Potent Inhibitor of Drug-Resistant HIV-1 Strains Identified from the Medicinal Plant Justicia gendarussa

Article abstract of DOI:10.1021/acs.jnatprod.7b00004

Justicia gendarussa, a medicinal plant collected in Vietnam, was identified as a potent anti-HIV-1 active lead from the evaluation of over 4500 plant extracts. Bioassay-guided separation of the extracts of the stems and roots of this plant led to the isolation of an anti-HIV arylnaphthalene lignan (ANL) glycoside, patentiflorin A (1). Evaluation of the compound against both the M-and T-Tropic HIV-1 isolates showed it to possess a significantly higher inhibition effect than the clinically used anti-HIV drug AZT. Patentiflorin A and two congeners were synthesized, de novo, as an efficient strategy for resupply as well as for further structural modification of the anti-HIV ANL glycosides in the search for drug leads. Subsequently, it was determined that the presence of a quinovopyranosyloxy group in the structure is likely essential to retain the high degree of anti-HIV activity of this type of compounds. Patentiflorin A was further investigated against the HIV-1 gene expression of the R/U5 and U5/gag transcripts, and the data showed that the compound acts as a potential inhibitor of HIV-1 reverse transcription. Importantly, the compound displayed potent inhibitory activity against drug-resistant HIV-1 isolates of both the nucleotide analogue (AZT) and non-nucleotide analogue (nevaripine). Thus, the ANL glycosides have the potential to be developed as novel anti-HIV drugs.

Full text of DOI:10.1021/acs.jnatprod.7b00004

Article
pubs.acs.org/jnp
Potent Inhibitor of Drug-Resistant HIV‑1 Strains Identified from the
Medicinal Plant Justicia gendarussa
Hong-Jie Zhang,*,†,# Emily Rumschlag-Booms,‡,¶,# Yi-Fu Guan,† Dong-Ying Wang,† Kang-Lun Liu,†
Wan-Fei Li,† Van H. Nguyen,§ Nguyen M. Cuong,⊥ Djaja D. Soejarto,∥ Harry H. S. Fong,∥
and Lijun Rong*,‡
†School of Chinese Medicine, Hong Kong Baptist University, Kowloon, Hong Kong SAR, People’s Republic of China
‡Department of Microbiology and Immunology, College of Medicine, University of Illinois at Chicago, 835 South Wolcott Avenue,
Chicago, Illinois 60612, United States
§Institute of Marine Biochemistry of the Vietnam Academy of Science and Technology (VAST), 18 Hoang Quoc Viet Road, Cau
Giay, Hanoi, Vietnam
⊥Cuc Phuong National Park, Nho Quan, Ninh Binh, Vietnam
∥Department of Medicinal Chemistry and Pharmacognosy, College of Pharmacy, University of Illinois at Chicago, 833 South Wood
Street, Chicago, Illinois 60612, United States
S
* Supporting Information
ABSTRACT: Justicia gendarussa, a medicinal plant collected in Vietnam, was identified as a potent anti-HIV-1 active lead from
the evaluation of over 4500 plant extracts. Bioassay-guided separation of the extracts of the stems and roots of this plant led to
the isolation of an anti-HIV arylnaphthalene lignan (ANL) glycoside, patentiflorin A (1). Evaluation of the compound against
both the M- and T-tropic HIV-1 isolates showed it to possess a significantly higher inhibition effect than the clinically used anti-
HIV drug AZT. Patentiflorin A and two congeners were synthesized, de novo, as an efficient strategy for resupply as well as for
further structural modification of the anti-HIV ANL glycosides in the search for drug leads. Subsequently, it was determined that
the presence of a quinovopyranosyloxy group in the structure is likely essential to retain the high degree of anti-HIV activity of
this type of compounds. Patentiflorin A was further investigated against the HIV-1 gene expression of the R/U5 and U5/gag
transcripts, and the data showed that the compound acts as a potential inhibitor of HIV-1 reverse transcription. Importantly, the
compound displayed potent inhibitory activity against drug-resistant HIV-1 isolates of both the nucleotide analogue (AZT) and
non-nucleotide analogue (nevaripine). Thus, the ANL glycosides have the potential to be developed as novel anti-HIV drugs.
available on the market for the treatment of HIV-infected
IDS (acquired immunodeficiency syndrome) has become
Aa worldwide epidemic since its first report in 1981 in the patients. These drugs are classified as non-nucleoside reverse
United States.1,2 About 78 million people have been infected
transcriptase inhibitors (NNRTIs), nucleoside reverse tran-
scriptase inhibitors (NRTIs), protease inhibitors (PIs), entry
and/or fusion inhibitors, and integrase inhibitors.7 Highly active
antiretroviral therapy (HAART) combining three or more anti-
HIV medications in a daily regimen is the recommended
treatment for those infected with HIV. Although these drugs
with the human immunodeficiency virus (HIV), and nearly half
of them have died since. There were roughly 2.1 million people
newly infected with HIV in 2015.3−5 AIDS is presently the
leading cause of death in Africa and reportedly caused the death
of 1.1 million people globally in 2015.6
The first anti-HIV drug, zidovudine (AZT), was developed
and approved in 1987. Today, more than 40 FDA-approved
drugs, including a number of combination cocktails, are
Received: January 2, 2017
© XXXX American Chemical Society and
American Society of Pharmacognosy
A
DOI: 10.1021/acs.jnatprod.7b00004
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
Article
Figure 1. Confirmation, separation, and chemical structures of the anti-HIV compound. (A) Confirmation of anti-HIV activity of the plant: A small
portion (5.52 g) of SVA5614 was rapidly fractionated into 22 fractions (Fa1−Fa22) by a silica gel column in 1 h. Fa14−F18 obtained from the
eluents of CHCl3/MeOH (85:15 to 8:2) showed almost complete inhibition of HIV replication at the concentrations of 1.0 and 0.1 μg/mL. (B)
Isolation of the anti-HIV compound: Scale-up separation of SVA5614 by silica gel chromatography yielded 40 fractions (F1−F40). Fraction F26,
showing a similar HPLC profile to that of the active fraction Fa16, was further subjected to preparative HPLC separation to yield the active
compound patentiflorin A (1). (C) Chemical structure of patentiflorin A (1). (D) Titration of patentiflorin A (1): Patentiflorin A (1) was shown to
inhibit HIV replication with an IC50 value of 26.9 nM in the “one-stone-two-birds” assay. The bioassay experiments (repeated three times each) were
performed in triplicate. The pseudoviral evaluation system is described in Figure S1, Supporting Information.
have significantly extended the life span of HIV-positive people,
especially those in economically wealthy countries, they are
unable to eliminate the virus from the infected patients, have
potential side effects, and show diminishing effectiveness on
chronic use due to the development of drug-resistant HIV
isolates.8−10 In addition, AIDS patients in developing countries
in sub-Saharan Africa and other regions of the world with the
greatest prevalence of HIV infections often cannot afford these
medications or simply do not have access to them. Thus, it is
imperative to continuously push forward in the discovery and
development of novel, more effective, more accessible, and
affordable anti-HIV therapeutics.
Natural products, especially the plant natural products, have
played the most important role in the history of drug
discovery.11 Many compounds have also been reported from
higher plants to exhibit anti-HIV activity in the past two
decades. Examples of important higher plant-derived anti-HIV
agents or lead compounds include betulinic acid and its
derivatives,12,13 calanolide coumarins,14,15 and ingenol diterpe-
noids.16−18 Thus, higher plants are clearly an excellent source
for discovering new antiviral agents.
The current study reports the identification of an
arylnaphthalene lignan glycoside possessing specific and potent
anti-HIV-1 activity from the plant Justicia gendarussa and of its
synthesis and that of two congeners. These compounds have
the potential to be developed as novel anti-HIV therapeutic
agents, capable of being added to the current HAART drugs.
RESULTS AND DISCUSSION
■
Through the collaborations among several institutes in
Vietnam, Laos, Hong Kong, and the United States, a program
was established for the search for anti-HIV, antimalarial, anti-
TB, and anticancer agents from higher plants.19 More than
4500 plant samples were collected in Vietnam and Laos and
subjected to subsequent extract preparation and evaluation for
bioactivities against these disease targets. Interestingly, one of
B
DOI: 10.1021/acs.jnatprod.7b00004
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
Article
a
Scheme 1. Experimental Procedures for Synthesis of Diphyllin (10)
a
Conditions: (a) 2a (63.3 mmol), Br (69.1 mmol), MeOH, rt, 6 h, 86%; (b) 3 (50.2 mmol), HS(CH2)2SH (50.2 mmol), p-TsOH (2.79 mmol),
benzene, reflux, 10 h, 93%; (c) 4 (46.6 mmol), 2b (55.9 mmol), n-BuLi (69.9 mmol), THF, −78 °C to rt, 2 h, 50%; (d) 5 (20.7 mmol), MnO2 (345
mmol), CH2Cl2, rt, 16 h, 98%; (e) 6 (14.3 mmol), 7 (17.3 mmol), LDA (45 mmol), THF, −78 °C to rt, 1 h, 57%; (f) 8 (0.65 mmol), HgO (0.71
mmol), HgCl2 (1.43 mmol), MeCN, reflux, 3 h, 52%; (g) 9 (0.34 mmol), p-TsOH (0.22 mmol), benzene, reflux, 16 h, 85%.
the CH2Cl2 plant extracts (SV5614) displayed complete
inhibition against HIV replication at a concentration of 20
μg/mL.20 This bioactivity was confirmed by the evaluation of
the MeOH extract (SVA5614), prepared from a re-collected
sample of the same plant, with HIV-1 replication inhibition at
an IC50 value of 40 ng/mL. These results indicate that
J. gendarussa is a promising lead plant in the search for anti-HIV
agents.
methylenedioxy group at C-3′/C-4′ to form a piperonyl (1,3-
benzodioxole) group.
Compound 1 was identified as the known compound
patentiflorin A by analysis of its spectroscopic data (Table S1
and Figures S2−S7, Supporting Information) and a comparison
with literature data.23 We further confirmed the identity by a de
novo total synthesis (Schemes 1 and 2) of the compound. The
As noted above, the extracts SV5614 and SVA5614 were
prepared with CH2Cl2 and MeOH, respectively, from two
separate field-collected plant materials. SV5614 was prepared
from the initial collection of the stems and roots of the plant
J. gendarussa Brum. f. (synonym: Gendarussa vulgaris Nees)
(Acanthaceae family), with SVA5614 being derived from a
larger re-collection of the plant materials.
Scheme 2. Experimental Procedures for Synthesis of
Patentiflorin A (1) from Diphyllin (10)
a
J. gendarussa is a bush of up to 0.3 m in height, found in
Vietnam, China, Indonesia, Thailand, the Philippines, India,
and Burma. The plant leaves and roots have been used as an
herbal medicine for the treatment of fall injury, rheumatism,
pain, swelling, and bone fracture as well as thermogenic and
diaphoretic agents in these countries.21,22
Bioassay-directed separation of SVA5614 led to the isolation
of patentiflorin A (1) (Figures 1A−C).23 The compound
showed anti-HIV-1 activity with an IC50 value of 26.9 nM in the
defective HIV-based pseudotyped assay, which is also known as
the “one-stone-two-birds” protocol (Figure 1D and Figure S1,
Supporting Information).20
a
Conditions: (a) 11 (0.61 mmol), DMAP (0.06 mmol), Ac2O (1.5
mL), pyridine, rt, overnight; (b) 12, HBr/HOAc (33% HBr, 1.5 mL),
CH2Cl2, rt, 15 min, 99%; (c) 12 (0.95 mmol), 13 (0.61 mmol), TBAB
(0.95 mmol), NaOH (20 mL, 0.1 M), CHCl3, 40 °C, 6 h; (d) 14,
K2CO3 (1.0 mmol), MeOH, rt, 1 h, 38%.
Patentiflorin A (1), [α]2D0 −23.5 (c 1.20, MeOH), was
determined to be an arylnaphthalene lignan glycoside
containing a methylenedioxy and two methoxy groups by
1
comparison of their H and 13C NMR data to those of known
synthesized patentiflorin A (1) gave the same 1H and 13C NMR
spectroscopic and specific rotation data as those of the natural
isolate (Figure S26, Supporting Information), thus providing
additional confirming evidence of chemical identification.
In addition to patentiflorin A (1), two structural congeners
(15 and 16) (Figure 2) were also synthesized and evaluated for
potential HIV replication inhibition activities. The synthesis
arylnaphthalene lignans (Table S1, Supporting Informa-
tion).24,25 The γ-lactone carbonyl carbon was assigned at C-
9′ rather than at C-9 due to the presence of the HMBC cross-
peaks of H2-9 to C-7. Analysis of 1D (1H, 13C, and DEPT) and
2D (1H−1H COSY, HMQC, and HMBC) NMR data
positioned the two methoxy groups at C-4 and C-5 and the
C
DOI: 10.1021/acs.jnatprod.7b00004
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
Article
routes for these compounds are summarized in Schemes 1 and
2.
Figure 2. Chemical structures of the synthesized congeners 7β-D-
xylosyloxydiphyllin (15) and 7β-D-glucopyranosyloxydiphyllin (16).
The aglycone diphyllin (10) was determined to be the key
intermediate for the synthesis of patentiflorin A (1). The
successful synthesis of this intermediate enabled us not only to
obtain patentiflorin A but also to afford a synthesis route to
other related arylnaphthalene lignan derivatives. Scheme 1
illustrates our successful synthesis to diphyllin (10) through the
key feature of an intermolecular Michael addition reaction of
intermediate 6 with furan-2(5H)-one (7) to produce 8.
Glycosylation of diphyllin (10) at C-7 with D-quinovose (11)
led to patentiflorin A (1) (Scheme 2) (Figures S8−S27,
Supporting Information). The MS and NMR data of the
synthesized compound being the same as those of the natural
isolate confirmed that the two compounds are identical (Figure
S26, Supporting Information).
The same strategy for the synthesis of patentiflorin A (1) was
employed to synthesize two congeners (15 and 16). By
replacing D-quinovose (11) with D-xylose and D-glucose in
Scheme 2, the congeners 7β-D-xylosyloxydiphyllin (15) and 7β-
D-glucopyranosyloxydiphyllin (16) were obtained (Figure 2 and
Figures S28−S31, Supporting Information), respectively. 7β-D-
Xylosyloxydiphyllin (15, diphyllinin) and 7β-D-glucopyranosy-
loxydiphyllin (16, cleistanthin B) are two natural products that
were originally isolated from the aerial parts of Haplophyllum
hispanicum26 and the bark of Cleistanthus collinus,27 respectively.
The biological activities of the natural and synthesized
patentiflorin A (1), diphyllin (10), and compounds 15 and 16
were evaluated and compared (Figure 3). As expected, the
synthesized patentiflorin A (1) showed similar anti-HIV activity
to that of the natural one (Figure 3A). However, compounds
15 and 16 showed much lower anti-HIV activity (Figure 3D)
than patentiflorin A (1), although these compounds differ from
one another only by the sugar units. Although the aglycone
diphyllin (10) displayed some level of activity (Figure 3A), it is
clear that the presence of a sugar unit is required for effective
inhibitory action against HIV-1.
Figure 3. Anti-HIV activity and cytotoxicity of the anti-HIV
compounds. (A) Comparison of the anti-HIV activity of the natural
and synthesized patentiflorin A (1) and diphyllin (10) in the defective
HIV-1 pseudoviral assay. (B) Cytotoxicity of the natural patentiflorin
A (1) against A549 and HeLa cells. (C) Inhibition of patentiflorin A
(1) against four HIV viral strains (Bal:M-Tropic, 89.6:Dual Tropic,
SF162:M-Tropic, and LAV.04:T-Tropic): patentiflorin A (1, natural)
displayed a dose-dependent effect against the four strains with IC50
values in the range of 24−37 nM. (D) The IC50 values of the anti-HIV
activity of the compounds 1, 10, and 15−16 were obtained using the
“one-stone-two-birds” evaluation system, with the data obtained from
three experiments, each performed in triplicate.
four HIV-1 clinical isolates: BAL and SF162 (both M-tropic),
LAV0.04 (T-tropic), and 89.6 (dual tropic) using a stand-
ardized human PBMC assay.28
The results clearly showed that compound 1 is a broad-
spectrum inhibitor. Like AZT, it inhibited the particle
production of all four HIV-1 isolates effectively in a dose-
dependent manner (Figure 3C). Compound 1 gave an IC50
value of 24−37 nM, compared to 77−95 nM for AZT,
depending on the isolates (Table 1). As expected, the
synthesized patentiflorin A (1) had a similar anti-HIV-1 activity
profile compared to that of the natural compound (Table 1).
This finding is important because it validates that both the
isolated and synthesized patentiflorin A (1) are active anti-HIV
compounds with higher degrees of potency than AZT. Most
significantly, the ability to chemically synthesize a potential
drug lead such as patentiflorin A (1) would eliminate the need
of a dependence for resupply on the phytochemical isolation of
the compound from the source plant matrix for drug
development efforts or for commercial production should it
become an approved drug.
The emergence of the drug-resistant HIV isolates is one of
the major problems in the long-term treatment of HIV/AIDS
patients. Thus, one critical parameter in the search for novel
anti-HIV therapeutics is that a new candidate should have a
good therapeutic efficacy against the drug-resistant HIV
isolates. Thus, patentiflorin A (1) was investigated to determine
whether it was effective against an NRTI-resistant isolate (HIV-
The cytotoxicity of the natural patentiflorin A (1) was
initially evaluated in A549 (human alveolar adenocarcinoma)
and HeLa (human epithelial cervical adenocarcinoma) cell
lines. As shown in Figure 3B, at a concentration of 19 μM, the
natural patentiflorin A exhibited no apparent cytotoxicity to
these cells. When the natural and synthesized patentiflorin A
(1) were evaluated in the PBMC (human peripheral blood
mononuclear cell), both displayed the same level of cytotoxicity
(CC50: 75 μM).
1
1617−1) and an NNRTI-resistant isolate (HIV-1N119) using the
PBMC assay as described above.28
As shown in Table 1, patentiflorin A (1) effectively inhibited
all three of the HIV-1 isolates tested, LAV, HIV-11617‑1, and
HIV-1N119. In contrast, AZT, as an NRTI, was effective against
To determine the anti-HIV-1 activity spectrum of the natural
and synthesized patentiflorin A (1), both were tested against
D
DOI: 10.1021/acs.jnatprod.7b00004
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
Article
Table 1. Inhibition Activity of Patentiflorin A (1, Natural and Synthesized) against HIV Clinical Strains and Resistant Strains
strains (IC50, nM)
compound
Bal: M-Tropic
89.6: Dual-Tropic
SF162: M-Tropic
Lav.04: T-Tropic
HIV-1LAV
HIV-11617‑1
HIV-1N119
1 (natural)
1 (synthesized)
AZT
30
32
77
32
31
95
37
30
85
24
32
79
108
72
61
3508
156
47
5.2
a
nevaripine
532
>100 000
a
The datum is taken from the literature.29,30
LAV and HIV-1N119, but not HIV-11617‑1, while nevirapine,
which is an NNRTI, was effective against LAV and HIV-11617‑1
needed to determine the anti-HIV-1 mechanism of action and
target of compound 1.
,
29,30
but not against HIV-1N119
.
These results clearly demon-
Patentiflorin A (1) was isolated and identified as a potent
anti-HIV lead compound from the medicinal plant J. gendarussa.
It displayed broad-spectrum activity against both M-tropic and
T-tropic HIV-1 isolates with IC50’s lower than that of AZT, the
first anti-HIV drug developed and still used in the treatment of
HIV/AIDS. The de novo total synthesis of the arylnaphthalene
lignin (ANL) glycoside was subsequently carried out. We
demonstrated that the newly discovered inhibitor targets
reverse transcription in the HIV-1 life cycle, and it is highly
potent against NRTI- and NNRTI-resistant HIV-1 variants.
Therefore, the new inhibitor and its derivatives have potential
to be developed as novel anti-HIV therapeutic agents.
strate that patentiflorin A (1) is a potent inhibitor against both
NRTI- and NNRTI-resistant HIV-1 isolates.
Because of the nature of the initial anti-HIV evaluation
protocol employed, it was apparent that patentiflorin A (1)
would most likely target a postentry step in the HIV-1
replication cycle such as reverse transcription, integration,
transcription, or protein expression. To further delineate the
mechanism of action of 1, the inhibition profiles of the natural
isolate and AZT (control) against HIV gene expression were
investigated and compared (Figure 4). HIV gene expression of
A variety of biological activities including antibacterial,
antitumor, and anti-HIV activities have been reported for
ANL compounds.33−37 However, no reported ANL compounds
showed the same level of anti-HIV potency as that of
patentiflorin A (1). Our data showed that the glycoside
patentiflorin A (1) was at least 50-fold more potent than its
parent aglycone, diphyllin (10), in inhibiting HIV-1 replication
(Figure 3).
Patentiflorin A (1) was first isolated from the plant
J. patentiflora and was shown to be cytotoxic in several cancer
cell lines, with CC50 values in the range of 3−40 nM.23
However, in our study, the compound showed cytotoxicity at
much lower concentrations in several human cell lines. To
further characterize 1, the compound was synthesized in order
to verify not only its chemical structure but also its biological
activities, as well as being a means of resupply for future uses.
The synthesized patentiflorin A showed similar anti-HIV
activity profiles to those of the natural patentiflorin A in all
the HIV strains tested, and it demonstrated low toxicity to
human PMBC with a CC50 value at 75.5 μM (Table 1).
To further determine the anti-HIV potential and structural
relationships among ANL glycosides, two congeners [7β-D-
xylosyloxydiphyllin (15) and 7β-D-glucopyranosyloxydiphyllin
(16)] of patentiflorin A (1) were synthesized. Compounds 1,
15, and 16 all contain a sugar unit at C-7. The sugar units differ
from one another only by the C-5″ substituent, with a methyl
group for 1, a hydroxymethyl group for 16, and no substituent
at C-5″ for 15. It is most interesting to note that with only a
slight chemical structural difference at C-5″ the three ANL
glycosides exhibited such differences in their anti-HIV activity,
with 1 being ca. 20−30 times more potent than 15 and 16
(Figure 3D). Compound 1 contains a quinovopyranosyloxy
sugar unit, while 15 and 16 are glycosylated with xylose and
glucose, respectively, suggesting that the presence of a
quinovopyranosyloxy sugar moiety may be essential to maintain
the anti-HIV potency among these three ANL compounds. To
fully elucidate the anti-HIV structure−activity relationship of
ANL glycosides, it will be essential to synthesize and evaluate a
full complement of other glycosides.
Figure 4. Real-time PCR data of patentiflorin A (1) and AZT against
HIV gene expression. A549 target cells were challenged with VSV-G/
HIV pseudotyped virus while concurrently being treated with either
purified compound 1 or AZT (10-fold dilutions beginning with 5 μg/
mL). Forty-eight hours postinfection/treatment, cells were prepared
for RNA isolation, reverse transcription PCR, and subsequent
TaqMan-based real-time PCR. Detection of the HIV R/U5 region
serves as a measure of early transcription product, while the HIV U5/
gag region serves as an measure of late transcription product.
the R/U5 and U5/gag transcripts was measured using
TaqMan-based real-time PCR.31,32 In this assay, A549 target
cells were challenged with a VSV-G/HIV pseudovirus in the
presence or absence of the test compound. Hence, patentiflorin
A (1) and AZT were added simultaneously with the virus. AZT
is a powerful NRTI of HIV that blocks the conversion of viral
RNA into DNA. In this assay, AZT blocked R/U5 and U5/gag
transcription in a dose-dependent manner with more potent
inhibition against the late transcript. In contrast, the test
compound (1) was shown to inhibit both the early and late
transcripts at levels greater than AZT. The inhibition by 1 is
most notable at 0.005 μg/mL, with gene expression being
decreased by more than 75% as compared to 40% for AZT.
These data suggest that patentiflorin A (1) is a potential
inhibitor of HIV reverse transcription. Further research is
E
DOI: 10.1021/acs.jnatprod.7b00004
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
Article
fractions (F1−F40). Fraction F26 showed similar TLC and HPLC
profiles to those of Fa16. A portion (120 mg) of F26 was thus
subjected to preparative HPLC separation on a Phenomenex LUNA-
C-18 column (solvent system: MeOH/H2O, 65:35) to yield eight
fractions (F41−F48). Further bioassaying showed that fraction F47
inhibited HIV replication by more than 90% at a concentration of 0.2
μg/mL. The remaining portion of fraction F26 (2.93 g) was
chromatographed on a prepacked RP-18 silica gel (40 μm, 275 Å, J.
T. Baker) (7.3 g) flash column, eluting with a gradient solvent mixture
of MeOH/H2O to afford fractions F50−F54. Fractions F51 (670 mg)
and F52 (890 mg) were pooled and subjected to a preparative HPLC
separation (Phenomenex LUNA-C-18 column; solvent system:
MeOH/H2O, 65:35), which resulted in 12 fractions (F55−F66).
Fraction F62 showed similar TLC and HPLC profiles to that of F47.
Further HPLC separation (Phenomenex LUNA-C-18 column; solvent
system: MeCN/H2O, 35:65) of F62 (139 mg) led to the isolation of
patentiflorin A (1) (29.6 mg): white powder, [α]2D0 = −51.2 (c 0.6,
MeOH); 1H and 13C NMR data, see Table S1, Supporting
Information.
Production of HIV Pseudovirions. HIV/VSV-G or HIV/HA
virions were produced, respectively, by cotransfecting with either 0.5
μg of VSV-G envelope expression plasmid or 0.5 μg of hemagglutinin
(HA) envelope expression plasmid with 0.5 μg of neuraminidase (NA)
expression plasmid and 2 μg of replication-defective HIV vector
(pNL4-3-Luc.R-.E-) into human embryonic kidney 293T cells (90%
confluent) in six-well plates via PEI (Invitrogen), as previously
described with a modified procedure.20 The HIV vector pNL4-
3.Luc.R-.E- was obtained through the AIDS Research and Reference
Reagent Program (Division of AIDS, NIAID, NIH).38,39 Sixteen hours
post-transfection, all media were replaced with fresh, complete
DMEM. Forty-eight hours post-transfection, the supernatants were
collected and filtered through a 0.45 μm pore size filter (Millipore),
and the pseudovirions were directly used for infection.
“One-Stone-Two-Birds” Anti-HIV Evaluation Assay. This
protocol is designed to identify potential inhibitors for HIV replication
(postentry steps) (Figure S1, Supporting Information). In this system,
the HIV vector pNL4-3.Luc.R-.E- was cotransfected with the VSV-G
to generate HIV/VSV-G virions, and the same HIV vector was
cotransfected with the H5N1 HA and NA constructs to generate HIV
virions with bird flu HA on the viral surface (HIV/HA). This pNL4-3
was derived from an infectious molecular clone of an SI, T-tropic
virus,40 which is replication deficient since the HIV is Env− and Vpr−.
In addition, the luciferase gene (luc) carried by this recombinant HIV
vector served as the reporter for HIV replication (reverse transcription,
integration, and HIV gene expression). The infection level was
measured as relative light units (RLUs) in the infected cells. The
luciferase activities of the 293T cells infected with the HIV vector
pNL4-3.Luc.R-.E- reached the range of 105−106 RLUs, approximately
100-fold higher than the background levels when measured using the
HIV virions without VSV-G. The evaluation principle is that the level
of the luciferase activity in the cells should be proportional to the level
of viral entry and replication. If a compound (or fraction) can interfere
with HIV replication/or HA-mediated viral entry, the level of the
luciferase activity in the infected cells will be reduced. Thus, using this
protocol, we were able to identify fractions or compounds capable of
inhibiting HIV replication. The test fractions or compounds were
evaluated as follows. Target A549 human lung cells were seeded at 0.5
× 105 cells per well (24-well plate) in complete Dulbecco’s modified
Eagle medium (DMEM). The lung cell line was used since it is
susceptible to HA-mediated viral entry. The stock HIV/VSV-G or
HIV/HA virions (approximately 2 × 106 RLUs on the target cells)
were mixed with the individual sample first, and the mixture was
incubated with the A549 target cells for 24 h. Ten microliters of each
sample in varying concentrations and 190 μL of the pseudovirus were
incubated with target cells. Twenty-four hours postinfection, all media
containing sample and virus was removed from the target cells and
replaced with fresh and complete DMEM. Forty-eight hours
postinfection, the target cells were lysed and the luciferase activity
was determined.
Several aspects of patentiflorin A (1) render it an attractive
candidate as a lead compound for anti-HIV-1 drug develop-
ment. It is a highly potent molecule and has a broad activity
spectrum against both M- and T-tropic HIV-1 isolates. The
compound was also shown to be more effective than AZT in
inhibiting four different HIV-1 isolates, either M- or T-tropic, in
human PBMCs with IC50’s in the range of 14−32 nM (Table
1). Further, it demonstrated an excellent selectivity index of
2500. This is the first report that this natural product displayed
not only comparable but higher anti-HIV activity than that of
the clinically used drug AZT.
EXPERIMENTAL SECTION
■
General Experimental Procedures. Optical rotations were
measured with a PerkinElmer model 241 polarimeter. IR spectra
were recorded on a Jasco FT/IR-410 spectrometer, equipped with a
Specac Silver Gate ATR system, by applying a film on a germanium
plate (Jasco, MD, USA). 1D and 2D NMR spectra were recorded on a
Bruker DRX-500 MHz, a Bruker DPX-400 MHz, or a Bruker DPX-
360 MHz spectrometer (Rheinstetten, Germany). Chemical shifts (δ)
were expressed in ppm with reference to the solvent signals (CDCl3:
1H:, 7.24 ppm; 13C, 77.00 ppm; methanol-d4: 1H, 3.30 ppm; 13C, 49.00
pm; DMSO-d6: 1H, 2.50 ppm; 13C, 39.50 pm), and coupling constants
(J) are reported in Hz. All NMR experiments were obtained by using
standard pulse sequences supplied by the vendor. Column
chromatography was carried out on silica gel (230−400 mesh,
Natland International Corporation, Research Triangle Park, NC,
USA). Reversed-phase flash chromatography was accomplished with
RP-18 silica gel (40−63 μm, EM Science, Gibbstown, NJ, USA), and
reversed-phase preparative HPLC was carried out on a Waters 600E
Delivery System pump, equipped with a Waters 996 photodiode
detector (Milford, MA, USA), and a Watrex GROM-Saphir 110 C18
column (120 Å, 12 μm, 300 × 40 mm2, Rottenburg-Hailfingen,
Switzerland) or a Phenomenex LUNA-C-18 column (120 Å, 12 μm,
250 × 50 mm2, Torrance, CA, USA). Thin-layer chromatography was
performed on EMD glass-backed plates coated with 0.25 mm layers of
silica gel 60 F254 (Kassel, Germany). HRTOFMS spectra were
recorded on a Micromass QTOF-2 (Milford, MA, USA), an Agilent
6540 Q-TOF (Santa Clara, CA, USA), an Agilent 6460 Triple
Quadrupole, or a Bruker Q-TOF mass spectrometer (Bremen,
Germany).
Plant Materials. The initial collection of the root and stem
samples of Justicia gendarussa Burm. f. (Acanthaceae) was made in
2006 in the “Cave of Prehistoric Man” area, close to hot spot 33 of
Cuc Phuong National Park, with geographic coordinate readings of
20°21′633″ N, 105°38′257″ E. A larger amount of the plant sample for
the current isolation work, consisting of the same plant part (bark and
stem) (4.0 kg), was subsequently re-collected from plants located in
the same area. The re-collection of the root and stem samples of
J. gendarussa was made on July 15, 2008, at geographic coordinate
readings of 20°17′250″ N, 105°40′235″ E. Voucher specimens (M.V.
Xinh #742 for the initial collection and N.M. Cuong #2162 for the re-
collection) were collected and are deposited at the Herbarium of Cuc
Phuong National Park.
Extraction and Isolation. The dried, milled plant material (4.0
kg) was extracted with MeOH (3 × 10 L) to afford 155 g of extract
(SVA5614) following evaporation of the solvent. A small portion of
the MeOH extract (5.5 g) was rapidly fractionated to 22 fractions
(Fa1−Fa22) in a 1 h period over a silica gel (10 g) column eluting
with gradient CHCl3, CHCl3/acetone, and CHCl3/MeOH solutions.
Anti-HIV evaluation of the fractions determined that fractions Fa14−
Fa18 inhibited HIV replication by more than 95% at a concentration
of 0.1 μg/mL without apparent cytotoxicity at 20 μg/mL. Scale-up
fractionation of SVA5614 was carried out to isolate the anti-HIV-active
compound(s) in the extract. The MeOH extract (140 g) was absorbed
onto 214 g of silica gel and chromatographed over a silica gel column
(1545 g). The column was developed by gradient elution with CHCl3,
CHCl3/acetone, and CHCl3/acetone/MeOH solutions to afford 40
F
DOI: 10.1021/acs.jnatprod.7b00004
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
Article
Cytotoxicity Assay. Approximately 5000 cells were seeded in a
96-well tissue culture plate in DMEM supplemented with FBS and
penicillin/streptomycin. DMSO alone or compounds in 100% DMSO
were added on the following day at appropriate concentrations and
incubated with cells at 37 °C in 5% CO2 for 24 h. After 24 h, all media
were removed and replaced with 100 μL of fresh complete DMEM.
After 48 h post initial addition of DMSO or compound, 20 μL of
CellTiter 96 Aqueous One Solution was added per well. After gentle
mixing, plates were incubated at 37 °C in 5% CO2 for 4 h. A 25 μL
amount of a 10% SDS solution was added per well, and plates were
stored at room temperature for approximately 12 h. Absorbance was
measured at 450 nm using a plate reader.
HIV Gene Expression Assay of the R/U5 and U5/gag
Transcripts. A549 target cells were challenged with VSV-G/HIV
pseudovirus while concurrently being treated with either purified
patentiflorin A (1) or AZT (10-fold dilutions beginning with 5 μg/
mL) in triplicate. Forty-eight hours postinfection/treatment, cells were
prepared for real-time PCR according to the Power SYBR Green
Cells-to-CT kit (Applied Biosystems). Transcript products were
detected with the following probes: 5′GGCTAACTAGGGAACC-
CA C T GC , 5 ′C A AC A G A CG G GC A C AC A C T AC T , 5 ′
AGATCCCTCAGACCCTTTTAGTCA, 5′ CTTTCGCTTTC-
AAGTCCGTGTT. GAPDH and 18S served as internal controls.
Anti-HIV Assay against Broad-Spectrum HIV Isolates and
Normal and Resistant Strains. Four HIV1 clinical strains, BAL and
SF162 (M-tropic), BAL (T-tropic), and 89.6 (a dual tropic strain), as
CH2Cl2 (2 × 150 mL), and the combined organic layers were washed
with water (250 mL) and brine (250 mL) and dried over anhydrous
Na2SO4. After the solvent was removed, the residue was purified by
silica gel chromatography, eluting with 20% EtOAc in n-hexane, to
afford 2-bromo-4,5-dimethoxybenzaldehyde (3) as a white foam (13.4
g, 86%): 1H NMR (CDCl3, 500 MHz) δ 10.18 (1H, s, H-7), 7.41 (1H,
s, H-6), 7.06 (1H, s, H-3), 3.97 (3H, s, OCH3), 3.92 (3H, s, OCH3);
13C NMR (CDCl3, 125 MHz) δ 190.9 (CH, C-7), 154.6 (C, C-4),
149.0 (C, C-5), 126.6 (C, C-1), 120.5 (C, C-2), 115.5 (CH, C-6),
110.5 (CH, C-3), 56.6 (CH3, OCH3), 56.3 (CH3, OCH3).
2-(2-Bromo-4,5-dimethoxyphenyl)-[1,3]dithiane (4). To a flask
containing dry benzene (300 mL) were added the bromoaldehyde (3)
(12.3 g, 50.2 mmol), 1,3-propanedithiol [HS(CH2)2SH, 5.04 mL, 50.2
mmol], and p-toluenesulfonic acid (0.48 g, 2.79 mmol). The flask was
connected to a Dean−Stark trap and refluxed for 10 h. The solvent
was removed in vacuo, and the residue was partitioned between Et2O
(150 mL) and 1 M NaOH (150 mL). The organic layer was washed
with 1 M NaOH (150 mL), H2O (250 mL), and brine (250 mL) and
dried over anhydrous Na2SO4. After the solvent was removed, the
residue was purified by silica gel chromatography, eluting with 20%
EtOAc in n-hexane, to yield 2-(2-bromo-4,5-dimethoxyphenyl)-
1
[1,3]dithiane (4) (15.6 g, 93%) as a white foam: H NMR (CDCl3,
500 MHz) δ 7.16 (1H, s, H-3), 6.99 (1H, s, H-6), 5.53 (1H, s, H-7),
3.90 (3H, s, OCH3), 3.85 (3H, s, OCH3), 3.12 (2H, brt, J = 13.0 Hz,
H-S1a and H-S3a), 2.90 (2H, brd, J = 11.5 Hz, H-S1b and H-S3b),
2.18 (1H, brdt, J = 12.0, 2.0 Hz, H-S2a), 1.93 (1H, brqd, J = 11.5, 3.0
Hz, H-S2b); 13C NMR (CDCl3, 125 MHz) δ 149.5 (C, C-5), 149.0
(C, C-4), 130.3 (C, C-1), 115.3 (CH, C-3), 113.0 (C, C-2), 111.9
(CH, C-6), 56.29 (CH3, OCH3), 56.27 (CH3, OCH3), 50.6 (CH, C-
7), 32.4 (2C, CH2, C-S1 and C-S3), 25.1 (CH2, C-S2).
well as HIV-1LAV (wild type), NRTI-resistant isolate (HIV-11617−1
)
(AZT-resistant strain from AIDS repository), and NNRTI-resistant
isolate (HIV-1N119) (nevaripine-resistant strain from AIDS repository)
were used in the current study. A standardized human PBMC assay
was used to determine the compound susceptibility of these HIV-1
strains.28 AZT, an anti-HIV drug in clinical use, was used as a positive
control. All data were generated from three independent experiments,
each performed in triplicate. Prior to HIV-1 infection, human PBMCs
were used in each experiment. Briefly, donor PBMCs were suspended
in R-3 medium [RPMI 1640 medium supplemented with 15−20%
FBS (fetal bovine serum), 5% IL-2 (human interleukin-2), 250 U of
penicillin per mL, 250 μg of streptomycin per mL, and 2 mM L-
glutamine] and stimulated with PHA (phytohemeagglutinin, 2−3 μg/
mL) for 7 days. The preparations (compound or fraction) were added
to the cultured cells, and the different HIV-1 strains were used to
challenge the cultured cells in 96-well plates [1 × 105 cells per well
with 1000 TCID50 (virus 50% tissue culture infectious doses) of HIV
strain]. After 7 days of incubation, the supernatants were collected and
the HIV p24 levels of the infected cells were determined using a p24
antigen ELISA. To measure IC50 values, each drug was tested using
seven concentrations (5, 1, 0.2, 0.04, 0.008, 0.016, and 0 μg/mL). The
IC50’s were calculated by comparing p24 antigen values for the
compounds (fraction)-containing wells with those for no-drug control
wells. For the p24 assay, the maximum cutoff should be around 120−
150 pg/mL.
Chemical Synthesis of Patentiflorin A (1) and Its Glycoside
Congeners (15 and 16). A schematic illustration for the synthesis of
patentiflorin A (1) is summarized in Schemes 1 and 2. The same
synthesis approach was used to synthesize two patentiflorin A
congener diphyllin glycosides, 7β-D-xylosyloxydiphyllin (15) and 7β-
D-glucopyranosyloxydiphyllin (16), by replacing D-quinovose with D-
xylose and D-glucose in Scheme 2, respectively. All starting materials
and reagents are commercially available. Intermediates and final
products were purified by silica gel column chromatography and
analyzed via NMR and MS data. The aglycone diphyllin (10) is the
key intermediate to the synthesis of patentiflorin A and its congeners.
2-Bromo-4,5-dimethoxybenzaldehyde (3). 3,4-Dimethoxybenzal-
dehyde (veratral, 2a) (10.5 g, 63.3 mmol) was dissolved in dry,
degassed MeOH (250 mL) and stirred under argon. To this solution
was added Br2 (3.56 mL, 69.1 mmol), and the reaction mixture was
stirred for 6 h at rt. After the completion of the reaction, as indicated
by TLC, solvent was removed through evaporation and the resulting
mixture was partitioned between CH2Cl2 (250 mL) and a saturated
solution of Na2S2O3 (250 mL). The aqueous layer was extracted with
Benzo[1,3]dioxol-5-yl-(2-[1,3]dithian-2-yl-4, 5-dimethoxyphenyl)-
methanol (5). To a solution of the dithiane (4) (15.6 g, 46.6 mmol) in
dry THF (150 mL) was added n-BuLi (43.7 mL, 1.6 M solution in n-
hexane, 69.9 mmol) at −78 °C under argon, and the mixture was
stirred for 1 h. A solution of piperonal (2b, 8.39 g, 55.9 mmol) in dry
THF (30 mL) was added at −78 °C. The mixture was stirred for 2 h
and allowed to warm to rt over 3 h. The reaction was quenched with a
saturated solution of NH4Cl (100 mL), and the mixture was extracted
with Et2O (3 × 80 mL). The organic layer was washed with brine,
dried over anhydrous Na2SO4, and concentrated. The residue was
purified by silica gel chromatography, eluting with 20−40% EtOAc in
n-hexane, to afford the diphenyl alcohol 5 as a white foam (9.5 g,
1
50%): H NMR (CDCl3, 400 MHz) δ 7.12 (1H, s, H-3), 6.86 (1H,
brd, J = 7.6 Hz, H-6′), 6.85 (1H, s, H-6), 6.83 (1H, s, H-2′), 6.12 (1H,
brs, H-7′), 5.94 (2H, s, −OCH2O−), 5.39 (1H, s, H-7), 3.90 (3H, s,
OCH3), 3.78 (3H, s, OCH3), 2.96 (2H, brt, J = 12.8 Hz, H-S1a and H-
S3a), 2.80 (2H, brd, J = 13.6 Hz, H-S1b and H-S3b), 2.14 (1H, brd, J
= 14.4 Hz, H-S2a), 1.89 (1H, brq, J = 14.0 Hz, H-S2b); 13C NMR
(CDCl3, 100 MHz) δ 148.9 (C, C-3′), 148.8 (C, C-4′), 147.7 (C, C-
4), 146.8 (C, C-5), 137.2 (C, C-1′), 133.4 (C, C-2), 128.9 (C, C-1),
119.9 (CH, C-6′), 111.4 (CH, C-6), 110.9 (CH, C-3), 108.1 (CH, C-
5′), 107.4 (CH, C-2′), 101.1 (CH2, −OCH2O−), 72.0 (CH, C-7′),
56.1 (CH3, OCH3), 56.0 (CH3, OCH3), 47.9 (CH, C-7), 32.6 (CH2,
C-S1 or C-S3), 32.5 (CH2, C-S3 or C-S1), 25.1 (CH2, C-S2).
Benzo[1,3]dioxol-5-yl-(2-[1,3]dithian-2-yl-4,5-dimethoxyphenyl)-
methanone (6). The diphenyl alcohol 5 (8.4 g. 20.7 mmol) was
stirred with activated MnO2 (30.0 g, 345 mmol) in CH2Cl2 (200 mL)
at rt under nitrogen for 16 h. The solution was filtered through a plug
of Celite and washed with CHCl3 (300 mL). The filtrate was
subsequently evaporated to dryness to afford the diphenyl ketone 6 as
a white foam (8.2 g, 98%): 1H NMR (CDCl3, 400 MHz) δ 7.39 (1H,
brd, J = 1.2 Hz, H-2′), 7.35 (1H, brdd, J = 8.0, 1.6 Hz, H-6′), 7.31
(1H, s, H-3), 6.84 (1H, d, J = 8.0 Hz, H-5′), 6.80 (1H, s, H-6), 6.07
(2H, s, −OCH2O−), 5.45 (1H, s, H-7), 3.99 (3H, s, OCH3), 3.82
(3H, s, OCH3), 2.94 (2H, brtd, J = 12.4, 1.5 Hz, H-S1a and H-S3a),
2.82 (2H, brdt, J = 14.4, 3.6 Hz, H-S1b and H-S3b), 2.10 (1H, brdq, J
= 14.0, 1.6 Hz, H-S2a), 1.88 (1H, brqt, J = 12.4, 2.8 Hz, H−S2b); 13C
NMR (CDCl3, 100 MHz) δ 195.0 (C, C-7′), 152.2 (C, C-4′), 151..1
(C, C-5), 148.2 (C, C-3′), 147.8 (C, C-4), 132.7 (C, C-1), 131.7 (C,
C-1′), 129.9 (C, C-2), 127.6 (CH, C-2′), 112.1 (CH, C-6′), 111.9
G
DOI: 10.1021/acs.jnatprod.7b00004
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
Article
(CH, C-3), 109.6 (CH, C-6), 107.9 (CH, C-5′), 102.1 (CH2,
−OCH2O−), 56.3 (CH3, OCH3), 56.2 (CH3, OCH3), 47.7 (CH, C-
7), 32.4 (2C, CH2, C-S1 and C-S3), 25.1 (CH2, C-S2).
with 50% EtOAc in n-hexane, to yield diphyllin (10) as a yellowish
powder (106 mg, 82%).41
Tetra-O-acetyl-D-quinovose (12). To a solution of D-quinovose
(11, 100 mg, 0.61 mmol) in pyridine (5 mL) was added DMAP (7.5
mg, 0.06 mmol) and Ac2O (1.5 mL) at rt. The reaction mixture was
stirred overnight and quenched with MeOH (1 mL). Evaporation of
the solvent to dryness afforded the tetraacetate 12 as a white powder
(203 mg, 100%): 1H NMR (CDCl3, 400 MHz) δ 6.27 (1H, d, J = 4.0
Hz, H-1″), 5.43 (1H, t, J = 10.0 Hz, H-2″), 5.06 (1H, dd, J = 10.4, 3.6
Hz, H-3″), 4.86 (1H, t, J = 10.0 Hz, H-4″), 4.02 (1H, m, H-5″), 2.17
(3H, s, COCH3), 2.06 (3H, s, COCH3), 2.03 (3H, s, COCH3), 2.01
(3H, s, COCH3), 1.20 (3H, d, J = 6.0, 6″-CH3); 13C NMR (CDCl3,
100 MHz) δ 170.3 (C, COCH3), 169.8 (C, COCH3), 169.7 (C,
COCH3), 169.1 (C, COCH3), 91.7 (CH, C-1″), 73.3 (CH, C-5″),
69.9 (CH, C-3″), 69.6 (CH, C-4″), 67.9 (CH, C-2″), 21.0 (CH3,
COCH3), 20.8 (CH3, COCH3), 20.7 (CH3, COCH3), 20.5 (CH3,
COCH3), 17.4 (CH3, 6″-CH3).
9-Benzo[1,3]dioxol-5-yl-9-hydroxy-4-([1,3]-dithian-2-yl)-6,7-di-
methoxy-3a,4,9,9a-tetrahydro-3H-naphtho[2,3-c]furan-1-one (8).
n-Butyllithium (1.6 M solution in hexanes, 62.5 mL, 100 mmol) was
added dropwise over 5 min to a cooled (−78 °C) solution of
diisopropylamine (14.1 mL, 100 mmol) in THF (43 mL) under argon.
The solution was warmed to ambient temperature over 30 min to
afford lithium diisopropylamide (LDA). The freshly prepared solution
(25.7 mL) was added dropwise via syringe over 3 min to a cooled
(−78 °C) THF solution (60 mL) of the diphenyl ketone 6 (5.78 g,
14.3 mmol). After 40 min, 2(5H)-furanone (7) (1.44 g, 17.3 mmol) in
THF (10 mL) was added to the solution over 1 min. The reaction
mixture was warmed to rt for l h and quenched with H2O (2 mL). The
solvent was removed by evaporation under vacuum. The residue was
purified by silica gel chromatography by eluting with 10% MeOH in
CH2Cl2 to yield the lactone 8 (3.95 g, 57% yield) as a white powder:
1H NMR (CDCl3, 500 MHz) δ 7.58 (1H, s, H-3), 6.93 (1H, dd, J =
8.0, 1.5 Hz, H-6′), 6.87 (1H, d, J = 1.5 Hz, H-2′), 6.77 (1H, d, J = 8.0
Hz, H-5′), 6.40 (1H, s, H-6), 5.95 (2H, s, −OCH2O−), 4.41 (1H, brt,
J = 8.0 Hz, H-9a), 4.20 (1H, dd, J = 12.0, 9.0 Hz, H-9b), 3.96 (3H, s,
5-OCH3), 3.87 (1H, dt, J = 12.0, 7.5 Hz, H-8), 3.67 (3H, s, 4-OCH3),
3.40 (1H, d, J = 6.0 Hz, H-8′), 3.22 (1H, brtd, J = 12.5, 2.5 Hz, H-S1a
or H-S3a), 3.14 (1H, brtd, J = 12.5, 2.0 Hz, H-S3a or H-S1a), 2.90
(1H, brdt, J = 11.5, 3.0 Hz, H-S1b or H-S3b), 2.78 (1H, brdt, J = 11.5,
3.0 Hz, H-S3b or H-S1b), 2.34 (1H, brs, 7′-OH), 2.23 (1H, brd, J =
14.0 Hz, H-S2a), 2.01 (1H, brq, J = 13.0 Hz, H-S2b); 1H NMR
(DMSO-d6, 400 MHz) δ 7.44 (1H, s, H-3), 6.85 (1H, d, J = 8.0 Hz, H-
5′), 6.81 (1H, d, J = 1.2 Hz, H-2′), 6.75 (1H, dd, J = 8.0, 1.6 Hz, H-5′),
6.41 (1H, s, H-6), 6.04 (1H, brs, 7′-OH), 6.00 (2H, s, −OCH2O−),
4.30 (1H, m, H-8),4.02 (2H, m, H2-9), 3.78 (3H, s, 5-OCH3), 3.52
(3H, s, 4-OCH3), 3.43 (1H, brtd, J = 12.8, 2.0 Hz, H-S1a or H-S3a),
3.27 (1H, brt, J = 12.8 Hz, H-S3a or H-S1a), 3.09 (1H, brd, J = 6.0 Hz,
H-8′), 2.87 (1H, brd, J = 14.4 Hz, H-S1b or H-S3b), 2.72 (1H, brd, J =
14.8 Hz, H-S3b or H-S1b), 2.14 (1H, brd, J = 14.0 Hz, H-S2a), 1.76
(1H, brq, J = 13.2 Hz, H-S2b); 13C NMR (DMSO-d6, 100 MHz) δ
174.2 (C, C-9′), 148.8 (C, C-4′), 148.6 (C, C-3′), 146.7 (C, C-4),
145.7 (C, C-5), 143.6 (C, C-1′), 133.8 (C, C-2), 126.4 (C, C-1), 119.3
(CH, C-6′), 112.6 (CH, C-6), 109.5 (CH, C-3), 107.4 (CH, C-5′),
106.8 (CH, C-2′), 101.0 (CH2, −OCH2O−), 70.0 (C, C-7′), 68.3
(CH2, C-9), 55.5 (CH3, OCH3), 55.4 (CH3, OCH3), 51.0 (CH, C-8′),
49.0 (C, C-7), 41.1 (CH, C-8), 28.2 (CH2, C-S1 or C-S3), 26.2 (CH2,
C-S3 or C-S1), 23.7 (CH2, C-S2).
Tri-O-acetyl-D-quinovosyl Bromide (13). The tetraacetate 12 (203
mg) was dissolved in glacial HOAc (1 mL) to which 1.5 mL of 33%
HBr/HOAc was added slowly at rt with stirring. After stirring for 15
min, the solution was dissolved in CH2Cl2 (20 mL) and extracted with
H2O and 1 M aqueous NaHCO3. The CH2Cl2 layer was dried over
Na2SO4 and concentrated in vacuo to give the brominated quinovose
1
13 (215 mg, 99% yield from D-quinovose): H NMR (CDCl3, 400
MHz) δ 6.58 (1H, d, J = 4.0 Hz, H-1″), 5.52 (1H, t, J = 9.6 Hz, H-2″),
4.89 (1H, t, J = 9.6 Hz, H-4″), 4.80 (1H, dd, J = 10.0, 4.0 Hz, H-3″),
4.19 (1H, m, H-5″), 2.10 (3H, s, COCH3), 2.07 (3H, s, COCH3), 2.03
(3H, s, COCH3), 1.26 (3H, d, J = 6.4, 6″-CH3).
Tri-O-acetylpatentiflorin A (14). To a solution of diphyllin (10)
(360 mg, 0.95 mmol) and tetrabutylammonium bromide (TBAB)
(306 mg, 0.95 mmol) in CHCl3 (15 mL) was added 20 mL of aqueous
0.1 M NaOH. After stirring for 10 min at 40 °C, the quinovosyl
bromide (13) (215 mg, 0.61 mmol) was added. After the two-phase
reaction mixture was stirred for 6 h at 40 °C, CHCl3 (20 mL) was
added. The organic phase was washed with H2O, dried over Na2SO4,
and evaporated under reduced pressure. The residue was purified by
flash silica gel chromatography, eluting with EtOAc/petroleum ether
(1:1), to afford 14 as a white powder (247 mg, 62%): 1H NMR
(CDCl3, 400 MHz) δ 7.543/7.539 (1H, s, H-6), 7.08 (1H, s, H-3),
6.96 (1H, d, J = 8.0, H-5′), 6.82 (1H, overlap, H-6′), 6.79 (1H,
overlap, H-2′), 6.10/6.05 (2H, s, −OCH2O−), 5.48 (1H, d, J = 8.0 Hz,
H-1″), 5.46 (1H, d, J = 14.0, H-9a), 5.43/5.42 (1H, d, J = 14.4, H-9b),
5.28 (1H, t, J = 9.6 Hz, H-2″), 5.13 (1H, dd, J = 8.0, 0.8 Hz, H-3″),
5.00 (1H, t, J = 9.6 Hz, H-4″), 4.07 (3H, s, 5-OCH3), 3.81 (3H, s, 4-
OCH3), 3.70 (1H, m, H-5″), 2.12 (3H, s, COCH3), 2.07 (3H, s,
COCH3), 2.06 (3H, s, COCH3), 1.27 (3H, d, J = 6.8, 6″-CH3).
Patentiflorin A (1).23 To a MeOH solution (10 mL) of compound
14 (247 mg) was added K2CO3 (138 mg, 1.0 mmol). After stirring for
60 min at rt, the reaction solution was neutralized with 1 M HCl and
concentrated under reduced pressure to afford a solid residue, which
was dissolved in CHCl3 (10 mL). The resulting CHCl3 was washed
with H2O and dried over Na2SO4. After evaporation of the solvent, the
residue was purified by silica gel flash chromatography, eluting with 5%
MeOH in CH2Cl2, to afford patentiflorin A (1) as a yellowish powder
9-Benzo[1,3]dioxol-5-yl-9-hydroxy-6,7-dimethoxy-3,3a,9,9a-
tetrahydronaphtho[2,3-c]furan-1,4-dione (9). A solution of the
lactone 8 (315 mg, 0.65 mmol), HgO (153 mg, 0.71 mmol), and
HgCl2 (388 mg, 1.43 mmol) in aqueous MeCN (85%, 30 mL) was
refluxed for 3 h. The reaction solution was then partitioned between
CHCl3 and saturated (NH4)2CO3. The organic layer was washed with
brine, dried over MgSO4, and concentrated, followed by silica gel
column chromatography, eluting with 10% MeOH in CH2Cl2, to yield
the benzofuranone 9 as a yellowish powder (134 mg, 52%): 1H NMR
(CDCl3, 400 MHz) δ 7.46 (1H, s, H-6), 7.23 (1H, s, H-3), 6.80 (1H,
d, J = 1.9 Hz, H-2′), 6.62 (1H, d, J = 8.2 Hz, H-5′), 6.38 (1H, dd, J =
8.2, 2.0 Hz, H-6′), 5.91 (2H, s, −OCH2O−), 5.72 (1H, brs, 7′-OH),
4.70 (1H, d, J = 9.2 Hz, H-9a), 4.27 (1H, dd, J = 9.2, 5.8 Hz, H-9b),
3.94 (3H, s, OCH3), 3.92 (3H, s, OCH3), 3.42 (1H, d, J = 7.4 Hz, H-
8′), 3.06 (1H, dd, J = 7.4, 5.6 Hz, H-8); 13C NMR (CDCl3, 100 MHz)
δ 192.9 (C, C-7), 176.8 (C, C-9′), 155.7 (C, C-4), 149.5 (C, C-5),
148.1 (C, C-4′), 147.5 (C, C-3′), 141.9 (C, C-1′), 138.3 (C, C-1),
125.4 (C, C-2), 120.0 (CH, C-6′), 108.7 (CH, C-3), 108.0 (CH, C-6),
107.8 (CH, C-5′), 106.8 (CH, C-2′), 101.3 (CH2, −OCH2O−), 72.8
(C, C-7′), 70.7 (CH2, C-9), 56.4 (CH3, OCH3), 56.1 (CH3, OCH3),
50.3 (CH, C-8′), 46.0 (CH, C-8).
(122 mg, 38% yield from 10): [α]2D0 −53.2 (c 0.7, MeOH); H NMR
1
(methanol-d4, 360 MHz) δ 8.049/8.039 (1H, s, H-6), 6.968/6.945
(1H, s, H-3), 6.89 (1H, d, J = 8.1 Hz, H-5′), 6.725/6.648 (1H, d, J =
2.6 Hz, H-2′), 6.677/6.655 (1H, dd, J = 8.0, 1.7, H-6′), 6.027/6.016
(2H, m, −OCH2O−), 5.536/5.533 (1H, d, J = 15.2, H-9a), 5.409/
5.404 (1H, d, J = 15.2, H-9b), 4.761/4.759 (1H, d, J = 7.8 Hz, H-1″),
3.972/3.968 (3H, s, 5-OCH3), 3.668/6.662 (3H, s, 4-OCH3), 3.640/
3.636 (1H, dd, J = 9.3, 8.0 Hz, H-2″), 3.409 (1H, t, J = 9.2 Hz, H-3″),
3.270 (1H, m, H-5″), 3.137 (1H, t, J = 9.2 Hz, H-4″), 1.303/1.301
(3H, d, J = 6.1, 6″-CH3); 13C NMR (methanol-d4, 90 MHz) δ 172.14
(C, C-9′), 153.25/153.22 (C, C-5), 151.63/151.60 (C, C-4), 148.94
(C, C-4′), 148.94 (C, C-3′), 146.34 (C, C-7), 137.48 (C, C-7′), 132.20
(C, C-8), 131.79 (C, C-2), 129.89/129.86 (C, C-1′), 128.84 (C, C-1),
124.76/124.71 (CH, C-6), 119.89/119.83 (C, C-8′), 111.78/111.76
(C, C-2′), 108.94/108.89 (CH, C-5′), 106.83 (CH, C-3), 106.66 (CH,
C-1″), 102.68/102.60 (CH2, −OCH2O−), 77.81 (CH, C-3″), 76.70
Diphyllin (10). The benzofuranone 9 (134 mg, 0.34 mmol) and p-
toluenesulfonic acid (37 mg, 0.22 mmol) were refluxed in benzene (15
mL) for 16 h. The solvent was removed by evaporation under vacuum.
The residue was purified by silica gel column chromatography, eluting
H
DOI: 10.1021/acs.jnatprod.7b00004
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
Article
(CH, C-4″), 75.70 (CH, C-2″), 73.64 (CH, C-5″), 69.10 (CH2, C-9),
56.69 (CH3, 5-OCH3), 55.98 (CH3, 4-OCH3), 18.20 (CH3, C-6″);
positive ESIMS m/z 527.02 [M + H]+ (calcd for C27H27O11, 527.16).
7β-D-Xylosyloxydiphyllin (15, diphyllinin):26 yellowish powder (9.6
mg); 1H NMR (CDCl3, 400 MHz) δ 7.86 (1H, s, H-6), 7.06 (1H, brs,
H-5′), 6.93 (1H, s, H-3), 6.73−6.85 (2H, m, H-2′ and H-6′), 6.070/
6.024 (2H, m, −OCH2O−), 5.44 (1H, brd, J = 15.8, H-9a), 5.42 (1H,
d, J = 15.7, H-9b), 4.81 (1H, brs, H-1″), 4.02 (3H, s, 5-OCH3), 3.83
(1H, m, H-5″a), 3.78 (3H, s, 4-OCH3), 3.52−3.65 (2H, m, H-2″ and
H-4″), 3.14−3.25 (2H, m, H-3″ and H-5″); positive HRESIMS m/z
513.1386 [M + H]+ (calcd for C26H25O11, 513.1397).
Medical Center, Chicago, Illinois, USA, for conducting the anti-
HIV assays against the wild-type and resistant isolates in the
PBMCs.
REFERENCES
■
(1) CDC (Centers for Disease Control and Prevention, USA).
Morbidity and Mortality Weekly Report (MMWR) 1981, 30, 250.
(2) Barre-
́
Sinoussi, F.; Chermann, J. C.; Rey, F.; Nugeyre, M. T.;
Chamaret, S.; Gruest, J.; Dauguet, C.; Axler-Blin, C.; Vez
́
inet-Brun, F.;
Rouzioux, C.; Rozenbaum, L.; Montagnier, W. Science 1983, 220,
868−871.
(3) UNAIDS. Fact Sheet 2016; http://www.unaids.org/en/
resources/campaigns/HowAIDSchangedeverything/factsheet (ac-
cessed March 31, 2017).
7β-D-Glucopyranosyloxydiphyllin (16, cleristanthin B):27 yellowish
1
powder (11.2 mg); H NMR (methanol-d4, 400 MHz) δ 8.16 (1H, s,
H-6), 7.05 (1H, brs, H-5′), 6.95 (1H, s, H-3), 6.68−6.88 (2H, m, H-2′
and H-6′), 6.03 (2H, s, −OCH2O−), 5.77 (1H, brd, J = 15.4, H-9a),
5.47 (1H, d, J = 15.4, H-9b), 4.83 (1H, brs, H-1″), 4.01 (3H, s, 5-
OCH3), 3.90 (1H, m, H-6″a), 3.72 (3H, s, 4-OCH3), 3.58−3.70 (2H,
m, H-2″ and H-6″b), 3.36−3.53 (2H, m, H-3″and H-5″), 3.26 (1H, m,
H-5″); positive HRESIMS m/z 543.1503 [M + H]+ (calcd for
C27H27O12, 513.1397).
(4) WHO (World Health Organization). Global Health Observatory
(GHO) data - HIV/AIDS; http://www.who.int/gho/hiv/en/ (ac-
cessed December 28, 2016).
(5) UNAIDS. Global Aids Update 2016; http://www.unaids.org/
sites/default/files/media_asset/global-AIDS-update-2016_en.pdf (ac-
cessed March 31, 2017).
(6) WHO (World Health Organization). Global Health Observatory
(GHO) data - the top 10 causes of death; http://www.who.int/
mediacentre/factsheets/fs310/en/ (accessed March 31, 2017).
(7) FDA (U.S. Food and Drug Administration). Drugs used in the
treatment of HIV infection; http://www.fda.gov/forpatients/illness/
hivaids/ucm118915.htm (accessed March 31, 2017).
ASSOCIATED CONTENT
* Supporting Information
■
S
The Supporting Information is available free of charge on the
ACS Publications website at DOI: 10.1021/acs.jnat-
prod.7b00004.
1H and 13C NMR data of 1, “one-stone-two-birds” anti-
HIV evaluation system, 1D and 2D NMR, IR, and MS
spectra of 1, and NMR and MS spectra of the synthetic
compounds (3−6, 8−10, and 13−16) (PDF)
(8) Thayer, A. M. Chem. Eng. News 2008, 86, 29−36.
(9) WHO (World Health Organization). WHO HIV drug resistance
report 2012; http://apps.who.int/iris/bitstream/10665/75183/1/
9789241503938_eng.pdf (accessed March 31, 2017).
(10) Cos, P.; Maes, L.; Berghe, D. V.; Hermans, N.; Pieters, L.;
Vlietinck, A. J. Nat. Prod. 2004, 67, 284−293.
AUTHOR INFORMATION
Corresponding Authors
*Tel: +852-34112956. Fax: +852-34112461. E-mail: zhanghj@
hkbu.edu.hk (H.-J. Zhang).
■
(11) Newman, D. J.; Cragg, G. M. J. Nat. Prod. 2016, 79, 629−661.
(12) Kashiwada, Y.; Hashimoto, F.; Cosentino, L. M.; Chen, C. H.;
Garrett, P. E.; Lee, K. H. J. Med. Chem. 1996, 39, 1016−1017.
(13) Smith, P. F.; Ogundele, A.; Forrest, A.; Wilton, J.; Salzwedel, K.;
Doto, J.; Allaway, G. P.; Martin, D. E. Antimicrob. Agents Chemother.
2007, 51, 3574−3581.
*Tel: 312-3550203. E-mail: lijun@uic.edu (L. Rong).
ORCID
Hong-Jie Zhang: 0000-0002-7175-5166
(14) Kashman, Y.; Gustafson, K. R.; Fuller, R. W.; Cardellinall, J. H.;
McMahon, J. B.; Currens, M. J.; BuckheitJr, R. W.; Hughes, S. H.;
Cragg, G. M.; Boyd, M. R. J. Med. Chem. 1992, 35, 2735−2743.
(15) Ma, T.; Liu, L.; Xue, H.; Li, L.; Han, C. Y.; Wang, L.; Chen, Z.
W.; Liu, G. J. Med. Chem. 2008, 51, 1432−1446.
(16) Zechmeister, K.; Brandl, F.; Hoppe, W.; Hecker, E.; Opferkuch,
H. J.; Adolf, W. Tetrahedron Lett. 1970, 11, 4075−4078.
(17) Fujiwara, M.; Ijichi, K.; Tokuhisa, K.; Katsuura, K.; Shigeta, S.;
Konno, K.; Wang, G. Y.; Uemura, D.; Yokota, T.; Baba, M.
Antimicrobial Agents Chemother. 1996, 40, 271−273.
Present Address
¶Northeastern Illinois University, 5500 N. St. Louis Avenue,
Chicago, Illinois 60625, United States.
Author Contributions
#H.-J. Zhang and E. Rumschlag-Booms contributed equally to
this work.
Notes
(18) Fujiwara, M.; Ijichi, K.; Tokuhisa, K.; Katsuura, K.; Wang, G. Y.
S.; Uemura, D.; Shigeta, S.; Konno, K.; Yokota, T.; Baba, M. Antiviral
Chem. Chemother. 1996, 7, 230−236.
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
(19) Soejarto, D. D.; Zhang, H. J.; Fong, H. H. S.; Tan, G. T.; Ma, C.
M.; Gyllenhaal, C.; Riley, M. C.; Kadushin, M. R.; Franzblau, S. G.;
Bich, T. Q.; Cuong, N. M.; Hiep, N. T.; Loc, P. K.; Xuan, L. T.; Hai,
N. V.; Hung, N. V.; Chien, N. Q.; Vu, B. M.; Ly, H. M.; Southavong,
B.; Sydara, K.; Bouamanivong, S.; Pezzuto, J. M.; Rose, W.; Dietzman,
G.; Miller, B.; Thuy, T. V. J. Nat. Prod. 2006, 69, 473−481.
(20) Rumschlag-Booms, E.; Zhang, H. J.; Soejarto, D. D.; Fong, H.
H. S.; Rong, L. J. J. Antivirals Antiretrovirals 2011, 3, 8−10.
(21) Jiangsu College of New Medicine. Dictionary of Chinese
Traditional Medicine; Shanghai Science and Technology Press:
Shanghai, 1986; Item 2471.
(22) Kavitha, K.; Sridevisangeetha, K. S.; Sujatha, K.; Umamaheswari.
J. Pharm. Res. 2014, 8, 990−997.
(23) Susplugas, S.; Hung, N. V.; Bignon, J.; Thoison, O.; Kruczynski,
́ ́
A.; Sevenet, T.; Gueritte, F. J. Nat. Prod. 2005, 68, 734−738.
(24) Yang, M. H.; Wu, J.; Fan, C.; Zhou, Y. Magn. Reson. Chem. 2006,
44, 727−730.
This project was supported by the Research Grants Council of
the Hong Kong Special Administrative Region, China (Project
No. HKBU 262912), the Health and Medical Research Fund
(12132161) of the Food and Health Bureau, Hong Kong SAR,
the Hong Kong Baptist University (HKBU) Interdisciplinary
Research Matching Scheme (RC-IRMS/15-16/02), Faculty
Research Grants, Hong Kong Baptist University (FRG2/11-
12/134 and FRG2/14-15/047), NIH Grants 3U01TW001015-
10S1 and 2U01TW001015-11A1, administered by the Fogarty
International Center as part of an International Cooperative
Biodiversity Groups (ICBG) program, through funds from
NIH, NSF, and Foreign Agricultural Service of the USDA, and
Mr. Kwok Yat Wai and Madam Kwok Chung Bo Fun Graduate
School Development Fund. The authors are grateful to the
Molecular Infectious Disease Core facility at Rush University
I
DOI: 10.1021/acs.jnatprod.7b00004
J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products
Article
(25) Liu, G. R.; Wu, J.; Si, J. Y.; Wang, J. M.; Yang, M. H. Magn.
Reson. Chem. 2008, 46, 283−286.
(26) Gonzalez, A. G.; Moreno, R. O.; Rodrigues, F. L. Anales de
Quimica (1968−1979) 1974, 70, 234−238.
(27) Lakshmi, T. G.; Scrimannaryana, G.; Rao, N. V. Curr. Sci. 1970,
39, 395−396.
(28) Japour, A. J.; Mayers, D. L.; Johnson, V. A.; Kuritzkes, D. R.;
Beckett, L. A.; Arduino, J. M.; Lane, J.; Black, R. J.; Reichelderfer, P. S.;
D’Aquila, R. T. Antimicrob. Agents Chemother. 1993, 37, 1095−1101.
(29) Fujihashi, T.; Hara, H.; Sakata, T.; Mori, K.; Higuchi, H.;
Tanaka, A.; Kaji, H.; Kaji, A. Antimicrob. Agents Chemother. 1995, 39,
2000−2007.
(30) Richman, D.; Shih, C. K.; Lowy, I.; Rose, J.; Prodanovich, S. G.;
Griffin, J. Proc. Natl. Acad. Sci. U. S. A. 1991, 88, 11241−11245.
(31) Greene, W. C. Annu. Rev. Immunol. 1990, 8, 453−475.
(32) Knipe, D. M.; Howley, P. M. Fields Virology, 5th ed.; Wolters
Kluwer Health/Lippincott Williams & Wilkins: Philadelphia, 2007.
(33) Zhang, Y. L.; Bao, F. K.; Hu, J. J.; Liang, S. W.; Zhang, Y.; Du,
G. H.; Zhang, C. J.; Cheng, Y. X. Planta Med. 2007, 73, 1596−1599.
(34) Lee, J. C.; Lee, C. H.; Su, C. L.; Huang, C. W.; Liu, H. S.; Lin, C.
N.; Won, S. J. Carcinogenesis 2005, 26, 1716−1730.
(35) Tuchinda, P.; Kornsakulkarn, J.; Pohmakotr, M.; Kongsaeree, P.;
Prabpai, S.; Yoosook, C.; Kasisit, C.; Sophasan, S.; Reutrakul, V. J. Nat.
Prod. 2008, 71, 655−663.
(36) Chang, C. W.; Lin, M. T.; Lee, S. S.; Liu, K. C.; Hsu, F. L.; Lin,
J. Y. Antiviral Res. 1995, 27, 367−374.
(37) Ren, Y. L.; Lantvit, D. D.; Deng, Y.; Kanaqasabai, R.; Gallucci, J.
C.; Ninh, T. N.; Chai, H. B.; Soejarto, D. D.; Fuchs, J. R.; Yalowich, J.
C.; Yu, J.; Swanson, S. M.; Kinghorn, A. D. J. Nat. Prod. 2014, 77,
1494−1504.
(38) Connor, R. I.; Chen, B. K.; Choe, S.; Landau, N. R. Virology
1995, 206, 935−944.
(39) He, J.; Choe, S.; Walker, R.; Di Marzio, P.; Morgan, D. O.;
Landau, N. R. J. Virol. 1995, 69, 6705−6711.
(40) Michael, N. L.; Nelson, J. A.; KewalRamani, V. N.; Chang, G.;
O’Brien, S. J.; Mascola, J. R.; Volsky, B.; Loulder, M.; White, G. C. J.
Virol. 1998, 72, 6040−6047.
(41) Innocenti, G.; Puricelli, L.; Piacente, S.; Caniato, R.; Filippini,
R.; Cappelletti, E. M. Chem. Pharm. Bull. 2002, 50, 844−846.
J
DOI: 10.1021/acs.jnatprod.7b00004
J. Nat. Prod. XXXX, XXX, XXX−XXX