Functional characterization of wheat ent-kaurene(-like) synthases indicates continuing evolution of labdane-related diterpenoid metabolism in the cereals

Article abstract of DOI:10.1016/j.phytochem.2012.08.021

Wheat (Triticum aestivum) and rice (Oryza sativa) are two of the most agriculturally important cereal crop plants. Rice is known to produce numerous diterpenoid natural products that serve as phytoalexins and/or allelochemicals. Specifically, these are labdane-related diterpenoids, derived from a characteristic labdadienyl/copalyl diphosphate (CPP), whose biosynthetic relationship to gibberellin biosynthesis is evident from the relevant expanded and functionally diverse family of ent-kaurene synthase-like (KSL) genes found in rice the (OsKSLs). Herein reported is the biochemical characterization of a similarly expansive family of KSL from wheat (the TaKSLs). In particular, beyond ent-kaurene synthases (KS), wheat also contains several biochemically diversified KSLs. These react either with the ent-CPP intermediate common to gibberellin biosynthesis or with the normal stereoisomer of CPP that also is found in wheat (as demonstrated by the accompanying paper describing the wheat CPP synthases). Comparison with a barley (Hordeum vulgare) KS indicates conservation of monocot KS, with early and continued expansion and functional diversification of KSLs in at least the small grain cereals. In addition, some of the TaKSLs that utilize normal CPP also will react with syn-CPP, echoing previous findings with the OsKSL family, with such enzymatic promiscuity/elasticity providing insight into the continuing evolution of diterpenoid metabolism in the cereal crop plant family, as well as more generally, which is discussed here.

Full text of DOI:10.1016/j.phytochem.2012.08.021

Phytochemistry 84 (2012) 47–55
Contents lists available at SciVerse ScienceDirect
Phytochemistry
journal homepage: www.elsevier.com/locate/phytochem
Functional characterization of wheat ent-kaurene(-like) synthases indicates
continuing evolution of labdane-related diterpenoid metabolism in the cereals
Ke Zhou a, Meimei Xu a, Mollie Tiernan a, Qian Xie a, Tomonobu Toyomasu b, Chizu Sugawara b,
Madoka Oku b, Masami Usui b, Wataru Mitsuhashi b, Makiko Chono c, Peter M. Chandler d,
Reuben J. Peters a,
⇑
a Department of Biochemistry, Biophysics, and Molecular Biology, Iowa State University, Ames, IA 50011, USA
b Department of Bioresource Engineering, Yamagata University, Tsuruoka, Yamagata 997-8555, Japan
c NARO Institute of Crop Science, Kannondai, Tsukuba 305-8518, Japan
d CSIRO Plant Industry, GPO Box 1600 Canberra, ACT 2601, Australia
a r t i c l e i n f o
a b s t r a c t
Article history:
Available online 22 September 2012
Wheat (Triticum aestivum) and rice (Oryza sativa) are two of the most agriculturally important cereal crop
plants. Rice is known to produce numerous diterpenoid natural products that serve as phytoalexins and/
or allelochemicals. Specifically, these are labdane-related diterpenoids, derived from a characteristic lab-
dadienyl/copalyl diphosphate (CPP), whose biosynthetic relationship to gibberellin biosynthesis is evi-
dent from the relevant expanded and functionally diverse family of ent-kaurene synthase-like (KSL)
genes found in rice the (OsKSLs). Herein reported is the biochemical characterization of a similarly expan-
sive family of KSL from wheat (the TaKSLs). In particular, beyond ent-kaurene synthases (KS), wheat also
contains several biochemically diversified KSLs. These react either with the ent-CPP intermediate com-
mon to gibberellin biosynthesis or with the normal stereoisomer of CPP that also is found in wheat (as
demonstrated by the accompanying paper describing the wheat CPP synthases). Comparison with a bar-
ley (Hordeum vulgare) KS indicates conservation of monocot KS, with early and continued expansion and
functional diversification of KSLs in at least the small grain cereals. In addition, some of the TaKSLs that
utilize normal CPP also will react with syn-CPP, echoing previous findings with the OsKSL family, with
such enzymatic promiscuity/elasticity providing insight into the continuing evolution of diterpenoid
metabolism in the cereal crop plant family, as well as more generally, which is discussed here.
Ó 2012 Elsevier Ltd. All rights reserved.
Keywords:
Wheat, Triticum aestivum
Barley, Hordeum vulgare
Rice, Oryza sativa
Graminae
Arabidopsis thaliana
Cruciferae
ent-Kaurene synthase
Phytoalexin
Phytoanticipin
Allelochemicals
Natural products biosynthesis
Plant defense
1. Introduction
complete gene list has enabled comprehensive investigation of var-
ious aspects of rice physiology and metabolism. Such work then
Cereal crop plants provide the bulk of the world’s caloric intake,
with wheat and rice representing the two most important for di-
rect human consumption (Dyson, 1996). Rice has served as a model
for the cereal crop plant family, as its agricultural importance and
relatively small genome size led to early and thorough sequencing
(Goff et al., 2002; International Rice Genome Sequencing Project,
2005; Yu et al., 2002), which was complemented by a large scale
cDNA sequencing effort (Kikuchi et al., 2003). The resulting
provides the basis for similar investigations in other cereal crops
such as wheat.
Rice is a particularly prolific producer of labdane-related diter-
penoids, which have been suggested to act as phytoalexins in de-
fense against microbial pathogens and as allelochemicals
suppressing the growth of neighboring weed plants (Peters,
2006; Toyomasu, 2008). The biosynthesis of this super-family of
natural products is derived from that of the gibberellin phytohor-
mones, at least in plants, and is characterized by a similar pair of
sequentially catalyzed cyclization reactions (Peters, 2010). In
particular, bicyclization of the general diterpenoid precursor
(E,E,E)-geranylgeranyl diphosphate (GGPP), typically to a labdadie-
nyl/copalyl diphosphate (CPP) intermediate, which is then often
further cyclized to an olefin. The corresponding enzymes have
been termed CPP synthases (CPSs) and ent-kaurene synthase-like
(KSL), respectively, for their relationship to those found in all
plants for gibberellin biosynthesis (Peters, 2006). Specifically, these
Abbreviations: KS, ent-kaurene synthase; KSL, ent-kaurene synthase-like;
TaKS(L), wheat (Triticum aestivum) KSL; HvKS, barley (Hordeum vulgare) kaurene
synthase; OsKS(L), rice (Oryza sativa) KSL; AtKS, Arabidopsis thaliana KS; CPP, copalyl
diphosphate; CPS, CPP synthase; TaCPS, wheat (Triticum aestivum) CPS; OsCPS, rice
(Oryza sativa) copalyl diphosphate synthase; GC–MS, gas chromatography with
mass spectrometric detection; GGPP, (E,E,E)-geranygeranyl diphosphate; RACE,
rapid amplification of cDNA ends; ORF, open reading frame.
⇑
Corresponding author. Tel.: +1 515 294 8580; fax: +1 515 294 0453.
E-mail address: rjpeters@iastate.edu (R.J. Peters).
0031-9422/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.phytochem.2012.08.021

48
K. Zhou et al. / Phytochemistry 84 (2012) 47–55
fall into the same phylogenetically defined sub-families – i.e., TPS-c
and TPS-e/f, respectively (Chen et al., 2011).
2.2. Induction of transcription of wheat labdane-related diterpene
synthase genes
Rice contains expanded gene families encoding CPS (OsCPSs)
and KSL (OsKSLs), and these have been extensively investigated,
with biochemical function assigned to each (Cho et al., 2004; Kan-
no et al., 2006; Nemoto et al., 2004; Otomo et al., 2004a,b; Prisic
et al., 2004; Wilderman et al., 2004; Xu et al., 2004, 2007). In addi-
tion, consistent with a role in phytoalexin biosynthesis, many of
the OsKSLs exhibit inducible gene transcription (Peters, 2006;
Toyomasu, 2008). Previous work with maize (Zea mays) demon-
strated the inducible production of labdane-related diterpenes in
this distantly related cereal crop plant (Mellon and West, 1979),
and recently it has been shown that maize produces such diterpe-
noid phytoalexins (Schmelz et al., 2011). In addition, it has been
suggested that CPS gene expansion and functional diversion to sec-
ondary/more specialized metabolism occurred early in the cereal
crop plant family – i.e., the Poaceae (Prisic et al., 2004). Thus, it
seems likely that more specialized labdane-related diterpenoid
metabolism will be widespread throughout the Poaceae. Indeed,
gene probing/mapping experiments using CPS and KS homologs
from barley suggests that at least barley and wheat contain ex-
panded CPS and KSL gene families (Spielmeyer et al., 2004). Such
expansion and diversification of diterpene synthases is not con-
fined to the Poaceae – e.g., having been shown in gymnosperms
as well (Keeling et al., 2011; Martin et al., 2004).
Some preliminary analysis of wheat CPSs (TaCPSs) has been pre-
viously reported (Toyomasu et al., 2009). However, only the ent-
kaurene synthase (KS) activity expected for the requisite gibberel-
lin biosynthesis has been previously reported from wheat (Aach
et al., 1995). Herein reported is the cloning and functional charac-
terization of seven members of the wheat KSL family (TaKSLs),
along with demonstrating KS activity for the previously isolated
barley KSL (HvKS), also discussed are the implications of these
findings for the evolution of diterpenoid metabolism in the cereal
crop family, as well as plants more generally.
In rice, mRNA levels of the OsKSLs, as well as OsCPSs, involved in
phytoalexin biosynthesis were dramatically increased by UV-irra-
diation (Peters, 2006). Thus, the possibility that mRNA levels of
some of the TaKSLs would be induced in response to UV-irradiation
was analyzed by qRT-PCR. Indeed, mRNA levels of TaKSL1, TaKSL2,
TaKSL3, and TaKSL5, were found to be higher in UV-irradiated
leaves, although those of TaKSL4 and TaKSL6 were not (Fig. 2).
2.3. Biochemical characterization
The TaKSLs and HvKS were functionally characterized via use of
a previously developed metabolic engineering system that enables
co-expression of both GGPP synthase and CPS producing the three
commonly found stereoisomers of CPP, along with downstream
KSL heterologously expressed as GST fusion proteins, which does
not affect product outcome (Cyr et al., 2007). This enabled analysis
of their activity with CPP of ent- (2), normal (3), or syn- (4) stereo-
chemistry (Fig. 3). Using this approach, HvKS was demonstrated to
selectively react with ent-CPP (2) and produce only ent-kaurene (5)
– i.e., HvKS does not react with normal (3) or syn-CPP (4). Similarly,
the closely related TaKSL6 specifically reacts with 2 to produce 5. In
addition, the putative homoeologs TaKSL5-1 and TaKSL5-2 also
selectively react with 2 to chiefly produce 5, although both also pro-
duce ent-beyerene (6), in a ꢀ3:1 ratio. However, TaKSL5-1 and
TaKSL5-2 may be sesquiterpene synthases, as they more readily re-
act with (E,E)-farnesyl diphosphate to produce (E)-nerolidol, as pre-
viously reported (Hillwig et al., 2011). TaKSL4 reacts with normal
CPP (3) to produce pimara-8(9),15-diene (7), and also will react
with syn-CPP (4) to produce a number of diterpenes, chiefly syn-
pimara-9(11),15-diene (8), along with at least five other relatively
minor unidentified products, but does not react with ent-CPP (2).
TaKSL3 exhibits relatively low activity, although it does selectively
react with ent-CPP (2) to generate two diterpene products. Unfortu-
nately, due to the low yield of those products, it was not possible to
obtain enough of these compounds for structural characterization.
No activity was detectable with TaKSL2 using a construct in which
only the usual pseudo-mature truncation were made (i.e., to simply
remove the N-terminal plastid targeting sequence). In an attempt to
find an active enzyme an extensively truncated construct, resem-
bling TaKSL5-1 and TaKSL5-2 [i.e., similar to plant mono- and ses-
qui- terpene synthases in missing the N-terminal domain
generally associated with plant diterpene synthases (Cao et al.,
2010)], was made and found to react with not only ent-CPP (2) to
produce the known ent-pimara-8(14),15-diene (9), but also with
normal CPP (3) to make abietadiene (10), although not with syn-
CPP (4). Finally, TaKSL1 also reacts with normal CPP (3) to produce
iso-pimara-7,15-diene (11), as well as with syn-CPP (4) to produce
syn-iso-pimara-7,15-diene (12), but not with ent-CPP (2).
2. Results
2.1. Identification of kaurene synthase-like genes from wheat and
barley
Isolation of HvKS has been previously reported (Spielmeyer
et al., 2004). TaKSL genes were initially identified by homology
searches against the available EST data with the known OsKSL.
The corresponding full-length cDNAs were then cloned by RT-
PCR and, where necessary, by RACE. Through this effort, five clearly
full-length KSLs were found; TaKSL1, 2, 3, 4, and 6, which encode
proteins of 837, 853, 856, 837, and 852 amino acid (aa) residues
(GenBank Accessions AB597957–AB597960 and AB597962),
respectively. In addition, two closely related genes (94% identical
at the nucleotide sequence level) were cloned and assigned as
TaKSL5-1 and TaKSL5-2 under the assumption that these are poly-
ploidy derived homoeologs (e.g., the most notable difference is an
in-frame 63 nucleotide deletion in TaKSL5-2 relative to TaKSL5-1).
Notably, as previously reported (Hillwig et al., 2011), TaKSL5-1
and TaKSL5-2 are substantially shorter than other KSLs, resembling
plant mono- and sesqui- terpene synthases in length. Specifically,
these encode proteins of 663 and 641 aa long, respectively, and
are missing the large N-terminal domain usually associated with
diterpene synthases (Cao et al., 2010), although they otherwise clo-
sely align with the other TaKSLs (Fig. 1). While many of these KSLs
have a Gly in place of a position generally conserved as Ser/Thr
within the terpene synthase secondary divalent metal binding mo-
tif, such substitution has been observed before and found not to be
deleterious (Zhou and Peters, 2009), encouraging further analysis.
2.4. Molecular phylogenetic analysis of cereal KS(L)
Previous molecular phylogentic analysis of cereal CPSs indicates
that expansion and functional divergence of at least two copies of
such an enzyme encoding gene to more specialized metabolism oc-
curred prior to the speciation event separating the wheat and rice
lineages (Toyomasu et al., 2009). To determine if similar early mul-
tiplication and functional divergence occurred with the KSLs, as
well as to provide insight into potential physiological function of
the various TaKSL family members, a molecular phylogenetic anal-
ysis of the cereal KS(L)s was carried out. Specifically, the full-length
amino acid sequences of all the OsKSLs with HvKS and all the TaK-
SLs (but TaKSL5-1 and TaKSL5-2) were aligned. TaKSL5-1 and
TaKSL5-2 were excluded on the basis of their significant difference

K. Zhou et al. / Phytochemistry 84 (2012) 47–55
49
Fig. 1. HvKS and TaKSL1-6 amino acid sequence alignment (with the primary DDxxD and secondary NDxx(S/T)xxxE divalent metal binding motifs underlined).
in size as well as presumed function as sesquiterpene synthases
rather than KSL. The KS from the dicot Arabidopsis thaliana (AtKS)
also was included to provide a designated outgroup sequence for
the resulting phylogenetic tree, which was constructed using the
nearest neighbor joining method (Fig. 4).
While the TaKSLs and OsKSLs largely cluster independently,
indicating continued expansion and divergence of this gene family
after separation of the wheat/rice lineages, there is some overlap.
In particular, OsKSL4 clusters with TaKSL1 and TaKSL4, suggesting
early KSL gene duplication and functional divergence in the small

50
K. Zhou et al. / Phytochemistry 84 (2012) 47–55
Fig. 2. Transcriptional induction of the TaKSLs by UV-irradiation. The mRNA levels for all the TaKSLs are normalized to that for TaKSL1 pre-induction, with data from control
plants indicated by circles and that from induced plants by diamonds (duplicate data points from technical replicates shown). Analysis of biological replicates demonstrates
the same overall expression pattern.
grain cereal lineage. Given the inducible transcription of at least
TaKSL1 and OsKSL4, it seems likely that the ancestral enzymatic
gene was similarly involved in more specialized metabolism. In
addition, consistent with their shared conservation of KS activity,
HvKS and TaKSL6 are the most closely related KSLs (sharing 91%
aa sequence identity), and both are quite similar to OsKS1 as well
(ꢀ68% aa identity), which is required for gibberellin biosynthesis in
rice (Sakamoto et al., 2004). This conservation pattern reflects the
underlying evolutionary separation of rice from wheat and barley,
as these fall into the Poaceae subfamilies Oryzoideae and Pooideae,
respectively (Kellogg, 1998). Thus, it seems likely that HvKS and
TaKSL6 are similarly involved in gibberellin biosynthesis, although
this remains to be demonstrated. Consistent with this hypothesis,
the highly divergent sequences, including overall length, as well
as reduced product fidelity and inducible gene transcription, of
TaKSL5-1 and TaKSL5-2 suggests that these are not involved in gib-
berellin metabolism, and these have been shown elsewhere to
cluster with the rice pseudogenes OsKSL2 and OsKSL3, rather than
OsKS1 (Hillwig et al., 2011).
Notably, while the rice KSLs have clearly undergone repeated
evolutionary diversification of substrate specificity (e.g., the syn-
CPP specific OsKSL4 and OsKSL11 fall into separate clusters), the
TaKSLs characterized in this study do exhibit such functional con-
servation. In particular, the ent-CPP specific TaKSLs cluster to-
gether, with the normal/syn-CPP specific TaKSL1 and TaKSL4
falling into a separate cluster. This latter cluster further includes
the OsKSL4 that exhibits a similar substrate range (Morrone
et al., 2011), suggesting an early origin for such dual substrate ste-
reo-specificity, which is consistent with early diversification of the
responsible CPS suggested in the accompanying report (Wu et al.,
in press). However, there is no clear phylogenetic relationship
among the inducible versus non-inducible TaKSLs, which also
was noted for the rice OsKSLs (Peters, 2006). For example, while
TaKSL1 and TaKSL2 exhibit UV-inducible transcription, TaKLS1
clusters with the non UV-inducible TaKSL4 rather than similarly
regulated TaKSL2.
upstream CPS gene family in the accompanying report (Wu
et al., in press). Together, these results suggest some, albeit as
yet undefined, physiological role(s) for the derived labdane-re-
lated diterpenoids. In rice, which has undergone similar CPS and
KSL gene family expansion, the resulting natural products are
thought to serve as inducible phytoalexins against fungal patho-
gens, constitutive phytoanticipans against bacterial infection,
and/or as allelechemicals (Peters, 2006; Toyomasu, 2008). Given
the similar transcriptional induction of TaKSL1, TaKSL2, TaKSL3
and TaKSL5-1 and TaKSL5-2 as observed with the phytoalexin
relevant diterpene synthases from rice, it seems likely that the
diterpenoids derived from these wheat KSLs will serve as phyto-
alexins in wheat. On the other hand, the conservation of HvKS
and TaKSL6 with OsKS1, both in biochemical function and lack
of transcriptional induction as well as phylogenetically, strongly
indicates that these are involved in gibberellin biosynthesis.
Finally, it is possible that the non-inducible TaKSL4 might serve
in biosynthesis of phytoanticipins. Alternatively, TaKSL4 may
serve to produce allelochemicals, much as has been shown for
the rice momilactones (Xu et al., 2012).
The dual normal/syn-CPP reactivity observed here with TaKSL1
and TaKSL4 provides some insight into the underlying enzymatic
catalysis, as the products resulting from reaction with these alter-
native substrates exhibit certain similarities (Fig. 5). Specifically,
TaKSL1 produces a pimaradiene with b-methyl at C13 and C7,8-
double bond resulting from deprotonation at C7 of the relevant
isopimara-15-en-8-yl+ intermediate from both normal (3) and
syn-CPP (4). TaKSL4 produces a pimaradiene with
a-methyl at
C13 and double bond involving C9 from both substrates. However,
when reacting with syn-CPP (4), this entails a hydride shift from C9
to C8, enabling deprotonation at C11 to form the observed C9,11-
double bond, rather than the direct deprotonation at C9 of the ini-
tially formed pimara-15-en-8-yl+ intermediate observed upon
reaction with normal CPP (3). The shared C13 configuration of
the pimaradienes resulting from reaction with these alternative
substrates further implies that both TaKSL1 and TaKSL4 bind nor-
mal (3) and syn-CPP (4) in a similar conformation (Fig. 6). On the
other hand, the production of abietadiene (10) from normal CPP
(3) by TaKSL2 prevents insight into the configuration of C13 in
the relevant pimarenyl+ intermediates, which then cannot be com-
pared to the ent-CPP (2) conformation implied by the observed
production of ent-pimara-8(14),15-diene (9).
3. Discussion
The results reported here demonstrate that the KSL gene fam-
ily in wheat has undergone expansion and functional diversifica-
tion. These findings resemble the results described for the

K. Zhou et al. / Phytochemistry 84 (2012) 47–55
51
Fig. 3. Identification of products formed by TaKS(L)s via GC–MS based comparison to authentic standards. (a–d) Chromatograph of the products formed by HvKS, TaKSL6,
TaKSL5-1, and TaKSL5-2, respectively, from ent-CPP (2). (e–i) Mass spectrum of HvKS and TaKSL6 products, as well as the major product of TaKSL5-1 and TaKSL5-2, from 2,
with comparison to authentic ent-kaur-16-ene (5) (RT = 16.81 min). (j–l) Mass spectrum of the minor product of TaKSL5-1 and TaKSL5-2 from 2, with comparison to authentic
ent-beyer-15-ene (6) (RT = 16.05 min). (m) Chromatograph of the product formed by TaKSL1 from normal CPP (3). (n,o) Mass spectrum of TaKSL1 product from 3, with
comparison to authentic isopimara-7,15-diene (11) (RT = 16.49 min). (p) Chromatograph of the product formed by TaKSL4 from 3. (q,r) Mass spectrum of TaKSL4 product
from 3, with comparison to authentic pimara-8(9),15-diene (7) (RT = 15.91 min). (s) Chromatograph of the product formed by TaKSL1 from syn-CPP (4). (t,u) Mass spectrum of
TaKSL1 product from 4, with comparison to authentic syn-isopimara-7,15-diene (8) (RT = 15.82 min). (v) Chromatograph of the products formed by TaKSL4 from 4. (w,x) Mass
spectrum of TaKSL4 product from 4, with comparison to authentic syn-isopimara-9(11),15-diene (12) (RT = 16.26 min). In all cases, the retention time of the enzymatic
product was P0.02 min. different from that of the matching authentic sample.

52
K. Zhou et al. / Phytochemistry 84 (2012) 47–55
Fig. 4. Molecular phylogenetic tree for characterized cereal KS(L)s, constructed using the Nearest Neighbor Joining method, and with AtKS as the designated outgroup
sequence.
The dual reactivity of TaKSL2 with the normal (3) and ent-CPP
(2) found in wheat is similar to the ability of OsKSL10 to react with
the syn- (4) and ent-CPP (2) found in rice. However, while the dual
normal/syn-CPP reactivity of TaKSL1 and TaKSL4 found here is
analogous to that reported for OsKSL4 and OsKSL11 (Morrone
et al., 2011), these do not seem to be physiologically relevant.
Specifically, because rice does not produce normal CPP (3) and,
as described in the accompanying report (Wu et al., in press),
wheat does not seem to produce syn-CPP (4). Nevertheless, such la-
tent plasticity presumably enables facile evolution of diterpenoid
metabolism, as changes in CPP stereochemistry arising from func-
tional diversification of the upstream CPSs would be readily
TaKSL4
TaKSL5,6
H
HvKS
H
H
pimara-8,
ent-kaurene (5)
15-diene (7)
OPP
TaKSL5
OPP
H
H
H
TaKSL2
H
H
H
H
H
ent-CPP (2)
ent-beyerene (6)
normal CPP (3)
abietadiene (10)
TaKSL2
H
TaKSL1
H
H
H
ent-pimara-8(14),
15-diene (9)
isopimara-7,
15-diene (11)
TaKSL4
H
11
15
syn-pimara-9(11),
15-diene (8)
OPP
9
OPP
1
10
8
H
7
H
syn-CPP (4)
TaKSL1
H
H
syn-isopimara-7,
15-diene (12)
Fig. 5. Reactions catalyzed by HvKS and the various TaKSLs. Also shown is generic initially catalyzed cyclization to a pimar-15-en-8-yl carbocationic intermediate, with
carbon numbering indicated as mentioned in the text.

K. Zhou et al. / Phytochemistry 84 (2012) 47–55
53
evolution of expanded labdane-related diterpenoid biosynthesis
demonstrated here for the cereal crop plant family. In particular,
the ability to produce alternative stereochemical variants of CPP
may then lead to immediate appearance of more elaborated natu-
ral products (i.e., via promiscuity of the downstream KSLs and
cytochromes P450). Similar latent substrate promiscuity may con-
tribute to the evolution of more specialized terpenoid metabolism
observed in all plants more generally.
A)
H
syn
O
O
O
O
P
O
O
P
OH
OH
TaKSL1
OH
OH
H
O
O
5. Experimental
normal
P
P
5.1. General
OH
OH
Unless otherwise noted, all chemical reagents were purchased
from Fisher Scientific (Loughborough, Leicestershire, UK), and
molecular biology reagents from Invitrogen (Carlsbad, CA, USA).
All recombinant expression was carried out with the OverExpress
C41 strain of Escherichia coli (Lucigen, Middleton, WI, USA). Gas
chromatography with mass spectrometric detection (GC–MS) anal-
yses were performed using a Varian (Palo Alto, CA, USA) 3900
instrument with HP-5 ms column and Saturn 2100 ion trap mass
B)
H
O
O
syn
O
O
P
O
O
P
OH
OH
TaKSL4
OH
OH
O
O
H
P
P
spectrometer in electron ionization (70 eV) mode. Samples (1 lL)
normal
were injected in splitless mode at 50 °C and, after a 3 min. hold,
the temperature raised at 14 °C/min. to 300 °C, where it was held
for 3 min. MS data was collected from m/z from 90 to 600, starting
12 min. after the injection until the end of the run. GC with flame
ionization detection (FID) was carried out using an Agilent (Santa
Clara, CA, USA) 6890 GC with HP-5 ms column, and the same pro-
tocol utilized for GC–MS analyses. Bioinformatic sequence analyses
were carried out either with the VectorNTI (Fig. 1) or CLC Sequence
Viewer (Fig. 4) software packages.
OH
OH
Fig. 6. Comparison of the proposed configuration of the alternative substrates in
the active site of the dual normal/syn-CPP reactive TaKSL1 (A) and TaKSL4 (B).
accommodated by these promiscuous KSLs. In addition, down-
stream enzymes such as cytochrome P450 monooxygenases
exhibit similar promiscuity (Wang et al., 2012). Such broader met-
abolic plasticity enables the immediate appearance of multi-step
biosynthetic pathways from changes in an upstream enzyme.
Indeed, such changes in CPS stereochemistry appear to have been
directly relevant in the cereal crop plant family. As described in
the accompanying report (Wu et al., in press), wheat and rice pro-
duce alternative stereoisomers of CPP (i.e., normal (3) or syn (4),
respectively, in addition to the ent-CPP (2) required for GA biosyn-
thesis). Such stereochemical variation is then readily accommo-
dated by the presence of these promiscuous enzymes. In fact, it
may be these evolutionary changes in CPS stereochemical outcome
that led to this observed dual reactivity for some of the rice and
wheat KSLs – i.e., this reflects promiscuous intermediate stages
during the evolution of altered substrate specificity, which is a con-
cept that has been more generally postulated (Tawfik, 2010).
5.2. Cloning
BLAST searches were carried out using the OsKSL as probes in
DDBJ (http://blast.ddbj.nig.ac.jp/top-e.html). TaKSL1, 2, 3, 4, 5 and
6
correspond to the sequences of BE585476, CV775031,
BE585481, CK205050/CA646242, DR740781/CJ593452, and
BE419989, respectively. The corresponding full-length cDNAs were
then cloned from Triticum aestivum cv. Nourin-61-gou by rapid
amplification of cDNA ends (RACE) and end-to-end RT-PCR using
gene specific primers based on these EST sequences, much as de-
scribed previously (Toyomasu et al., 1998).
Each KSL was transferred to the Gateway vector system via PCR
amplification and directional topoisomerization insertion into
pENTR/SD/D-TOPO, with the ensuing constructs verified by com-
plete gene sequencing. These clones were subsequently transferred
via directional recombination to the T7-based N-terminal GST fu-
sion expression vector pDEST15.
4. Conclusion
The results presented here demonstrate that wheat contains an
expanded and biochemically diverse family of KSLs. While the
physiological roles of the ensuing labdane-related diterpenoids lar-
gely remain unclear, the KSL gene family seems to have undergone
continued evolution in both wheat and rice since the separation of
these related cereal crop plants, suggesting continuing relevance
for these natural products. Given the similar inducible transcrip-
tional regulation of unrelated KSLs from wheat and rice, it seems
likely that wheat may use labdane-related diterpenoids in plant
defense, analogous to their roles in rice. However, their indepen-
dent evolutionary trajectories suggest that there will be differences
in their exact function. Regardless of physiological role, the bio-
chemical activity exhibited by the KSLs characterized here signifi-
cantly expands our understanding of the diterpenoid metabolic
repertoire of wheat. In addition, the dual substrate reactivity dem-
onstrated here for some of the wheat KSLs echoes recently re-
ported promiscuity of the rice KSLs (Morrone et al., 2011), and
this flexibility in substrate recognition presumably enabled the
5.3. Functional characterization via metabolic engineering
Functional characterization of HvKS and the TaKSLs was accom-
plished by use of our previously described modular metabolic engi-
neering system (Cyr et al., 2007). Briefly, class I labdane-related
diterpene synthases such as the TaKSLs are co-expressed, from
pDEST expression vectors, with pACYC-Duet (Novagen/EMD) de-
rived plasmids that carry a GGPP synthase and CPS (pGGxC). These
lead to production of the three most common stereoisomers of CPP,
specifically pGGnC leads to production of normal CPP (3), pGGeC
leads to production of ent-CPP (2), and pGGsC leads to production
of syn-CPP (4). Accordingly, HvKS and the TaKSLs were separately
co-expressed with each of the three pGGxC vectors (i.e., in all
possible pairings). The resulting recombinant bacteria were then
analyzed as previously described (Morrone et al., 2009). Briefly,

54
K. Zhou et al. / Phytochemistry 84 (2012) 47–55
Dyson, T., 1996. Population and Food: Global Trends and Future Prospects.
Table 1
Routledge, London.
Primers used in RT-PCR analysis of mRNA levels.
Goff, S.A., Ricke, D., Lan, T.H., Presting, G., Wang, R., Dunn, M., Glazebrook, J.,
Sessions, A., Oeller, P., Varma, H., Hadley, D., Hutchison, D., Martin, C., Katagiri,
F., Lange, B.M., Moughamer, T., Xia, Y., Budworth, P., Zhong, J., Miguel, T.,
Paszkowski, U., Zhang, S., Colbert, M., Sun, W.L., Chen, L., Cooper, B., Park, S.,
Wood, T.C., Mao, L., Quail, P., Wing, R., Dean, R., Yu, Y., Zharkikh, A., Shen, R.,
Sahasrabudhe, S., Thomas, A., Cannings, R., Gutin, A., Pruss, D., Reid, J., Tavtigian,
S., Mitchell, J., Eldredge, G., Scholl, T., Miller, R.M., Bhatnagar, S., Adey, N.,
Rubano, T., Tusneem, N., Robinson, R., Feldhaus, J., Macalma, T., Oliphant, A.,
Briggs, S., 2002. A draft sequence of the rice genome (Oryza sativa L. ssp.
japonica). Science 296, 92–100.
Gene
Forward primer
Reverse primer
TaKSL1
TaKSL2
TaKSL3
TaKSL4
TaKSL5
TaKSL6
18S
GCGGTTAACTCATTCGCAGA
ATGTGGAGGAGGCATCTGC
CTCTTGGCATCTGTTGTGAATGG
CGCTTACCTCATACGGGATG
GATCAAGAGTGTCCTGGACTTCA
ACTCACCCGGATTCGCT
CCTCACTTGACTCCCTCTTGA
GGCAACAACTCAGCTTCCAGG
GTTGAGGAGTCGGCAACAAG
CGTCTCTGGATTCCCTCTCA
CAGATGAACGGAGGCTTCG
GCGGTAGTTCAACCTTGCG
ATCTAAGGGCATCACAGACC
GGAGCGATTTGTCTGGTTA
Hillwig, M.L., Xu, M., Toyomasu, T., Tiernan, M.S., Gao, W., Cui, G., Huang, L., Peters,
R.J., 2011. Domain loss has independently occurred multiple times in plant
terpene synthase evolution. Plant J. 68, 1051–1060.
Kanno, Y., Otomo, K., Kenmoku, H., Mitsuhashi, W., Yamane, H., Oikawa, H.,
Toshima, H., Matsuoka, M., Sassa, T., Toyomasu, T., 2006. Characterization of a
rice gene family encoding type-A diterpene cyclases. Biosci. Biotechnol.
Biochem. 70, 1702–1710.
NZY liquid media cultures 50 mL were grown with shaking to
A600 ꢀ 0.6 at 37 °C, the temperature reduced to 16 °C for 1 h prior
to induction with IPTG (added to
a final concentration of
Keeling, C.I., Madilao, L.L., Zerbe, P., Dullat, H.K., Bohlmann, J., 2011. The primary
diterpene synthase products of Picea abies levopimaradiene/abietadiene
0.5 mM), followed by continued fermentation at 16 °C for an addi-
tional ꢀ72 h. These cultures were then extracted with an equal vol-
ume of hexanes, dried under N2, and resuspended in hexanes
synthase (PaLAS) are epimers of
Chem. 286, 21145–21153.
a thermally unstable diterpenol. J. Biol.
Kellogg, E.A., 1998. Relationships of cereal crops and other grasses. Proc. Natl. Acad.
Sci. U. S. A 95, 2005–2010.
(100 lL) for GC–MS analysis, with product identification accom-
plished by comparison to authentic standards.
Kikuchi, S., Satoh, K., Nagata, T., Kawagashira, N., Doi, K., Kishimoto, N., Yazaki, J.,
Ishikawa, M., Yamada, H., Ooka, H., Hotta, I., Kojima, K., Namiki, T., Ohneda, E.,
Yahagi, W., Suzuki, K., Li, C.J., Ohtsuki, K., Shishiki, T., Otomo, Y., Murakami, K.,
Iida, Y., Sugano, S., Fujimura, T., Suzuki, Y., Tsunoda, Y., Kurosaki, T., Kodama, T.,
Masuda, H., Kobayashi, M., Xie, Q., Lu, M., Narikawa, R., Sugiyama, A., Mizuno, K.,
Yokomizo, S., Niikura, J., Ikeda, R., Ishibiki, J., Kawamata, M., Yoshimura, A.,
Miura, J., Kusumegi, T., Oka, M., Ryu, R., Ueda, M., Matsubara, K., Kawai, J.,
Carninci, P., Adachi, J., Aizawa, K., Arakawa, T., Fukuda, S., Hara, A., Hashidume,
W., Hayatsu, N., Imotani, K., Ishii, Y., Itoh, M., Kagawa, I., Kondo, S., Konno, H.,
Miyazaki, A., Osato, N., Ota, Y., Saito, R., Sasaki, D., Sato, K., Shibata, K.,
Shinagawa, A., Shiraki, T., Yoshino, M., Hayashizaki, Y., 2003. Collection,
mapping, and annotation of over 28,000 cDNA clones from japonica rice.
Science 301, 376–379.
International Rice Genome Sequencing Project, 2005. The map-based sequence of
the rice genome. Nature 436, 793–800.
Martin, D.M., Faldt, J., Bohlmann, J., 2004. Functional characterization of nine
norway spruce TPS genes and evolution of gymnosperm terpene synthases of
the TPS-d subfamily. Plant Physiol. 135, 1908–1927.
Mellon, J.E., West, C.A., 1979. Diterpene biosynthesis in maize seedlings in response
to fungal infection. Plant Physiol. 64, 406–410.
Morrone, D., Chambers, J., Lowry, L., Kim, G., Anterola, A., Bender, K., Peters, R.J.,
2009. Gibberellin biosynthesis in bacteria: separate ent-copalyl diphosphate
and ent-kaurene synthases in Bradyrhizobium japonicum. FEBS Lett. 583, 475–
480.
5.4. Analysis of inducible wheat labdane-related diterpene synthase
gene transcription
To measure TaKSL mRNA levels in response to UV irradiation,
leaf sheaths were obtained from wheat plants that had been culti-
vated in a growth chamber for 2 weeks at 25 °C and exposed to UV
light for 15 min according to a previously described method (Oto-
mo et al., 2004b), and then harvested 20 h or 40 h after irradiation.
Total RNA was extracted from frozen samples using an RNAqueous
column with Plant RNA Isolation Aid (Ambion), and cDNA was syn-
thesized from 1-lg aliquots of total RNA by using a QuantiTect re-
verse transcription kit (Qiagen). Real-time QRT-PCR, using SYBR
Green II, was carried out in a TP800 thermal cycler (Takara). This
experiment was repeated three times (i.e., with separately grown
plants), as previously described (Sawada et al., 2008), but with
the primers listed in Table 1, and the data from a representative
experiment (run in duplicate) shown in Fig. 2.
Morrone, D., Hillwig, M.L., Mead, M.E., Lowry, L., Fulton, D.B., Peters, R.J., 2011.
Evident and latent plasticity across the rice diterpene synthase family with
potential implications for the evolution of diterpenoid metabolism in the
cereals. Biochem. J. 435, 589–595.
Acknowledgements
Nemoto, T., Cho, E.-M., Okada, A., Okada, K., Otomo, K., Kanno, Y., Toyomasu, T.,
Mitsuhashi, W., Sassa, T., Minami, E., Shibuya, N., Nishiyama, M., Nojiri, H.,
Yamane, H., 2004. Stemar-13-ene synthase, a diterpene cyclase involved in
the biosynthesis of the phytoalexin oryzalexin S in rice. FEBS Lett. 571, 182–
186.
Otomo, K., Kanno, Y., Motegi, A., Kenmoku, H., Yamane, H., Mitsuhashi, W., Oikawa,
H., Toshima, H., Itoh, H., Matsuoka, M., Sassa, T., Toyomasu, T., 2004a. Diterpene
cyclases responsible for the biosynthesis of phytoalexins, momilactones A, B,
and oryzalexins A–F in rice. Biosci. Biotechnol. Biochem. 68, 2001–2006.
Otomo, K., Kenmoku, H., Oikawa, H., Konig, W.A., Toshima, H., Mitsuhashi, W.,
Yamane, H., Sassa, T., Toyomasu, T., 2004b. Biological functions of ent- and syn-
copalyl diphosphate synthases in rice. key enzymes for the branch point of
gibberellin and phytoalexin biosynthesis. Plant J. 39, 886–893.
We thank Dr. Robert M. Coates (Univ. of Illinois) for graciously
providing an authentic sample of beyer-15-ene, and Dr. Tsuneo
Sasanuma (Yamagata University) for providing the T. aestivum cv.
Nourin-61-gou seeds. This study was generously supported in part
by grants from the USDA-NIFA-AFRI (2008-35318-05027) and NIH
(GM076324) to R.J.P., and in part by support from the Grant-in-Aid
for Scientific Research C (No. 17580093 to T.T.) from the Japanese
Society for the Promotion of Science.
Peters, R.J., 2006. Uncovering the complex metabolic network underlying
diterpenoid phytoalexin biosynthesis in rice and other cereal crop plants.
Phytochemistry 67, 2307–2317.
Peters, R.J., 2010. Two rings in them all: the labdane-related diterpenoids. Nat. Prod.
Rep. 27, 1521–1530.
Prisic, S., Xu, M., Wilderman, P.R., Peters, R.J., 2004. Rice contains two disparate ent-
copalyl diphosphate synthases with distinct metabolic functions. Plant Physiol.
136, 4228–4236.
Sakamoto, T., Miura, K., Itoh, H., Tatsumi, T., Ueguchi-Tanaka, M., Ishiyama, K.,
Kobayashi, M., Agrawal, G.K., Takeda, S., Abe, K., Miyao, A., Hirochika, H., Kitano,
H., Ashikari, M., Matsuoka, M., 2004. An overview of gibberellin metabolism
enzyme genes and their related mutants in rice. Plant Physiol. 134, 1642–1653.
Sawada, Y., Katsumata, T., Kitamura, J., Kawaide, H., Nakajima, M., Asami, T.,
Nakaminami, K., Kurahashi, T., Mitsuhashi, W., Inoue, Y., Toyomasu, T., 2008.
Germination of photoblastic lettuce seeds is regulated via the control of
endogenous physiologically active gibberellin content, rather than of
gibberellin responsiveness. J. Exp. Bot. 59, 3383–3393.
References
Aach, H., Bose, G., Graebe, J.E., 1995. Ent-Kaurene biosynthesis in a cell-free system
from wheat (Triticum aestivum L.) seedlings and the localisation of ent-kaurene
synthetase in plastids of three species. Planta 197, 333–342.
Cao, R., Zhang, Y., Mann, F.M., Huang, C., Mukkamala, D., Mudock, M.P., Mead, M.E.,
Prisic, S., Wang, K., Lin, K.-Y., Chang, T.-K., Peters, R.J., Oldfield, E., 2010.
Diterpene cyclases and the nature of the isoprene fold. Proteins 78, 2417–2432.
Chen, F., Tholl, D., Bohlmann, J., Pichersky, E., 2011. The family of terpene synthases
in plants: a mid-size family of genes for specialized metabolism that is highly
diversified throughout the kingdom. Plant J. 66, 212–229.
Cho, E.-M., Okada, A., Kenmoku, H., Otomo, K., Toyomasu, T., Mitsuhashi, W., Sassa,
T., Yajima, A., Yabuta, G., Mori, K., Oikawa, H., Toshima, H., Shibuya, N., Nojiri, H.,
Omori, T., Nishiyama, M., Yamane, H., 2004. Molecular cloning and
characterization of
a cDNA encoding ent-cassa-12,15-diene synthase, a
putative diterpenoid phytoalexin biosynthetic enzyme, from suspension-
cultured rice cells treated with a chitin elicitor. Plant J. 37, 1–8.
Cyr, A., Wilderman, P.R., Determan, M., Peters, R.J., 2007. A modular approach for
facile biosynthesis of labdane-related diterpenes. J. Am. Chem. Soc. 129, 6684–
6685.
Schmelz, E.A., Kaplan, F., Huffaker, A., Dafoe, N.J., Vaughan, M.M., Ni, X., Rocca, J.R.,
Alborn, H.T., Teal, P.E., 2011. Identity, regulation, and activity of inducible
diterpenoid phytoalexins in maize. Proc. Natl. Acad. Sci. U. S. A. 108, 5455–5460.

K. Zhou et al. / Phytochemistry 84 (2012) 47–55
55
Spielmeyer, W., Ellis, M., Robertson, M., Ali, S., Lenton, J.R., Chandler, P.M., 2004.
Isolation of gibberellin metabolic pathway genes from barley and comparative
mapping in barley, wheat and rice. Theor. Appl. Genet. 109, 847–855.
Tawfik, D.S., 2010. Messy biology and the origins of evolutionary innovations. Nat.
Chem. Biol. 6, 692–696.
Xu, M., Galhano, R., Wiemann, P., Bueno, E., Tiernan, M., Wu, W., Chung, I.M.,
Gershenzon, J., Tudzynski, B., Sesma, A., Peters, R.J., 2012. Genetic evidence for
natural product-mediated plant-plant allelopathy in rice (Oryza sativa). New
Phytol. 193, 570–575.
Xu, M., Hillwig, M.L., Prisic, S., Coates, R.M., Peters, R.J., 2004. Functional
identification of rice syn-copalyl diphosphate synthase and its role in
initiating biosynthesis of diterpenoid phytoalexin/allelopathic natural
products. Plant J. 39, 309–318.
Xu, M., Wilderman, P.R., Morrone, D., Xu, J., Roy, A., Margis-Pinheiro, M., Upadhyaya,
N., Coates, R.M., Peters, R.J., 2007. Functional characterization of the rice
kaurene synthase-like gene family. Phytochemistry 68, 312–326.
Yu, J., Hu, S., Wang, J., Wong, G.K., Li, S., Liu, B., Deng, Y., Dai, L., Zhou, Y., Zhang, X.,
Cao, M., Liu, J., Sun, J., Tang, J., Chen, Y., Huang, X., Lin, W., Ye, C., Tong, W., Cong,
L., Geng, J., Han, Y., Li, L., Li, W., Hu, G., Huang, X., Li, W., Li, J., Liu, Z., Li, L., Liu, J.,
Qi, Q., Liu, J., Li, L., Li, T., Wang, X., Lu, H., Wu, T., Zhu, M., Ni, P., Han, H., Dong, W.,
Ren, X., Feng, X., Cui, P., Li, X., Wang, H., Xu, X., Zhai, W., Xu, Z., Zhang, J., He, S.,
Zhang, J., Xu, J., Zhang, K., Zheng, X., Dong, J., Zeng, W., Tao, L., Ye, J., Tan, J., Ren,
X., Chen, X., He, J., Liu, D., Tian, W., Tian, C., Xia, H., Bao, Q., Li, G., Gao, H., Cao, T.,
Wang, J., Zhao, W., Li, P., Chen, W., Wang, X., Zhang, Y., Hu, J., Wang, J., Liu, S.,
Yang, J., Zhang, G., Xiong, Y., Li, Z., Mao, L., Zhou, C., Zhu, Z., Chen, R., Hao, B.,
Zheng, W., Chen, S., Guo, W., Li, G., Liu, S., Tao, M., Wang, J., Zhu, L., Yuan, L.,
Yang, H., 2002. A draft sequence of the rice genome (Oryza sativa L. ssp. indica).
Science 296, 79–92.
Toyomasu, T., 2008. Recent advances regarding diterpene cyclase genes in higher
plants and fungi. Biosci. Biotechnol. Biochem. 72, 1168–1175.
Toyomasu, T., Kagahara, T., Hirose, Y., Usui, M., Abe, S., Okada, K., Koga, J.,
Mitsuhashi, W., Yamane, H., 2009. Cloning and characterization of cDNAs
encoding ent-copalyl diphosphate synthases in wheat: insight into the
evolution of rice phytoalexin biosynthetic genes. Biosci. Biotechnol. Biochem.
73, 772–775.
Toyomasu, T., Kawaide, H., Mitsuhashi, W., Inoue, Y., Kamiya, Y., 1998. Phytochrome
regulates gibberellin biosynthesis during germination of photoblastic lettuce
seeds. Plant Physiol. 118, 1517–1523.
Wang, Q., Hillwig, M.L., Okada, K., Yamazaki, K., Wu, Y., Swaminathan, S., Yamane, H.,
Peters, R.J., 2012. Characterization of CYP76M5-8 indicates metabolic plasticity
within a plant biosynthetic gene cluster. J. Biol. Chem. 287, 6159–6168.
Wilderman, P.R., Xu, M., Jin, Y., Coates, R.M., Peters, R.J., 2004. Identification of syn-
pimara-7,15-diene synthase reveals functional clustering of terpene synthases
involved in rice phytoalexin/allelochemical biosynthesis. Plant Physiol. 135,
2098–2105.
Wu, Y., Zhou, K., Toyomasu, T., Sugawara, C., Oku, M., Abe, S., Usui, M., Mitsuhashi,
W., Chono, M., Chandler, P. M., Peters, R. J., in press. Functional characterization
of wheat copalyl diphosphate synthases elucidates the early evolution of
labdane-related diterpenoid metabolism in the cereals. Phytochemistry.
Zhou, K., Peters, R.J., 2009. Investigating the conservation pattern of a putative
second terpene synthase divalent metal binding motif in plants.
Phytochemistry 70, 366–369.