylamine (1.5 mL, 10.0 mmol) in dichloromethane (100 mL) at
room temperature and stirred overnight. The resulting precipitate was
collected, washed with dichloromethane and water, and dried to provide
a light yellow solid 18 (1.47 g, 77%). Mp: 258−260 °C. 1H NMR (400
MHz, DMSO-d6): δ 9.85 (s, 1 H), 8.13 (d, 2 H, J = 8.0 Hz), 8.01 (d, 2 H,
J = 8.0 Hz), 7.53 (d, 1 H, J = 8.0 Hz), 6.61 (d, 1 H, J = 8.0 Hz), 6.42 (s, 2
H). 13C NMR (DMSO-d6, 75 MHz) δC 164.6, 155.1, 145.2, 138.3, 137.2,
132.3, 128.8, 118.4, 116.5, 113.8, 110.4. HR-ESI-MS: calcd for
C13H10N4OCl m/z 273.0542 (M + H)+, found m/z 273.0544.
N-[2-Amino-6-(4-cyanophenyl)pyridin-3-yl]-4-cyanobenzamide
(19). This compound was prepared using the same procedure as for the
preparation of 15a. Yellow solid (yield, 81%). Mp: >290 °C. 1H NMR
(400 MHz, DMSO-d6): δ 9.93 (s, 1 H), 8.15−8.21 (m, 4 H), 8.01 (d, 2
H, J = 8.0 Hz), 7.91 (d, 2 H, J = 8.0 Hz), 7.76 (d, 1 H, J = 7.2 Hz), 7.32 (d,
1 H, J = 7.2 Hz), 6.18 (s, 2 H). 13C NMR (DMSO-d6, 75 MHz) δC 164.7,
154.2, 149.2, 143.0, 138.6, 134.3, 132.5, 132.3, 128.8, 126.8, 119.0, 118.7,
118.4, 113.8, 110.6, 109.6. HR-ESI-MS: calcd for C20H14N5O m/z
340.1198 (M + H)+, found m/z 340.1194.
4,4′-(3H-Imidazo[4,5-b]pyridine-2,5-diyl)dibenzonitrile (20). This
compound was prepared using the same procedure as for the
preparation of 16a. Yellow solid (yield, 89%). Mp: >290 °C. 1H NMR
(400 MHz, DMSO-d6): δ 13.93 (br s, 1 H), 8.41 (d, 2 H, J = 8.0 Hz),
8.34 (d, 2 H, J = 8.0 Hz), 8.21 (br s, 1 H), 7.97−8.08 (m, 5 H). 13C NMR
(DMSO-d6, 75 MHz) δC 152.1, 149.5, 143.4, 133.5, 133.0, 132.8, 127.3,
127.3, 118.9, 118.5, 116.7, 112.7, 110.9. HR-ESI-MS: calcd for C20H12N5
m/z 322.1103 (M + H)+, found m/z 322.1093.
Trihydrochloride Salt of 4,4′-(3H-Imidazo[4,5-b]pyridine-2,5-diyl)-
dibenzimidamide (21). This compound was prepared using the same
procedure as for the preparation of 9. Yellow solid (0.25 g, 61%). Mp:
>300 °C. 1H NMR (400 MHz, DMSO-d6): δ 9.50 (s, 2 H), 9.44 (s, 2 H),
9.19 (s, 2 H), 9.11 (s, 2 H), 8.49 (d, 2 H, J = 8.0 Hz), 8.39 (d, 2 H, J = 8.0
Hz), 8.23 (d, 1 H, J = 8.4 Hz), 7.98−8.07 (m, 5 H). 13C NMR (DMSO-
d6, 75 MHz) δC 165.3, 165.0, 152.4, 149.7, 144.1, 133.9, 129.7, 129.1,
128.8, 127.7, 127.1, 126.9, 116.8; HR-ESI-MS: calcd for C20H18N7 m/z
356.1624 (M + H)+, found m/z 356.1612. Anal. Calcd for C20H17N7·
3HCl·1.1H2O: C, 49.57; H, 4.62; N, 20.23. Found: C, 49.89; H, 4.67; N,
19.88.
4-[[5-(4-Cyanophenyl)-3H-imidazo[4,5-b]pyridin-2-yl]-
methylamino]benzonitrile (16c). This compound was prepared using
the same procedure as for the preparation of 16a. Yellow solid (yield,
73%). Mp: 237−239 °C. 1H NMR (400 MHz, DMSO-d6): δ 8.28 (d, 2
H, J = 8.4 Hz), 8.02 (d, 1H, J = 7.6 Hz), 7.91−7.95 (m, 3 H), 7.48 (d, 2
H, J = 8.8 Hz), 7.37 (br s, 1 H), 6.74 (d, 2 H, J = 8.8 Hz), 4.63 (s, 2 H).
13C NMR (DMSO-d6, 75 MHz) δC 157.2, 152.1, 148.8, 144.2, 133.9,
133.2, 127.8, 121.0, 119.5, 116.3, 112.9, 111.0, 97.3, 41.4. HR-ESI-MS:
calcd for C21H15N6 m/z 351.1358 (M + H)+, found m/z 351.1351.
Trihydrochloride Salt of 4-[2-[(4-Carbamimidoylphenoxy)-
methyl]-3H-imidazo[4,5-b]pyridin-5-yl]benzimidamide (17a). This
compound was prepared using the same procedure as for the
1
preparation of 9. Yellow solid (0.29 g, 66%). Mp: >290 °C. H NMR
(400 MHz, DMSO-d6): δ 13.69 (s, 0.6 H), 13.43 (s, 0.4 H), 9.52 (s, 2
H), 9.31 (s, 4 H), 9.13 (s, 2 H), 8.34 (d, 2 H, J = 7.2 Hz), 8.17−7.88 (m, 6
H), 7.33 (d, 2 H, J = 7.6 Hz), 5.55 (s, 2 H). 13C NMR (DMSO-d6, 75
MHz) δC 165.3, 164.7, 162.3, 153.2, 149.3, 144.4, 130.4, 128.9, 127.6,
127.1, 120.5, 116.3, 115.5, 64.2. HR-ESI-MS: calcd for C21H20N7O, m/z
386.1729 (M + H)+, found m/z 386.1741. Anal. Calcd for C21H19N7O·
3HCl·1.2H2O·0.07acetone: C, 48.94; H, 4.81; N, 18.84. Found: C,
48.97; H, 4.95; N, 18.47.
Dihydrochloride Salt of 4-[2-(4-Carbamimidoylphenethyl)-3H-
imidazo[4,5-b]pyridin-5-yl]benzimidamide (17b). This compound
was prepared using the same procedure as for the preparation of 9.
White solid (0.33 g, 82%). Mp: >300 °C 1H NMR (400 MHz, DMSO-
d6): δ 9.06−9.45 (br s, 8 H), 8.32 (s, 2 H, J = 7.2 Hz), 7.92−8.02 (m, 4
H), 7.75 (d, 2 H, J = 8.4 Hz), 7.54 (s, 2 H, J = 7.2 Hz), 3.29 (s, 4 H). 13C
NMR (DMSO-d6, 75 MHz) δC 165.5, 165.4, 158.0, 148.4, 147.6, 144.7,
129.3, 129.0, 128.4, 127.4, 127.0, 125.9, 115.8, 32.8, 30.1. HR-ESI-MS:
calcd for C22H22N7 m/z 384.1937 (M + H)+, found m/z 384.1951 Anal.
Calcd for C22H21N7·2HCl·1.3H2O: C, 55.07; H, 5.38; N, 20.44. Found:
C, 55.29; H, 5.42; N, 20.16.
4-[(5-Chloro-3H-imidazo[4,5-b]pyridin-2-yl)methoxy]benzonitrile
(22). This compound was prepared using the same procedure as for the
1
preparation of 16a. White solid (yield, 88%). Mp: 270−272 °C. H
NMR (400 MHz, DMSO-d6): δ 8.04 (d, 1 H, J = 8.0 Hz), 7.81 (d, 2 H, J
= 8.4 Hz), 7.31 (d, 1 H, J = 8.0 Hz), 7.26 (d, 2 H, J = 8.4 Hz), 5.49 (s, 2
H). 13C NMR (DMSO-d6, 75 MHz): δC 161.1, 152.6, 143.9, 134.3,
119.0, 118.1, 116.0, 103.8, 64.0. HR-ESI-MS: calcd for C14H10N4OCl
m/z 285.0543 (M + H)+, found m/z 285.0539.
4-[(5-Chloro-3-methyl-3H-imidazo[4,5-b]pyridin-2-yl)methoxy]-
benzonitrile (23a). To a suspension of 22 (1.0 g, 3.5 mmol) and
anhydrous potassium carbonate (1.46 g, 10.5 mmol) in acetone (25 mL)
was added a solution of methyl iodide (0.33 mL, 5.25 mmol) dissolved
in acetone (25 mL) at room temperature. The reaction mixture was
stirred for 12 h and filtered. The filtrate was concentrated under reduced
pressure. The residue was diluted with ethyl acetate (50 mL), washed
with water and saturated saline, dried over anhydrous sodium sulfate,
filtered, and concentrated. The crude solid was then purified by column
chromatography (silica gel, using a gradient elution method with a
mixture of hexane and ethyl acetate) to afford the title compound which
Dihydrochloride Salt of 4-[[5-(4-carbamimidoylphenyl)-3H-
imidazo[4,5-b]pyridin-2-yl]methylamino]benzimidamide (17c).
This compound was prepared using the same procedure as for the
1
preparation of 9. Yellow solid (0.29 g, 70%). Mp: >280 °C. H NMR
(400 MHz, DMSO-d6): δ 13.36 (s, 0.6 H),12.96 (s, 0.4 H), 9.44 (s, 2 H),
9.17 (s, 2 H), 8.87 (s, 2 H), 8.58 (s, 2 H), 8.33 (t, 2 H, J = 8.8 Hz), 8.09
(d, 0.6 H, J = 8.4 Hz), 7.95−7.97 (m, 3.4 H), 7.65 (d, 2 H, J = 6.8 Hz),
7.48−7.55 (m, 1 H, NH), 6.80 (d, 2 H, J = 8.8 Hz), 4.63 (dd, 2 H, J = 5.6
Hz). 13C NMR (DMSO-d6, 75 MHz) δC 165.8, 164.8, 157.0, 153.5,
149.2, 144.8, 130.2, 129.2, 127.9, 127.5, 116.4, 114.0, 112.5, 41.4. HR-
ESI-MS: calcd for C21H21N8 m/z 385.1889 (M + H)+, found m/z
385.1894 Anal. Calcd for C21H20N8·2HCl·1.7H2O·0.04Et2O: C, 51.77;
H, 5.30; N, 22.82. Found: C, 52.09; H, 5.27; N, 22.47.
N-(2-Amino-6-chloropyridin-3-yl)-4-cyanobenzamide (18). A sol-
ution of 4-cyanobenzoic acid (1.47 g, 0.01 mol), thionyl chloride (1.4
mL, 0.02 mol), and DMF (0.1 mL) in toluene (50 mL) was heated at
reflux for 2 h. The solution was concentrated to dryness under reduced
pressure. Dichloromethane (15 mL × 2) was added to the solid, and the
1
eluted first as a white solid 23a (0.70 g, 67%). Mp: 199−200 °C. H
NMR (400 MHz, DMSO-d6): δ 8.14 (d, 1 H, J = 8.4 Hz), 7.81 (d, 2 H, J
= 8.8 Hz), 7.36 (d, 1 H, J = 8.4 Hz), 7.29 (d, 2 H, J = 8.8 Hz), 5.59 (s, 2
H), 3.84 (s, 3 H). 13C NMR (DMSO-d6, 75 MHz): δC 161.1, 151.3,
147.4, 144.5, 134.2, 132.9, 130.4, 119.0, 118.4, 116.1, 103.8, 63.0, 28.9.
HR-ESI-MS: calcd for C15H12N4OCl m/z 299.0700 (M + H)+, found
m/z 299.0713.
4-[(5-Chloro-1-methyl-1H-imidazo[4,5-b]pyridin-2-yl)methoxy]-
benzonitrile (23b). This compound, 23b, appeared in later fractions of
the chromatography as a white solid (0.07 g, 7%). Mp: 242−243 °C. 1H
NMR (400 MHz, DMSO-d6): δ 8.17 (d, 1 H, J = 8.4 Hz), 7.82 (d, 2 H, J
M
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX

The Journal of Organic Chemistry
Featured Article
= 8.8 Hz), 7.40 (d, 1 H, J = 8.4 Hz), 7.30 (d, 2 H, J = 8.8 Hz), 5.61 (s, 2
H), 3.91 (s, 3 H). 13C NMR (DMSO-d6, 75 MHz): δC 161.1, 153.4,
152.5, 144.2, 134.2, 127.5, 122.4, 119.0, 118.3, 116.0, 103.8, 62.6, 30.7.
HR-ESI-MS: calcd for C15H12N4OCl m/z 299.0700 (M + H)+, found
m/z 299.0711.
AUTHOR INFORMATION
■
Corresponding Authors
*E-mail: wdw@gsu.edu.
*E-mail: dboykin@gsu.edu.
4-[2-[(4-Cyanophenoxy)methyl]-3-methyl-3H-imidazo[4,5-b]-
pyridin-5-yl]benzonitrile (24a). This compound was prepared using the
same procedure as for the preparation of 15a. Yellow solid (yield, 88%).
Mp: 226−228 °C. 1H NMR (400 MHz, DMSO-d6): δ 8.39 (d, 2 H, J =
8.4 Hz), 8.21 (d, 1 H, J = 8.4 Hz), 8.03 (d, 1 H, J = 8.4 Hz), 7.98 (d, 2 H, J
= 8.4 Hz), 7.82 (d, 2 H, J = 8.8 Hz), 7.32 (d, 2 H, J = 8.8 Hz), 5.64 (s, 2
H), 3.95 (s, 3 H). 13C NMR (DMSO-d6, 75 MHz): δC 161.2, 152.0,
148.9, 148.3, 143.0, 134.2, 134.0, 132.8, 128.2, 127.4, 119.0, 118.9, 116.2,
116.0, 111.0, 103.8, 63.2, 28.6; HR-ESI-MS: calcd for C22H16N5O, m/z
366.1355 (M + H)+, found m/z 366.1363.
Notes
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
This work was supported by the National Institutes of Health
(Grant No. AI064200).
REFERENCES
■
(1) Koehler, A. N. Curr. Opin. Chem. Biol. 2010, 14, 331−340.
(2) Tidwell, R. R.; Boykin, D. W. In Demeunynck, M., Bailly, C.,
Wilson, W. D., Eds. DNA and RNA Binders: From Small Molecules to
Drugs; Wiley-VCH: Weinheim, 2003; Vol. 2, pp 414−460.
(3) Sharma, S. K.; Tandon, M.; Lown, J. W. J. Org. Chem. 2000, 65,
1102−1107.
Dihydrochloride Salt of 4-[2-[(4-Carbamimidoylphenoxy)methyl]-
3-methyl-3H-imidazo[4,5-b]pyridin-5-yl]benzimidamide (25a). This
compound was prepared using the same procedure as for the
1
preparation of 9. White solid (0.34 g, 81%). Mp: >280 °C. H NMR
(400 MHz, DMSO-d6): δ 9.36 (br s, 8 H), 8.41 (d, 2 H, J = 8.4 Hz), 8.22
(d, 1 H, J = 8.4 Hz), 8.06 (d, 1 H, J = 8.4 Hz), 8.01 (d, 2 H, J = 8.4 Hz),
7.90 (d, 2 H, J = 8.4 Hz), 7.36 (d, 2 H, J = 8.4 Hz), 5.68 (s, 2 H), 3.98 (s, 3
H). 13C NMR (DMSO-d6, 75 MHz): δC 165.2, 164.7, 162.0, 152.1,
149.1, 148.3, 143.6, 134.0, 130.2, 128.7, 128.2, 127.8, 126.9, 120.5, 116.2,
115.3, 63.2, 28.7; HR-ESI-MS: calcd for C22H22N7O m/z 400.1886 (M
+ H)+, found m/z 400.1893 Anal. Calcd for C22H21N7O·2HCl·1.3H2O:
C, 53.30; H, 5.20; N, 19.78. Found: C, 53.59; H, 5.15; N, 19.51.
4-[5-[(4-Cyanobenzyl)oxy]-3-methyl-3H-imidazo[4,5-b]pyridin-2-
yl]benzonitrile (26a). This compound was prepared using the same
procedure as for the preparation of 23a. The compound 26a was
purified by column chromatography (silica gel, using a gradient elution
method with a mixture of hexane and ethyl acetate) which eluted first as
(4) Wilson, W. D.; Tanious, F. A.; Mathis, A.; Tevis, D.; Hall, J. E.;
Boykin, D. W. Biochimie 2008, 90, 999−1014.
(5) Suckling, C. Future Med. Chem. 2012, 4, 971−989.
(6) Pandian, G. N.; Shinohara, K.; Ohtsuki, A.; Nakano, Y.; Masafumi,
M.; Bando, T.; Nagase, H.; Yamada, Y.; Watanabe, A.; Terada, N.; Sato,
S.; Morinaga, H.; Sugiyama, H. ChemBioChem 2011, 12, 2822−2828.
(7) Yasuda, A.; Noguchi, K.; Minoshima, M.; Kashiwazaki, G.; Kanda,
T.; Katayama, K.; Mitsuhashi, J.; Bando, T.; Sugiyama, H.; Sugimoto, Y.
Cancer Sci. 2011, 102, 2221−2230.
(8) Li, B.; Montgomery, D. C.; Puckett, J. W.; Dervan, P. B. J. Org.
Chem. 2013, 78, 124−133.
1
(9) Yang, F.; Nickols, N. G.; Li, B. C.; Marinov, G. K.; Said, J. W.;
Dervan, P. B. Proc. Natl. Acad. Sci. U.S.A. 2013, 110, 1863−1868.
(10) Edwards, T. G.; Koeller, K. J.; Slomczynska, U.; Fok, K.; Helmus,
M.; Bashkin, J. K.; Fisher, C. Antiviral Res. 2011, 91, 177−186.
(11) Benson, D. A.; Cavanaugh, M.; Clark, K.; Karsch-Mizrachi, I.;
Lipman, D. J.; Ostell, J.; Sayers, E. W. Nucleic Acids Res. 2013, 41, D36−
42.
a white solid (yield, 72%). Mp: 240−241 °C. H NMR (400 MHz,
DMSO-d6): δ 8.05−8.11 (m, 5 H), 7.86 (d, 2 H, J = 7.2 Hz), 7.71 (d, 2
H, J = 7.2 Hz), 6.88 (d, 1 H, J = 8.4 Hz), 5.58 (s, 2 H), 3.89 (s, 3 H). 13C
NMR (DMSO-d6, 75 MHz) δC 160.0, 149.7, 145.9, 143.2, 134.4, 132.7,
132.4, 130.9, 129.9, 129.5, 128.5, 118.8, 118.5, 112.0, 110.4, 106.7, 66.5,
30.5. HR-ESI-MS: calcd for C22H16N5O, m/z 366.1355 (M + H)+, found
m/z 366.1356.
(12) Bishop, E. P.; Rohs, R.; Parker, S. C.; West, S. M.; Liu, P.; Mann, R.
S.; Honig, B.; Tullius, T. D. ACS Chem. Biol. 2011, 6, 1314−1320.
(13) Ecker, J. R.; Bickmore, W. A.; Barroso, I.; Pritchard, J. K.; Gilad, Y.;
Seqal, E. Nature 2012, 489, 52−55.
(14) Munde, M.; Wang, S.; Kumar, A.; Stephens, C. E.; Farahat, A. A.;
Boykin, D. W.; Wilson, W. D.; Poon, G. M. Nucleic Acids Res. 2013,
DOI: 10.1093/nar/gkt955.
4-[5-[(4-Cyanobenzyl)oxy]-1-methyl-1H-imidazo[4,5-b]pyridin-2-
yl]benzonitrile (26b). This compound, 26b, appeared in later fractions
of the chromatography as a white solid (yield, 4%). Mp: 222−223 °C.
1H NMR (400 MHz, DMSO-d6): δ 8.07−8.15 (m, 5 H), 7.85 (d, 2 H, J =
6.4 Hz), 7.68 (d, 2 H, J = 6.4 Hz), 6.94 (d, 1 H, J = 6.8 Hz), 5.54 (s, 2 H),
3.94 (s, 3 H). 13C NMR (DMSO-d6, 75 MHz): δC 159.9, 151.5, 143.6,
134.1, 132.7, 132.4, 130.0, 128.1, 125.0, 123.2, 118.9, 112.2, 110.2, 106.9,
66.0, 32.3. HR-ESI-MS: calcd for C22H16N5O m/z 366.1355 (M + H)+,
found m/z 366.1355.
(15) Nanjunda, R.; Wilson, W. D. Curr. Protoc. Nucleic Acid Chem.
2012, 51, 8.8.1−8.8.20.
(16) Thuita, J. K.; Wang, M. Z.; Kagira, J. M.; Denton, C. L.; Paine, M.
F.; Mdachi, R. E.; Murilla, G. A.; Ching, S.; Boykin, D. W.; Tidwell, R. R.;
Hall, J. E.; Brun, R. PLoS Negl. Trop. Dis. 2012, 6, e1734.
(17) Paine, M. F.; Wang, M. Z.; Generaux, C. N.; Boykin, D. W.;
Wilson, W. D.; De Koning, H. P.; Olson, C. A.; Pohlig, G.; Burri, C.;
Brun, R.; Murilla, G. A.; Thuita, J. K.; Barrett, M. P. Curr. Opin. Invest.
Drugs 2010, 11, 876−883.
(18) Wenzler, T.; Boykin, D. W.; Ismail, M. A.; Hall, J. E.; Tidwell, R.
R.; Brun, R. Antimicrob. Agents Chemother. 2009, 53, 4185−4192.
(19) Liu, Y.; Chai, Y.; Kumar, A.; Tidwell, R. R.; Boykin, D. W.; Wilson,
W. D. J. Am. Chem. Soc. 2012, 134, 5290−5299.
Dihydrochloride Salt of 4-[5-[(4-Carbamimidoylbenzyl)oxy]-3-
methyl-3H-imidazo[4,5-b]pyridin-2-yl]benzimidamide (27a). This
compound was prepared using the same procedure as for the
1
preparation of 9. White solid (0.27 g, 65%). Mp: >260 °C. H NMR
(400 MHz, DMSO-d6): δ 9.54 (s, 2 H), 9.40 (s, 2 H), 9.28 (s, 2 H), 9.16
(s, 2 H), 8.11−8.16 (m, 3 H), 8.02 (d, 2 H, J = 8.0 Hz), 7.85 (d, 2 H, J =
8.0 Hz), 7.75 (d, 2 H, J = 8.0 Hz), 6.90 (d, 1 H, J = 8.4 Hz), 5.61 (s, 2 H),
3.93 (s, 3 H). 13C NMR (DMSO-d6, 75 MHz) δC 165.4, 165.2, 160.0,
149.8, 145.8, 143.6, 134.7, 130.8, 129.6, 129.1, 128.8, 128.6, 128.3, 128.1,
127.3, 106.8, 66.5, 30.5. HR-ESI-MS: calcd for C22H22N7O m/z
400.1886 (M + H)+, found m/z 400.1881 Anal. Calcd for C22H21N7O·
2HCl·1.8H2O: C, 52.34; H, 5.31; N, 19.42. Found: C, 52.50; H, 5.30; N,
19.25.
(20) Rahimian, M.; Kumar, A.; Say, M.; Bakunov, S. A.; Boykin, D. W.;
Tidwell, R. R.; Wilson, W. D. Biochemistry 2009, 48, 1573−1583.
(21) Nguyen, B.; Neidle, S.; Wilson, W. D. Acc. Chem. Res. 2009, 42,
11−21.
ASSOCIATED CONTENT
(22) Neidle, S. Nat. Prod. Rep. 2001, 18, 291−309.
■
(23) Wei, D.; Wilson, W. D.; Neidle, S. J. Am. Chem. Soc. 2013, 135,
1369−1377.
S
* Supporting Information
Thermal profiles for the new heterocyclic cations, CD spectra for
17a, and 1H and 13C NMR spectra for the new intermediates and
heterocyclic cations. This material is available free of charge via
the Internet at http://pubs.acs.org.
(24) Wang, S.; Nanjunda, R.; Aston, K.; Bashkin, J. K.; Wilson, W. D.
Biochemistry 2012, 51, 9796−9806.
(25) Rettig, M.; Germann, M. W.; Wang, S.; Wilson, W. D.
ChemBioChem 2013, 14, 323−331.
N
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX

The Journal of Organic Chemistry
Featured Article
(26) Singh, M. P.; Joseph, T.; Kumar, S.; Bathini, Y.; Lown, J. W. Chem.
Res. Toxicol. 1992, 5, 597−607.
(27) Chenoweth, D. M.; Poposki, J. A.; Marques, M. A.; Dervan, P. B.
Bioorg. Med. Chem. 2007, 15, 759−770.
(28) Farahat, A. A.; Paliakov, E.; Kumar, A.; Barghash, A. E.; Goda, F.
E.; Eisa, H. M.; Wenzler, T.; Brun, R.; Liu, Y.; Wilson, W. D.; Boykin, D.
W. Bioorg. Med. Chem. 2011, 19, 2156−2167.
(29) Ramadas, K.; Srinivasan, N. Synth. Commun. 1992, 22, 3189−
3195.
(30) Wagner, G.; Horn, H. Pharmazie 1975, 30, 353−357.
(31) Renneberg, D.; Dervan, P. B. J. Am. Chem. Soc. 2003, 125, 5707−
5716.
(32) Hauel, N. H.; Nar, H.; Priepke, H.; Ries, U.; Stassen, J. M.; Wiene,
W. J. Med. Chem. 2002, 45, 1757−1766.
(33) Frutos, R. P.; Wei, X. D.; Patel, N. D.; Tampone, T. G.; Mulder, J.
A.; Busacca, C. A.; Senanayake, C. H. J. Org. Chem. 2013, 78, 5800−
5803.
(34) Boykin, D. W.; Kumar, A.; Spychala, J.; Zhou, M.; Lombardy, R. J.;
Wilson, W. D.; Dykstra, C. C.; Jones, S. K.; Hall, J. E.; Tidwell, R. R.;
Laughton, C.; Nunn, C. M.; Neidle, S. J. Med. Chem. 1995, 38, 912−916.
(35) Pinner, A.; Klein, F. Ber. Dtsch. Chem. Ges. 1877, 10, 1889−1897.
(36) Ismail, M. A.; Batista-Parra, A.; Miao, Y.; Wilson, W. D.; Brun, R.;
Wenzler, T.; Boykin, D. W. Bioorg. Med. Chem. 2005, 13, 6718−6726.
(37) Oguchi, M.; Wada, K.; Honma, H.; Tanaka, A.; Kaneko, T.;
Sakakibara, S.; Ohsumi, J.; Serizawa, N.; Fujiwara, T.; Horikoshi, H.;
Fujita, T. J. Med. Chem. 2000, 43, 3052−3066.
(38) Miyaura, N.; Suzuki, A. Chem. Rev. 1995, 95, 2457−2483.
(39) Ismail, M. A.; Boykin, D. W. Synth. Commun. 2011, 41, 319−330.
(40) Wilson, W. D.; Tanious, F. A.; Fernandez-Saiz, M.; Rigl, C. T.
Methods Mol. Biol. 1997, 90, 219−240.
(41) Rettig, M.; Kamal, A.; Ramu, R.; Mikolajczak, J.; Weisz, K. Bioorg.
Med. Chem. 2009, 17, 919−928.
(42) Shi, X. C.; Chaires, J. B. Nucleic Acids Res. 2006, 34, e14.
(43) Hancock, S. P.; Ghane, T.; Cascio, D.; Rohs, R.; Felice, R. D.;
Johnson, R. C. Nucleic Acids Res. 2013, 41, 6750−6760.
(44) Rohs, R. S.; West, E.; Sosinsky, A.; Liu, P.; Mann, R. S.; Honig, B.
Nature 2009, 461, 1248−1253.
(45) Norden, B.; Kubista, M.; Kurucsev, T. Q. Rev. Biophys. 1992, 25,
51−170.
(46) Seidel, C. A. M.; Schulz, A.; Sauer, M. H. M. J. Phys. Chem. 1996,
100, 5541−5553.
(47) Edman, L.; Mets, U.; Rigler, R. Proc. Natl. Acad. Sci. U.S.A. 1996,
93, 6710−6715.
(48) Neubauer, H.; Gaiko, N.; Berger, S.; Schaffer, J.; Eggeling, C.;
Tuma, J.; Verdier, L.; Seidel, C. A. M.; Griesinger, C.; Volkmer, A. J. Am.
Chem. Soc. 2007, 129, 12746−12755.
(49) Nguyen, B.; Tanious, F. A.; Wilson, W. D. Methods 2007, 42,
150−161.
(50) Liu, Y.; Wilson, W. D. Methods Mol. Biol. 2012, 613, 1−23.
(51) Nanjunda, R.; Munde, M.; Liu, Y.; Wilson, W. D. In Methods for
Studying DNA/Drug Interactions; Wanunu, M., Tor, Y., Eds.; CRC Press-
Taylor & Francis Group: Boca Raton, FL, 2011; Chapter 4.
(52) Minehan, T. G.; Gottwald, K.; Dervan, P. B. Helv. Chim. Acta
2000, 83, 2197−2213.
(53) Viger, A.; Dervan, P. B. Bioorg. Med. Chem. 2006, 14, 8539−8549.
(54) SYBYL Molecular Modeling Software, Version X1.2, Tripos Inc.:
St. Louis, MO, 2010.
(55) Liu, Y.; Collar, C. J.; Kumar, A.; Stephens, C. E; Boykin, D. W.;
Wilson, W. D. J. Phys. Chem. B 2008, 112, 11809−11818.
(56) Collar, C. J.; Lee, M.; Wilson, W. D. J. Chem. Inf. Model 2010, 50,
1611−1622.
O
dx.doi.org/10.1021/jo402599s | J. Org. Chem. XXXX, XXX, XXX−XXX