A novel thermoacidophilic family 10 xylanase from Penicillium pinophilum C1

Article abstract of DOI:10.1016/j.procbio.2011.09.018

A novel endo-β-1,4-xylanase gene (xyn10C1) was cloned from Penicillium pinophilum C1 and overexpressed in Pichia pastoris. The 1071-bp full-length gene encodes a 356-residue polypeptide containing the catalytic domain of glycoside hydrolase 10. Deduced XYN10C1 shares highest amino acid sequence identity of 49.3% with a putative xylanase from Glomeella graminicola M1.001. Purified recombinant XYN10C1 showed maximal activity at pH 4.0-5.5 and 75 °C, exhibited good adaptability to broad acidic pH and temperature ranges (>69.0% activity at pH 2.5-6.5; and >91.0% activity at 70-80 °C and 22.2% even at 90 °C), and was highly stable at pH 2.0-7.0 for 1 h at 37 °C. The specific activity, K_m and V_max values for birchwood xylan and soluble wheat arabinoxylan were 100.7 and 137.4 U/mg, 4.3 and 6.9 mg/ml, and 195.4 and 209.3 μmol/min/mg, respectively. The enzyme was strongly resistant to most metal ions and proteases (pepsin and trypsin). Under simulated mashing conditions, addition of XYN10C1 (80 U) to the brewery mash (12.5 g in 50 ml system) significantly increased the filtration rate by 26.7% and reduced the viscosity by 9.8%, respectively. All these favorable enzymatic properties make XYN10C1 attractive for potential applications in the food and animal feed industries.

Full text of DOI:10.1016/j.procbio.2011.09.018

Process Biochemistry 46 (2011) 2341–2346
Contents lists available at SciVerse ScienceDirect
Process Biochemistry
journal homepage: www.elsevier.com/locate/procbio
A novel thermoacidophilic family 10 xylanase from Penicillium pinophilum C1
Hongying Cai1, Pengjun Shi1, Yingguo Bai, Huoqing Huang, Tiezheng Yuan, Peilong Yang, Huiying Luo,
Kun Meng, Bin Yao∗
Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 1 April 2011
Received in revised form 22 August 2011
Accepted 25 September 2011
Available online 1 October 2011
A novel endo-␤-1,4-xylanase gene (xyn10C1) was cloned from Penicillium pinophilum C1 and overex-
pressed in Pichia pastoris. The 1071-bp full-length gene encodes a 356-residue polypeptide containing
the catalytic domain of glycoside hydrolase 10. Deduced XYN10C1 shares highest amino acid sequence
identity of 49.3% with a putative xylanase from Glomeella graminicola M1.001. Purified recombinant
XYN10C1 showed maximal activity at pH 4.0–5.5 and 75 ◦C, exhibited good adaptability to broad acidic
pH and temperature ranges (>69.0% activity at pH 2.5–6.5; and >91.0% activity at 70–80 ◦C and 22.2% even
at 90 ◦C), and was highly stable at pH 2.0–7.0 for 1 h at 37 ◦C. The specific activity, Km and Vmax values
for birchwood xylan and soluble wheat arabinoxylan were 100.7 and 137.4 U/mg, 4.3 and 6.9 mg/ml, and
195.4 and 209.3 ␮mol/min/mg, respectively. The enzyme was strongly resistant to most metal ions and
proteases (pepsin and trypsin). Under simulated mashing conditions, addition of XYN10C1 (80 U) to the
brewery mash (12.5 g in 50 ml system) significantly increased the filtration rate by 26.7% and reduced
the viscosity by 9.8%, respectively. All these favorable enzymatic properties make XYN10C1 attractive for
potential applications in the food and animal feed industries.
Keywords:
Penicillium pinophilum C1
Xylanase
Thermoacidophilic
Pichia pastoris
Malting and brewing
© 2011 Elsevier Ltd. All rights reserved.
1. Introduction
Various microorganisms have been reported to be xylanase
producers, including bacteria, actinomycetes, fungi, protozoa, and
Xylan is one of the major hemicellulose components in plant
cell walls of monocots and hard woods, and is the second most
abundant polysaccharide after cellulose [1,2]. It is a heteroglycan
composed of a backbone of ␤-1,4-linked xylopyranose residues
substituted by a set of glycosidic-ester linkages as the side chains
[3]. Due to the heterogeneity and complexity of its structure, com-
plete hydrolysis of xylan requires a large variety of synergistically
acting enzymes, including endo-␤-1,4-xylanase, ␤-d-xylosidase,
␣-l-arabinofuranosidase, ␣-d-glucuronidase, acetylxylan esterase
and feruloyl or coumaroyl esterases [1]. Among them, endo-␤-
1,4-xylanase is the key enzyme to hydrolyze the main backbone
of xylan, yielding different lengths of short xylooligosaccharides
[4]. Xylanases are classified into glycosyl hydrolase (GH) families
5, 7, 8, 10, 11, and 43 based on the similarities of the amino
acid sequences (http://www.cazy.org/fam/acc GH.html) [5], and
majority of xylanases are confined into GH families 10 and 11
[1]. Compared with family 10 xylanases that have high molec-
ular masses (>30 kDa) and high pI values, family 11 xylanases
have relatively low molecular weight (19–25 kDa) and lower pI
values [6].
yeast. Among them, fungi attract much attention due to their
higher-level secretion of xylanolytic enzymes into the medium
[3]. Xylanases have been applied in the processes of commercial
food production, animal feed, baking, fruit juice clarification, waste
treatment, brewing, pulp biobleaching, bioconversion in fuels and
chemicals and textile production [7,8]. Each industry has specific
requirements, and thus prefers different xylanases with ideal prop-
erties. So far, most commercially available xylanases are produced
by Trichoderma and Aspergillus that lack thermostability and are
not active at acidic pH, thus limiting their applications in animal
feed and brewing industries [1]. Here we report a novel thermoaci-
dophilic xylanase from Penicillium pinophilum C1. The recombinant
xylanase produced in Pichia pastoris exhibited good adaptability to
acidic pH and high temperature even above 80 ◦C, and had superior
acid and thermal stability. In addition, the enzyme had strong resis-
tance to most chemicals and proteases. Its application potential in
brewing industry was also evaluated.
2. Materials and methods
2.1. Strains, vectors, materials and media
Penicillium pinophilum C1 isolated from the acidic wastewater (pH 3.0) of a tin
mine in Yunnan province, China, was obtained from the China General Microbio-
logical Culture Collection Center (CGMCC No. 4432). To induce xylanase production,
strain C1 was grown at 30 ◦C in the wheat bran medium consisting of 5 g/l (NH4)2SO4,
∗
Corresponding author. Tel.: +86 10 82106053; fax: +86 10 82106054.
E-mail addresses: yaobin@mail.caas.net.cn, yaobin@caas-bio.net.cn (B. Yao).
These authors contributed equally to this work.
1
1359-5113/$ – see front matter © 2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.procbio.2011.09.018

2342
H. Cai et al. / Process Biochemistry 46 (2011) 2341–2346
2.5. Xylanase activity assay
Table 1
Primers used in this study.
The xylanase activity was determined using the 3,5-dinitrosalicylic acid (DNS)
Primers
Sequences (5ꢀ → 3ꢀ)a
Size (bp)
method by measuring the release of reducing sugar from birchwood xylan [11]. The
standard assay mixture was composed of 0.1 ml of appropriately diluted enzyme
(2 U) and 0.9 ml 0.1 M citric acid–Na2HPO4 (pH 5.0) containing 1% (w/v) birch-
wood xylan. After incubation at 75 ◦C for 10 min, the reaction was terminated by
adding 1.5 ml DNS reagent, boiled for 5 min and cooled to room temperature. The
absorbance was measured at 540 nm. Each assay and its control were done in tripli-
cate. One unit of xylanase activity was defined as the amount of enzyme required to
produce 1 ␮mol of reducing sugar per min under the standard conditions (pH 5.0,
75 ◦C, 10 min).
GH10F1
GH10R1
C1F
C1R
GH10PF
GH10PR
GH10 usp1
GH10 usp2
GH10 usp3
GH10 dsp1
GH10 dsp2
GH10 dsp3
TGGGAYGTNGTNAAYGARGC
TAYTCTATRTTRWARTCRTT
20
20
26
25
34
36
24
22
19
21
20
22
CAGCTCAACGAGCTGGCCCAGAAGG
TTACACGTCCAGCGGCTTGCTCCTC
GGGGAATTCCAGCTCAACGAGCTGGCCCAGAAGG
GGGGCGGCCGCTTACACGTCCAGCGGCTTGCTCCTC
CTCAACGACAACGGCACGTACCGG
CGGCACGTACCGGTCCGACATC
CGACCCGGGCGCGAAGCTG
GTACAGCTTCGCGCCCGGGTC
CCTCGCTGGCCGCCTGGTAG
CGGACCGGTACGTGCCGTTGTC
2.6. Purification of recombinant XYN10C1
To purify recombinant XYN10C1, the induced culture was centrifuged at
12,000 × g for 10 min at 4 ◦C to remove cell debris and undissolved materials. The
cell-free culture supernatant was concentrated by ultrafiltration with Vivaflow 200
membrane of 10-kDa molecular weight cut-off (Vivascience, Hannover, Germany),
and loaded onto a FPLC HiTrap Q Sepharose XL 5 ml column (GE Healthcare, Uppsala,
Sweden) that was equilibrated with 20 mM citric acid–Na2HPO4 (pH 6.5). Proteins
were eluted using a linear gradient of NaCl (0–1.0 M) in the same buffer at a flow rate
of 3.0 ml/min. Fractions containing the enzyme activity were pooled and subjected
to sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) [12]. To
determine the protein concentration, a Bradford assay was used with bovine serine
albumin as a standard [13]. The purified recombinant XYN10C1 (1 ␮g) was treated
with 250 U of Endo H for 2 h at 37 ◦C according to the supplier’s instructions, and
the deglycosylated and untreated purified XYN10C1 were analyzed by SDS–PAGE.
a
Restriction sites are underlined, and R = A/G, N = A/C/G/T, and Y = C/T.
1 g/l KH2PO4, 0.5 g/l MgSO4·7H2O, 0.2 g/l CaCl2, 0.01 g/l FeSO4·7H2O, and 30 g/l wheat
bran [9].
Escherichia coli Trans1-T1 (TransGen, Beijing, China) cultivated at 37 ◦
C in
Luria–Bertani medium was used for gene cloning and sequencing. P. pastoris GS115
from Invitrogen (Carlsbad, CA) was cultivated at 30 ◦C for gene expression. Plas-
mids pEASY-T3 (TransGen) and pPIC9 (Invitrogen) were used for gene cloning and
expression, respectively. Media for P. pastoris growth and induction were prepared
according to the instruction of the Pichia Expression kit (Invitrogen).
Birchwood xylan, beechwood xylan, soluble wheat arabinoxylan and car-
boxymethyl cellulose-sodium (CMC-Na) were purchased from Sigma (St. Louis, MO).
The DNA purification kit, LA Taq DNA polymerase, and restriction endonucleases
were supplied by TaKaRa (Tsu, Japan), and T4 DNA ligase and endo-␤-N-
2.7. Biochemical characterization of purified recombinant XYN10C1
acetylglucosaminidase
(Hitchin, UK). All other chemicals used are of analytical grade and available com-
mercially.
H (Endo H) were obtained from New England Biolabs
The optimal pH of the purified recombinant XYN10C1 for xylanase activity was
determined at 50 ◦C and pH 2.0–8.0 for 10 min in the presence of 1% (w/v) birch-
wood xylan. The pH stability of XYN10C1 was estimated by measuring the residual
activity under standard conditions (pH 5.0, 75 ◦C, 10 min) after pre-incubation of
the enzyme solution in buffers at pH 2.0–7.0, 37 ◦C for 1 h without substrate. The
activity of XYN10C1 without incubation was set as 100%. The buffer used was 0.1 M
citric acid–Na2HPO4 (pH 2.0–8.0). The optimal temperature for xylanase activity was
determined by performing the reaction at temperatures ranging from 25 to 90 ◦C in
0.1 M citric acid–Na2HPO4 (pH 5.0) containing 1% (w/v) birchwood xylan for 10 min.
Thermostability of XYN10C1 was determined after pre-incubation of the enzyme in
0.1 M citric acid–Na2HPO4 (pH 5.0) at 65, 70 and 75 ◦C without substrate for different
periods. The remaining activity was assessed under standard conditions.
2.2. Cloning of the xylanase gene (xyn10C1)
Genomic DNA of strain C1 was isolated using the fungal DNA Mini kit (Omega
Bio-tek, Norcross, GA) and used as a template for PCR amplification. To obtain the
core region of the xylanase gene from strain C1, a degenerate primer set (GH10F1
and GH10R1) specific for fungal GH 10 xylanase genes and a touchdown PCR were
used as described by Luo et al. [9]. The resulting PCR fragment with appropriate size
was purified and ligated into the pEASY-T3 vector for sequencing and subjected to
BLAST analysis.
Thermal asymmetric interlaced (TAIL)-PCR was performed using nested
insertion-specific primers (Table 1) with an annealing temperature of 60 ◦C to obtain
the 5ꢀ and 3ꢀ flanking fragments of the core region. The resulting amplified frag-
ments with correct size were cloned into pEASY-T3 vector and sequenced, and then
assembled with the known fragment sequence to obtain the full-length xylanase
gene.
The effects of various metal ions (Na+, K+, Ca2+, Li+, Co2+, Cr3+, Ni2+, Cu2+
,
Mg2+, Fe3+, Mn2+, Zn2+, Pb2+, and Ag+) and chemical reagents (EDTA, SDS, and ␤-
mercaptoethanol) on the activity of purified XYN10C1 was determined at the final
concentrations of 1 mM and 5 mM, and its resistance to proteolysis by pepsin and
trypsin was determined as described before [14].
The kinetic parameters, Km and Vmax, for the purified recombinant enzyme were
determined in 0.1 M citric acid–Na2HPO4 (pH 5.0) containing 0.25–10 mg/ml birch-
wood xylan or soluble wheat arabinoxylan at 75 ◦C for 5 min. The resulting data were
plotted according to Lineweaver–Burk method [15] using the non-linear regres-
sion computer program GraFit (Version 7, Erithacus Software, Surrey, UK). Each
experiment was repeated three times and each experiment had three replicates.
Mycelia of strain C1 were harvested after 4-day growth in wheat bran-inducing
medium at 30 ◦C. Total RNA was extracted and purified using the total RNA isola-
tion system (Promega, Madison, WI) according to the instructions of manufacturer.
Reverse transcription (RT)-PCR was carried out to obtain the full-length xylanase
cDNA, using primers C1F and C1R (Table 1) with an annealing temperature of 60 ◦C.
2.8. Substrate specificity and analysis of xylan hydrolysis products
2.3. Sequence analysis
To investigate the substrate specificity of recombinant XYN10C1, the enzyme
activity was determined in the standard assay system containing 1% (w/v) of birch-
wood xylan, beechwood xylan, CMC-Na, soluble wheat arabinoxylan, insoluble
wheat arabinoxylan or barley ␤-glucan.
To study the hydrolysis products of birchwood xylan and soluble wheat ara-
binoxylan by purified recombinant XYN10C1, reactions containing 25 U purified
recombinant XYN10C1 and 0.5% (w/v) birchwood xylan or soluble wheat arabinoxy-
lan in 500 ␮l 0.1 M citric acid–Na2HPO4 (pH 5.0) were incubated at 37 ◦C for 12 h.
The excess enzyme was removed from the reaction using the Nanosep Centrifu-
gal 3 K Device (Pall, Chicago, IL). The products were analyzed by high-performance
anion-exchange chromatography (HPAEC) with a model 2500 system from Dionex
(Sunnyvale, CA) as described previously [14]. Xylose, xylobiose, xylotriose, xylote-
traose, and xylopentaose were used as standards.
Vector NTI 7.0 software was employed to assemble and analyze the DNA
sequence, and to calculate the molecular mass of mature peptide. The signal
peptide was predicted using SignalP (http://www.cbs.dtu.dk/services/SignalP/).
The exon–intron structure and transcription initiation sites of the full-length gene
were predicted using the online software FGENESH (http://linux1.softberry.com/
berry.phtml). Sequence homology database searches were conducted using
the BLAST server (http://www.ncbi.nlm.nih.gov/BLAST). Multiple align-
ments of protein sequences were performed using the ClustalW program
(http://www.ebi.ac.uk/clustalW). Homology modeling and electrostatic poten-
tial analysis was performed using Accelrys Discovery Studio software (DS 2.5,
http://www.accelrys.com) with the GH 10 xylanase from Cellulomonas fimi (PDB:
3CUF) as the template.
2.4. Expression of xyn10C1 in P. pastoris
2.9. Effects of XYN10C1 on the filtration rate and viscosity of mash
The gene fragment coding for the mature protein without the signal peptide
was amplified using the expression primers GH10PF and GH10PR (Table 1). The
PCR products were digested with EcoRI and NotI and cloned into pPIC9 under the
control of the alcohol oxidase promoter. The recombinant plasmid pPIC9-xyn10C1
was linearized using BglII and then transformed into P. pastoris GS115 competent
cells by electroporation. The fermentation in shake tubes and 1-l shake flasks was
carried out following the method of Qiu et al. [10].
Mash was prepared according to the method of Celestino et al. [16] with some
modifications. Malt was firstly triturated in a disintegrator followed by filtration
through a 0.2-mm sieve, and 12.5 g of malt was dissolved in 50 ml 0.1 M citric
acid–Na2HPO4 (pH 5.5) containing 40 U or 80 U XYN10C1. The reaction was incu-
bated at 45 ◦C for 30 min, 50 ◦C for 30 min, 60 ◦C for 60 min, and 70 ◦C for 30 min,
and boiled for 5 min. Addition of 0.1 M citric acid–Na2HPO4 (pH 5.5) instead of the

H. Cai et al. / Process Biochemistry 46 (2011) 2341–2346
2343
Fig. 1. Charge distribution on the surface of a three-dimensional model of XYN10C1. Negatively and positively charged surfaces are coloured red and blue, respectively. (A)
The surface showing the substrate cleft with the active site. (B) The opposite-side surface. (For interpretation of the references to colour in this figure legend, the reader is
referred to the web version of the article.)
enzyme solution was treated as a control. Each reaction was terminated by addition
of 50 ml cold water and immediately cooled down to room temperature.
The filtration rate was determined by filtering 10 ml of mash after reaction
through a 101 filter paper (Xinhua, Beijing, China). Filtration rate in the absence
of enzyme was used as a control. The reduction of filtration rate was calculated
using the following equation [10,16]:
an estimated theoretical molecular weight of 38.0 kDa. Based on
the sequence comparison, XYN10C1 had the catalytic domain typ-
ical of GH 10 and no cellulose binding domain. The deduced amino
acid sequence of XYN10C1 exhibited highest identity of 49.3% with
a putative xylanase from G. graminicola M1.001, followed by an
experimentally verified xylanase (XYND) from Penicillium funiculo-
sum (CAG25554; 44.4%). The putative tertiary structure of XYN10C1
is the classical (␣/␤)8 fold, and the two catalytic residues (Glu148
and Glu255) are located on the inner surface of the protein. Anal-
ysis of solvent-exposed amino acids revealed a low frequency of
positively charged residues on the surface (Fig. 1).
(
− ) × 100
control
control
ꢀ =
where is the total flow time of 10 ml and ꢀ is the filtration time reduction.
Viscosimetry was used to measure the mash viscosity with or without enzyme
treatment. Mash supernatant (5 ml) after filtration was subjected to viscosity assay
at 20 ◦C. Mash viscosity without enzyme addition was used as the control. The
viscosity reduction was calculated using the following equations:
ꢁwater × t × ꢂ
ꢁ =
3.2. Expression and purification of recombinant XYN10C1
twater × ꢂwater
The gene fragment for mature protein without the signal pep-
tide was cloned into vector pPIC9 and successfully expressed in
P. pastoris. Positive transformants were screened by measuring
the xylanase activity in the culture supernatant. The transfor-
mant showing the highest extracellular enzyme activity (2.3 U/ml)
was subjected to large-scale expression. After methanol induc-
tion for 72 h in 1 l shaker flask, the enzyme activity of 477 U/ml
was detected. XYN10C1 in the culture supernatant was purified
to electrophoretic homogeneity by a single-step anion-exchange
chromatography. The specific activity of the purified recombinant
XYN10C1 was 100.7 U/mg towards birchwood xylan. The apparent
molecular mass of purified recombinant XYN10C1 on SDS–PAGE gel
was found to be 60.0 kDa, which was much higher than its theoret-
ical molecular mass (38.0 kDa). After deglycosylation with Endo H,
the purified recombinant XYN10C1 yielded a single band of about
∼40.0 kDa (Fig. 2), which was in agreement with the calculated
molecular weight.
(ꢁcontrol − ꢁ) × 100
ꢀꢁ =
ꢁcontrol
where ꢁ is the viscosity, t is the total flow time through viscometer, ꢀꢁ is the
viscosity reduction, and ꢂ is the density.
2.10. Nucleotide sequence accession number
The nucleotide sequence for the GH 10 xylanase gene (xyn10C1) of P. pinophilum
C1 was deposited into the GenBank database under the accession number
HQ668176.
3. Results
3.1. Gene cloning and sequence analysis
A 158-bp xylanase gene fragment was amplified from the
genomic DNA of strain C1 with degenerate primers GH10F1 and
GH10R1. The fragment showed highest amino acid sequence
similarity of 64% with the family 10 xylanase from Glomerella
graminicola M1.001 (EFQ31642). The 3ꢀ and 5ꢀ flanking regions were
obtained by TAIL-PCR, and assembled with the core region to give
a 1939-bp fragment. One complete chromosomal gene of 1253 bp
was identified by FGENESH.
The full-length cDNA sequence (1071 bp, see supplementary Fig.
S1) of the xylanase gene, denoted xyn10C1, was obtained by RT-PCR
from P. pinophilum C1. Two introns (100 bp and 82 bp, respec-
tively) interrupted the coding sequence. A putative 18-residue
signal peptide at N-terminus was identified by SignalP analysis. The
deduced mature protein of XYN10C1 contained 356 residues with
3.3. Enzyme characterization
Purified recombinant XYN10C1 had a pH optimum of 4.0–5.5
at 50 ◦C and broad pH adaptability, retaining more than 80% of the
maximal activity at pH 3.0–6.5 and 69% activity at pH 2.5 (Fig. 3A).
The apparent temperature optimum of XYN10C1 was 75 ◦C at pH
5.0 (Fig. 3B). The enzyme retained almost all of the activity after
incubation for 1 h at pH 2.0–7.0 (Fig. 3C). In the thermostability
assay, XYN10C1 was highly stable at 65 ◦C for 1 h, but lost almost
half of its activity at 70 ◦C for 30 min and 80% activity at 75 ◦C for
10 min (Fig. 3D).

2344
H. Cai et al. / Process Biochemistry 46 (2011) 2341–2346
Table 2
Effects of metal ions and chemical reagents on purified recombinant XYN10C1
activity.
Chemicals
Relative activity (%)a
1 mM
5 mM
None
100.0
100.0
Na+
110.9 1.2
111.3 1.5
108.0 0.8
111.4 1.0
110.3 1.8
109.9 1.4
106.8 1.7
103.4 2.6
104.2 1.7
101.7 0.9
106.8 2.3
103.9 2.0
98.4 0.9
60.4 1.2
97.2 2.0
118.6 1.8
110.0 1.1
107.8 2.0
103.7 0.5
109.6 1.0
104.3 1.8
112.3 0.8
104.6 0.9
67.0 1.4
107.4 1.1
102.3 0.8
100.8 2.3
93.2 1.8
57.5 1.1
4.8 1.4
K+
Ca2+
Li+
Co2+
Cr3+
Ni2+
Cu2+
Mg2+
Fe3+
Mn2+
Fig. 2. SDS–PAGE analysis of the purified recombinant XYN10C1. Lane 1, standard
protein molecular weight markers; lane 2, the culture supernatant; lane 3, the
purified recombinant XYN10C1; lane 4, the purified recombinant XYN10C1 after
deglycosylation with Endo H.
Pb2+
Ag+
SDS
EDTA
␤-Mercaptoethanol
89.7 0.6
126.0 2.7
a
Values represent the mean SD (n = 3) relative to untreated control samples.
The effect of different metal ions or chemical reagents on the
activity of purified XYN10C1 was determined at a final concen-
tration of 1 and 5 mM (Table 2). At low concentration, all the
chemicals except for SDS enhanced or had no effects on the enzyme
activity. At the concentration of 5 mM, Ag+, Cu2+, and EDTA inhib-
ited the enzyme activity partially. SDS was a strong inhibitor for
XYN10C1 activity, resulting in 40% loss of activity at 1 mM and
almost complete loss at 5 mM. XYN10C1 was highly resistant to
proteolytic digestion, showing 118.6% and 126.0% of its initial
activity after incubation for 2 h at 37 ◦C with pepsin and trypsin,
respectively.
3.4. Substrate specificity and kinetic parameters
The enzyme activity of purified recombinant XYN10C1 towards
different types of substances was detected. When defined the
activity towards birchwood xylan as 100.0%, the enzyme showed
highest activity on soluble wheat arabinoxylan (136.4%), followed
by beechwood xylan (101.7%). No activity was detected in the
presence of barley ␤-glucan, CMC-Na and insoluble wheat arabi-
noxylan.
A
B 120
100
80
120
100
80
60
40
20
0
60
40
20
0
2
3
4
5
6
7
8
20
30
40
50
60
70
80
90
pH
Temperature (°C)
65°C
70°C
75°C
C
D 120
120
100
80
60
40
20
0
100
80
60
40
20
0
2
3
4
5
6
7
8
0
10
20
30
40
50
60
pH
Time (min)
Fig. 3. Characterization of the purified recombinant XYN10C1. (A) The effect of pH on xylanase activity. The activity assay was performed at 50 ◦C in buffers of pH 2.0–8.0 for
10 min. (B) The effect of temperature on xylanase activity measured in 0.1 M citric acid–Na2HPO4 (pH 5.0) for 10 min. (C) pH stability of XYN10C1. After pre-incubating the
enzyme at 37 ◦C for 1 h at pH 2.0–8.0, the residual activity was measured in 0.1 M citric acid–Na2HPO4 (pH 5.0, 75 ◦C). (D) Thermostability of purified XYN10C1. The enzyme
was pre-incubated at 65 ◦C (ꢀ), 70 ◦C (ꢁ), or 75 ◦C (ꢂ) in 0.1 M citric acid–Na2HPO4 (pH 5.0). Aliquots were removed at specific time points for measurement of residual
activity in the same buffer at 75 ◦C. Each value in the panel represents the mean SD (n = 3).

H. Cai et al. / Process Biochemistry 46 (2011) 2341–2346
2345
1,400
1,200
1,000
800
1,100
nC
nC
B
A
800
600
400
200
X1
X2
600
400
X2
X1
200
-100
-100
20.0
25.0
30.0
35.1
10.0
min
15.0
min
0.0
5.0
10.0
0.0
5.0
15.0
20.0
25.0
30.0
35.1
Fig. 4. HPAEC analyses of the hydrolysis products of birchwood xylan (A) and soluble wheat arabinoxylan (B) by XYN10C1. X1 represents xylose, and X2 represents xylobiose.
Kinetic parameters of XYN10C1 on soluble wheat arabi-
noxylan and birchwood xylan were determined. The Km and
Vmax values towards soluble wheat arabinoxylan were 6.9 mg/ml
and 209.3 ␮mol/min/mg, respectively. Using birchwood xylan
as the substrate, the Km and Vmax values were 4.3 mg/ml and
195.4 ␮mol/min/mg, respectively.
to be a repulsion of its excess negative charges and the altered
conformation of the enzyme [23]. The enzyme could be denatured
when it loses its functional conformation.
The optimal temperature of XYN10C1 for xylanase activity was
75 ◦C, which was much higher than that of most known GH 10
xylanases of Penicillia, such as XynA (60 ◦C) from Penicillium pur-
purogenum, XynA and XynB (47–48 ◦C) from Penicillium capsulatum,
and XYLP from Penicillium chrysogenum (40 ◦C) [8]. Only a few
fungal xylanases have the similar or higher optimal temperature
(≥75 ◦C), including the xylanase (75 ◦C) from thermophilic fungus
Talaromyces thermophilus [24], and XYL10C (85 ◦C) from Bispora sp.
MEY-1 [9]. XYN10C1 was stable at 65 ◦C, and this thermostable
character is an important prerequisite for commercialization and
industrial applications [25]. Besides, XYN10C1 showed high activ-
ity towards various xylan substrates (soluble wheat arabinoxylan,
beechwood xylan and birchwood xylan), but had no ability to
degrade CMC-Na. In such a case, XYN10C1 can be applied in a
number of biotechnological applications where the existence of
cellulose is undesirable [26].
3.5. Analysis of hydrolysis products
The products of birchwood xylan and soluble wheat arabinoxy-
lan by XYN10C1 hydrolysis were analyzed by HPAEC (Fig. 4). The
main products were xylose and xylobiose. The composition of
hydrolysis products from birchwood xylan were 44.5% xylose and
55.5% xylobiose. The hydrolysis products of soluble wheat arabi-
noxylan were 38.8% xylose and 61.2% xylobiose.
3.6. Effects of XYN10C1 on the filtration rate and viscosity of mash
The specific filtration rate and viscosity of mash (12.5 g in 50 ml
0.1 M citric acid–Na2HPO4, pH 5.5) were reduced by 22.3% and 5.0%
with 40 U of purified XYN10C1, respectively. Higher reduction in
the filtration rate (26.7%) and viscosity (9.8%) were observed when
80 U XYN10C1 was used.
The effects of various metal ions on xylanase activity of XYN10C1
were tested. Of tested ions, Cu2+ has been reported to be an inhibitor
of most GH 10 xylanases [10,20,27], Co2+ and Ni2+ strongly inhibited
the activity of XYN10G5 from Phialophora sp. G5 [20], and Zn2+
had a moderate to significant inhibitory effect on xylanase activity
4. Discussion
[10,19]. XYN10C1 under study shows resistance to Cu2+, Co2+, Ni2+
,
and Zn2+ as XYL10C from Bispora sp. MEY-1 is [9]. Moreover, the
residual activity increased by 1.2–1.3 folds after treatment with
pepsin and trypsin. These properties suggest XYL10C has potential
for application in the animal feed industry.
The genus Penicillium is a promising producer of xylanolytic
enzymes suitable for applications in various industries [8]. In
this study, a novel xylanase from P. pinophilum C1 was identified,
cloned, functionally expressed and characterized. XYN10C1 has
a pH optimum at 4.0–5.5, similar to most fungal xylanases, such
as XYL10C (pH 4.5–5.0) from Bispora sp. MEY-1 [9], XynD (pH
4.2–5.2) from P. funiculosum [17], and xylanase II (pH 4.5) from
Penicillium sclerotiorum [18], which are different from the neutral
and alkaline pH optima of bacterial and few fungal xylanases [1,19].
Moreover, XYN10C1 is adaptable to a broader range of acidic pH.
At pH 2.5, the enzyme still exhibited 69% of the maximal activity,
significantly higher than xylanase II from P. sclerotiorum and
XYN10G5 from Phialophora sp. G5 that have little enzyme activity
(<30%) at pH 3.0 [18,20]. XYN10C1 has more acidic residues—the
ratio of acidic (Asp and Glu) to basic residues (Lys and Arg) is
48:28. It might be the key factor of its acidophilicity and broad
pH catalytic adaptation. XYN10C1 was only stable at acidic and
neutral conditions (pH 2.0–7.0). This property is similar to reported
GH 10 fungal xylanases, such as XYL10C from Bispora sp. MEY-1
[9] and XynA from Acidobacterium capsulatum [21]. Electrostatic
potential analysis indicates that GH 10 fungal xylanases have more
negative residues around the catalytic sites and on the surface
by comparison with alkaline active xylanases (Fig. 1). The acid
stability of these enzymes has been ascribed to the acidic residues
on the surface and low pIs [22]. The enzyme activities decreased
greatly at alkaline pH, and this instablility has been reported
During the mashing process, some factors might influence the
production of beer, such as producing the extracts at low levels,
slowing down the filtration rate, and forming some gelatinous
precipitates that leads to the high wort viscosity and increased
turbidity [28]. To increase mash efficiency, higher temperature
and addition of xylanase are developed to facilitate the degra-
dation of arabinoxylan in barley malts [29]. Under simulated
mashing conditions, XYN10C1 at the concentration of 80 U could
efficiently increase the filtration rate (26.7%) and decrease the
mash viscosity (9.8%), significantly higher than the commercial
xylanase (200 U) that increased the filtration rate by 20.2% and
reduced the viscosity by 4.8% of the mash [30]. So, XYN10C1 might
be used as a possible candidate for application in the brewing
industry.
In summary, XYN10C1 was a novel acidic xylanase of family
10, exhibited optimal activity at pH 4.0–5.5 and 75 ◦C, and had
good adaptability and stability to a broad acidic pH range. More-
over, the enzyme showed high hydrolysis efficiency towards wheat
arabinoxylan, had simple hydrolysis products, and was highly resis-
tant to most metal cations and proteases (pepsin and trypsin). All
these favorable characters make XYN10C1 potentially beneficial in
various biotechnological processes, especially the food and feed
industries.

2346
H. Cai et al. / Process Biochemistry 46 (2011) 2341–2346
and overexpression in Pichia pastoris. Appl Microbiol Biotechnol 2009;82:
Acknowledgements
423–61.
[15] Lineweaver H, Burk D. The determination of enzyme dissociation constants. J
Am Chem Soc 1934;56:658–66.
[16] Celestino KR, Cunha RB, Felix CR. Characterization of a ␤-glucanase produced
by Rhizopus microsporus var. microsporus, and its potential for application in
the brewing industry. BMC Biochem 2006;7:23.
This work was supported by the Earmarked Fund for Modern
Agro-industry Technology Research System (NYCYTX-42-G2-05)
and the Key Program of Transgenic Plant Breeding (2008ZX08003-
002).
[17] Furniss CSM, Williamson G, Kroon PA. The substrate specificity and sus-
ceptibility to wheat inhibitor proteins of Penicillium funiculosum xylanases
from
574–82.
a commercial enzyme preparation. J Sci Food Agric 2005;85:
Appendix A. Supplementary data
[18] Knob A, Carmona EC. Purification and characterization of two extracellular
xylanases from Penicillium sclerotiorum: a novel acidophilic xylanase. Appl
Biochem Biotechnol 2010;162:429–43.
[19] Yu EKC, Tan LUL, Chan MKH, Deschatelets L, Saddler JN. Production of ther-
mostable xylanase by a thermophilic fungus Thermoascus aurantiacus. Enzyme
Microb Technol 1987;9:16–24.
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.procbio.2011.09.018.
References
[20] Zhang F, Shi P, Bai Y, Luo H, Yuan T, Huang H, et al. An acid and highly
thermostable xylanase from Phialophora sp. G5. Appl Microbiol Biotechnol
2011;89:1851–8.
[21] Inagaki K, Nakahira K, Mukai K, Tamura T, Tanaka H. Gene cloning and char-
acterization of an acidic xylanase from Acidobacterium capsulatum. Biosci
Biotechnol Biochem 1998;62:1061–7.
[22] Mamo G, Thunnissen M, Hatti-Kaul R, Mattiasson B. An alkaline active
xylanase: insights into mechanisms of high pH catalytic adaptation. Biochimie
2009;91:1187–96.
[23] Huang Y, Krauss G, Cottaz S, Driguez H, Lipps G. A highly acid-stable and ther-
mostable endo-␤-glucanase from the thermoacidophilic archaeon Sulfolobus
solfataricus. Biochem J 2005;385:581–8.
[24] Maalej I, Belhaj I, Masmoudi FN, Belghith H. Highly thermostable xylanase of
the thermophilic fungus Talaromyces thermophilus: purification and character-
ization. Appl Biochem Biotechnol 2008;158:200–12.
[25] Eijsink VGH, Gaseidnes S, Borchet TV, van den Burg B. Direct evolution of
enzyme stability. Biomol Eng 2005;22:21–30.
[26] Polizeli ML, Rizzatti AC, Monti R, Terenzi HF, Jorge JA, Amorim DS. Xylanases
from fungi: properties and industrial applications. Appl Microbiol Biotechnol
2005;67:577–91.
[27] Belancic A, Scarpa J, Peirano A, Díaz R, Steiner J, Eyzaguirre J. Penicillium pur-
purogenum produces several xylanases: purification and properties of two of
the enzymes. J Biotechnol 1995;41:71–9.
[1] Collins T, Gerday C, Feller G. Xylanases, xylanase families and extremophilic
xylanases. FEMS Microbiol Rev 2005;29:3–23.
[2] Puls J, Schuseil J. Chemistry of hemicelluloses: relationship between hemi-
cellulose structure and enzymes required for hydrolysis. In: Coughlan MP,
Hazlewood GP, editors. Hemicellulose and hemicellulases. London: Portland
Press; 1993. p. 1–27.
[3] Ahmed S, Riaz S, Jamil A. Molecular cloning of fungal xylanases: an overview.
Appl Microbiol Biotechnol 2009;84:19–35.
[4] Biely P. Microbial xylanolytic systems. Trends Biotechnol 1985;3:286–90.
[5] Henrissat BA. Classification of glycosyl hydrolases based on amino acid
sequence similarities. Biochem J 1991;280:309–16.
[6] Henrissat B, Bairoch A. Updating the sequence-based classification of glycosyl
hydrolases. Biochem J 1996;316:695–6.
[7] Beg QK, Kapoor M, Mahajan L, Hoondal GS. Microbial xylanases and their indus-
trial applications: a review. Appl Microbiol Biotechnol 2001;56:326–38.
[8] Chávez R, Bull P, Eyzaguirre J. The xylanolytic enzyme system from the genus
Penicillium. J Biotechnol 2006;123:413–33.
[9] Luo H, Li J, Yang J, Wang H, Yang Y, Huang H, et al. A thermophilic and
acid stable family-10 xylanase from the acidophilic fungus Bispora sp. MEY-1.
Extremophiles 2009;13:849–57.
[10] Qiu Z, Shi P, Luo H, Bai Y, Yuan T, Yang P, et al. A xylanase with broad
pH and temperature adaptability from Streptomyces megasporus DSM 41476,
and its potential application in brewing industry. Enzyme Microb Technol
2010;46:506–12.
[28] Gupta N, Reddy VS, Maiti S, Ghosh A. Cloning, expression, and sequence
analysis of the gene encoding the alkali-stable, thermostable endoxylanase
from alkalophilic, mesophilic Bacillus sp. Strain NG-27. Appl Environ Microbiol
2000;66:2631–5.
[29] Li Y, Lu J, Gu G, Shi Z, Mao Z. Mathematical modeling for prediction of endo-
xylanase activity and arabinoxylans concentration during mashing of barley
malts for brewing. Biotechnol Lett 2004;26:779–85.
[11] Miller GL. Use of dinitrosalicylic acid reagent for determination of reducing
sugar. Anal Chem 1959;31:426–8.
[12] Laemmli UK. Cleavage of structural proteins during the assembly of the head
of bacteriophage T4. Nature 1970;227:680–5.
[13] Bradford MM. A rapid and sensitive method for the quantitation of micro-
gram quantities of protein utilizing the principle of protein-dye binding. Anal
Biochem 1976;72:248–54.
[14] Luo H, Wang Y, Wang H, Yang J, Yang Y, Huang H, et al. A novel highly acidic
␤-mannanase from the acidophilic fungus Bispora sp. MEY-1: gene cloning
[30] Bai Y, Wang J, Zhang Z, Shi P, Luo H, Huang H, et al.
A novel fam-
ily 9 ␤-1,3(4)-glucanase from thermoacidophilic Alicyclobacillus sp. A4 with
potential applications in the brewing industry. Appl Microbiol Biotechnol
2010;87:251–9.