The role of conserved arginine residue in loop 4 of glycoside hydrolase family 10 xylanases

Article abstract of DOI:10.1271/bbb.69.904

An arginine residue in loop 4 connecting β strand 4 and α-helix 4 is conserved in glycoside hydrolase family 10 (GH10) xylanases. The arginine residues, Arg²⁰⁴ in xylanase A from Bacillus halodurans C-125 (XynA) and Arg¹⁹⁶ in xylanas

Full text of DOI:10.1271/bbb.69.904

Biosci. Biotechnol. Biochem., 69 (5), 904–910, 2005
The Role of Conserved Arginine Residue in Loop 4 of Glycoside
Hydrolase Family 10 Xylanases
y
1
Mamoru NISHIMOTO,1 Motomitsu KITAOKA,1; Shinya FUSHINOBU,2 and Kiyoshi HAYASHI
1National Food Research Institute, 2-1-12 Kannondai, Tsukuba, Ibaraki 305-8642, Japan
2Department of Biotechnology, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan
Received October 4, 2004; Accepted February 10, 2005
An arginine residue in loop 4 connecting ꢀ strand 4
and ꢁ-helix 4 is conserved in glycoside hydrolase family
10 (GH10) xylanases. The arginine residues, Arg204 in
xylanase A from Bacillus halodurans C-125 (XynA) and
Arg196 in xylanase B from Clostridium stercorarium F9
(XynB), were replaced by glutamic acid, lysine, or
glutamine residues (XynA R204E, K and Q, and XynB
R196E, K and Q). The pH-kcat=Km and the pH-kcat
relationships of these mutant enzymes were measured.
The pKe2 and pKes2 values calculated from these curves
were 8.59 and 8.29 (R204E), 8.59 and 8.10 (R204K), 8.61
and 8.19 (R204Q), 7.42 and 7.19 (R196E), 7.49 and 7.18
(R196K), and 7.86 and 7.38 (R196Q) respectively. Only
the pKes2 value of arginine derivatives was less than
those of the wild types (8.49 and 9.39 [XynA] and 7.62
and 7.82 [XynB]). These results suggest that the
conserved arginine residue in GH10 xylanases increases
the pKa value of the proton donor Glu during substrate
binding. The arginine residue is considered to clamp the
proton donor and subsite þ1 to prevent structural
change during substrate binding.
acid residues around the active cleft have been deter-
mined by mutation analysis and structural analysis with
substrate complex.14–18) We noticed that an arginine
residue is conserved near the proton donor glutamic acid
residue in the middle of loop 4 following ꢀ strand 4 in
the three-dimensional structures of GH10 xylanases.
Because the arginine residue is located approximately
ꢀ
4 A from the glutamic acid residue and tyrosine or
phenylalanine residues forming a part of subsite þ1, the
arginine residue does not directly interact with the
proton donor glutamic acid residue or substrate binding
sites. In this study, we investigated the role of the
arginine residue using two GH10 xylanases, xylanase A
from Bacillus halodurans C-125 (XynA) and xylanase B
from Clostridium stercorarium F9 (XynB).19,20) We
concluded that the arginine residue plays a role in
keeping the pKa of the proton donor glutamic acid
residue high when the enzyme is bound with a substrate.
Materials and Methods
Construction of arginine mutants. Arginine residues
of XynA and XynB were replaced by glutamic acid,
lysine, or glutamine residues using mega-primer poly-
merase chain reaction21) with KOD plus polymerase
(Toyobo, Osaka, Japan), and the primers shown in
Table 1. Plasmid DNA of XynA and XynB prepared
previously19) were used as templates. The amplified
fragments and pET28a vector (Novagen, Darmstadt,
Germany) were digested with NcoI and XhoI before the
ligation step, which employed a DNA ligation kit,
Ligation High (Toyobo). In the construction of the
expression plasmids, Ile2 from XynA and Asn2 from
XynB were replaced by Val and Asp respectively, to
produce an additional NcoI restriction enzyme site. At
the C-terminus of each fragment, a Leu-Glu-His-His-
His-His-His-His sequence was added to facilitate the
purification process. The expression plasmids were used
to transform Escherichia coli BL21 (DE3).
Key words: glycoside hydrolase family 10 (GH10);
xylanase; pH activity; arginine
Xylanase (EC3.2.1.8) catalyzes the hydrolysis of the
main polysaccharide chain (ꢀ-1,4 xylosyl bond) in
xylan, the most abundant component of plant cell walls
except for cellulose. Recently, xylanase has been found
to be applicable in the paper industry, replacing the use
of toxic chlorinated species to remove lignin from kraft
pulp.1,2) Most xylanases are classified into two families
based on their amino acid sequence similarity,3) glyco-
side hydrolase families 10 and 11 (GH10 and GH11).
GH10 xylanase takes a TIM barrel structure.4–8) Cata-
lytic amino acid residues has been identified as two
glutamic acid residues.9,10) It is known that several
amino acid residues are widely conserved as well the
catalytic amino acid residues, forming subsite ꢀ2 to þ1
in GH10 xylanases.11–13) The roles of some of the amino
y
To whom correspondence should be addressed. Tel: +81-29-838-8071; Fax: +81-29-838-7321; E-mail: mkitaoka@nfri.affrc.go.jp
Abbreviations: GH10, glycoside hydrolase family 10; XynA, xylanase A from Bacillus halodurans C-125; XynB, xylanase B from Clostridium
stercorarium F9; pNP-X2, p-nitrophenyl-ꢀ-D-xylobioside

Role of Conserved Arginine Residue in GH10 Xylanases
905
Table 1. Nucleotide Sequences of the Primers Used for Mega-Primer PCR
Nucleotide sequence (50 ! 30)
XynA-N
XynA-C
R204E
CCATGGTTACACTTTTTAGAAAGCCTT
CTCGAGATCAATAATTCTCCAGTAAGCAGG
AATGTAGTCGGTACCTGTTATTTGATACCATTCCGATTCCTCCAGGCCGCCGCCATCGTC
AATGTAGTCGGTACCTGTTATTTGATACCATTCCGATTCCTTCAGGCCGCCGCCATCGTC
AATGTAGTCGGTACCTGTTATTTGATACCATTCCGATTCCTGCAGGCCGCCGCCATCGTC
TACCATGGATAAATTCTTAAACAAAAAATGGAGCTTAATTTTAACTATGG
ATCCTCGAGTTCCCGCAACCGTGAA
TACTCGGTACCGGTAATCTGATACCAAGGACTGTTTTCCATACCGCCGG
TACTCGGTACCGGTAATCTGATACCAAGGACTGTTTTTCATACCGCCGG
TACTCGGTACCGGTAATCTGATACCAAGGACTGTTTTGCATACCGCCGG
R204K
R204Q
XynB-N
XynB-C
R196E
R196K
R196Q
The restriction enzyme sites are underlined and mutations are indicated by bold letters.
Production and purification of the recombinant
xylanases. Each transformant was cultivated at 30 ꢁC
with shaking in LB medium containing 50 mg/ml
kanamycin until the absorbance at 600 nm reached a
level of 0.5. Protein expression was then induced by the
addition of isopropyl-1-thio-ꢀ-D-galactoside at a final
concentration of 0.5 mM, followed by further incubation
for 20 h at 30 ꢁC with shaking. Mutant enzymes were
purified from the cell-free extract prepared from the
100 ml culture described below. The cells were harvest-
ed by centrifugation at 15;000 ꢂ g for 10 min and then
were resuspended in 20 mM sodium phosphate buffer
(pH 7.0). The resuspended cells were sonicated using a
sonifier (Branson Ultrasonic Corporation, Danbury, CT,
U.S.A.), and the cell debris was removed by centrifu-
gation at 17;000 ꢂ g for 30 min. Each enzyme was
previously.26) The enzyme in 25 ml of 20 mM phosphate
buffer (pH 7.0) containing 0.04% Triton X-100 was
preincubated with 50 ml of various 0.2 M buffer solutions,
as described below, for 3 min, and incubated with 25 ml
of 0.003% substrate for 5 min. The reaction was stopped
by adding 100 ml of copper–bicinchoninic acid reagent.
The reaction mixture was incubated at 100 ꢁC for 15 min
and kept on ice for 20 min. Reducing power was
measured based on absorbance at 560 nm using xylose
as the standard.
pH-Activity studies of the xylanases. To investigate
the relationships between pH and enzyme activity, each
enzyme solution was diluted in 0.13 mM of each of the
following buffers, containing 0.01% Triton X-100 with
various concentrations of the substrate (0.038–1.14 mM)
at the pH levels indicated: citrate (pH 3.2 and 3.7),
acetate (pH 3.9, 4.3, 4.8, 5.3, and 5.8), MES (pH 5.2,
5.6, 6.1, and 6.6), HEPES (pH 6.5, 6.9, 7.3, 7.8, and
8.3), and CHES buffer (pH 7.7, 8.2, 8.8, 9.2, and 9.7).
The kinetic parameters and pKes and pKe values were
calculated by curve-fitting the experimental data to the
Michaelis–Menten equation (Eq. 1) and the bell-shaped
curves (Eq. 2 and Eq. 3)27) using the GraFit computer
program.28)
¨
purified using an AKTA purifier (Pharmacia Biotech,
Uppsala, Sweden) with Ni-NTA agarose (Qiagen,
Hilden, Germany) and DEAE-Toyopearl (Tosoh, To-
kyo) column chromatography, as described previous-
ly.19) The homogeneity of the purified enzymes was
confirmed by SDS–PAGE analysis.22)
Protein measurement and xylanase activity. Protein
concentrations were determined using theoretical ex-
tinction coefficients calculated from the amino acid
sequences of the proteins.23) The E
v ¼ ðkcat½Eꢃ0½Sꢃ0Þ=ðKm þ ½Sꢃ0Þ
VmaxðpHÞ ¼ Vmax=ðð10(pK
(pKes1, pKa for the nucleophile with substrate; pKes2
ðEq. 1Þ
1%
1 cm, 280 nm
values
es1-pH)
)
þ 1Þð10(pH-pK þ 1ÞÞ;
es2
calculated for the arginine mutants from XynA and
XynB were 20.96 and 17.42 respectively. Xylanase
activity was determined by measuring the amount of p-
nitrophenol liberated from p-nitrophenyl-ꢀ-D-xylobio-
side (pNP-X2)24) as substrate. Reactions were performed
at 40 ꢁC in 50 mM MES buffer (pH 6.6) containing
0.01% Triton X-100 and 1.3 mM pNP-X2. The reactions
were stopped by the addition of an equal volume of 1 M
sodium carbonate solution, and the amount of p-nitro-
phenol generated was quantified by measuring absorb-
ance at 400 nm. One unit of xylanase activity was
defined as the amount of the enzyme liberating 1 mmol
of p-nitrophenol per min under the conditions described
above. Xylanase activity for soluble birch wood xylan
was measured using the copper–bicinchoninic acid
method.25) The soluble xylan was prepared as described
,
pKa for the proton donor with substrate binding)
ðEq. 2Þ
Vmax=KmðpHÞ
¼ ðVmax=KmÞ=ðð10(pK
(pKe1, pKa for the nucleophile without substrate;
e1-pH)
)
þ 1Þð10(pH-pK þ 1ÞÞ;
e2
pKe2, pKa for the proton donor without substrate
binding)
ðEq. 3Þ
The dissociation pattern of the proton donor and
nucleophile is illustrated in Fig. 1.

906
M. NISHIMOTO et al.
template. Around the proton donor residues, the struc-
tures of loop 4 were different especially in the front part
due to their low similarity. That of XynB was more
Results and Discussion
Modeled structure of XynA and XynB
To confirm that the arginine residue was mutated, the
predicted three-dimensional structures of XynA and
XynB were constructed on the web site program of
SWISS-MODEL (http://www.expasy.org/swissmod/)29)
based on the three-dimensional structure of GH10
xylanase from Geobacillus stearothermophilus T-6
(PDBID: 1HIZ).30) They showed 75% and 68% amino
acid sequence similarity (Fig. 2A) with XynA and XynB
respectively, suggesting the reliability of the general
structure. The amino acid sequences of XynA and XynB
have 51% identity and 73% similarity. The modeled
structure of XynA and XynB are shown in Fig. 2B to be
comparable with the template structure. The location of
the conserved residues such as catalytic and substrate
binding residues were topologically identical with the
Fig. 1. Model for the Dissociation Pattern of an Enzyme Containing
Two Catalytic Residues.
pKa1 and pKa2 show the dissociation constant for the nucleophile
and proton donor residues respectively.
Fig. 2. Alignment of Amino Acid Sequences (A) and Modeled Structures (B) for XynA and XynB and Template 1HIZ.
(A) Amino acid sequences of XynA, XynB, and 1HIZ are aligned. Reversal letters represent identical amino acid residues at each position.
The region of loop 4 is boxed. Asterisks show the conserved residues in the active center shown in Fig. 4. Dotted lines show ꢁ-helixes and ꢀ-
strands constructing the ðꢀ=ꢁÞ8 barrel. (B) Structures of XynA, XynB, and 1HIZ are shown in ribbon-style, colored white, black, and gray
respectively. These structures were superimposed by SWISS Pdb-Viewer software.29) Amino acid residues, proton donor Glu195, and loop 4
constituents containing Arg204 show a stick form (numbering from XynA).

Role of Conserved Arginine Residue in GH10 Xylanases
907
bulky than those of XynA and 1HIZ because XynB was
two amino acid residues longer in the front part of loop
4. But the locations of the arginine residue (Arg204 for
XynA and Arg196 for XynB) were well conserved,
ꢀ
approximately 4.5 A apart from the side chain of the
proton donor residue.
pH-Activity relationships of the mutant xylanases
The pH-activity relationships of the mutant xylanases
were measured using pNP-X2 as a substrate. Relative
Vmax=Km and Vmax and Km values were determined at
various pH levels, as shown in Fig. 3. It is obvious that
the drastic increases of the parental enzymes in Km
values with the increase in pH disappeared with the
mutation. The pKes and pKe values were calculated by
regressing the experimental data with formulae (2) and
(3), as shown in Table 3.
Considering the dissociation of the nucleophile
glutamic acid residue, small increases in both the pKe1
and pKes1 values were observed with both xylanases, but
the ꢁ1 values (pKes1–pKe1) did not change with the
mutations. The arginine residue might have some weak
long-range interaction with the nucleophile.
Construction of the arginine mutants
To investigate the function of the arginine residue, the
strongly basic residues (Arg) in XynA and XynB were
replaced by acidic (Glu), neutral (Gln), or less basic
(Lys) residues. All the mutated enzymes were expressed
as soluble proteins and successfully purified through the
His-tag trapping system. They showed hydrolytic activ-
ities on both pNP-X2 and xylan.
Basic characterization of the mutant xylanases
The activities of the purified mutant xylanases are
listed in Table 2. We report that the Km values toward
pNP-X2 of the mutant enzymes were identical with
those of the corresponding parental enzyme. The kcat
values on pNP-X2 of the mutants were slightly less than
those of the corresponding parental enzymes, especially
with XynA. Specific activities for birch wood xylan also
decreased slightly by the mutations, but the differences
were not so significant as to establish that the arginine
residue was essential in the catalytic action or substrate
recognition. Additionally, it should be noted that no
significant difference in the activity with the difference
in the residues after substitution was observed. Hence
we conclude that the arginine residue does not play a
direct role in the catalysis of GH10 xylanases.
The thermal stabilities of the parental and mutant
xylanases were assessed by determining the residual
activity after incubation at 60 ꢁC. The half lives of the
activity for mutants were smaller than those of the
corresponding parental enzymes, but again the differ-
ences were not very significant, only small decreases in
a stable temperature range within a few degrees. Thus
we do not consider that the stabilization of the enzyme is
the main role of the arginine. Furthermore, the decreases
in stability did not affect the measurement of pH-activity
relationships for mutant enzymes under the assay
conditions used.
In the case of the dissociation of the proton donor
glutamic acid residue, significant differences in pKes2
were observed, whereas pKe2 did not change with the
mutations. The differences are obvious by comparing
the difference in ꢁ2 (pKes2–pKe2). Both the parental
enzymes have positive ꢁ2 values, but those of all the
mutants turned negative. These results suggest that the
side chain of arginine residue plays an important role in
keeping pKes2 value high only when the enzymes form
complexes with substrates.
It should be noted that the pKes2 value of all the
mutants of each parent were identical even though the
charge of the replaced residues were different, indicating
that the function of arginine cannot be explained only by
the charge of the residue. Thus, the effect of the arginine
residues should be related not merely to the charge, but
to the whole structure of the arginine.
The location of the amino acid residues well con-
served in GH 10 xylanases around Arg204 in the modeled
structure of XynA is schematically illustrated in Fig. 4.
The distances between the residues were almost iden-
tical with XynB, as shown in Fig. 4. The arginine
residue appears not directly to interact with substrate
judging from the structure of G. stearothermophilus T-6
xylanase with substrate binding (PDB ID: 1R87). The
positive charge of Arg204 appears not directly to interact
with the side chain of the proton donor Glu195 because of
the distance of 4.5 A (between Nꢂ2 of Arg204 and O"1 of
ꢀ
Glu195). This accords with the fact that the pKe2 values
did not change with the mutation of the arginine
residues.
Table 2. Comparison of the Characterization for Arginine Mutants
A charged nitrogen atom of Arg204 (Nꢂ2) was found
to make a hydrogen bond with the phenolic oxygen atom
of Tyr239, which fixed substrates at subsite þ1 by
stacking interaction.31) Roberge et al. substituted the
conserved tyrosine residue with phenylalanine in Strep-
tomyces lividans xylanase A and concluded that this
hydrogen bond did not appear to be important for the
catalytic activity.32) Furthermore, some GH10 xylanases
naturally have phenylalanine residue at the position,12)
again indicating that the phenolic hydroxyl group is not
essential for the activity. These results agree with our
kcat
Km
Specific activity
for xylan
t1=2
at 60 ꢁC
(min)ꢄ
for pNP-ꢄX2 for pNP-X2
(secꢀ1
)
(mM)ꢄ
(U/mg)#
XynA
32.4
15.7
18.9
22.5
58.1
50.8
51.4
54.3
0.20
0.21
0.18
0.20
0.09
0.14
0.10
0.12
16.2
10.2
12.3
12.2
10.3
6.50
8.35
8.96
59.4
24.5
36.6
51.7
249
R204E
R204K
R204Q
XynB
R196E
R196K
R196Q
101
123
101
The enzyme reaction was performed at pH 6.6 (*) or pH 7.0 (#).

908
M. NISHIMOTO et al.
Fig. 3. Comparison of pH-Activity Profiles.
These profiles show the pH versus Vmax=Km (A and D), Vmax (B and E), and Km (C and F) for arginine mutants. Open circles, XynA and XynA
derivatives; closed circles, XynB and XynB derivatives; circles, wild type; squares, glutamic acid mutants; triangles, lysine mutants; diamonds,
glutamine mutants.
Table 3. Comparison of pKe and pKes Values for Arginine Mutants
pKe1
pKes1
ꢁ1
pKe2
pKes2
ꢁ2
XynA
Wild type
R204E
R204K
R204Q
XynB
4:72 ꢅ 0:21
5:10 ꢅ 0:12
4:99 ꢅ 0:10
5:15 ꢅ 0:10
4:10 ꢅ 0:08
4:56 ꢅ 0:07
4:52 ꢅ 0:09
4:59 ꢅ 0:09
ꢀ0:62
ꢀ0:56
ꢀ0:47
ꢀ0:56
8:49 ꢅ 0:18
8:59 ꢅ 0:12
8:59 ꢅ 0:10
8:61 ꢅ 0:10
9:39 ꢅ 0:08
8:29 ꢅ 0:06
8:10 ꢅ 0:08
8:19 ꢅ 0:08
þ0:90
ꢀ0:30
ꢀ0:49
ꢀ0:42
Wild type
R196E
R196K
R196Q
4:23 ꢅ 0:09
4:39 ꢅ 0:09
4:45 ꢅ 0:08
4:31 ꢅ 0:07
3:86 ꢅ 0:09
4:09 ꢅ 0:06
4:13 ꢅ 0:06
4:18 ꢅ 0:05
ꢀ0:37
ꢀ0:30
ꢀ0:32
ꢀ0:13
7:62 ꢅ 0:09
7:42 ꢅ 0:09
7:49 ꢅ 0:08
7:86 ꢅ 0:06
7:82 ꢅ 0:08
7:19 ꢅ 0:07
7:18 ꢅ 0:08
7:38 ꢅ 0:05
þ0:20
ꢀ0:23
ꢀ0:31
ꢀ0:48

Role of Conserved Arginine Residue in GH10 Xylanases
909
roles for both activity and substrate binding as subsite
ꢀ1 as demonstrated by mutational analysis.32,33) Thus
the effect of His136 to Glu195 might not be direct, but
rather through Trp135
.
In conclusion, the conserved arginine residue plays an
important role for GH10 xylanases to keep pKa of the
proton donor glutamic acid high during substrate bind-
ing by clamping the proton donor and subsite þ1.
Acknowledgment
This work was supported in part by a grant from
the Bio-oriented Technology Research Advancement
Institution.
References
1) Bissoon, S., Christov, L., and Singh, S., Bleach boosting
effects of purified xylanase from Thermomyces lanugi-
nosus SSBP on bagasse pulp. Process Biochem., 37,
567–572 (2002).
2) La Grange, D. C., Pretorius, I. S., Claeyssens, M., and
van Zyl, W. H., Degradation of xylan to D-xylose by
recombinant Saccharomyces cerevisiae coexpressing the
Aspergillus niger ꢀ-xylosidase (xlnD) and the Tricho-
derma reesei xylanase II (xyn2) genes. Appl. Environ.
Microbiol., 67, 5512–5519 (2001).
3) Bourne, Y., and Henrissat, B., Glycoside hydrolases and
glycosyltransferases: Families and functional modules.
Curr. Opin. Struct. Biol., 11, 593–600 (2001).
4) Derewenda, U., Swenson, L., Green, R., Wei, Y.,
Morosoli, R., Shareck, F., Kluepfel, D., and Derewenda,
Fig. 4. A Schematic Diagram of the Interaction of Well-Conserved
Residues in GH 10 Xylanases around Arg204 in the Modeled
Structure of XynA.
Amino acid residues that are the major focus of this paper are
represented in line form. The expected hydrogen bond is shown by
ꢀ
the dotted line (distances are indicated with XynA/XynB in A). Nꢂ2
and N" atoms of Arg204 form hydrogen bonds with the phenolic
oxygen atom of Tyr239 and the carbonyl oxygen of the main chain of
Glu195 respectively. Tyr239 and Trp135 constitute part of subsite þ1
and ꢀ1 respectively. N"1 of Trp135 has a hydrogen bond with O"1 of
Glu195. The indole ring of His136 is located 3.7/3.6, 3.3/3.4, and
3.6/3.4 A from Nꢂ1 of Arg204, O"1 of Glu195, and N"1 of Trp135
ꢀ
respectively.
ꢀ
Z. S., Crystal structure, at 2.6-A resolution, of the
Streptomyces lividans xylanase A, a member of the F
family of ꢀ-1,4-D-glycanases. J. Biol. Chem., 269,
20811–20814 (1994).
results that the arginine mutants that lost the hydrogen
bond showed comparable activities with the correspond-
ing wild-type enzymes.
5) Fujimoto, Z., Kuno, A., Kaneko, S., Kobayashi, H.,
Kusakabe, I., and Mizuno, H., Crystal structures of the
sugar complexes of Streptomyces olivaceoviridis E-86
xylanase: Sugar binding structure of the family 13
carbohydrate binding module. J. Mol. Biol., 316, 65–78
(2002).
6) White, A., Withers, S. G., Gilkes, N. R., and Rose, D. R.,
Crystal structure of the catalytic domain of the ꢀ-1,4-
glycanase cex from Cellulomonas fimi. Biochemistry, 33,
12546–12552 (1994).
7) Harris, G. W., Jenkins, J. A., Connerton, I., Cummings,
N., Lo Leggio, L., Scott, M., Hazlewood, G. P., Laurie,
J. I., Gilbert, H. J., and Pickersgill, R. W., Structure of
the catalytic core of the family F xylanase from
Pseudomonas fluorescens and identification of the
xylopentaose-binding sites. Structure, 2, 1107–1116
(1994).
The N" atom of Arg204 has been found to form a
hydrogen bond with the carbonyl oxygen in the main
chain of the proton donor Glu195. Considering the two
hydrogen bonds, Arg204 might play a role as a structural
clamp between proton donor Glu195 and subsite þ1 to
protect from structural changes during substrate-binding.
This clamping explains the small decreases in thermal
stability through the mutations. The clamping might also
explain how it is that the effect of the mutation of Arg204
appeared only with pKes2
.
The real mechanism in the decrease in pKes2 is not
readily available with the experimental results above,
but a possible explanation is the following: His136 is
located close to the proton donor Glu195 with a distance
136
of 3.3 A between C"1 of His and O"1 of Glu195. Thus
ꢀ
8) Natesh, R., Bhanumoorthy, P., Vithayathil, P. J., Sekar,
K., Ramakumar, S., and Viswamitra, M. A., Crystal
the positive charge of His136 might affect the pKa of the
proton donor Glu195. The distance between N"2 of
ꢀ
structure at 1.8 A resolution and proposed amino acid
sequence of a thermostable xylanase from Thermoascus
aurantiacus. J. Mol. Biol., 288, 999–1012 (1999).
His136 and Nꢂ1 of Arg204 is relatively close at 3.7 A.
ꢀ
Arg204 might prevent His136 from approaching Glu195 by
preventing a structural change, by clamping the proton
donor and subsite þ1 or by a steric hindrance. The
histidine residue also neighbor Trp135 and has important
9) MacLeod, A. M., Lindhorst, T., Withers, S. G., and
Warren, R. A., The acid/base catalyst in the exogluca-
nase/xylanase from Cellulomonas fimi is glutamic acid

910
M. NISHIMOTO et al.
127: Evidence from detailed kinetic studies of mutants.
Biochemistry, 33, 6371–6376 (1994).
aryl-xylobiosides. J. Biosci. Bioeng., 93, 428–430
(2002).
10) Tull, D., Withers, S. G., Gilkes, N. R., Kilburn, D. G.,
Warren, R. A., and Aebersold, R., Glutamic acid 274 is
the nucleophile in the active site of a ‘‘retaining’’
exoglucanase from Cellulomonas fimi. J. Biol. Chem.,
266, 15621–15625 (1991).
11) Charnock, S. J., Spurway, T. D., Xie, H., Beylot, M. H.,
Virden, R., Warren, R. A., Hazlewood, G. P., and
Gilbert, H. J., The topology of the substrate binding
clefts of glycosyl hydrolase family 10 xylanases are not
conserved. J. Biol. Chem., 273, 32187–32199 (1998).
12) Lo Leggio, L., Jenkins, J., Harris, G. W., and Pickersgill,
R. W., X-ray crystallographic study of xylopentaose
binding to Pseudomonas fluorescens xylanase A. Pro-
teins, 41, 362–373 (2000).
21) Ke, S. H., and Madison, E. L., Rapid and efficient site-
directed mutagenesis by single-tube ‘megaprimer’ PCR
method. Nucleic Acids Res., 25, 3371–3372 (1997).
22) Laemmli, U. K., Cleavage of structural proteins during
the assembly of the head of bacteriophage T4. Nature,
227, 680–685 (1970).
23) Gill, S. C., and von Hippel, P. H., Calculation of protein
extinction coefficients from amino acid sequence data.
Anal. Biochem., 182, 319–326 (1989).
24) Kitaoka, M., Haga, K., Kashiwagi, Y., Sasaki, T.,
Taniguchi, H., and Kusakabe, I., Kinetic studies on p-
nitrophenyl-cellobioside hydrolyzing xylanse from Cell-
vibrio gilvus. Biosci. Biotechnol. Biochem., 57, 1987–
1989 (1993).
13) Ducros, V., Charnock, S. J., Derewenda, U., Derewenda,
Z. S., Dauter, Z., Dupont, C., Shareck, F., Morosoli, R.,
Kluepfel, D., and Davies, G. J., Substrate specificity in
glycoside hydrolase family 10. Structural and kinetic
analysis of the Streptomyces lividans xylanase 10A.
J. Biol. Chem., 275, 23020–23026 (2000).
14) Andrews, S. R., Charnock, S. J., Lakey, J. H., Davies,
G. J., Claeyssens, M., Nerinckx, W., Underwood, M.,
Sinnott, M. L., Warren, R. A., and Gilbert, H. J.,
Substrate specificity in glycoside hydrolase family 10.
Tyrosine 87 and leucine 314 play a pivotal role in
discriminating between glucose and xylose binding in
the proximal active site of Pseudomonas cellulosa
xylanase 10A. J. Biol. Chem., 275, 23027–23033 (2000).
15) Pell, G., Szabo, L., Charnock, S. J., Xie, H., Gloster,
T. M., Davies, G. J., and Gilbert, H. J., Structural and
biochemical analysis of Cellvibrio japonicus xylanase
10C: How variation in substrate-binding cleft influences
the catalytic profile of family GH-10 xylanases. J. Biol.
Chem., 279, 11777–11788 (2004).
16) Fujimoto, Z., Kaneko, S., Kuno, A., Kobayashi, H.,
Kusakabe, I., and Mizuno, H., Crystal structures of
decorated xylooligosaccharides bound to a family 10
xylanase from Streptomyces olivaceoviridis E-86. J.
Biol. Chem., 279, 9606–9614 (2004).
17) Pell, G., Taylor, E. J., Gloster, T. M., Turkenburg, J. P.,
Fontes, C. M., Ferreira, L. M., Nagy, T., Clark, S. J.,
Davies, G. J., and Gilbert, H. J., The mechanisms by
which family 10 glycoside hydrolases bind decorated
substrates. J. Biol. Chem., 279, 9597–9605 (2004).
18) Lo Leggio, L., Kalogiannis, S., Eckert, K., Teixeira,
S. C. M., Bhat, M. K., Andrei, C., Pickersgill, R. W., and
Larsen, S., Substrate specificity and subsite mobility in
T. aurantiacus xylanase 10A. FEBS Lett., 509, 303–308
(2001).
25) Waffenschmidt, S., and Jaenicke, L., Assay of reducing
sugars in the nanomole range with 2,20-bicinchoninate.
Anal. Biochem., 165, 337–340 (1987).
26) Honda, Y., Kitaoka, M., Sakka, K., Ohmiya, K., and
Hayashi, K., An investigation of the pH-activity rela-
tionships of Cex, a family 10 xylanase from Cellulomo-
nas fimi: Xylan inhibition and the influence of the nitro-
substituted aryl-ꢀ-D-xylobiosides. J. Biosci. Bioeng., 93,
313–317 (2002).
27) Dixon, M., The effect of pH on the affinities of enzymes
for substrates and inhibitors. Biochem. J., 55, 161–170
(1953).
28) Leatherbarrow, R. J., Using linear and non-linear
regression to fit biochemical data. Trends Biochem.
Sci., 15, 455–458 (1990).
29) Guex, N., and Peitsch, M. C., SWISS-MODEL and the
Swiss-PdbViewer: An environment for comparative
protein modeling. Electrophoresis, 18, 2714–2723
(1997).
30) Teplitsky, A., Mechaly, A., Stojanoff, V., Sainz, G.,
Golan, G., Feinberg, H., Gilboa, R., Reiland, V.,
Zolotnitsky, G., Shallom, D., Thompson, A., Shoham,
Y., and Shoham, G., Structure determination of the
extracellular xylanase from Geobacillus stearothermo-
philus by selenomethionyl MAD phasing. Acta Crystal-
logr. D Biol. Crystallogr., 60, 836–848 (2004).
31) Charnock, S. J., Spurway, T. D., Xie, H., Beylot, M. H.,
Virden, R., Warren, R. A., Hazlewood, G. P., and
Gilbert, H. J., The topology of the substrate binding
clefts of glycosyl hydrolase family 10 xylanases are not
conserved. J. Biol. Chem., 273, 32187–32199 (1998).
32) Roberge, M., Shareck, F., Morosoli, R., Kluepfel, D.,
and Dupont, C., Characterization of active-site aromatic
residues in xylanase A from Streptomyces lividans.
Protein Eng., 12, 251–257 (1999).
19) Nishimoto, M., Kitaoka, M., and Hayashi, K., Employ-
ing chimeric xylanases to identify regions of an alkaline
xylanase participating in enzyme activity at basic pH.
J. Biosci. Bioeng., 94, 395–400 (2002).
20) Nishimoto, M., Honda, Y., Kitaoka, M., and Hayashi, K.,
A kinetic study on pH-activity relationship of XynA
from alkaliphilic Bacillus halodurans C-125 by using
33) Charnock, S. J., Lakey, J. H., Virden, R., Hughes, N.,
Sinnott, M. L., Hazlewood, G. P., Pickersgill, R., and
Gilbert, H. J., Key residues in subsite F play a critical
role in the activity of Pseudomonas fluorescens sub-
species cellulosa xylanase A against xylooligosaccha-
rides but not against highly polymeric substrates such as
xylan. J. Biol. Chem., 272, 2942–2951 (1997).