Antitubercular nucleosides that inhibit siderophore biosynthesis: SAR of the glycosyl domain

Article abstract of DOI:10.1021/jm061068d

Tuberculosis is the leading cause of infectious disease mortality in the world by a bacterial pathogen. We previously demonstrated that a bisubstrate inhibitor of the adenylation enzyme MbtA, which is responsible for the second step of mycobactin biosynth

Full text of DOI:10.1021/jm061068d

J. Med. Chem. 2006, 49, 7623-7635
7623
Antitubercular Nucleosides That Inhibit Siderophore Biosynthesis: SAR of the
Glycosyl Domain
Ravindranadh V. Somu,† Daniel J. Wilson,† Eric M. Bennett,† Helena I. Boshoff,‡ Laura Celia,§ Brian J. Beck,§
Clifton E. Barry, III,‡ and Courtney C. Aldrich*,†
Center for Drug Design, Academic Health Center, UniVersity of Minnesota, Minneapolis, Minnesota 55455, Tuberculosis Research Section,
National Institute of Allergy and Infectious Diseases, RockVille, Maryland 20852-1742, and Bacteriology Program, American Type Culture
Collection, Manassas, Virginia 20110
ReceiVed September 11, 2006
Tuberculosis is the leading cause of infectious disease mortality in the world by a bacterial pathogen. We
previously demonstrated that a bisubstrate inhibitor of the adenylation enzyme MbtA, which is responsible
for the second step of mycobactin biosynthesis, exhibited potent antitubercular activity. Here we systematically
investigate the structure-activity relationships of the bisubstrate inhibitor glycosyl domain resulting in the
identification of a carbocyclic analogue that possesses a KIapp value of 2.3 nM and MIC99 values of 1.56 µM
against M. tuberculosis H37Rv. The SAR data suggest the intriguing possibility that the bisubstrate inhibitors
utilize a transporter for entry across the mycobacterial cell envelope. Additionally, we report improved
conditions for the expression of MbtA and biochemical analysis, demonstrating that MbtA follows a random
sequential enzyme mechanism for the adenylation half-reaction.
Introduction
actively imported by dedicated bacterial membrane transporters.6
M. tuberculosis produces two series of structurally related
peptidic siderophores known as mycobactin-T7 and carboxy-
mycobactins8 that vary by the appended lipid residue and will
be, hereafter, collectively referred to as the “mycobactins”
(Figure 1).9,10 Initially, the mycobactins were regarded as an
“essential substance” because they were found to be required
for growth by Mycobacterium paratuberculosis.11 The myco-
bactins were first recognized as potential chemotherapeutic
targets as early as 1945 when J. Francis pointed out that they
would provide a good model for the development of chemo-
therapeutic agents, because if antagonists could be found, then
they would be highly selective.9 Indeed derivatives of myco-
bactins produced through chemical synthesis have been found
to have antituberculosis activity and may likely act as myco-
bactin antagonists.12-14 Recent advances in the understanding
of mycobactin biosynthesis have provided new opportunities
to antagonize siderophore production in M. tuberculosis. The
corresponding biosynthetic genes for these siderophores are
clustered in two different regions of the M. tuberculosis
genome.15-17 The mbt-1 cluster (mbtA-mbtJ) encodes for a set
of proteins that builds the mycobactin core scaffold.16 The mbt-2
locus (mbtK-mbtN) encodes for four gene products responsible
for activation and attachment of the lipid residue.17 Both gene
clusters are transcriptionally regulated by the IdeR repressor
protein that binds Fe(II).18 During iron-limitation, IdeR dissoci-
ates from the promoter region, enabling transcription of the mbt
operons.
Tuberculosis (TBa) is the leading cause of infectious disease
mortality in the world by a bacterial pathogen, and an estimated
8 million people are diagnosed each year with TB.1 The
emergence of extensively drug-resistant (XDR) TB strains that
are refractory to treatment by the first-line agents isoniazid and
rifampin as well as three or more of the six second-line drugs
is cause for grave concern. The Centers of Disease Control found
that from 2000 to 2004, XDR-TB increased from 5% of
multidrug resistant TB cases to 6.5% worldwide.2 In the
industrialized nations (including the United States) in the survey,
XDR-TB increased from 3 to 11% during this same 5-year
period. Consequently, the development of new drugs is urgently
needed for this virtually untreatable form of TB.
The acquisition of iron by M. tuberculosis and other
pathogenic bacteria is an essential process. In a mammalian host,
the concentration of free iron in serum and body fluids is too
low to support bacterial growth.3 The extracellular iron of the
host is primarily bound by iron transport proteins such as the
transferrins and lactoferrins, while intracellular iron is seques-
tered by heme compounds and iron-sulfur clusters in various
proteins and in the iron storage protein ferritin.4 Therefore,
bacteria have evolved a number of mechanisms to obtain this
vital micronutrient. The most prevalent mechanism involves the
synthesis, secretion, and reuptake of small molecule iron
chelators termed siderophores.4,5 Siderophores extract iron from
host proteins, and the resulting ferric-siderophore complex is
The crucial role of the mycobactins for virulence was
demonstrated through a targeted genetic disruption of mbtB,
which blocked mycobactin production.19 Significantly, the
resulting mutant strain was restricted for growth in iron-limiting
media and impaired for growth in macrophage THP-1 cells.19
The siderophore knockout strain of M. tuberculosis also
exhibited retarded iron acquisition in the phagosomal compart-
ment of macrophages compared to wild-type M. tuberculosis.20
The finding that mycobactins directly acquire intracellular iron
through lipid trafficking provided the first evidence that these
siderophores are important in vivo.21 Furthermore p-aminosali-
* To whom correspondence should be addressed. Phone: 612-625-7956.
Fax: 612-626-5173. E-mail: aldri015@umn.edu.
† University of Minnesota.
‡ National Institute of Allergy and Infectious Diseases.
§ American Type Culture Collection.
a Abbreviations: DBU, 1,8-diazabicyclo[5.4.0]undec-7-ene; MBP, mal-
tose binding protein; MIC, minimum inhibitory concentration; NHS,
N-hydroxysuccinimide; NRPS, nonribosomal peptide synthetase; PAS, para-
aminosalicylic acid; PDB, protein data bank; PKS, polyketide synthase;
SAR, struture-activity relationships; SUMO, small ubiquitin modifying
protein; TB, tuberculosis; TBAF, tetrabutylammonium fluoride; TBS, tert-
butyldimethylsilyl; TFA, trifluoroacetic acid; XDR, extensively drug-
resistant.
10.1021/jm061068d CCC: $33.50 © 2006 American Chemical Society
Published on Web 12/21/2006

7624 Journal of Medicinal Chemistry, 2006, Vol. 49, No. 26
Somu et al.
Figure 1. Biosynthesis of the mycobactins by a mixed NRPS-PKS assembly line initiated by MbtA.
cylic acid (PAS), a drug used for the treatment of TB, has been
shown to inhibit mycobactin synthesis; however, the large doses
(up to 12 g/day) and resulting gastrointestinal side effects have
relegated PAS to a second-line agent.22,23 In addition, several
other observations have indirectly provided evidence for the
importance of mycobacterial iron metabolism. Thus, iron
overload and active TB infection are inversely correlated,24 and
M. tuberculosis containing a constitutively expressed IdeR iron
repressor homologue exhibited attenuated virulence in a BALB/c
mouse model.25 Collectively, these findings have established
the mycobactins and iron acquisition as critical for pathogenesis
of M. tuberculosis.
Mycobactins are mixed-ligand siderophores that are charac-
Figure 2. The bisubstrate inhibitor template is comprised of four
domains: aryl, linker, glycosyl, and base. The acylphosphate linkage
of the acyl adenylate intermediate 2 is mimicked by an acylsulfamate
linkage in salicyl-AMS 6. The expanded portion of the figure shows
the glycosyl modifications described herein.
terized by an aromatic hydroxy acid, which caps the N-terminus
of a highly modified peptidic scaffold.5 These are biosynthesized
by large modular enzymes termed the nonribosomal peptide
synthetases (NRPSs) because they operate independently of the
mRNA templated ribosomal machinery and function analo-
gously to the well-studied type I polyketide synthases (PKSs)
with their modular organization and use of a thiotemplate
mechanism.26,27 The enzymology of NRPS-catalyzed sidero-
phore biosynthesis has been intensively investigated over the
past decade, enabling the rational design of small molecule
inhibitors toward these proteins.28
in most members of the adenylate-forming enzyme superfamily
and the functionally related aminoacyl tRNA synthetases.27,38
In the adenylation or first half-reaction, binding of ATP and
salicylic acid 1 is followed by nucleophilic attack of the substrate
carboxylate on the R-phosphate of ATP to generate a tightly
bound acyl adenylate 2 and the release of pyrophosphate (Figure
1). In the acylation or second half-reaction, the enzyme binds
the phosphopantetheine cofactor of the N-terminal thiolation
domain of MbtB and transfers the acyl adenylate 2 onto the
nucleophilic sulfur atom of this cofactor moiety to provide
salicyl-bound-MbtB 3, which is ultimately elaborated to the
mycobactins.
The reaction mechanism catalyzed by MbtA presents several
opportunities to develop inhibitors against MbtA. The finding
that acyl adenylate species bind several orders of magnitude
more tightly than the substrate acids suggests that analogues
incorporating stable linkers as bioisosteres of the labile acylphos-
phate function will provide potent enzyme inhibitors.34,39 This
tight binding is essential to ensure that the acyl adenylate is
not lost to the bulk solvent through diffusion before this is
channeled to the corresponding acceptor residue. Additionally,
sequestering the acyl adenylate by the enzyme may reduce the
likelihood of adventitious hydrolysis of the mixed phosphoric-
carboxylic acid anhydride. Inhibitors based on this design
principle are considered bisubstrate inhibitors because they are
expected to interact with both substrate binding pockets.40
Bisubstrate inhibitors that simply mimic the acyl adenylate
intermediate can be further classified as intermediate mimetics.35
The inhibitor scaffold is thus comprised of four domains (Figure
2). Modifications of the linker region have been most extensively
investigated.39,41-44 Previously, we synthesized acylsulfamate,
acylsulfamide, â-ketophosphonate, acyltriazole, sulfamate, â-ke-
tosulfonamide, and R,R-difluoro-â-ketosulfonamide linkages as
surrogates for the labile acylphosphate linkage.44,45 Among these
salicyl-AMS inhibitors 6 and 7 incorporating the acylsulfamate
and acylsulfamide linkages, respectively, exhibited the highest
activity (see Figure 2). In this article, we have systematically
examined the role of the ribose subunit of the salicyl-AMS
inhibitor scaffold through the preparation of inhibitors 8-13
The mycobactin core scaffold is synthesized through the
activity of six enzymes MbtA-F that comprise a mixed NRPS-
PKS assembly line.15-17 The salicylic acid starter unit is
prepared by a dedicated enzyme, MbtI, which utilizes the
primary metabolite chorismate as a substrate.29-31 Biosynthesis
is initiated by the stand-alone adenylation enzyme MbtA, which
activates salicylic acid at the expense of ATP and loads the
adenylated intermediate onto the thiolation domain of MbtB,
where it undergoes sequential elongation by serine (catalyzed
by MbtB), lysine (catalyzed by MbtE), two malonyl CoA’s (to
form the â-hydroxybutyrate residuescatalyzed by the PKS
enzymes MbtC and MbtD), and another molecule of lysine
(catalyzed by MbtF).16 Additional modifications through lipi-
dation (catalyzed by MbtK) and N-hydroxylation (catalyzed by
MbtG) of the lysine residues provides the mycobactins.17,32,33
The second biosynthetic step, catalyzed by MbtA, is an
attractive point to block for the following reasons. First, the
adenylating enzyme MbtA is a member of the well-studied
adenylate-forming enzyme superfamily, and inhibitors of the
functionally related aminoacyl tRNA synthetases have already
been developed and are used clinically (e.g., mupirocinsa
topical antibiotic, an inhibitor of isoleucyl tRNA synthetase).34,35
Second, the crystal structures of the adenylation domains DhbE
determined by Stubbs and co-workers allowed the development
of a homology model of MbtA.36 Third, comparison of mbtA
to the human proteome showed no functional homologs. Fourth,
inhibitors toward the adenylation protein MbtA are expected
to be useful against the biosynthesis of a wide array of
structurally diverse siderophores that are capped with an aryl
acid.28 Finally, the mycobactin auxotrophy of M. paratubercu-
losis was recently shown to be due to a truncation of mbtA.37
MbtA incorporates salicylic acid into the mycobactin core
scaffold, using a two-step reaction that is mechanistically similar

Adenylation Inhibitors of Siderophore Biosynthesis
Journal of Medicinal Chemistry, 2006, Vol. 49, No. 26 7625
Scheme 2a
Scheme 1a
a Reaction conditions: (a) 2,2′-dimethoxypropane, MeSO3H, acetone,
84%; (b) NH2SO2Cl, NaH, DME, 63%; (c) DBU, DMF, 60%; (d) 80% aq
TFA, 66%.
a Reaction conditions: (a) TBSCl, imidazole, cat. DMAP, DMF, 84%
(20); (b) 50% aq TFA, 60%; (c) p-TsOH, MeOH, 78% over 2 steps (23);
(d) NH2SO2Cl, NaH, DME, 38% (24), 82% (25); (e) Cs2CO3, DMF; (f)
DBU, DMF, 87% (28); (g) Pd/C, H2, MeOH, 17% over 2 steps (29); (h)
TBAF, THF, 50%; (i) 80% aq TFA, 53% over 2 steps.
(Figure 2). Additionally, we report the cloning, overexpression,
and purification of MbtA. Biochemical analysis of MbtA using
a bisubstrate inhibitor has provided details into the reaction
mechanism of the first half-reaction catalyzed by a NRPS
adenylating enzyme. Comparison of the in vitro enzyme
inhibition of MbtA as well as in vivo activity against whole-
cell M. tuberculosis has yielded important insight into specificity
of inhibitor uptake by M. tuberculosis.
Scheme 3a
Results
Chemistry. Inspired by the work of Vince and co-workers,
we initially investigated the synthesis of carbocyclic analog 8,
wherein the ribofuranose ring oxygen is replaced by a CH2.
Removal of the labile glycosidic linkage is expected to increase
both the lipophilicity and the metabolic stability.46 The synthesis
of 8 was most efficiently carried out from aristeromycin 14, a
nucleoside antibiotic produced by Streptomyces citricolor.47
Protection of 14 as the acetonide48 followed by sulfamoylation
afforded 15.49 Salicylation with NHS ester 16 in the presence
of DBU provided 17, which was deprotected with 80% aqueous
TFA to furnish 8 (Scheme 1).
a Reaction conditions: (a) HC(OMe)3, pTsOH; (b) (i) Ac2O, (ii) 6 N
HCl, 48% from 14; (c) NH2SO2Cl, NaH, DME, 55%; (d) 16, DBU, DMF,
81%; (e) 80% aq TFA, 80%; (f) Pd/C, H2, MeOH, 36%.
The importance of the 2′- and 3′-hydroxyls of the ribofuranose
moiety was explored by the preparation of analogues 9 and 10.
Initially, the chemistry was optimized on the 2′-deoxy nucleo-
side. Consistent with the greater instability of 2′-deoxy nucleo-
sides, we found that 9 was unstable under acidic conditions (80%
aq TFA, 3 h) previously employed for the synthesis of several
analogues and for the conversion of 20 to 21 (Vide infra).44 The
choice of the benzyl ether to protect the salicyl group was guided
by this consideration. The synthesis of analogue 9 began with
bis-silylation of 18 to afford 20, followed by selective removal
(50% aq TFA, 0 °C, 3 h)42 of the 5′-O-TBS to provide 21, which
was sulfamoylated to yield 24 (Scheme 2). Our established
salicylation protocol with 26, employing DBU as base, afforded
a recalcitrant DBU salt of 27, which was deprotected to afford
the DBU salt of 9. The DBU could not be removed by ion-
exchange or by chromatography (coeluting with 1% Et3N) that
had previously been successful in cases where the DBU salt
was obtained. We believe that the DBU salt forms a very tight
complex as we observed the [M+DBU+H]+ ion by mass
spectrometry. Additionally, we observed that the DBU salt of
9 was inactive in both the in vitro enzyme assay and against a
whole-cell assay of M. tuberculosis (data not shown), while the
triethylammonium salt of 9 displayed potent activity (Vide infra).
The lack of activity of the DBU salt also provides strong
corroborating evidence that this forms a tight complex with the
inhibitor. Thus, we turned to our complementary method
employing Cs2CO3 as base. Successful coupling of 24 to NHS
ester 2644 was realized employing 3 equiv of Cs2CO3 to provide
27. Sequential deprotection of the benzyl ether by catalytic
hydrogenation to 29 and TBS ether with TBAF afforded 9.
Synthesis of inhibitor 10 was initiated from the nucleoside
antibiotic cordycepin 19 using an analogous series of reactions
(Scheme 2). Protection as the di-O-TBS ether 22, followed by
the selective cleavage of the 5′-O-TBS, optimally proceeded
using p-TsOH in methanol to provide 23. Sulfamoylation of
the 5′-OH afforded 25 that was coupled to 26 employing DBU
to provide 28, which was isolated as the triethylammonium salt
illustrating the capricious nature of this reaction. Sequential
deprotection of the benzyl ether by catalytic hydrogenation to
30 and TBS ether with 80% aq TFA afforded 10.
We also examined analogues 11 and 12 lacking both the 2′-
and 3′-hydroxyl groups. For these analogues, the carbocyclic
sugar analogue was employed due to its greater stability.
Aristeromycin 14 was transformed to a cyclic orthoester 31
using triethyl orthoformate and perchloric acid (Scheme 3).50
Treatment of the resulting orthoester in refluxing Ac2O followed
by 4 N aq HCl afforded 32 with an overall yield of 48% from
14.50 Compound 32 was sulfamoylated to yield 33, which was
coupled to NHS ester 16 mediated by DBU to afford 34.
Deprotection of 34 with 80% aqueous TFA provided analogue
11. Catalytic hydrogenation of 11 provided the fully reduced
dideoxy analog 12.

7626 Journal of Medicinal Chemistry, 2006, Vol. 49, No. 26
Somu et al.
Scheme 4a
a Reaction conditions: (a) NH2SO2Cl, NaH, DME, 45%; (b) 26, DBU,
DMF, 44%; (c) Pd/C, H2, MeOH, 98%.
Additionally, the acyclo analogue 13 was prepared starting
from the acyclo nucleoside 3551, which was sulfamoylated to
provide 36 (Scheme 4).49 Coupling of 36 with NHS ester 26
provided 37. Catalytic hydrogenation of 37 afforded the acyclo
analog 13.
Biochemistry/Enzymology. Walsh and co-workers previ-
ously overexpressed MbtA as a N-terminal maltose binding
protein (MBP) fusion with a C-terminal hexa-his tag; however,
the total yield of protein obtained after purification and removal
of the MBP was approximately 0.1 mg protein per L of culture.16
To obtain adequate amounts of protein for biochemical analysis,
MbtA was subcloned from BAC143Rv (kindly provided by Dr.
Stewart Cole, Institute Pasteur15) into pET-SUMO, which
incorporates an N-terminal hexa-his SUMO tag onto the
corresponding gene product.42 Coexpression with the chaperones
GroEL and GroES from the plasmid pGRO7 (Takara) were
found to further improve expression levels 10-20-fold. Expres-
sion with these chaperones necessitated additional processing
to remove GroEL from MbtA before subsequent Ni affinity
purification. This was accomplished employing a modified
protocol using ATP and denatured E. coli proteins to cause
GroEL to release MbtA and bind to the denatured proteins.52
Recombinant MbtA was purified by Ni-NTA affinity chroma-
tography. Cleavage of the (his)6-SUMO tag with SUMO
protease and subsequent Ni-NTA affinity chromatography to
remove the SUMO fragment and his-tagged protease provided
native MbtA (2 mg/L) in approximately 95% purity, as
determined by SDS-PAGE (Supporting Information, Figure S1).
For each batch of enzyme prepared, the amount of active
enzyme was determined by titrating with tight-binding inhibitor
8 (For a representative plot, see Supporting Information, Figure
S2).53
Figure 3. Dose-response of fractional initial velocity of γ-[32P]-ATP
formation catalyzed by MbtA as a function of inhibitor 8 concentration.
The curve represents the best nonlinear fit of the data to the Morrison
equation. The data points represent the mean with standard error of
duplicate experiments.
To evaluate whether the tight-binding inhibitors exhibited
time-dependent inhibition, a time-course analysis was performed.
The reaction velocity remained linear from 2-20 min when
both 6 and [32P]PPi were added at t0. Thus, the inhibitor reached
a rapid equilibrium, consistent with earlier reports of acylsulfa-
mate bisubstrate inhibitors with isoleucine tRNA synthetase.55,56
Nevertheless, to ensure that the reaction was at steady-state, all
substrates (ATP, PPi, salicylic acid) and inhibitor were prein-
cubated for 10 min and observation of the residual enzyme
activity was measured by addition of [32P]PPi at t0. The initial
rates, V0, at a given [I] were determined by single time point
stopped-time incubations at 20 min. Because the inhibitors
exhibited tight-binding behavior (KIapp < 200‚[E]), the fractional
initial velocities (Vi/V0) and [I] were fit to the Morrison equation
(eq 1, see Experimental Section) by nonlinear regression
analysis, constraining [E] where Vi is the initial velocity with
inhibitor and V0 represents the initial velocity for a DMSO
control to obtain KIapp values for 8-13.40,57 A representative
plot is shown in Figure 3 (see Supporting Information, Figures
S5-S9). The [E] was experimentally determined by active-site
titration with 8.
Determination of the steady-state kinetic parameters of
salicylic acid and ATP as well as inhibition of MbtA by the
bisubstrate inhibitors was measured using a [32P]PPi-ATP
exchange assay.54 The assay exploits the equilibrium nature of
the adenylation reaction which can be summarized as follows:
E + S + ATP / [E‚S-AMP] + PPi. Because the product
S-AMP remains tightly bound to the enzyme, a steady-state
kinetic analysis in the forward direction cannot be performed
due to product inhibition. However, measurement in the reverse
direction is readily performed using [32P]PPi and following its
incorporation into γ-[32P]ATP.
The KM of ATP with MbtA has not been previously reported
and was experimentally determined as 184 ( 24 µM by
measuring V0 as a function of [ATP] to provide a saturation
curve, which was fit by nonlinear regression analysis to the
Michaelis-Menten equation (Supporting Information, Figure
S3). Analogously, the KM of salicylic acid was determined as
3.3 ( 0.5 µM (literature16 9.0 µM: MbtA with a C-terminal
His-tag) by measuring V0 as a function of salicylic acid [Sal]
(Supporting Information, Figure S4).
The KIapp of the parent ribose inhibitor 6 was found to be 6.6
nM (Table 1). Replacement of the 5′-oxygen atom of the ribose
moiety with a nitrogen atom in analogue 7 led to a 1.8-fold
increase in activity (7 vs 6). Carbocyclic analogue 8 displayed
potent inhibition with a KIapp of 2.3 nM, which represents a
3-fold increase in activity (8 vs 6), suggesting that the ring-
oxygen does not participate in H bonding. To more precisely
map out the structural requirements of the ribofuranose subunit,
analogues 9 and 10 were evaluated. Deletion of the 2′-alcohol
in 9 led to an approximately 2-fold increase in activity (9 vs
6), while deletion of the 3′-alcohol in analogue 10 also resulted
in a 2-fold increase in potency (10 vs 6). The dideoxy-dehydro
carbocyclic analogue 11 exhibited a 126-fold loss in binding
affinity (11 vs 6), but still maintained submicromolar enzyme
inhibition. Dideoxy carbocyclic analogue 12 was found to
possess a mere 9-fold decrease in binding affinity (12 vs 6)
despite the removal of both the 2′- and 3′-alcohols and the
ribofuranose ring oxygen. Thus, an approximately 14-fold was
regained by simply reducing the unsaturation in 11 (12 vs 11).

Adenylation Inhibitors of Siderophore Biosynthesis
Journal of Medicinal Chemistry, 2006, Vol. 49, No. 26 7627
Table 1. SAR of the Glycosyl Domain
a ClogP values were calculated using QikProp software (Schro¨dinger). b Grown in GAST media without added Fe3+
without added Fe3+ d Not applicable. e Not determined. f See ref 44. g See ref 45.
.
c Grown in desferrated BHI media
.
Figure 4. (A) KIapp as a function of ATP concentration. (B) KIapp as a function of salicylic acid concentration.
The acyclo analogue 13 exhibited a profound 2530-fold decrease
in activity (13 vs 6), clearly demonstrating the importance of
the conformational rigidity of the parent ribose moiety.
Carbocyclic inhibitor 8, which represents the most potent
inhibitor, was selected for further biochemical evaluation to
determine the modality of inhibition and, hence, the true
overlapping binding sites.59,60 Next, the KI′ of 8 was determined
as a function of the nonvaried substrate salicylic acid [Sal] from
5-50‚KM(Sal) at fixed concentrations of ATP. The KI′ was also
found to vary linearly with [Sal], demonstrating that this
inhibitor is also competitive with respect to salicylic acid (Figure
4B). Due to the tight-binding nature of 8, we rapidly reached
the limit of the Morrison equation to determine KIapp values
(KIapp < 1/100‚[E]) when [ATP] and [Sal] were simultaneously
varied precluding determination of the true inhibition con-
stant.60
Molecular Modeling. To investigate the structural basis for
the in vitro activity results, we docked each compound into a
homology model based on the X-ray structure of the homolog
DhbE.36 Key interactions of the nucleoside region of 6 appear
in Figure 5. The hydrogen-bonding pattern of the lowest energy
structure was identical to that seen for the natural phosphate
inhibition constant. The apparent inhibition constant (KIapp) of
(ATP)
8 was determined as a function of [ATP] from 5-55‚KM
.
The KIapp varied linearly with [ATP], demonstrating that this
inhibitor is competitive with respect to ATP (Figure 4A). Based
on the Cheng-Prusoff equation (see eq 2, Experimental Section)
for a competitive tight-binding inhibitor, the inhibition constant
KI′ ) 0.038 ( 0.007 nM with respect to the varied substrate
(ATP) at a given concentration of the nonvaried substrate
(salicylic acid).58 For a bisubstrate inhibitor, KI′ also depends
on the concentration of the nonvaried substrate because of

7628 Journal of Medicinal Chemistry, 2006, Vol. 49, No. 26
Somu et al.
enzyme assay.19 The minimum inhibitory concentrations (MIC99)
that inhibited complete growth of M. tuberculosis are shown in
Table 1. Isoniazid was used as a positive control, while DMSO
was employed as a negative control. The previously determined
MIC99 values of compounds 6 and 7 are shown for compari-
son.44 Both of these compounds display activity rivaling the
first line antitubercular agent isoniazid. The carbocyclic analogue
8 displayed an MIC99 of 1.56 µM, which represents a 5-fold
loss of activity relative to the parent compound 6. Similarly
the 2′- and 3′-deoxy derivatives 9 and 10 displayed MIC99 values
of 25 and 1.56 µM, respectively. However, removal of both
the 2′- and 3′-alcohols in cyclopentene analogue 11 resulted in
complete loss of activity consistent with its poor enzyme
inhibition (KIapp ) 830 nM). The removal of the 2′- and 3′-
oxygen atoms in 12 resulted in total loss of in vivo activity
despite its moderate in vitro activity (KIapp ) 61 nM). The acyclo
adenosine analog 13 was inactive in accord with its weak
enzyme inhibition (KIapp ) 16.7 µM). Additionally, several of
the compounds were assessed for activity against an isolate of
Yersinia pseudotuberculosis, which, like Y. pestis, requires the
salicyl-capped NRPS-PKS-derived siderophore known as yers-
iniabactin for growth under iron-limiting conditions.62 Biosyn-
thesis of yersiniabactin is initiated by the adenylating enzyme
YbtE, which shows 39% amino acid identity to MbtA, but
absolute conservation of putative nucleoside binding resi-
dues.42,44 The parent compound 6 exhibited moderate inhibition
with a MIC99 of 20 µM, and 3-deoxy analogue 10 possessed
an MIC99 of 80 µM. Carbocyclic 8, cyclopentene analogue 11,
and acyclo analogue 13 displayed no inhibition of Y. pseudotu-
berculosis growth up to 100 µM.
Figure 5. Schematic diagram of key nucleoside/protein interactions
for analog 6 based on docking. For comparison with the DhbE X-ray
structure, residues are numbered according to PDB entry 1MDB.36
intermediate in the DhbE X-ray structure. The sugar pucker,
3′-endo, was also conserved, and the lowest energy conformation
deviated from the X-ray structure’s ligand by only 0.22 Å rms.
The deletion of the 2′- or 3′-hydroxyl in 9 and 10 did not alter
the C3′-endo pucker of the lowest-energy structure, despite the
loss of two hydrogen bonds in each case. The small change in
the in vitro activity of 8 relative to the parent compound was
consistent with the DhbE structure, where the 4′-oxygen was
3.6 Å from the nearest possible hydrogen bonding donor, the
side chain of Lys519. Our modeling of 6 and 7 confirmed this
lack of a hydrogen-bonding partner for ribose-based ligands.
The other single-heteroatom change, in 7, also resulted in no
significant structural changes, although the 5′-NH to Lys519
hydrogen bond had a slightly less favorable geometric config-
uration than the parent compound. However, the 5′-NH was
able to form an internal hydrogen bond with the aryl carbonyl.
With most of the single heteroatom substitutions, two
conformations of the C4′-C5′-O5′-S linker were observed,
one matching the DhbE X-ray structure and the other pivoting
the two central atoms and breaking the O5′-Lys519 hydrogen
bond. However, for the carbocycle 8, only the alternate
conformation was observed, suggesting that this hydrogen bond
is not critical for activity.
Compounds 11-13 involved more significant chemical
changes. The 3′-endo pucker was maintained in 12, but as with
the carbocycle 8, the lowest energy structure showed the loss
of the O5′-Lys519 hydrogen bond. Although the ∼10-fold
lower in vitro activity of this compound likely resulted from
the loss of hydrogen-bonding interactions, the X-ray structure
of DhbE in the absence of a ligand showed a slight movement
of Arg428, allowing it to form a salt bridge with Asp413.
Therefore, 12 may bind without a large energy penalty for
desolvating Asp413. The more significant (∼100-fold) loss of
activity for 11 was likely due to strain, as the experimentally
observed C3′-endo pucker would distort planarity around the
double bond. The lowest energy structure was indeed distorted,
with a C4′-exo pucker, although the pucker amplitude was
reduced relative to 6 (16.4 vs 39.4, calculated using PROSIT).61
Finally, 13 docked with the conformation expected for active
compounds (0.51 Å rms relative to the DhbE X-ray structure),
but the remaining sugar atoms shifted ∼0.75 Å into the space
generated by deleting C2′ and C3′.
Discussion
Inhibition of siderophore biosynthesis has emerged as an
attractive strategy to develop novel antibiotics against pathogens
that require siderophores for virulence.42-44,63-65 In this report,
we have systematically investigated the SAR of the glycosyl
domain of our salicyl-nucleoside bisubstrate inhibitor. In
particular, in vitro results against MbtA showed that deletion
of the 3′- and 4′-oxygen atoms were generally well tolerated,
while deletion of the 2′ oxygen and modifications making the
sugar more (13) or less (11) flexible were detrimental. The
activity of carbocyclic analog 8 was especially significant. A
major metabolic and decomposition pathway of nucleosides
involves expulsion of the nucleobase as a result of the
chemically and enzymatically susceptible glycosidic bond, thus
carbocyclic analog 8 is noteworthy because this glycosidic bond
is replaced by a stable linkage. Overall, in vitro enzyme
inhibition and in vivo antimycobacterial activity were well
correlated except for analogue 12, which displayed potent
enzyme inhibition toward MbtA, yet had no antimycobacterial
activity. The parent acylsulfamate 6 and 3-deoxy analogue 10
were also found to be moderate inhibitors of Y. pseudotuber-
culosis growth, demonstrating that these inhibitors are effective
against other siderophore-producing bacteria under iron-limiting
conditions. The reasons for the reduced activities of these
compounds against Y. pseudotuberculosis are not clear but
suggest that in vitro comparisons of YbtE and MbtA as well as
other physiological studies are needed for development of
analogs active against other pathogens.
Biological Activity Against Whole-Cell Mycobacterium
tuberculosis and Yersinia pseudotuberculosis. All inhibitors
synthesized above were evaluated against whole-cell M. tuber-
culosis H37Rv under iron-limiting conditions. The whole-cell
assay also measures inherent resistance, such as membrane
permeability, a factor that is not assessed with the in vitro
We postulate that the lack of bioactivity of 12 is a result of
hindered transport and by corollary propose that the sugar moiety
of the nucleoside subunit is critical for recognition by a putative
transporter(s). In general, acyl adenylate intermediate mimetics
developed for the functionally related aminoacyl tRNA syn-

Adenylation Inhibitors of Siderophore Biosynthesis
Journal of Medicinal Chemistry, 2006, Vol. 49, No. 26 7629
thetases were found to display excellent enzyme inhibition, but
were inactive in vivo against whole-cell microorganisms as a
result of limited membrane permeability, a problem that was
expected to be exacerbated with the imposing mycobacterial
cell envelope.35 The findings that the bisubstrate inhibitors such
as 6 possess potent submicromolar MIC99 values provides strong
evidence that these compounds are using a transporter for
uptake. The mycobacterial cell wall provides a permeability
barrier to hydrophilic solutes that results in intrinsic resistance
to many antibacterial agents.66 To obtain vital nutrients and
cofactors, M. tuberculosis possesses an astonishing 37 ABC
(ATP-dependent binding cassette) transporters of which 16 have
been unambiguously assigned as importers responsible for
assimilation of amino acid, nucleotides, and other essential
cofactors.67 Rodriguez and Smith recently reported that the gene
products of Rv1345 and Rv1347 encode for an ABC transporter
responsible for transport of carboxymycobactin.68 Additionally,
M. tuberculosis transports many hydrophilic solutes via facili-
tated diffusion mediated by a class of proteins known as the
porins (the major porin is known as MspA), which have also
been shown to play an important role in the transport of
antibiotics such as â-lactams and aminoglycosides.69 The
availability of targeted disruption mutants of several ABC
transporters and MspA should enable the identification of the
transporter(s) responsible for uptake of the bisubstrate inhibitors.
Alternatively, identification of resistant-conferring mutations in
M. tuberculosis toward the nucleoside bisubstrate inhibitors
described herein may also lead to the identification of the
transporter of these antibacterial agents.
reaction toward both ATP and salicylic acid for the bisubstrate
inhibitor 8 is diagnostic for an equilibrium random mechanism.60
Quadri and co-workers observed that YbtE and bisubstrate
inhibitor 6 display competitive behavior with respect to ATP
and uncompetitive with respect to salicylic acid.42 However, as
discussed extensively by Fromm, this inhibition pattern for a
bisubstrate inhibitor can arise from either a sequential ordered
or random mechanism.60
The significance of an understanding of the reaction mech-
anism is 2-fold. First, it provides a model for inhibitor binding
with either the nucleoside or salicyl domain of the bisubstrate
inhibitor first docking into the active site, followed by binding
of the other respective domain. Second, the inhibitors must
compete with both ATP and salicylic acid. Salicylic acid is an
abundant metabolite of M. tuberculosis, as well as many other
pathogens. In fact, the concentration of salicylic acid has been
Sal
measured as high as 200 µM or approximately 40KM in
growing cultures of M. smegmatis.76 Consequently, the KIapp
values measured herein may represent an accurate measure of
in vivo inhibitor efficacy, because these were measured under
supersaturating substrate conditions (salicylic acid was 250 µM
Sal
or 50‚KM and ATP was set at 10 mM or 50‚KMATP).
Conclusion
In conclusion, we have reported the systematic evaluation of
the structure-activity relationships of the bisubstrate inhibitor
glycosyl domain that govern binding toward MbtA and in vivo
activity against M. tuberculosis. Molecular modeling has been
used to interpret the SAR data. These studies have provided a
foundation for future SAR campaigns, and we have importantly
identified several modifications to the glycosyl inhibitor template
that can be used to modulate the pharmacodynamic and
pharmacokinetic properties of the inhibitors. The intriguing
possibility that the bisubstrate inhibitors utilize a transporter for
entry across the mycobacterial cell envelope is supported by
SAR studies. Efforts are now underway to examine the
importance of the aryl and base domains of the bisubstrate
template to identify sites amenable to modification. Detailed
pharmacokinetic, toxicity, and mechanism of action studies of
the designed bisubstrate inhibitors are underway, and the results
will be reported in due course.
Inhibition of complex biosynthetic pathways is most effective
when targeting the rate-limiting biosynthetic step. However,
neither the rate of mycobactin synthesis by M. tuberculosis nor
the rate-limiting biosynthetic step is known. Thus far, only
MbtA, the N-terminal carrier domain of MbtB, the phospho-
pantetheinyl transferase MbtT, and the tailoring enzymes
MbtK-MbtN have been functionally characterized.16,17 The
approximately 2-3 log difference between KIapp and the MIC99
value could be partially due to the requirement to fully abrogate
MbtA activity, if this is not the rate-limiting step. Walsh and
co-workers have measured the rates of aryl acid activation by
EntE, the adenylation enzyme involved in synthesis of the
siderophore enterobactin.70 EntE catalyzes the activation and
loading of 2,3-dihydroxybenzoic acid onto the cognate carrier
Experimental Section
domain of EntB and proceeds with kcat of 130 min-1 70
. Thus, it
Chemistry General Procedures. All commercial reagents
(Sigma-Aldrich, Acros) were used as provided unless otherwise
indicated. Aristeromycin (14) and acycloadenosine (34) were kindly
provided by Prof. Robert Vince (University of Minnesota, Min-
neapolis, MN). 2-Deoxyadenosine and 3-deoxyadenosine were
obtained from Berry and Associates (Dexter, MI). An anhydrous
solvent dispensing system (J. C. Meyer) using two packed columns
of neutral alumina was used for drying THF and CH2Cl2, while
two packed columns of 4 Å molecular sieves were used to dry
DMF, and the solvents were dispensed under argon. Anhydrous
DME was purchased from Aldrich and used as provided. Flash
chromatography was performed with Silia P grade silica gel 60
(Silicycle) with the indicated solvent system. All reactions were
performed under an inert atmosphere of dry Ar or N2 in oven-
dried (150 °C) glassware. 1H and 13C NMR spectra were recorded
on a Varian 600 MHz spectrometer. Proton chemical shifts are
reported in ppm from an internal standard of residual chloroform
(7.26 ppm) or methanol (3.31 ppm), and carbon chemical shifts
are reported using an internal standard of residual chloroform (77.0
ppm) or methanol (49.1 ppm). Proton chemical data are reported
as follows: chemical shift, multiplicity (s ) singlet, d ) doublet,
t ) triplet, q ) quartet, p ) pentet, m ) multiplet, br ) broad),
coupling constant, integration. High-resolution mass spectra were
is quite likely that the rate of activation catalyzed by MbtA is
fast with respect to the overall rate of mycobactin synthesis. A
greater understanding of the enzymology of the other proteins
(MbtB-MbtI) and determination of the rate of mycobactin
synthesis in vivo will be necessary to establish whether MbtA
catalyzes the rate-limiting step. The recently reported crystal
structures of MbtI and MbtK pave the way for the rational design
of inhibitors toward these enzymes.30,31,33 Because MbtI cata-
lyzes the very first biosynthetic step, inhibitors toward MbtI
could display synergy with those of MbtA because these
enzymes catalyze consecutive biosynthetic steps.
Another important consideration for inhibitor design is an
understanding of enzyme reaction mechanism. Despite a
preponderance of bioinformatic,71,72 biochemical,70,73,74 and
structural studies36,75 of NRPS adenylation domains, the detailed
reaction mechanism of these adenylation domains has not been
fully elucidated.27,38 Bisubstrate inhibitors can serve as powerful
mechanistic probes for multisubstrate reactions and allow one
to discriminate among related reaction mechanisms.60 The
competitive inhibition pattern observed in the adenylation half-

7630 Journal of Medicinal Chemistry, 2006, Vol. 49, No. 26
Somu et al.
obtained on an Agilent TOF II TOF/MS instrument equipped with
either an ESI or APCI interface. Optical rotations were measured
on Rudolph Autopol III polarimeter. Melting points were measured
on electrothermal Mel-Temp manual melting point apparatus and
are uncorrected.
MHz, CDCl3) δ 25.7, 56.5, 94.8, 115.3, 121.5, 132.4, 135.7, 158.1,
160.3, 169.4; unable to obtain a HRMS using either ESI(() or APCI
(().
5′-O-(N-(2-Hydroxybenzoyl)sulfamoyl)aristeromycin Triethyl-
ammonium Salt (8). This was prepared from 15 (90 mg, 0.23
mmol, 1.0 equiv) and 16 (196 mg, 0.70 mmol) using the general
salicylation procedure A. Purification by flash chromatography (85:
15:1 EtOAc/MeOH/Et3N) provided the salicylated adduct as a DBU
salt (40 mg, 25%), and further elution afforded compound 17 (120
mg, 60%) as a triethylammonium salt.
General Procedure for Sulfamoylation.77 To a solution of 2′,3′-
O-isopropylidene protected nucleoside (1 mmol, 1 equiv) in DME
(50 mL) at 0 °C was added NaH (60% suspension in mineral oil,
1.5 mmol, 1.5 equiv). After 30 min, a solution of sulfamoyl chloride
(1.5 mmol, 1.5 equiv) in DME (10 mL) was added dropwise over
5 min, and the reaction was stirred 16 h at rt. The reaction was
quenched at 0 °C with MeOH (10 mL) then concentrated under
reduced pressure. Purification by flash chromatography afforded
the title compound. Due to the instability of the products, HRMS
data could not be obtained using either ESI(() or APCI(() to
identify the molecular ion peak. Mass peaks corresponding to loss
of the sulfamoyl moiety [M-SO2NH2]+ were observed in some cases
(data not shown).
General Procedures for Salicylation. Procedure A. To a
solution of 2′,3′-O-isopropylidene-protected 5′-O-sulfamoylated
nucleoside (1.0 mmol, 1.0 equiv) in DMF (30 mL) at 0 °C was
added NHS ester (3.0 mmol, 3.0 equiv) followed by DBU (1.5
mmol, 1.5 equiv), and the reaction was stirred 16 h at rt. The
reaction mixture was concentrated under reduced pressure. Purifica-
tion by flash chromatography using a mixture of MeOH and EtOAc
containing 1% Et3N afforded the title compounds. Procedure B.
To a solution of 2′,3′-O-isopropylidene-protected 5′-O-sulfa-
moylated nucleoside (1.0 mmol, 1.0 equiv) in DMF (30 mL) at 0
°C was added NHS ester (3.0 mmol, 3.0 equiv) followed by Cs2-
CO3 (3.0 mmol, 3.0 equiv), and the reaction was stirred 16 h at rt.
The reaction mixture was filtered to remove solids and washed with
a small quantity of DMF. Concentration under reduced pressure
followed by purification by flash chromatography using a mixture
of MeOH and EtOAc containing 1% Et3N afforded the title
compounds.
The triethylammonium salt of compound 17 (70 mg, 0.11 mmol)
prepared above was treated with 80% aq TFA (1.0 mL) at rt for 4
h. The reaction was thoroughly concentrated in vacuo to remove
all residual TFA. Purification of the residue by flash chromatog-
raphy (70:30:1 EtOAc/MeOH/Et3N) afforded the title compound
8 (40 mg, 66%): Rf ) 0.20 (7:3 EtOAc/MeOH); [R]20 -4.9 (c
D
1
0.78, CH3OH); H NMR (600 MHz, CD3OD) δ 1.23 (t, J ) 7.2
Hz, 9H), 1.95-2.05 (m, 1H), 2.40-2.55 (m, 2H), 3.07 (q, J ) 7.2
Hz, 6H), 4.12 (dd, J ) 5.4, 3.0 Hz, 1H), 4.27 (d, J ) 5.0 Hz, 2H),
4.50 (dd, J ) 9.0, 5.4 Hz, 1H), 4.80-4.95 (m, 1H), 6.70-6.85 (m,
2H), 7.27 (t, J ) 7.2 Hz, 1H), 7.91 (d, J ) 7.8 Hz, 1H), 8.13 (s,
1H), 8.31 (s, 1H); 13C NMR (150 MHz, CDCl3) δ 9.5, 30.2, 44.3,
47.7, 61.0, 71.5, 73.6, 76.8, 117.9, 119.3, 120.4, 120.7, 131.3, 134.3,
141.6, 151.2, 153.4, 157.2, 162.0, 174.8; HRMS (ESI+) calcd for
C18H21N6O7S [M + H]+, 465.1187; found, 465.1204 (error 3.7
ppm).
3′,5′-O-Bis(tert-Butyldimethylsilyl)-2-deoxyadenosine (20). To
a solution of 2-deoxyadenosine (3.00 g, 11.1 mmol, 1.0 equiv) in
DMF (16 mL) at 0 °C were added imidazole (4.54 g, 66.8 mmol,
6.0 equiv) and DMAP (200 mg, 1.6 mmol, 0.15 equiv). Next, a
solution of TBSCl (4.20 g, 27.9 mmol, 2.5 equiv) in DMF (8.0
mL) was added dropwise at 0 °C, and the reaction was stirred 30
min. The reaction mixture was diluted with saturated aq NaHCO3
(100 mL) and extracted with EtOAc (3 × 100 mL). The combined
organic extracts were dried (Na2SO4), filtered, and concentrated
under reduced pressure. Purification by flash chromatography (6:1
EtOAc/hexanes) afforded the title compound (4.5 g, 84%) as a white
2′,3-O-Isopropylidene-5′-O-(sulfamoyl)aristeromycin (15). This
was prepared from 2′,3′-O-isopropylidenearisteromycin48 (290 mg,
0.95 mmol, 1.0 equiv) using the general procedure for sulfamoy-
lation. Purification by flash chromatography (4:1 EtOAc/MeOH)
solid: mp ) 123-125 °C; Rf ) 0.7 (1:3 EtOAc/hexanes); [R]20
D
-2.7 (c 0.96, CHCl3); 1H NMR (600 MHz, CDCl3) δ 0.00 (s, 6H),
0.01 (s, 6H), 0.82 (s, 18H), 2.34 (ddd, J ) 13.2, 6.0, 4.2 Hz, 1H),
2.50-2.58 (m, 1H), 3.68 (dd, J ) 10.8, 3.0 Hz, 1H), 3.78 (dd, J )
11.4, 4.2 Hz, 1H), 3.92 (dd, J ) 6.6, 3.0 Hz, 1H), 4.52 (dd, J )
9.0, 3.6 Hz, 1H), 5.70 (br s, 2H), 6.36 (t, J ) 6.6 Hz, 1H), 8.05 (s,
1H), 8.26 (s, 1H); 13C NMR (150 MHz, CDCl3) δ -5.5, -5.4,
-4.1, -4.7, 18.0, 18.4, 25.8, 26.0, 41.3, 62.8, 71.9, 84.3, 87.9,
120.0, 139.1, 149.6, 152.8, 155.3; HRMS (ESI+) calcd for
C22H40N5O3Si2 [M - H]+, 478.2664; found, 478.2656 (error 1.7
ppm).
afforded the title compound as a thick oil (230 mg, 63%): Rf )
1
0.70 (3:1 EtOAc/MeOH); [R]20 -6.6 (c 1.8, CH3OH); H NMR
D
(600 MHz, CD3OD) δ 1.29 (s, 3H), 1.54 (s, 3H), 2.37 (q, J ) 12.0
Hz, 1H), 2.46-2.54 (m, 1H), 2.54-2.64 (m, 1H), 4.24 (dd, J )
16.2, 6.6 Hz, 1H), 4.28 (dd, J ) 16.2, 6.6 Hz, 1H), 4.70 (t, J ) 6.0
Hz, 1H), 4.88-4.96 (m, 1H), 5.09 (t, J ) 6.6 Hz, 1H), 8.19 (s,
1H), 8.21 (s, 1H); 13C NMR (150 MHz, CDCl3) δ 25.4, 27.7, 34.9,
44.5, 62.6, 71.1, 82.2, 84.8, 115.3, 120.6, 141.6, 150.7, 153.6, 157.4.
N-Hydroxysuccinimidyl 2-(methoxymethyloxy)benzoate (16).
A solution of LiOH (660 mg, 27.5 mmol, 3.0 equiv) in MeOH (18
mL) and water (2 mL) was added to methyl 2-(methoxymethyloxy)-
benzoate78 (1.81 g, 9.17 mmol, 1.0 equiv), and the reaction mixture
was refluxed for 4 h. The reaction mixture was concentrated, the
residue was dissolved in H2O (20 mL), and the pH was adjusted to
3 and then extracted with EtOAc (3 × 50 mL). The combined
organic extracts were concentrated to afford 2-(methoxymethyloxy)-
benzoic acid (1.56 g, 93%), which was directly carried onto the
next step: 1H NMR (600 MHz, CDCl3) δ 3.54 (s, 3H), 5.34 (s,
2H), 7.15 (t, J ) 7.8 Hz, 1H), 7.26 (d, J ) 8.4 Hz, 1H), 7.51 (t, J
) 9.0 Hz, 1H), 8.14 (d, J ) 7.8 Hz, 1H); 13C NMR (150 MHz,
CDCl3) δ 57.0, 95.8, 115.1, 118.4, 122.9, 133.5, 134.9, 156.2, 166.0.
To a solution of the crude product (1.56 g, 8.56 mmol, 1.0 equiv)
from above in THF (80 mL) at 0 °C was added N-hydroxysuccin-
imide (0.988 g, 8.56 mmol, 1.0 equiv) and DCC (1.76 g, 8.56 mmol,
1.0 equiv). The resulting mixture was stirred for 30 min at 0 °C
and then 2 h at rt. The reaction mixture was filtered to remove the
DCU precipitate, and the filtrate was concentrated under reduced
pressure. Purification by flash chromatography (4:1 EtOAc/hexanes)
afforded the title compound 16 (2.02 g, 85%): Rf ) 0.85 (EtOAc);
1H NMR (600 MHz, CDCl3) δ 2.86 (br s, 4H), 3.50 (s, 3H), 5.26
(s, 2H), 7.08 (t, J ) 7.8 Hz, 1H), 7.23 (d, J ) 8.4 Hz, 1H), 7.55
(t, J ) 8.4 Hz, 1H), 8.02 (d, J ) 7.8 Hz, 1H); 13C NMR (150
3′-O-tert-Butyldimethylsilyl-2-deoxyadenosine (21). To a solu-
tion of 20 (1.0 g, 2.08 mmol, 1.0 equiv) in THF (25 mL) was added
50% aq TFA (12 mL).42 After 3 h, the reaction mixture was
quenched with aq 10 M NH4OH until the pH was basic (∼10).
The reaction mixture was concentrated under reduced pressure, and
the solid obtained was dried, dissolved in ethyl acetate, and washed
with brine. The aqueous layer was extracted with EtOAc (3 × 50
mL). The combined EtOAc extracts were dried (Na2SO4), filtered,
and concentrated. Purification by flash chromatography (EtOAc)
afforded the title compound (0.45 g, 60%) as a white solid: mp )
178-182 °C; Rf ) 0.2 (EtOAc); [R]20D -4.8 (c 0.89, CH3OH); 1H
NMR (600 MHz, CDCl3) δ 0.14 (s, 6H), 0.94 (s, 9H), 2.37 (ddd,
J ) 13.2, 6.0, 2.4 Hz, 1H), 2.80 (ddd, J ) 13.2, 7.8, 5.4 Hz, 1H),
3.70 (dd, J ) 12.0, 3.0 Hz, 1H), 3.81 (dd, J ) 12.0, 3.0 Hz, 1H),
4.03 (d, J ) 2.4 Hz, 1H), 4.68 (t, J ) 3.0 Hz, 1H), 6.42 (t, J ) 6.6
Hz, 1H), 8.17 (s, 1H), 8.31 (s, 1H); 13C NMR (150 MHz, CDCl3)
δ -4.6 (2C), 18.7, 26.3, 42.1, 63.4, 74.4, 87.1, 90.4, 120.8, 141.6,
150.0, 153.4, 157.4; HRMS (ESI+) calcd for C16H28N5O3Si [M +
H]+, 366.1956; found, 366.1984 (error 7.7 ppm).
3′-O-tert-Butyldimethylsilyl-2′-deoxy-5′-O-(sulfamoyl)adenos-
ine (24). This was prepared from 21 (1.81 g, 4.92 mmol, 1.0 equiv)
using the general procedure for sulfamoylation. Purification by flash
chromatography (19:1 EtOAc/MeOH) afforded the title compound

Adenylation Inhibitors of Siderophore Biosynthesis
Journal of Medicinal Chemistry, 2006, Vol. 49, No. 26 7631
(0.80 g, 38%) as a viscous colorless oil: Rf ) 0.55 (9:1 EtOAc/
CD3OD) δ -4.6, -4.5, 18.9, 26.4, 42.2, 69.9, 74.9, 85.9, 87.5,
118.1, 119.4, 120.3, 120.6, 131.6, 134.6, 141.3, 150.5, 153.9, 157.4,
162.3, 175.4; HRMS (ESI+) calcd for C23H33N6O7SSi [M + H]+,
565.1895; found, 565.1817 (error 13.8 ppm).
1
MeOH); [R]20 -41.7 (c 0.690, CH3OH); H NMR (600 MHz,
D
CDCl3) δ 0.09 (s, 6H), 0.98 (s, 9H), 2.43 (ddd, J ) 13.2, 6.0, 3.6
Hz, 1H), 2.60-2.75 (m, 1H), 4.18 (dd, J ) 9.0, 3.0 Hz, 1H), 4.25
(dd, J ) 10.8, 4.2 Hz, 1H), 4.20 (dd, J ) 10.8, 3.0 Hz, 1H), 4.60-
4.70 (m, 1H), 6.43 (t, J ) 6.6 Hz, 1H), 8.16 (s, 1H), 8.20 (s, 1H);
13C NMR (150 MHz, CDCl3) δ -5.6, -5.5, 17.4, 25.1, 40.4, 68.1,
72.0, 84.1, 84.8, 118.8, 138.8, 148.7, 152.3, 155.3.
2′-Deoxy-5′-O-(N-(2-hydroxybenzoyl)sulfamoyl)adenosine Tri-
ethylammonium Salt (9‚Et3N). To a solution of 29 (10.5 mg, 0.018
mmol, 1.0 equiv) in THF (2.0 mL) was added TBAF (1.0 M
solution in THF, 0.1 mL, 6.0 equiv), and the solution was stirred
3 h at rt. The reaction mixture was concentrated, and purification
of the residue by flash chromatography (65:35:1 EtOAc/MeOH/
Et3N) afforded the title compound (5.1 mg, 50%): Rf ) 0.15 (3:1
EtOAc/MeOH); [R]20D -99 (c 0.25, CH3OH); 1H NMR (600 MHz,
CD3OD) δ 1.29 (t, J ) 7.2 Hz, 9H), 2.44 (ddd, J ) 13.8, 5.4, 2.4
Hz, 1H), 2.70-2.90 (m, 1H), 3.18 (q, J ) 7.2 Hz, 6H), 4.24 (s,
1H), 4.32 (dd, J ) 11.4, 3.6 Hz, 1H), 4.35 (dd, J ) 10.8, 3.6 Hz,
1H), 4.62-4.70 (m, 1H), 6.50 (t, J ) 6.6 Hz, 1H), 6.75-6.84 (m,
2H), 7.29 (t, J ) 7.8 Hz, 1H), 7.93 (d, J ) 7.8 Hz, 1H), 8.16 (s,
1H), 8.50 (s, 1H); 13C NMR (150 MHz, CD3OD) δ 9.4, 41.6, 48.1,
70.0, 73.5, 85.9, 87.0, 118.0, 119.4, 120.3, 120.8, 131.5, 134.5,
141.3, 150.6, 153.9, 157.4, 162.2, 175.1; HRMS (ESI+) calcd for
C17H19N6O7S [M + H]+, 451.1030; found, 451.1014 (error 3.5
ppm).
2′-O-tert-Butyldimethylsilyl-3-deoxyadenosine (23). Compound
19 (100 mg, 0.37 mmol, 1.0 equiv) was bis-silylated with TBSCl
(140 mg, 0.93 mmol, 2.5 equiv) to afford 22 using the procedure
described for the preparation of 20. The di-TBS product obtained
was used directly for the next step.
To a solution of crude di-TBS product prepared above (170 mg,
0.37 mmol, 1.0 equiv) in MeOH/EtOAc (1:1, 10 mL) at 0 °C was
added pTsOH‚H2O (0.35 g, 1.83 mmol, 2.8 equiv). After 5 h, the
reaction was complete, and the reaction mixture was quenched using
an excess of solid K2CO3 (500 mg), stirred for 1 h, filtered, and
concentrated under reduced pressure. Purification by flash chro-
matography (1:20 MeOH/EtOAc) afforded the title compound (106
5′-O-(N-(2-Benzyloxybenzoyl)sulfamoyl)-3′-O-tert-butyldim-
ethylsilyl-2′-deoxyadenosine 1,8-diazabicyclo[5.4.0]undec-7-ene
Salt (27‚DBU). Compound 24 (150 mg, 0.34 mmol) was coupled
with 2644 (329 mg, 1.012 mmol, 1.5 equiv) using the general
salicylation procedure A. Purification by flash chromatography (90:
10:1 EtOAc/MeOH/Et3N) afforded the title compound (120 mg,
44%) as a viscous oil: Rf ) 0.3 (EtOAc/MeOH); [R]20 +7.1 (c
D
0.22, CH3OH); 1H NMR (600 MHz, CD3OD) δ 0.00 (s, 3H), 0.01
(s, 3H), 0.80 (s, 9H), 1.35-1.60 (m, 8H), 2.20-2.35 (m, 1H), 2.60-
2.75 (m, 1H), 2.76 (t, J ) 5.4 Hz, 2H), 3.00-3.20 (m, 4H), 3.25-
3.32 (m, 2H), 3.86 (q, J ) 3.6 Hz, 1H), 4.03 (dd, J ) 10.8, 4.2 Hz,
1H), 4.13 (dd, J ) 10.8, 3.6 Hz, 1H), 4.55-4.64 (m, 1H), 5.02 (s,
2H), 6.26 (t, J ) 6.6 Hz, 1H), 6.89 (t, J ) 7.2 Hz, 1H), 7.04 (d, J
) 8.4 Hz, 1H), 7.15-7.25 (m, 3H), 7.26-7.36 (m, 3H), 7.69 (d, J
) 7.8 Hz, 1H), 8.04 (s, 1H), 8.15 (s, 1H); 13C NMR (150 MHz,
CD3OD) δ -4.7, -4.6, 18.8, 24.2, 26.3, 27.8, 27.9, 30.0, 32.0,
38.1, 41.2, 50.1, 52.5, 69.8, 72.2, 73.8, 85.6, 86.4, 114.2, 120.4,
122.1, 123.9, 129.5, 129.6, 129.8, 131.8, 133.9, 137.7, 141.0, 150.4,
153.9, 157.3, 158.1, 168.3, 174.2; HRMS (ESI+) calcd for
C39H55N8O7SSi [M + DBU + H]+, 807.3678; found, 807.3674
(error 0.5 ppm).
2′-Deoxy-5′-O-(N-(2-hydroxybenzoyl)sulfamoyl)adenosine 1,8-
Diazabicyclo[5.4.0]undec-7-ene Salt (9‚DBU). To a solution of
27‚DBU (80 mg, 0.099 mmol, 1.0 equiv) in MeOH (10 mL) was
added 10% Pd/C (20 mg), and the reaction was stirred under a H2
atmosphere for 8 h. The reaction mixture was filtered through a
plug of Celite, and the residue was washed with MeOH (4 × 10
mL). The combined filtrates were concentrated, and the crude
obtained was treated with TBAF (0.5 mL, 1.0 M THF solution,
0.50 mmol, 5.0 equiv) for 3 h. The reaction was concentrated in
vacuo. Purification by flash chromatography (15:85:1 MeOH/
EtOAc/Et3N) afforded the title compound (16 mg, 27% overall yield
mg, 78% over two steps) as a white solid: mp ) 154-156 °C; Rf
1
) 0.2 (EtOAc); [R]20 -49.4 (c 0.890, CH3OH); H NMR (600
D
MHz, CDCl3) δ 0.00 (s, 3H), 0.14 (s, 3H), 1.06 (s, 9H), 2.44-
2.56 (m, 1H), 2.83 (ddd, J ) 10.8, 7.2, 2.4 Hz, 1H), 3.82 (d, J )
12.6 Hz, 1H), 4.26 (d, J ) 12.6 Hz, 1H), 4.77 (d, J ) 9.0 Hz, 1H),
5.33 (q, J ) 7.2 Hz, 1H), 5.87 (d, J ) 6.0 Hz, 1H), 6.11 (br s, 2H,
NH2), 6.49 (br s, 1H, OH), 8.10 (s, 1H), 8.62 (s, 1H); 13C NMR
(150 MHz, CDCl3) δ -5.4, -5.2, 17.8, 25.5, 34.8, 69.4, 73.9, 80.4,
93.6, 121.1, 140.5, 148.6, 152.5, 155.9; HRMS (ESI+) calcd for
C16H28N5O3Si [M + H]+, 366.1956; found, 366.1976 (error 5.5
ppm).
for two steps) as a thick oil: Rf ) 0.2 (1:5 MeOH/EtOAc); [R]20
D
+9.0 (c 0.51, MeOH); 1H NMR (600 MHz, CD3OD) δ 1.35-1.60
(m, 8H), 2.47 (ddd, J ) 13.8, 7.2, 4.8 Hz, 1H), 2.79-2.83 (m,
1H), 3.81 (dt, J ) 13.8, 7.2 Hz, 2H), 3.34 (t, J ) 6.0 Hz, 2H),
3.50-3.60 (m, 4H), 4.15 (q, J ) 3.6 Hz, 1H), 4.30 (dd, J ) 10.8,
4.2 Hz, 1H), 4.37 (dd, J ) 10.8, 3.0 Hz, 1H), 4.60-4.68 (m, 1H),
6.43 (t, J ) 6.6 Hz, 1H), 6.80-6.90 (m, 2H), 7.32 (t, J ) 8.4 Hz,
1H), 7.24 (d, J ) 7.8 Hz, 1H), 8.17 (s, 1H), 8.29 (s, 1H); 13C NMR
(150 MHz, CD3OD) δ 24.2, 27.9, 28.0, 30.1, 31.9, 38.0, 40.9, 50.3,
52.6, 70.5, 72.5, 85.8, 86.2, 116.7, 118.5, 120.0, 120.4, 128.7, 134.7,
140.9, 150.4, 153.9, 157.3, 161.4, 171.2, 174.6; HRMS (ESI+)
calcd for C26H35N8O7S [M + DBU + H]+, 603.2344; found,
603.2363 (error 3.2 ppm).
2′-O-tert-Butyldimethylsilyl-3′-deoxy-5′-O-(sulfamoyl)adenos-
ine (25). This was prepared from 23 (90 mg, 0.246 mmol, 1.0 equiv)
using the general procedure for sulfamoylation. Purification by flash
chromatography (30:1 EtOAc/MeOH) afforded the title compound
(90 mg, 82%): mp ) 238-240 °C melted with charring; Rf )
1
0.40 (97:3 EtOAc/MeOH); [R]20 +13.7 (c 0.980, CH3OH); H
D
NMR (600 MHz, CD3OD) δ 0.03 (s, 3H), 0.06 (s, 3H), 0.87 (s,
9H), 2.11 (ddd, J ) 13.2, 6.0, 3.0 Hz, 1H), 2.35 (ddd, J ) 13.2,
8.4, 6.0 Hz, 1H), 4.29 (dd, J ) 10.8, 3.6 Hz, 1H), 4.43 (dd, J )
10.8, 2.4 Hz, 1H), 4.65-4.75 (m, 1H), 4.75-4.85 (m, 1H), 5.98
(d, J ) 2.4 Hz, 1H), 8.19 (s, 1H), 8.30 (s, 1H); 13C NMR (150
MHz, CD3OD) δ -4.9, -4.8, 18.8, 26.1, 35.8, 70.9, 77.7, 79.2,
92.8, 120.3, 140.4, 150.5, 152.9, 157.3; MS (ESI+) calcd for
C16H26N5O2Si [M - SO2NH2]+, 348.2; found, 348.1.
2′-Deoxy-3′-O-tert-Butyldimethylsilyl-5′-O-(N-(2-hydroxyben-
zoyl)sulfamoyl)adenosine (29). Compound 24 (100 mg, 0.22
mmol, 1.0 equiv) was coupled to 26 (215 mg, 0.66 mmol, 3.0 equiv)
using the general salicylation procedure B. The reaction mixture
was filtered then concentrated in vacuo. Purification by flash
chromatography afforded 27 as the triethylammonium salt.
Compound 27 prepared above was treated with Pd/C (15 mg) in
MeOH (15 mL) for 6 h under H2 (1 atm). The reaction mixture
was filtered and washed with MeOH, and the filtrate was
concentrated. Purification by flash chromatography (80:20:1 EtOAc/
MeOH/Et3N) afforded the title compound (21 mg, 17% over two
steps) as a thick oil: Rf ) 0.5 (4:1 EtOAc/MeOH); [R]20D -93 (c
0.88, CH3OH); 1H NMR (600 MHz, CD3OD) δ 0.08 (s, 3H), 0.10
(s, 3H), 0.90 (s, 9H), 2.39 (ddd, J ) 13.2, 6.0 Hz, 1H), 2.80-2.90
(m, 1H), 4.16-4.24 (m, 1H), 4.32 (dd, J ) 10.8, 3.6 Hz, 1H), 4.36
(dd, J ) 10.8, 3.6 Hz, 1H), 4.70-4.80 (m, 1H), 6.48 (t, J ) 6.6
Hz, 1H), 6.70-6.84 (m, 2H), 7.29 (t, J ) 8.4 Hz, 1H), 7.95 (d, J
) 7.8 Hz, 1H), 8.17 (s, 1H), 8.47 (s, 1H); 13C NMR (150 MHz,
5′-O-(N-(2-Benzyloxybenzoyl)sulfamoyl)-2′-O-tert-butyldim-
ethylsilyl-3′-deoxyadenosine Triethylammonium Salt (28). This
was prepared from 25 (70 mg, 0.157 mmol, 1.0 equiv) and 26 (154
mg, 0.47 mmol. 3.0 equiv) using the general salicylation procedure
A. Purification by flash chromatography (90:10:1 EtOAc/MeOH/
Et3N) afforded the title compound (90 mg, 87%) as thick oil: Rf
) 0.55 (1:9 MeOH/EtOAc); [R]20D +19 (c 0.70, CH3OH); 1H NMR
(600 MHz, CD3OD) δ 0.01 (s, 3H), 0.05 (s, 3H), 0.86 (s, 9H),
1.20 (t, J ) 7.2 Hz, 9H), 1.85-1.95 (m, 1H), 2.20-2.40 (m, 1H),
3.07 (q, J ) 7.2 Hz, 6H), 4.15 (d, J ) 11.4 Hz, 1H), 4.30 (d, J )
10.8 Hz, 1H), 4.40-4.50 (m, 1H), 4.73 (d, J ) 2.4 Hz, 1H), 5.10
(s, 2H), 5.93 (s, 1H), 6.93 (t, J ) 7.2 Hz, 1H), 7.06 (d, J ) 9.0 Hz,

7632 Journal of Medicinal Chemistry, 2006, Vol. 49, No. 26
Somu et al.
1H), 7.20-7.40 (m, 4H), 7.35 (d, J ) 7.8 Hz, 1H), 7.48 (d, J )
7.8 Hz, 2H), 8.18 (s, 1H), 8.47 (s, 1H); 13C NMR (150 MHz, CD3-
OD) δ -4.8, -4.7, 9.2, 18.8, 26.1, 35.7, 47.7, 70.6, 71.6, 78.1,
79.6, 92.5, 114.3, 120.2, 121.5, 128.8, 128.9, 129.4, 129.7, 131.2,
131.9, 138.7, 140.8, 150.5, 153.8, 157.1, 157.2, 176.7; HRMS
(ESI+) calcd for C30H39N6O7SSi [M + H]+, 655.2365; found,
655.2389 (error 3.7 ppm).
Et3N) afforded the title compound (150 mg, 81%) as a viscous oil:
Rf ) 0.65 (7:3 EtOAc/MeOH); [R]20 +42.8 (c 0.980, CH3OH);
D
1H NMR (600 MHz, CD3OD) δ 1.25 (t, J ) 7.2 Hz, 9H), 1.85-
1.95 (m, 1H), 2.85-2.95 (m, 1H), 3.14 (q, J ) 7.2 Hz, 6H), 3.27
(br s, 1H), 3.43 (s, 3H), 4.20-4.32 (m, 2H), 5.25 (s, 2H), 5.73 (t,
J ) 6.0 Hz, 1H), 5.97 (d, J ) 5.4 Hz, 1H), 6.24 (d, J ) 6.0 Hz,
1H), 6.95 (t, J ) 7.2 Hz, 1H), 7.10 (d, J ) 8.4 Hz, 1H), 7.25 (t, J
) 8.4 Hz, 1H), 7.38 (d, J ) 7.2 Hz, 1H), 8.19 (s, 1H), 8.23 (s,
1H); 13C NMR (150 MHz, CD3OD) δ 8.0, 34.5, 45.2, 55.5, 59.9,
71.1, 95.3, 115.9, 119.0, 121.3, 121.4, 128.6, 129.9, 130.0, 131.3,
137.6, 139.9, 149.2, 152.4, 154.5, 156.1, 175.2; HRMS (ESI+)
calcd for C20H23N6O6S [M + H]+, 475.1394; found, 475.1391 (error
0.6 ppm).
3′-Deoxy-5′-O-(N-(2-hydroxybenzoyl)sulfamoyl)adenosine Tri-
ethylammonium Salt (10). To a solution of 28 (70 mg, 0.092
mmol, 1.0 equiv) in MeOH (10 mL) was added 10% Pd/C (20
mg), and the reaction was stirred under a H2 atmosphere for 8 h.
The reaction mixture was filtered through a plug of Celite, and the
residue was washed with MeOH (4 × 10 mL). The combined
filtrates were concentrated, and the crude obtained was treated with
80% aq TFA (2.0 mL) for 8 h. The reaction was concentrated in
vacuo. Purification by flash chromatography (10:90:1 MeOH/
EtOAc/Et3N) afforded the title compound (27 mg, 53%) as thick
(1′R,4′S)-9-[4-((N-(2-Hydroxybenzoyl)sulfamoyl)oxymethyl)-
cyclopent-2-en-1-yl]adenine Triethylammonium Salt (11). Com-
pound 33 (50 mg, 0.086 mmol, 1.0 equiv) was stirred in 80% aq
TFA (2.0 mL) for 3 h then concentrated in vacuo. Purification by
flash chromatography (25:75:1 MeOH/EtOAc/Et3N) afforded the
title compound (36 mg, 80%) as a viscous oil: Rf ) 0.4 (4:1 EtOAc/
MeOH); [R]20D +22 (c 0.21, CH3OH); 1H NMR (600 MHz, CD3-
OD) δ 1.28 (t, J ) 7.2 Hz, 9H), 1.80-1.95 (m, 1H), 2.80-2.95
(m, 1H), 3.18 (q, J ) 7.2 Hz, 6H), 3.23 (br s, 1H), 4.15-4.30 (m,
2H), 5.69 (t, J ) 6.0 Hz, 1H), 5.90-6.00 (m, 1H), 6.21 (d, J ) 5.4
Hz, 1H), 6.70-6.80 (m, 2H), 7.26 (t, J ) 7.8 Hz, 1H), 7.84 (d, J
) 7.8 Hz, 1H), 8.17 (s, 1H), 8.18 (s, 1H); 13C NMR (150 MHz,
CD3OD) δ 8.0, 34.3, 46.7, 59.9, 71.2, 116.7, 118.1, 119.0, 119.5,
129.9, 130.0, 133.1, 137.6, 139.9, 149.1, 151.8, 155.7, 160.7, 161.9,
173.3; HRMS (ESI+) calcd for C18H19N6O5S [M + H]+, 431.1132;
found, 431.1102 (error 7.0 ppm).
(1′S,4′R)-9-[3-((N-(2-Hydroxybenzoyl)sulfamoyl)oxymethyl)-
cyclopent-1-yl]adenine Triethylammonium Salt (12). To com-
pound 11 (25 mg, 0.047 mmol, 1.0 equiv) in MeOH (5 mL) was
added 10% Pd/C (20 mg), and the reaction was stirred for 6 h under
a H2 atmosphere. The reaction mixture was filtered thru a plug of
Celite, and the solids were washed with MeOH (4 × 10 mL). The
filtrate was concentrated under reduced pressure. Purification by
flash chromatography (30:70:1 MeOH/EtOAc/Et3N) afforded the
title compound (9.0 mg, 36%) as a viscous oil: Rf ) 0.4 (4:1
EtOAc/MeOH); [R]20D +1.0 (c 0.44, CH3OH); 1H NMR (600 MHz,
CD3OD) δ 1.28 (t, J ) 7.2 Hz, 9H), 1.82-1.92 (m, 1H), 1.94-
2.04 (m, 2H), 2.06-2.16 (m, 1H), 2.22-2.32 (m, 1H), 2.44-2.50
(m, 1H), 2.50-2.60 (m, 1H), 3.18 (q, J ) 7.2 Hz, 6H), 4.17 (dd,
J ) 10.2, 6.6 Hz, 1H), 4.21 (dd, J ) 10.2, 6.6 Hz, 1H), 4.86-4.96
(m, 1H), 6.72-6.82 (m, 2H), 7.27 (t, J ) 7.8 Hz, 1H), 7.91 (d, J
) 7.8 Hz, 1H), 8.16 (s, 1H), 8.27 (s, 1H); 13C NMR (150 MHz,
CD3OD) δ 9.2, 27.6, 32.7, 36.4, 38.5, 47.9, 57.1, 73.6, 117.9, 119.2,
120.3, 120.8, 131.3, 134.3, 140.9, 150.7, 153.4, 157.2, 161.9, 174.6;
HRMS (ESI+) calcd for C18H21N6O5S [M + H]+, 433.1289; found,
433.1327 (error 8.8 ppm).
glassy oil: Rf ) 0.3 (1:4 MeOH/ EtOAc); [R]20 -10 (c 0.28,
D
MeOH); 1H NMR (600 MHz, CD3OD) δ 1.26 (t, J ) 7.2 Hz, 9H),
2.05-2.20 (m, 1H), 2.40-2.55 (m, 1H), 3.15 (q, J ) 7.2 Hz, 6H),
4.32 (dd, J ) 11.4, 4.2 Hz, 1H), 4.46 (d, J ) 11.4 Hz, 1H), 4.60-
4.80 (m, 2H), 6.00 (s, 1H), 6.70-6.85 (m, 2H), 7.27 (t, J ) 7.2
Hz, 1H), 7.91 (d, J ) 7.8 Hz, 1H), 8.12 (s, 1H), 8.47 (s, 1H); 13C
NMR (150 MHz, CD3OD) δ 9.3, 34.9, 47.9, 70.7, 76.9, 79.9, 92.9,
117.9, 119.3, 120.3, 120.7, 131.3, 134.3, 140.7, 150.2, 153.7, 157.3,
162.0, 174.9; HRMS (ESI+) calcd for C17H19N6O7S [M + H]+,
451.1030; found, 451.1053 (error 5.1 ppm).
(1′R,4′S)-9-[4-(Hydroxymethyl)cyclopent-2-en-1-yl]adenine
(32).50 To a solution of aristeromycin 14 (0.7 g, 2.63 mmol, 1.0
equiv) and trimethyl orthoformate (7.0 mL, 64 mmol, 24.3 equiv)
in DMF (2.1 mL) was added pTsOH‚H2O (720 mg, 3.81 mmol,
1.45 equiv). After 36 h at rt, anhydrous K2CO3 (1.05 g, 7.27 mmol)
was added, and the mixture was stirred for 2 h. The reaction mixture
was filtered, and the solids were washed with a minimum amount
of trimethyl orthoformate (2.0 mL). The combined filtrates and
washings were concentrated under reduced pressure to provide 31
as a gummy residue, which was azeotropically dried with toluene
(20 mL) on a rotary evaporator.
Crude 31 from above was refluxed 16 h in Ac2O (10 mL). The
reaction was cooled to rt, filtered through a plug of silica gel, and
concentrated under reduced pressure to afford a dark yellow solid,
which was treated with 6 N aq HCl (6 mL) at rt for 12 h. The
reaction was concentrated in vacuo. Purification by flash chroma-
tography (3:7 MeOH/EtOAc) afforded the title compound (150 mg,
48%): Rf ) 0.3 (3:7 MeOH/ EtOAc); [R]20D -6.2 (c 0.59, MeOH);
1H NMR (600 MHz, CD3OD) δ 1.73 (dt, J ) 13.8, 6.0 Hz, 1H),
2.82 (ddd, J ) 13.8, 8.4, 5.4 Hz, 1H), 3.02 (br s, 1H), 3.58 (dd, J
) 10.4, 4.8 Hz, 1H), 3.65 (dd, J ) 10.4, 5.4 Hz, 1H), 5.68 (t, J )
6.0 Hz, 1H), 5.95 (d, J ) 6.0, 1H), 6.21 (d, J ) 6.0 Hz, 1H), 8.12
(s, 1H), 8.19 (s, 1H); 13C NMR (150 MHz, CD3OD) δ 35.6, 49.2,
61.3, 65.4, 120.3, 130.5, 140.1, 140.9, 150.3, 153.5, 157.3; HRMS
(ESI+) calcd for C11H14N5O [M + H]+, 232.1193; found, 232.1197
(1.7 ppm).
9-[(((N-(2-Hydroxybenzoyl)sulfamoyl)oxy)ethoxy)methyl]-
adenine Triethylammonium Salt (13). This was prepared from
3649 (100 mg, 0.346 mmol, 1.0 equiv) and 26 (338 mg, 1.04 mmol,
3.0 equiv) using the general salicylation procedure A. Purification
by flash chromatography (85:15:1 EtOAc/MeOH/Et3N) afforded
37 (80 mg, 44%).
(1′R,4′S)-9-[4-((Sulfamoyl)oxymethyl)cyclopent-2-en-1-yl]ad-
enine (33). This was prepared from 32 (150 mg, 0.648 mmol, 1.0
equiv) using the general procedure for sulfamoylation. Purification
by flash chromatography (30:1 EtOAc/MeOH) afforded the title
Compound 37 prepared above was dissolved in MeOH (15.0
mL) and stirred under a H2 atmosphere in the presence of 10%
Pd/C (20 mg). After 4 h, the reaction mixture was filtered through
a plug of Celite. Purification by flash chromatography afforded the
title compound as a white solid (65 mg, 98%): mp ) 93-95 °C;
compound (110 mg, 55%) as an oil: Rf ) 0.50 (7:3 EtOAc/MeOH);
1
[R]20 +70.8 (c 0.290, CH3OH); H NMR (600 MHz, CD3OD) δ
D
1.77 (dt, J ) 14.4, 6.0 Hz, 1H), 2.91 (ddd, J ) 13.8, 9.0, 5.4 Hz,
1H), 3.27 (br s, 1H), 4.16 (dd, J ) 9.6, 4.8 Hz, 1H), 4.22 (dd, J )
9.6, 4.8 Hz, 1H), 5.73 (t, J ) 6.0 Hz, 1H), 6.01 (d, J ) 6.0 Hz,
1H), 6.21 (d, J ) 5.4 Hz, 1H), 8.09 (s, 1H), 8.20 (s, 1H); 13C NMR
(150 MHz, CDCl3) δ 35.5, 46.1, 61.0, 72.3, 120.2, 131.5, 138.3,
140.8, 150.4, 153.6, 157.3; MS (ESI+) calcd for C11H12N5 [M -
SO2NH2]+, 214.1; found, 214.1.
1
Rf ) 0.35 (3:1 EtOAc/MeOH); H NMR (600 MHz, CD3OD) δ
1.28 (t, J ) 7.2 Hz, 9H), 3.17 (q, J ) 7.2 Hz, 6H), 3.82 (t, J ) 4.2
Hz, 2H), 4.25 (t, J ) 4.2 Hz, 2H), 5.67 (s, 2H), 6.72-6.84 (m,
2H), 7.22 (t, J ) 7.8 Hz, 1H), 7.89 (d, J ) 7.2 Hz, 1H), 8.19 (s,
1H), 8.24 (s, 1H); 13C NMR (150 MHz, CD3OD) δ 8.0, 46.7, 67.5,
68.3, 72.9, 116.6, 118.0, 118.8, 119.5, 130.1, 133.1, 141.9, 149.7,
152.9, 156.2, 160.8, 173.6; HRMS (ESI+) calcd for C15H17N6O6S
[M + H]+, 409.0925; found, 409.0904 (error 5.1 ppm).
(1′R,4′S)-9-[4-((N-(2-(Methoxymethyloxy)benzoyl)sulfamoyl)-
oxymethyl)cyclopent-2-en-1-yl]adenine Triethylammonium Salt
(34). This was prepared from 33 (100 mg, 0.32 mmol) and 16 (270
mg, 0.96 mmol, 3.0 equiv) using the general salicylation procedure
A. Purification by flash chromatography (80:20:1 EtOAc/MeOH/
Cloning, Overexpression, and Purification of MbtA. The mbtA
gene was amplified by PCR from M. tuberculosis BAC RV143
using primers 5′CCAGCCCCCCTGTTAAGGAG3′ and 5′CCGA-

Adenylation Inhibitors of Siderophore Biosynthesis
Journal of Medicinal Chemistry, 2006, Vol. 49, No. 26 7633
ACGTGCCCATGAGTC3′ and was cloned into pCR2.1-TOPO
(Invitrogen) using the manufacturers instructions creating pCDD001.
This plasmid served as template for a second round of PCR using
the primers 5′ATGCCACCTAAAGCGGCAGATGGCCGCCGA3′
and 5′GGAAGCTTAATGGCAGCGCTGGGTCGTCACGGGA3′.
The resulting mbtA gene fragment was cloned into pET SUMO
(Invitrogen), according to the manufacturers instructions to create
pCDD003. After successfully cloning mbtA, the gene cassette was
confirmed by sequencing. pCDD003 was then electroporated into
E. coli BL21(DE3) containing the groEL groES chaperone plasmid
pGRO7 (Takara). LB (500 mL) supplemented with kanamycin (50
µg/mL), chloramphenicol (25 µg/mL), MgCl2 (10 mM), and
arabinose (0.5 mg/mL) was inoculated with 5 mL of overnight
culture. After growing to an OD600 at 37 °C, the cultures were
induced with 0.4 mM IPTG and grown for an additional 4 h at 30
°C. The cultures were then centrifuged, and the pellet was frozen
at -20 °C overnight. To remove GroEL from MbtA during the
purification process, a modified ATP-dependent removal protocol
was employed.52 Frozen pellets were resuspended in 22.5 mL
GroEL stripping buffer A (100 mM TEA‚HCl, 170 mM NaCl, pH
7.4) and sonicated. The lysate was centrifuged 10 min at 30 000 ×
g, and the pellet was discarded. Subsequently, 2.5 mL GroEL
stripping buffer B (100 mM TEA‚HCl, 200 mM MgCl2, 100 mM
ATP, pH 7.4) was added, and the lysate was incubated for 30 min
at 4 °C. To ensure the removal of GroEL, 140 µL of denatured E.
coli proteins prepared as previously described52 was added and the
lysate was allowed to incubate for another 1 h at 4 °C. After this
second incubation, 2 mL of 50% Ni-NTA (Qiagen) was added to
the lysate and allowed to incubate on an end-over-end mixer for 1
h at 4 °C. The mixture was poured into a column, and the flow
through was collected. The column was washed with 16 mL of
wash buffer (50 mM sodium phosphate, 300 mM NaCl, 20 mM
imidazole, pH 8.0), and MbtA was eluted with 3 mL of elution
buffer (50 mM sodium phosphate, 300 mM NaCl, 250 mM
imidazole, pH 8.0) of which the first 0.5 mL was discarded and
the final 2.5 mL was collected. The protein fraction was desalted
on a PD-10 column (GE Healthcare) into Sumo digestion buffer
without DTT (50 mM Tris‚HCl, 0.2% Igepal CA-630 (Sigma), 150
mM NaCl). The protein concentration was measured by the
Bradford Assay (Bio-Rad), after which DTT was added to 1 mM
and SUMO protease was added to 15 U/mg. The reaction was
incubated 15 h at 4 °C. After digestion, 0.5 mL of 50% Ni-NTA
was added back to the sample to remove the SUMO tag, SUMO
protease, and other E. coli proteins carried through purification that
have some affinity for Ni-NTA. The mixture was incubated at 4
°C for 1 h and then loaded on a column to separate the flow through
from the resin. The flow through was collected and desalted on a
PD-10 column into MbtA storage buffer (10 mM Tris‚HCl, 1 mM
EDTA, 5% glycerol, pH 8.0) and stored at -80 °C (2-5 mg
protein/L culture).
Enzyme Kinetic Studies. ATP/PPi Exchange Assay.54 Reac-
tions were performed under initial velocity conditions in a total
volume of 101 µL. The reaction was set up in a volume of 90 µL
and contained 250 µM salicylic acid, 10 mM ATP, 1 mM PPi, and
7 nM MbtA in assay buffer (75 mM Tris-HCl pH 7.5, 10 mM
MgCl2, 2 mM DTT). In reactions designed to measure inhibition
of 8-13, the inhibitors (1 µL) in DMSO or DMSO only as a control
were added. For experiments investigating the steady-state kinetic
parameters of salicylic acid and ATP, reactions were set up as above
using 14 nM MbtA and either holding the ATP concentration
constant at 10 mM and varying the salicylic acid concentration (2.25
µM, 4.5 µM, 9.0 µM, 18.0 µM, 36.0 µM) or holding the salicylic
acid concentration constant at 250 µM and varying the ATP
concentration (37.5 µM, 75 µM, 150 µM, 300 µM, 600 µM, 10
mM). Titration of MbtA against compound 8 to attain the accurate
enzyme concentration used 7 nM enzyme in assay buffer along
with 250 µM salicylic acid and 200 µM ATP (to attain the desired
[E]/Kiapp ratio of 200). The reaction components were allowed to
equilibrate for 10 min at 23 °C. Reactions were initiated by the
addition of 10 µL (0.5 µCi 32PPi, Perkin-Elmer 84.12Ci/mmol) in
50 mM sodium phosphate buffer pH 7.8 and placed at 37 °C for
20 min. Reactions were quenched by the addition of 200 µL
quenching buffer (350 mM HClO4, 100 mM PPi, 1.8% w/v activated
charcoal). The charcoal was pelleted by centrifugation and washed
once with 500 µL H2O. The washed pellet was resuspended in 200
µL H2O, transferred to a scintillation vial, mixed with 15 mL
scintillation fluid (RPI), and counted on a Beckman LS6500. The
counts from the bound γ-[32P]-ATP were directly proportional to
initial velocity of the reaction.
Data Analysis. For inhibitors that displayed tight-binding
inhibition (KIapp < 200‚[E]), the fractional activity (Vi/V0), where Vi
is the reaction velocity at a given [I] and V0 is the reaction velocity
of the DMSO control, were fit by nonlinear regression analysis to
the Morrison equation (eq 1), constraining [E] to 7.0 nM using
GraphPad prism version 4.0 to obtain KI app values.40 The enzyme
concentration in turn was determined by active-site titration
employing inhibitor 8.40 The dose response curves of the fractional
activity versus [I] for inhibitor 8 are shown in Figure 3, and 9-13
are shown in Figures S5-S9
([E] - [I] - KIapp) + ([E] - [I] - K app)2 + 4[E][KIapp
]
x
I
Vi/V0 )
2[E]
(1)
(2)
KIapp
KI′ )
(ATP)
1 + [ATP]/KM
M. tuberculosis H37Rv MIC Assay. Minimum inhibitory
concentrations (MICs) were determined in quadruplicate in iron-
deficient GAST according to the broth microdilution method using
drugs from DMSO stock solutions or with control wells treated
with an equivalent amount of DMSO.19 All measurements reported
herein used an initial cell density of 104-105 cells/assay, and growth
was monitored at 10 and at 14 days, with the untreated and DMSO-
treated control cultures reaching an OD620 ∼ 0.2-0.3. Plates were
incubated at 37 °C (100 µL/well), and growth was recorded by
measurement of optical density at 620 nm.
Y. pseudotuberculosis ATCC 6902 MIC Assay. Y. pseudotu-
berculois ATCC 6902 was selected as a representative strain from
others in the ATCC collection based on its phenotypic similarity
to other strains, nucleotide sequence confirmation of the ybtE gene,
as well as siderophore production using CAS agar plates.79 Further,
this strain demonstrated the ability to grow under iron-limiting
conditions relative to ybtE-negative strains. The MIC99 concentration
of each nucleoside compound was determined in triplicate using
the broth microdilution method. Y. pseudotuberculosis ATCC 6902
was cultured overnight on Difco Brain Heart Infusion (BHI, Becton,
Dickinson and Co.) medium at 37 °C. Cells were washed twice
with desferrated BHI (BHI-D, BHI treated with Chelex 100 resin
(BioRad) and supplemented with 200 µM 2,2′dipyridyl). The
washed cells were diluted in BHI-D to a 1.0 MacFarland standard
and used as an inoculum (initial cell density of 103-104 cells/200
µL media/well.) for BHI-D or BHI-D supplemented with 150 µM
FeCl3‚6H2O for iron-rich conditions. Each compound was added
to the media at varying concentrations up to 100 µM, and an
equivalent amount of DMSO (1%) only was used in control wells.
Microtiter plate cultures were grown for 24 h at 37 °C and shaken
using a Micromix plate shaker (program 20). Final optical density
at 600 nm was measured using a SpectraMax Plus (Molecular
Devices) reader.
Docking Studies. The homology model and docking runs were
configured as described,43 except that water molecules were held
fixed during the conformational search. A total of 10 000 search
steps were performed for each compound.
Acknowledgment. We thank Dr. Robert Vince for invalu-
able advice and for supplying aristeromycin and acycloadenos-
ine. We thank the Minnesota Supercomputing Institute VWL
lab for computer time and the Pasteur Research Institute (Paris)
for suppyling a bacterial artificial chromosome library of M.

7634 Journal of Medicinal Chemistry, 2006, Vol. 49, No. 26
Somu et al.
(21) Luo, M.; Fadeev, E. A.; Groves, J. T. Mycobactin-mediated iron
acquisition within macrophages. Nat. Chem. Biol. 2005, 1, 149-
153.
(22) Ratledge, C.; Brown, K. A. Inhibition of mycobactin formation in
Mycobacterium smegmatis by p-aminosalicylate. A new proposal for
the mode of action of p-aminosalicylate. Am. ReV. Respir. Dis. 1972,
106, 774-776.
(23) Mandell, G. L.; Petri, W. A. J. Antimicrobial agents: Drugs used in
the chemotherapy of tuberculosis, Mycobacterium aVium complex
disease, and leprosy. In Goodman and Gilman’s the Pharmacological
Basis of Therapeutics, 9th ed.; McGraw-Hill: New York, 1996; p
1164.
(24) Murray, M. J.; Murray, A. B.; Murray, M. B.; Murray, C. J. The
adverse effect of iron repletion on the course of certain infections.
Br. Med. J. 1978, 2, 1113-1115.
tuberculosis H37Rv. This research was supported by grants from
NIH (R01AI070219) and the Center for Drug Design in the
Academic Health Center of the University of Minnesota to
C.C.A.
Supporting Information Available: 1H NMR and 13C NMR
spectra of 8-13, table of HPLC conditions and purities of 8-13,
SDS-PAGE of purified MbtA, active-site titration plot of MbtA
with 6, normalized V versus [S] plots for the reactions of ATP and
salicylic acid with MbtA, and dose-response curves of fractional
MbtA activity (Vi/V0) as a function of inhibitor concentrations for
9-13. This material is available free of charge via the Internet at
http://pubs.acs.org.
(25) Manabe, Y. C.; Saviola, B. J.; Sun, L.; Murphy, J. R.; Bishai, W. R.
Attenuation of virulence in Mycobacterium tuberculosis expressing
a constitutively active iron repressor. Proc. Natl. Acad. Sci. U.S.A.
1999, 96, 12844-12848.
(26) Marahiel, M. A.; Stachelhaus, T.; Mootz, H. D. Modular peptide
synthetases involved in nonribosomal peptide synthesis. Chem. ReV.
1997, 97, 2651-2674.
(27) Sieber, S. A.; Marahiel, M. A. Molecular mechanisms underlying
nonribosomal peptide synthesis: approaches to new antibiotics. Chem.
ReV. 2005, 105, 715-738.
(28) Crosa, J. H.; Walsh, C. T. Genetics and assembly line enzymology
of siderophore biosynthesis in bacteria. Microbiol. Mol. Biol. ReV.
2002, 66, 223-249.
(29) Kerbarh, O.; Ciulli, A.; Howard, N. I.; Abell, C. Salicylate biosyn-
thesis: overexpression, purification, and characterization of Irp9, a
bifunctional salicylate synthase from Yersinia enterocolitica. J.
Bacteriol. 2005, 187, 5061-5066.
(30) Harrison, A. J.; Ramsay, R. J.; Baker, E. N.; Lott, J. S. Crystallization
and preliminary X-ray crystallographic analysis of MbtI, a protein
essential for siderophore biosynthesis in Mycobacterium tuberculosis.
Acta Crystallogr., Sect. F 2005, 61, 121-123.
(31) Harrison, A. J.; Yu, M.; Gardenborg, T.; Middleditch, M.; Ramsay,
R. J.; Baker, E. N.; Lott, J. S. The structure of MbtI from
Mycobacterium tuberculosis, the first enzyme in the biosynthesis of
the siderophore mycobactin, reveals it to be a salicylate synthase. J.
Bacteriol. 2006, 188, 6081-6091.
(32) Moody, D. B.; Young, D. C.; Cheng, T. Y.; Rosat, J. P.; Roura-Mir,
C.; O’Connor, P. B.; Zajonc, D. M.; Walz, A.; Miller, M. J.; Levery,
S. B.; et al. Science 2004, 303, 527-531.
(33) Card, G. L.; Peterson, N. A.; Smith, C. A.; Rupp, B.; Schick, B. M.;
Baker, E. N. The crystal structure of Rv1347c, a putative antibiotic
resistance protein from Mycobacterium tuberculosis, reveals a GCN5-
related fold and suggests an alternative function in siderophore
biosynthesis. J. Biol. Chem. 2005, 280, 13978-13986.
(34) Schimmel, P.; Tao, J.; Hill, J. Aminoacyl t-RNA synthetases as targets
for new anti-infectives. FASEB J. 1998, 12, 1599-1609.
(35) Kim, S.; Lee, S. W.; Choi, E.-C.; Choi, S. Y. Aminoacyl-tRNA
synthetases and their inhibitors as a novel family of antibiotics. Appl.
Microbiol. Biotechnol. 2003, 61, 278-288.
(36) May, J. J.; Kessler, N.; Marahiel, M. A.; Stubbs, M. T. Crystal
structure of DhbE, an archetype for aryl acid activating domains of
modular nonribosomal peptide synthetases. Proc. Natl. Acad. Sci.
U.S.A. 2002, 99, 12120-12125.
References
(1) World Health Organization 2005 Fact sheet on tuberculosis. http://
www.who.int/mediacentre/factsheets/fs104/en/print.html.
(2) CDC; Worldwide emergence of Mycobacterium tuberculosis with
extensive resistance to second-line drugs, MMWR; 55(10), TK-TK.
(3) Raymond, K. N.; Dertz, E. A.; Kim, S. S. Enterobactin: an archetype
for microbial iron transport. Proc. Natl. Acad. Sci. U.S.A. 2003, 100,
3584-3588.
(4) Ratledge, C.; Dover, L. G. Iron metabolism in pathogenic bacteria.
Annu. ReV. Microbiol. 2000, 54, 881-941.
(5) Quadri, L. E. Assembly of aryl-capped siderophores by modular
peptide synthetases and polyketide synthases. Mol. Microbiol. 2000,
37, 1-12.
(6) Clarke, T. E.; Tari, L. W.; Vogel, H. J. Structural biology of bacterial
iron uptake systems. Curr. Top. Med. Chem. 2001, 1, 7-30.
(7) Snow, G. A. Isolation and structure of mycobactin-T, a growth factor
of Mycobacterium tuberculosis. Biochem. J. 1965, 97, 166-175.
(8) Gobin, J.; Moore, C. H.; Reeve, J. R., Jr.; Wong, D. K.; Gibson, B.
W.; Horwitz, M. A. Iron acquisition by Mycobacterium tuberculo-
sis: Isolation and characterization of a family of iron-binding
exochelins. Proc. Natl. Acad. Sci. U.S.A. 1995, 92, 5189-5193.
(9) Snow, G. A. Mycobactins: Iron-chelating growth factors from
mycobacteria. Bacteriol. ReV. 1970, 34, 99-125.
(10) Vergne, A. F.; Walz, A. J.; Miller, M. J. Iron chelators from
mycobacteria (1954-1999) and potential therapeutic applications.
Nat. Prod. Rep. 2000, 17, 99-116.
(11) Twort, F. W.; Ingram, G. L. Y. A method for isolating and cultivating
the Mycobacterium enteritidis chronicae pseudotuberculosis boVis,
Jo¨hne, and some experiments on the preparation of a diagnostic
vaccine for pseudo-tuberculosis enteritis of bovines. Proc. R. Soc.
London, Ser. B 1912, 84, 517-530.
(12) Hu, J.; Miller, M. J. Total synthesis of a mycobactin S, a siderophore
growth promoter of Mycobacterium smegmatis, and determination
of its growth inhibitory activity against Mycobacterium tuberculosis.
J. Am. Chem. Soc. 1997, 119, 3462-3468.
(13) Xu, Y.; Miller, M. J. Total synthesis of mycobactin analogues as
potent antimycobacterial agents using a minimal protecting group
strategy. J. Org. Chem. 1998, 63, 4314-4322.
(14) Miller, M. J.; Xu, Y. Antimycobacterial Agents. U. S. Patent 6,-
310,058, Oct. 30, 2001.
(15) Cole, S. T.; Brosch, R.; Parkhill, J.; Garnier, T.; Churcher, C.; Harris,
D.; Gordon, S. V.; Eiglmeier, K.; Gas, S.; Barry, C. E., III; et al.
Deciphering the biology of Mycobacterium tuberculosis from the
complete genome sequence. Nature 1998, 393, 537-544.
(16) Quadri, L. E.; Sello, J.; Keating, T. A.; Weinreb, P. H.; Walsh, C.
T. Identification of a Mycobacterium tuberculosis gene cluster
encoding the biosynthetic enzymes for assembly of the virulence-
conferring siderophore mycobactin. Chem. Biol. 1998, 5, 631-645.
(17) Krithika, R.; Marathe, U.; Saxena, P.; Ansari, M. Z.; Mohanty, D.;
Gokhale, R. S. A genetic locus required for iron acquisition in
Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. U.S.A. 2006, 103,
2069-2074.
(18) Schmitt, M. P.; Predich, M.; Doukhan, L.; Smith, I.; Holmes, R. K.
Characterization of an iron-dependent regulatory protein (IdeR) of
Mycobacterium tuberculosis as a functional homolog of the diphtheria
toxin repressor (DtxR) from Corynebacterium diphtheriae. Infect.
Immun. 1995, 63, 4284-4289.
(19) De Voss, J. J.; Rutter, K.; Schroeder, B. G.; Su, H.; Zhu, Y.; Barry,
C. E., III. The salicylate-derived mycobactin siderophores of Myco-
bacterium tuberculosis are essential for growth in macrophages. Proc.
Natl. Acad. Sci. U.S.A. 2000, 97, 1252-1257.
(20) Wagner, D.; Maser, J.; Lai, B.; Cai, Z.; Barry, C. E., III; Honer Zu
Bentrup, K.; Russell, D. G.; Bermudez, L. E. Elemental analysis of
Mycobacterium aVium-, Mycobacterium tuberculosis-, and Myco-
bacterium smegmatis-containing phagosomes indicates pathogen-
induced microenvironments within the host cell’s endosomal system.
J. Immunol. 2005, 174, 1491-1500.
(37) Semret, M.; Zhai, G.; Mostowy, S.; Cleto, C.; Alexander, D.;
Cangelosi, G.; Cousins, D.; Collins, D. M.; van Soolingen, D.; Behr,
M. A. Extensive genomic polymorphism within Mycobacterium
aVium. J. Bacteriol. 2004, 186, 6332-6334.
(38) Gulick, A. M.; Lu, X.; Dunaway-Mariano, D. Crystal structure of
4-chlorobenzoate:CoA ligase/synthetase in the unliganded and aryl
substrate-bound states. Biochemistry 2004, 43, 8670-8679.
(39) Finking, R.; Neumuller, A.; Solsbacher, J.; Konz, D.; Kretzschmar,
G.; Schweitzer, M.; Krumm, T.; Marahiel, M. A. Aminoacyl
adenylate substrate analogues for the inhibition of adenylation
domains of nonribosomal peptide synthetases. ChemBioChem 2003,
4, 903-906.
(40) Copeland, R. A. EValuation of Enzyme Inhibitors in Drug DiscoVery;
Wiley: Hoboken, NJ, 2005.
(41) May, J. J.; Finking, R.; Wiegeshoff, F.; Weber, T. T.; Bandur, N.;
Koert, U.; Marahiel, M. A. Inhibition of the D-alanine:D-alanyl carrier
protein ligase from Bacillus subtilis increases the bacterium’s
susceptibility to antibiotics that target the cell wall. FEBS J. 2005,
272, 2993-3003.
(42) Ferreras, J. A.; Ryu, J. S.; Di Lello, F.; Tan, D. S.; Quadri, L. E.
Small-molecule inhibition of siderophore biosynthesis in Mycobac-
terium tuberculosis and Yersinia pestis. Nat. Chem. Biol. 2005, 1,
29-32.

Adenylation Inhibitors of Siderophore Biosynthesis
Journal of Medicinal Chemistry, 2006, Vol. 49, No. 26 7635
(43) Miethke, M.; Bisseret, P.; Beckering, C. L.; Vignard, D.; Eustache,
J.; Marahiel, M. A. Inhibition of aryl acid adenylation domains
involved in bacterial siderophore synthesis. FEBS J. 2006, 273, 409-
419.
(44) Somu, R. V.; Boshoff, H.; Qiao, C.; Bennett, E. M.; Barry, C. E.,
III; Aldrich, C. C. Rationally designed nucleoside antibiotics that
inhibit siderophore biosynthesis of Mycobacterium tuberculosis. J.
Med. Chem. 2006, 49, 31-34.
(45) Vannada, J.; Bennett, E. M.; Wilson, D.; Boshoff, H. I.; Barry, C.
E., III; Aldrich, C. C. Design, synthesis and biological evaluation of
beta-ketosulfonamide adenylation inhibitors as antitubercular agents.
Org. Lett. 2006, 8, 4707-4710.
(46) Vince, R.; Hua, M. Synthesis and anti-HIV activity of carbocyclic
2′,3′-didehydro-2′,3′-dideoxy 2,6-disubstituted purine nucleosides. J.
Med. Chem. 1990, 33, 17-21.
(47) Parry, R. J.; Bornemann, V.; Subramanian, R. Biosynthesis of the
Nucleoside Antibiotic Aristeromycin. J. Am. Chem. Soc. 1989, 111,
5819-5824.
(48) Picherit C.; Wagner, F.; Uguen, D. The sequel to a carbocyclic
nucleoside synthesis: a divergent access to both arenediazonium ions
and aryl triflates. Tetrahedron Lett. 2004, 45, 2579-2583.
(49) Peterson, E. M.; Brownell, J.; Vince, R. Synthesis and biological
evaluation of 5′-sulfamoylated purinyl carbocyclic nucleosides. J.
Med. Chem. 1992, 35, 3991-4000.
(50) Saksena, A. K.; Girijavallabhan, V. M.; Ganguly, A. K. Process for
preparing cyclopentyl purine derivatives. U.S. Patent 4,999,428, Apr
14, 1989.
(62) Perry, R. D.; Balbo, P. B.; Jones, H. A.; Fetherston, J. D.; DeMoll,
E. Yersiniabactin from Yersinia pestis: biochemical characterization
of the siderophore and its role in iron transport and regulation.
Microbiology 1999, 145, 1181-1190.
(63) Payne, R. J.; Kerbarh, O.; Miguel, R. N.; Abell, A. D.; Abell, C.
Inhibition studies on salicylate synthase. Org. Biomol. Chem. 2005,
3, 1825-1827.
(64) Lin, H.; Fischbach, M. A.; Gatto, G. J. J.; Liu, D. R.; Walsh, C. T.
Bromoenterobactins as potent inhibitors of a pathogen-associated,
siderophore-modifying C-glycosyltransferase. J. Am. Chem. Soc.
2006, 128, 9324-9325.
(65) Callahan, B. P.; Lomino, J. V.; Wolfenden, R. Nanomolar inhibition
of the enterobactin biosynthesis enzyme EntE: synthesis, substituent
effects, and additivity. Bioorg. Med. Chem. Lett. 2006, 16, 3802-
3805.
(66) Brennan, P. J.; Nikaido, H. The envelope of mycobacteria. Annu.
ReV. Biochem. 1995, 64, 29-63.
(67) Braibant, M.; Gilot, P.; Content, J. The ATP-binding cassette (ABC)
transport systems of Mycobacterium tuberculosis. FEMS Microbiol.
ReV. 2000, 24, 449-467.
(68) Rodriguez, G. M.; Smith, I. Identification of an ABC transporter
required for iron acquisition and virulence in Mycobacterium
tuberculosis. J. Bacteriol. 2006, 188, 424-430.
(69) Niederweis, M. Mycobacterial porins-new channel proteins in unique
outer membranes. Mol. Microbiol. 2003, 49, 1167-1177.
(70) Ehmann, D. E.; Shaw-Reid, C. A.; Losey, H. C.; Walsh, C. T. The
EntF and EntE adenylation domains of Escherichia coli enterobactin
synthetase: sequestration and selectivity in acyl-AMP transfers to
thiolation domain cosubstrates. Proc. Natl. Acad. Sci. U.S.A. 2000,
97, 2509-2514.
(51) Schaeffer, H. J.; Gurwana, S.; Vince, R.; Bittner, S. Novel substrate
of adenosine deaminase. J. Med. Chem. 1971, 14, 367-369.
(52) Rohman, M.; Harrison-Lavoie, K. J. Separation of copurifying GroEL
from glutathione-S-transferase fusion proteins. Protein Expression
Purif. 2000, 20, 45-47.
(53) Copeland, R. Tight-binding inhibitors. A practical introduction to
structure, mechanism, and data analysis, 2nd ed.; Wiley-VCH: New
York, 2000; Chapter 9, p 313.
(71) Stachelhaus, T.; Mootz, H. D.; Marahiel, M. A. The specificity-
conferring code of adenylation domains in nonribosomal peptide
synthetases. Chem. Biol. 1999, 6, 493-505.
(72) Challis, G. L.; Ravel, J.; Townsend, C. A. Predictive, structure-based
model of amino acid recognition by nonribosomal peptide synthetase
adenylation domains. Chem. Biol. 2000, 7, 211-224.
(54) Linne, U.; Marahiel, M. A. Reactions catalyzed by mature and
recombinant nonribosomal peptide synthetases. Methods Enzymol.
2004, 388, 293-315.
(55) Pope, A. J.; Lapointe, J.; Mensah, L.; Benson, N.; Brown, M. J.;
Moore, K. J. Characterization of isoleucyl-tRNA synthetase from
Staphylococcus aureus. I: Kinetic mechanism of the substrate
activation reaction studied by transient and steady-state techniques.
J. Biol. Chem. 1998, 273, 31680-31690.
(56) Pope, A. J.; Moore, K. J.; McVey, M.; Mensah, L.; Benson, N.;
Osbourne, N.; Broom, N.; Brown, M. J.; O’Hanlon, P. Characteriza-
tion of isoleucyl-tRNA synthetase from Staphylococcus aureus. II.
Mechanism of inhibition by reaction intermediate and pseudomonic
acid analogues studied using transient and steady-state kinetics. J.
Biol. Chem. 1998, 273, 31691-31701.
(57) Williams, J. W.; Morrison, J. F. The kinetics of reversible tight-
binding inhibition. Methods Enzymol. 1979, 63, 437-467.
(58) Cheng, Y.; Prusoff, W. H. Relationship between the inhibition
constant (KI) and the concentration of inhibitor which causes 50
percent inhibition (IC50) of an enzymatic reaction. Biochem. Phar-
macol. 1973, 22, 3099-3108.
(59) Ikeda, S.; Chakravarty, R.; Ives, D. H. Multisubstrate analogs for
deoxynucleoside kinases. J. Biol. Chem. 1986, 261, 15836-15843.
(60) Fromm, H. J. Reversible enzyme inhibitors as mechanistic probes.
Methods Enzymol. 1995, 249, 123-143.
(73) Eppelmann, K.; Stachelhaus, T.; Marahiel, M. A. Exploitation of the
selectivity-conferring code of nonribosomal peptide synthetases for
the rational design of novel peptide antibiotics. Biochemistry 2002,
41, 9718-9726.
(74) Bucevic-Popovic, V.; Pavela-Vrancic, M.; Dieckmann, R.; Do¨hren,
H. V. Relationship between activating and editing functions of the
adenylation domain of apo-tyrocidin synthetase 1 (apo-TY1). Bio-
chemie 2006, 88, 265-270.
(75) Conti, E.; Stachelhaus, T.; Marahiel, M. A.; Brick, P. Structural basis
for the activation of phenylalanine in the non-ribosomal biosynthesis
of gramicidin S. EMBO J. 1997, 16, 4174-4183.
(76) Ratledge, C.; Winder, F. G. The accumulation of salicylic acid by
mycobacteria during growth on an iron-deficient medium. Biochem.
J. 1962, 84, 501-506.
(77) Heacock, D.; Forsyth, C. J.; Shiba, K.; Musier-Forsyth, K. Synthesis
and aminoacyl-tRNA synthetase inhibitory activity of prolyl adenylate
analogs. Bioorg. Chem. 1996, 24, 273-289.
(78) Dunn, B. M.; Bruice, T. C. Steric and electronic effects on the
neighboring general acid catalyzed hydrolysis of methyl phenyl
acetals of formaldehyde. J. Am. Chem. Soc. 1970, 92, 2410-2416.
(79) Schwyn, B.; Neilands, J. B. Universal chemical assay for the detection
and determination of siderophores. Anal. Biochem. 1987, 160, 47-56.
(61) Sun, G.; Voigt, J. H.; Filippov, I. V.; Marquez, V. E.; Nicklaus, M.
C. PROSIT: Pseudo-rotational online service and interactive tool,
applied to a conformational survey of nucleosides and nucleotides.
J. Chem. Inf. Comput. Sci. 2004, 44, 1752-1762.
JM061068D