Full text of DOI:10.1093/molehr/6.5.465

Molecular Human Reproduction vol.6 no.5 pp. 465–468, 2000
The DAZL1 gene is expressed in human male and female
embryonic gonads before meiosis
Vera Brekhman1, Josef Itskovitz-Eldor1, Elena Yodko2, Michael Deutsch1 and Judith Seligman1,3
2
1Developmental Biology Laboratory, Dept. OB/GYN, Rambam Medical Center, POB 9602 Haifa 31096, and Department of
Pathology, Rambam Medical Center and The Rappaport Faculty of Medicine, Technion – Israel Institute of Technology,
Israel
3To whom correspondence should be addressed
The human DAZL1 gene (known also as DAZH or DAZLA) is the autosomal homologue of the Y-chromosomal
DAZ gene which has been found to be deleted in azoospermic males. Evidence suggests that the role of
DAZL1 may not be restricted to spermatogenesis, but may include oogenesis as well. In order to study the
function of human DAZL1 gene in the ovary, we observed its expression pattern during embryonic development.
RNA in-situ hybridization showed that DAZL1 transcripts were localized to a subset of cells (somatic versus
germ cells) in human embryonic ovary (23 weeks of gestation) and testis (21 weeks gestation). In the ovary,
DAZL1 transcripts were found in oogonia and in oocytes and granulosa cells of primordial follicles. In the
testis, DAZL1 transcripts were identified exclusively in the germ cells. Our results demonstrate high similarity
between the human DAZL1 and the mouse Dazl1 gene expression patterns during embryonic development,
suggesting that the human gene functions at the first phase of gametogenesis, just as in the mouse, where
Dazl1 mutations cause male and female sterility.
Key words: DAZL1/embryonic gonad/meiosis/oogenesis/spermatogenesis
Introduction
mouse Dazl1 has only one copy of this motif (Saxena et al.,
1996; Seboun et al., 1997).
The DAZ (deleted in azoospermia) gene on the long arm of
the Y chromosome (Reijo et al., 1995) may be the most
thoroughly studied pure male sterile locus in humans. Although
no human DAZ point mutants have been reported, strong
evidence suggests that this gene is involved in early spermato-
genesis. Firstly, Drosophila and mouse mutants that have lost
DAZ homologous gene function (boule and Dazl1 respectively)
were found to be azoospermic, just as with human azoospermia
(Eberhart et al., 1996; Ruggiu et al., 1997). Secondly, DAZ
homologous genes were found in many vertebrates (Reijo
et al., 1995, 1996; Cooke et al., 1996; Saxena et al., 1996;
Shan et al., 1996; Yen et al., 1996; Houston et al., 1998) in
which they appear to be expressed in the testis, exclusively in
spermatogonia (Menke et al., 1996; Niederberger et al., 1997).
From the evolutionary point of view, the Y chromosomal
DAZ gene arose from the DAZL1 gene on chromosome 3 via
a series of structural transformations (Saxena et al., 1996). A
recent study of DAZ and DAZL1 sequences suggested that the
Y-linked DAZ plays either a limited or little role in human
spermatogenesis (Agulnik et al., 1998). These studies imply
that the DAZL1 gene is the main functional locus. Indeed, the
human DAZL1 and mouse Dazl1 autosomal genes show higher
similarity in nucleotide sequences compared with the two
human genes (DAZ/DAZL1). Within the 82 residue RNA-
binding domain, the products of human DAZL1 and mouse
Dazl1 differ by only one amino acid substitution, while both
differ from human Y-encoded DAZ at nine residues. In addition,
DAZ has a variable number of copies of a 72 nucleotide repeat
unit termed ‘DAZ repeat’, whereas the human DAZL1 and the
The DAZ gene expresses only in the testis, whereas the
human DAZL1 and the mouse Dazl1 express in testes and
ovaries (Cooke et al., 1996; Saxena et al., 1996; Seligman
and Page, 1998). We previously showed that Dazl1 expresses
during mouse embryonic developing male and female gonads
well before the onset of meiosis, suggesting that Dazl1
functions at the first phase of gametogenesis at the differenti-
ation, proliferation and/or maintenance of primordial germ
cells and their substitutes (Seligman and Page, 1998). Our
expression results are supported by recent evidence showing
that the mouse Dazl1 is essential for the differentiation of
male and female germ cells. As expected, disruption of the
Dazl1 gene leads to loss of germ cells and complete absence
of male and female gamete production (Ruggiu et al., 1997).
The DAZL1 protein was found in the cytoplasm of follicular
human oocytes (Nishi et al., 1999). However, little is known
about the embryonic expression, transcription units and cellular
mechanisms of the human DAZL1 gene. Here, we wanted to
examine the localization of DAZL1 transcripts during gonad
embryonic development and compare the human and the mouse
gene expression. We have localized DAZL1 transcription units
in human gonads (testes and ovaries) from embryos at 15–25
weeks gestation by RNA in-situ hybridization. We observed
high similarity between the human DAZL1 and mouse Dazl1
gene expression during early embryonic development; they
both express in early developing male and female germ
cells (prospermatogonia and oogonia respectively). Our results
suggest that the human and the mouse genes exhibit similar,
© European Society of Human Reproduction and Embryology
465

V.Brekhman et al.
Figure 1. Analysis of human DAZL1 (A) and mouse Dazl1 (B) expression in embryonic testis, ovary, kidney, liver and lung by reverse
transcription–polymerase chain reaction (RT–PCR). RNA samples were isolated from human fetuses at ~23 weeks gestation and from
C57BL/6J mouse at 14.5 days post-coitum. A 335 bp fragment represents the human DAZL1 and mouse Dazl1. The gene encoding β-actin
was used as a reference reaction.
the probes with SP6 and T7 digoxygenin-RNA labelling kit (Roche
Molecular Biochemicals) for antisense and sense probe respectively.
Hybridization to gonad sections was performed according to a well-
established method (Komminoth et al., 1992). Slides were reacted
with anti-digoxygenin antibodies and developed with NBT/BCIP
reagents following Fast red staining.
if not identical, function at the first phase of male and female
gametogenesis.
Materials and methods
Embryo tissue dissections
Human gonads were obtained from aborted fetuses after the patients
had signed a concession agreement. The human embryonic gonad
work was approved by the Institutional Ethics Committee. Gonads
from embryos at 15–25 weeks gestation were isolated and fixed
immediately in 4% formalin to prepare paraffin-embedded cross-
sections or frozen in liquid nitrogen for RNA extraction. Mouse
embryonic gonads were obtained from C57BL/6J mating mice. For
all mouse embryo dissections the appearance of the vaginal plug was
calculated as 0.5 days post-coitum.
Results
To compare the human DAZL1 and mouse Dazl1 expression
pattern during development, RNA samples were extracted
from various human embryonic tissues from ~week 23 of
gestation and from mouse embryonic tissues of 14.5 days post-
coitum. These RNA samples were used to amplify a 335 bp
fragment of human DAZL1 and mouse Dazl1 by RT–PCR. As
shown in Figure 1, the human DAZL1 and the mouse Dazl1
are both expressed in the human embryonic testis and ovaries.
No amplification was found in the embryonic kidney, liver
and lung (see Figure 1).
To characterize more precisely the expression of DAZL1
by specific germ cell types, we performed direct in-situ
hybridization on sections of human embryonic ovaries and
testes. We used the 335 bp PCR product from DAZL1 cDNA
as a probe. This fragment was amplified by PCR using a forward
primer F1 containing SP6 polymerase promoter sequence (for
antisense probe) and a reverse primer R1 containing T7
polymerase promoter (for sense probe). Digoxygenin-labelled
DAZL1 probes (sense and antisense) were allowed to hybridize
within sections of normal embryonic ovary isolated from a
fetus at 23 weeks gestation (Figure 2) and a testis from a fetus
at 21 weeks gestation (Figure 3). As shown in Figure 2A,C,
DAZL1 transcripts were detected in oogonia and in oocytes
and granulosa cells of primordial follicles by DAZL1 antisense
probe. In some of the oocytes, DAZL1 was abundant in the
nucleus and in others DAZL1 was predominantly present in
the cytoplasm or in both nucleus and the cytoplasm. As shown
in Figure 2B,D, no reaction was observed in oogonia and
RNA extraction and reverse transcription–polymerase chain
reaction (RT–PCR)
RNA samples were extracted from various human and mouse embry-
onic tissues using Trizol reagent (Gibco BRL, Grand Island, NY,
USA) according to the manufacturer’s instruction. Briefly, gonads
were suspended in 1 ml Trizol, and 0.2 volumes of chloroform were
added to each sample. After centrifugation to remove cell debris,
RNA in the supernatant was precipitated with isopropanol, rinsed
with ethanol, and resuspended in deionized water. These RNA samples
were used to amplify the 335 bp fragment of human DAZL1 and
mouse Dazl1 by RT–PCR (cDNA cycle kit; Invitrogen) by using a
forward primer F1: 3Ј AGCCACGTCCTTTGATTTT 5Ј and a reverse
primer R1: 3Ј TAAGCACTGCCCGACTTCTT 5Ј. The gene encoding
β-actin was used as a reference reaction using a forward primer: 3Ј
CGACGAGGCCCAGAGCAAGAGAGG 5Ј and a reverse primer: 3Ј
CGTCAGGCAGCTCATAGCTCTTCTCCAGGG 5Ј.
In-situ hybridization
To identify human DAZL1 and mouse Dazl1 we used a 335 bp
fragment from the mouse Dazl1 cDNA including Dazl1 repeat region.
This 335 bp fragment was amplified by PCR using a forward primer
F1 containing SP6 promoter sequence at its 3Ј end and a reverse
primer R1 containing T7 promoter sequence at its 3Ј end. We labelled
466

Human DAZL1 embryonic expression
Figure 2. Localization of DAZL1 transcripts in embryonic ovary. Digoxygenin-labelled sense and antisense DAZL1 probes were allowed to
hybridize with cross-sections of an ovary from a fetus at 23 weeks gestation. (A,C) Hybridization with antisense probe; (B,D) hybridization
with sense probe (control); (A,B) low power magnification (ϫ400); (C,D) high power magnification (ϫ1000). Arrow ϭ primordial follicle;
arrowhead ϭ oogonia.
dramatic sexual dimorphism: oogonia enter meiotic prophase,
while prospermatogonia continue to divide mitotically
(McCarrey, 1993). In the ovarian sections at 15–25 weeks
gestation, some oogonia have not entered meiosis, some
oogonia have started meiosis and primordial follicles (arrested
in meiotic prophase I). Prospermatogonia are present at this
time in the testis, most of them are quiescent in mitosis. Here,
we show that DAZL1 transcripts are localized in germ cells
before meiosis and at the time meiosis commences. We could
not study earlier stages of gonad development because of the
difficulty in obtaining these tissues from humans. However, it
is most likely that the human DAZL1 gene is expressed earlier
during development before germ cell sexual differentiation,
such as in the mouse in primordial germ cells (Seligman and
Page, 1998).
Figure 3. Expression of DAZL1 in embryonic testis. Digoxygenin-
labelled sense and antisense DAZL1 probes were allowed to
hybridize with cross-sections of a testis from a fetus at 21 weeks
gestation. (A) Hybridization with antisense probe; (B) hybridization
with sense probe (control). Arrow ϭ germ cell; arrowhead ϭ
Sertoli cell.
Numerous genes are known to be expressed exclusively in
male or female germ cells, mainly in meiotic or post-meiotic
cells, but not in these earliest stages of gametogenesis (Hecht,
1993). The expression of human DAZL1 gene in both male
and female germ cells so early during embryonic development
is unusual. In the mouse, few genes are known to be expressed
exclusively in male and female germ cells early during
gametogenesis, but no human homologous genes were studied.
The mouse germ cell nuclear antigen (GCNA1) expresses in
primordial germ cells, and later in oogonia and prospermato-
gonia, such as the DAZL1 gene, but no DNA sequences of
this antigen are available (Enders and May, 1994). The TIAR
gene, which is also an RNA-binding protein such as DAZL1,
was found to be expressed in primordial germ cells (Beck
et al., 1998). Male and female mutant mice for TIAR are
sterile, similar to Dazl1 mutant mice. However, it seems that
TIAR does not function exclusively in gonads since mice
follicles by hybridization with the sense probe (control reac-
tion). In the testis, transcripts were identified exclusively in
germ cells (Figure 3A). As shown in Figure 3B, no staining
was observed in germ cells by hybridization with the sense
probe (control reaction).
Discussion
Once the germ cells initiate sexual differentiation at ~7 weeks
gestation in the human (13.5 days post-coitum in the mouse),
the subsequent kinetics of germ cell development show a
467

V.Brekhman et al.
Menke, D.B., Mutter, G.L. and Page, D.C. (1996) Expression of DAZ, an
azoospermia factor candidate, in human spermatogonia. Am. J. Hum. Genet.,
60, 237–241.
mutant for this gene also exhibit other abnormalities such as
growth deficit and high mortality (Beck et al., 1998).
The DAZL1 transcripts in the ovary are not restricted to
germ cells, but include the somatic cells of the primordial
follicle (granulosa cells). A similar expression of the mouse
Dazl1 protein in the ovary has been shown previously by
using antibodies (Ruggiu et al., 1997). The granulosa cells are
in tight connection with the oocyte throughout gap junctions
which allow the passage of proteins and RNA samples between
the oocyte and granulosa cells. That is why it is not surprising
that DAZL1 is also localized in granulosa cells. There is not
much information about DAZL1 transcription units in the
ovary. It is possible that different transcripts are present in
ovarian germ cells and in the granulosa cells. We have
previously identified in the human ovary a major 4.5 kb DAZL1
transcript, while in the testis a 3.5 kDa transcript is the most
abundant transcript. Only very low levels of the 4.5 kb
transcript were identified in the testis (Seligman and Page,
1998). The biological significance and function of the 3.5 and
4.5 kb transcription units remain to be studied.
Niederberger, C., Agulnik, A.I., Cho, Y. et al. (1997) In situ hybridization
shows that Dazla expression in mouse testis is restricted to premeiotic
stages IV–VI of spermatogenesis. Mamm. Genome, 8, 277–278.
Nishi, S., Hoshi, N., Kasahara, M. et al. (1999) Existence of human DAZLA
protein in the cytoplasm of human oocytes. Mol. Hum. Reprod., 5, 495–497.
Reijo, R., Lee, T.Y., Salo, P. et al. (1995) Diverse spermatogenic defects in
humans caused by the Y chromosome deletions encompassing a novel
RNA-binding protein gene. Nature Genet., 10, 383–393.
Reijo, R., Seligman, J., Dinulos, M.B. et al. (1996) Mouse autosomal homolog
of DAZ, a candidate male sterility gene in humans, is expressed in male
germ cells before and after puberty. Genomics, 35, 346–352.
Ruggiu, M., Speed, R., Taggart, M. et al. (1997) The mouse Dazla gene
encodes a cytoplasmic protein essential for gametogenesis. Nature, 389,
73–77.
Saxena, R., Brown, L.G., Hawkins,T. et al. (1996) Origins of the DAZ gene
cluster on the human Y chromosome: an autosomal gene was transposed,
then repeatedly amplified and pruned. Nature Genet., 14, 292–299.
Seboun, E., Barbaux, S., Bourgeron, T. et al. (1997) Gene sequence,
localization, and evolutionary conservation of DAZLA, a candidate male
sterility gene. Genomics, 41, 227–235.
Seligman, J. and Page, D.C. (1998) The Dazh gene is expressed in male and
female embryonic gonads before germ cell sex differentiation. Biochem.
Biophys Res. Commun., 245, 878–882.
It is probable that human DAZL1 and the mouse Dazl1
proteins perform similar functions in early gametogenesis
processes. Our results suggest that the DAZL1 locus may be
involved in infertility cases in humans. Mutation analysis
and linkage studies of this locus in families with recessive
inheritance pattern of infertility are needed to evaluate the role
of the DAZL1 gene in infertility incidences in humans.
Shan, Z., Hirschmann, P., Seebacher, T. et al. (1996) A SPGY copy homologous
to the mouse gene Dazla and the Drosophila gene boule is autosomal and
expressed only in the human male gonad. Hum. Mol. Genet., 5, 2005–2011.
Yen, P.H., Chai, N.N. and Salido, E.C. (1996) The human autosomal gene
DAZLA: testis specificity and a candidate for male infertility. Hum. Mol.
Genet., 5, 2013–2017.
Received on October 7, 1999; accepted on February 8, 2000
Acknowledgements
We thank Dr Raymond Coleman for advice and Ludmila Mazor for
tissue cross-section preparation. We thank OB/GYN department staff
for their assistance in this research.
References
Agulnik, A.I., Zharkikh, A., Boettger-Tong, H. et al. (1998) Evolution of the
DAZ gene family suggests that Y-linked DAZ plays little, or a limited, role
in spermatogenesis but underlines a recent African origin for human
populations. Hum. Mol. Genet., 7, 1371–1377.
Beck, A.R.P., Miller, I.J., Anderson, P. et al. (1998) RNA-binding protein
TIAR is essential for primordial germ cell development. Proc. Natl Acad.
Sci. USA, 95, 2331–2336.
Cooke, H.J., Lee, M., Kerr, S. et al. (1996) A murine homologue of the
human DAZ gene is autosomal and expressed only in male and female
gonads. Hum. Mol. Genet., 5, 513–516.
Eberhart, C.G., Maines, J.Z. and Wasserman, S.A. (1996) Meiotic cell cycle
requirement for the fly homolog of human deleted in azoospermia. Nature,
381, 783–785.
Enders, G.C. and May, II J.J. (1994) Developmentally regulated expression
of a mouse germ cell nuclear antigen examined from embryonic day 11 to
adult in male and female mice. Dev. Biol., 163, 331–340.
Hecht, N.B. (1993) Gene expression during male germ cell development. In
Desjardins, C. and Ewing, L.L. (eds), Cell and Molecular Biology of the
Testis. Oxford University Press, New York, USA, pp. 400–432.
Houston, D.W., Zhang, J., Maines, J.Z. et al. (1998) A Xenopus DAZ-like
gene encodes an RNA component of germ plasm and is a functional
homologue of Drosophila boule. Development, 125, 171–80.
Komminoth, P., Merk, F.B., Leav, I. et al. (1992) Comparison of 35S-
and digoxygenin-labeled RNA and oligonucleotide probes for in situ
hybridization. Expression of mRNA of the seminal vesicle secretion protein
II and androgen receptor genes in the rat prostate. Histochemistry, 98,
217–28.
McCarrey, J.R. (1993) Development of the germ cell. In Desjardins, C. and
Ewing, L.L. (eds), Cell and Molecular Biology of the Testis. Oxford
University Press, New York, USA, pp. 58–89.
468