Enantioselective synthesis of amines via reductive amination with a dehydrogenase mutant from Exigobacterium sibiricum: Substrate scope, co-solvent tolerance and biocatalyst immobilization

Article abstract of DOI:10.1016/j.bmc.2017.12.005

In recent years, the reductive amination of ketones in the presence of amine dehydrogenases emerged as an attractive synthetic strategy for the enantioselective preparation of amines starting from ketones, an ammonia source, a reducing reagent and a cofactor, which is recycled in situ by means of a second enzyme. Current challenges in this field consists of providing a broad synthetic platform as well as process development including enzyme immobilization. In this contribution these issues are addressed. Utilizing the amine dehydrogenase EsLeuDH-DM as a mutant of the leucine dehydrogenase from Exigobacterium sibiricum, a range of aryl-substituted ketones were tested as substrates revealing a broad substrate tolerance. Kinetics as well as inhibition effects were also studied and the suitability of this method for synthetic purpose was demonstrated with acetophenone as a model substrate. Even at an elevated substrate concentration of 50 mM, excellent conversion was achieved. In addition, the impact of water-miscible co-solvents was examined, and good activities were found when using DMSO of up to 30% (v/v). Furthermore, a successful immobilization of the EsLeuDH-DM was demonstrated utilizing a hydrophobic support and a support for covalent binding, respectively, as a carrier.

Full text of DOI:10.1016/j.bmc.2017.12.005

Accepted Manuscript
Enantioselective synthesis of amines via reductive amination with a dehydro-
genase mutant from Exigobacterium sibiricum: Substrate scope and biocatalyst
immobilization
Jana Löwe, Aaron A. Ingram, Harald Gröger
PII:
S0968-0896(17)31934-X
https://doi.org/10.1016/j.bmc.2017.12.005
BMC 14110
DOI:
Reference:
Bioorganic & Medicinal Chemistry
To appear in:
Received Date:
Revised Date:
Accepted Date:
30 September 2017
29 November 2017
2 December 2017
Please cite this article as: Löwe, J., Ingram, A.A., Gröger, H., Enantioselective synthesis of amines via reductive
amination with a dehydrogenase mutant from Exigobacterium sibiricum: Substrate scope and biocatalyst
immobilization, Bioorganic & Medicinal Chemistry (2017), doi: https://doi.org/10.1016/j.bmc.2017.12.005
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Graphical Abstract
To create your abstract, type over the instructions in the template box below.
Fonts or abstract dimensions should not be changed or altered.
Enantioselective synthesis of amines via reductive
Leave this area blank for abstract info.
amination with a dehydrogenase mutant from
Exigobacterium sibiricum: Substrate scope and biocatalyst immobilization
Jana Löwe, Aaron A. Ingramand Harald Gröger
Faculty of Chemistry, Bielefeld University, Universitätsstr. 25, 33615 Bielefeld, Germany

Bioorganic & Medicinal Chemistry
Enantioselective synthesis of amines via reductive amination with a
dehydrogenase mutant from Exigobacterium sibiricum: Substrate scope and
biocatalyst immobilization
Jana Löwe, Aaron A. Ingram and Harald Gröger*
Chair of Organic Chemistry I, Faculty of Chemistry, Bielefeld University, Universitätsstr. 25, 33615 Bielefeld, Germany
*
Chair of Organic Chemistry I, Faculty of Chemistry, Bielefeld University, Universitätsstr. 25, 33615 Bielefeld, Germany; e-mail: harald.groeger@uni-
bielefeld.de
ARTICLE INFO
ABSTRACT
In recent years, the reductive amination of ketones in the presence of amine dehydrogenases emerged as an
attractive synthetic strategy for the enantioselective preparation of amines starting from ketones, an
ammonia source, a reducing reagent and a cofactor, which is recycled in situ by means of a second
enzyme. Current challenges in this field consists of providing a broad synthetic platform as well as process
development including enzyme immobilization. In this contribution these issues are addressed. Utilizing
the amine dehydrogenase EsLeuDH-DM as a mutant of the leucine dehydrogenase from Exigobacterium
sibiricum, a range of aryl-substituted ketones were tested as substrates revealing a broad substrate
tolerance. Kinetics as well as inhibition effects were also studied and the suitability of this method for
synthetic purpose was demonstrated with acetophenone as a model substrate. Even at an elevated substrate
concentration of 50 mM, excellent conversion was achieved. In addition, the impact of water-miscible co-
solvents was examined, and good activities were found when using DMSO of up to 30% (v/v).
Furthermore, a successful immobilization of the EsLeuDH-DM was demonstrated utilizing a hydrophobic
Article history:
Received
Received in revised form
Accepted
Available online
Keywords:
Biocatalysis
Reductive amination
Amine dehydrogenase
Exigobacterium sibiricum
Immobilization
support
and
a
support
for
co-valent
binding,
respectively,
as
a
carrier.
2009 Elsevier Ltd. All rights reserved.
situ by means of a second enzyme, e.g., formate dehydrogenase
or glucose dehydrogenase, and a suitable reducing agent such as,
e.g., formate or glucose, as a co-substrate. This type of process,
which only requires stoichiometric amount of the co-substrate
whereas cofactor and enzymes are utilized in catalytic amounts,
is shown in Figure 1. The use of cofactor regeneration systems is
known for a long time for processes with amino acid
dehydrogenase and alcohol dehydrogenase, and the option to use
cheap and readily available co-substrates such as formate and
glucose make such a process technology attractive also from an
industrial perspective.
1. Introduction
Chiral amines serve as key building blocks for the preparation of
pharmaceuticals and numerous methods for their enantioselective
synthesis were developed.1Among them, for industrial scale
applications biocatalysis plays a dominant role. 2-4 So far, lipase-
catalyzed resolution of racemic amines is used on multi-thousand
tons scale based on an acylation technology developed by
BASF.3 In addition, enzymatic transamination has been
developed and proven as an efficient process for the synthesis of
Sitagliptin by Merck and Codexis.4 As a further alternative,
Bommarius et al. demonstrated recently that altering an amino
acid dehydrogenase through mutations led to an amine
dehydrogenase (AmDH), thus providing a further alternative for
enzyme catalyzed synthesis of enantiomerically pure amines.5
Towards this end, mutation of two amino acids in the active site
was carried out to create an access to such enzymes which
showed activity towards a variety of ketones and enabled the
synthesis of amines by means of an ammonium salt as an
economical amino donor in combination with NADH as a
cofactor. In general, the reduced cofactor can be regenerated in
Figure 1: Reductive amination of ketones with in situ-cofactor recycling

So far, various sources for the design of amine dehydrogenases
through mutagenesis have been used. The Bommarius, Turner
and Mutti groups started from a leucine dehydrogenase from
Bacillus stereothermophilus and a phenylalanine dehydrogenase
from Bacillus badius. Furthermore Bommarius et al. developed a
chimeric amine dehydrogenase mutant, consisting of this phenyl-
alanine dehydrogenase and leucine dehydrogenase.5 Moreover, a
mutant of the phenylalanine dehydrogenase from Rhodococcus
sp. M4 was established by the Li group and also used by the
Mutti group5,7 In 2015 Xu et al. described the application of the
principle the procedure described in literature,8 some changes
were made. For example, expression was carried out at a lower
temperature which enabled an improved overexpression leading
to an activity of 170 (±0.050) mU/mg towards acetophenone (1)
of crude extract compared to 0.10 U/mg reported in literature.8
For protein purification a Ni2+-NTA column was used in
accordance to literature.8 With higher salt-concentration via
desalting the protein concentration could be raised to double
amount. Despite of precipitation in both buffers, on ice an active
enzyme could be isolated. After purification the KM-value was
measured, and for acetophenone (1) a KM-value of 22.6 mM was
observed (see Supplementary Material).
two-site mutation (K77S/N270L) towards
a
leucine
dehydrogenase from Exigobacterium sibiricum (EsLeuDH-DM).8
They examined a broad range of short-chain secondary aliphatic
ketones and alkyl cyclic ketones, as well as acetophenone (1).8
Current challenges in this field consists of providing a broad
synthetic platform as well as process development including
immobilization of biocatalysts. In continuation with our work on
enzymatic enantioselective amine synthesis,9 and inspired by the
contributions on amine dehydrogenase described above,5-8 we
became interested in getting a detailed insight into the scope and
limitations of this novel technology in terms of substrate scope,
stability when using organic co-solvents and immobilization. For
our study we chose the (R)-amine dehydrogenase EsLeuDH-DM8
as a model enzyme.
2.2 Substrate scope
With this recombinant biocatalyst in hand, the substrate scope
was investigated via a spectrophotometric activity assay. The
focus of our study was in particular on aromatic ketones as in
previous work acetophenone was identified as suitable aromatic
substrate.8 For the first time it was examined if other types of
aryl-substituted ketones with different substitution pattern are
also accepted by the EsLeuDH-DM besides the “model
substrate” acetophenone (1). The substrate concentration of this
spectrophotometric assay was in a range of 5 mM and 20 mM.
Taking into account the high KM-value, the study at this substrate
concentrations can give an initial general inside into a substrate
tolerance but not necessarily an information about the maximum
2. Results and Discussion
2.1 Enzyme preparation, purification and characterization
(kinetic data)
velocity,
vmax.
The initial step consisted in conducting the preparation of the
(R)-amine dehydrogenase EsLeuDH-DM.8 Although following in
Figure 2: Substrate scope of the amine dehydrogenase EsLeuDH-DM according to spectrophotometric activity testing.
Activity was measured in NH4Cl buffer (2 M, pH 9.5) containing 0.1 mM NADH and 5-20 mM ketone at 30°C in a 1 mL
volume.

Selected results of these spectrophotometric activity assay
experiments, which gave an interesting insight into the substrate
scope of EsLeuDH-DM, are shown in Figure 2. Although the
enzymatic activity is highest for acetophenone (1), it is
noteworthy that homologues with an enlarged alkyl side chain
are tolerated as well with reasonable activity, e.g., butyrophenone
(3). Furthermore, in general EsLeuDH-DM shows a higher
activity for aromatic ketones with electron-withdrawing
substituents (e.g., 4 and 5) leading to a negative mesomeric effect
(-M-effect). In contrast, lower activities were observed when
using aromatic ketones with electron-donating substituents (e.g.,
6 and 7), which lead to a positive mesomeric effect (+M-effect).
These results might be explained with the decreased electrophilic
character of the carbonyl moiety in the latter case. In addition, the
more bulky compounds - and -ketoesters 10 and 11,
respectively, as well as the bicyclic ketone 8, gave reasonable
activities. In contrast, a somewhat lower activity was found for
the corresponding acid 9. Besides a range of acylic ketones also
the cyclic ketone 12 turned out to represent a suitable substrate.
conversion of 77% was determined corresponding to a product
formation of 39 mM. This indicates that increasing the substrate
concentration does not led to (significant) substrate or product
inhibition as well as to an elevated deactivation of the enzyme
(although further studies and recording of kinetic courses would
be needed to proof this hypothesis). Furthermore, there is a
significant decrease in activity of the enzyme after about 30 h
(see Supplementary Material), this could also be an explanation
for the slowly conversion after 30 h reaction time.
In general and independent of the substrate concentration the
biotransformations proceed with excellent enantioselectivity and
gave the desired amine product with an ee- value of >99% in all
cases.
2.3 Synthetic biotransformations and initial process
development
Next we became interested to evaluate the synthetic potential of
this method utilizing EsLeuDH-DM as a biocatalyst. For being
considered as a practical method, prerequisites are a sufficient
space-time-yield, a reasonable substrate loading as well as a
smoothly proceeding work-up with an economical solvent
consumption. Thus, a minimum substrate concentration of 50
mM was regarded to be desirable for such a synthesis on lab
scale, whereas for larger scale applications substrate
concentrations exceeding 500 mM would be advantageous.
Accordingly, we conducted biotransformations running at
elevated substrate concentration. As a substrate acetophenone (1)
was used and in situ-cofactor regeneration was conducted by
means of a glucose dehydrogenase (GDH) and D-glucose as a co-
substrate. We confirmed that under the chosen reaction
conditions (2 M NH4Cl, pH 9.5) both cofactor forms NADH and
NAD+ remained stable (for details, see Supplementary Material).
As a benchmark experiment a biotransformation at 20 mM
substrate concentration was carried out which gave the desired
amine with >98% conversion after a reaction time of 100 h. The
enantiomeric excess was excellent with >99% ee (as determined
for each sample taken for the biotransformation running at 20
mM). When increasing the substrate concentration to 50 mM of
acetophenone (1) while maintaining the utilized absolute enzyme
activity constant, we were pleased to find that the reductive
amination also proceeded smoothly, leading to a conversion of
77% with formation of exclusively the desired (R)-amine (R)-13
(Figure 3). In addition, increasing the enzyme amount by factor 2
led to a full conversion after 100 h even at 50 mM substrate
concentration, thus indicating both a high biocatalyst stability as
well as negligible inhibition concerns under these conditions. The
Figure 3: Reductive amination of acetophenone (1) with the amine
dehydrogenase EsLeuDH-DM. Biotransformations were made with
acetophenone (1) in NH4Cl-buffer (2 M, pH 9.5), EsLeuDH-DM (10 U),
glucose (100 mM), NAD+ (1 mM) and GDH (18 U) in a total volume of 1
mL at 30°C; thus, the enzyme to substrate ratio was 500 and 200 U per mmol
of 1 in case of 20 and 50 mM substrate concentration of 1, respectively. The
conversion is defined as the ratio of formed product amount related to the
amount of used substrate (in %). Since no by-product was observed, this
value corresponds to the ratio of substrate consumed in the reaction related to
substrate used in the reaction.
2.4 Co-solvent screening
A further option in process development is the utilization of co-
solvents. Taking into account the high KM-value for model
substrate 1 in combination with the (relatively) low water-
solubility of hydrophobic ketones, we focused on the
identification of suitable water-miscible solvents, which could be
used as a co-solvent in combination with the buffer system. Such
a solvent system would then enable an increase of substrate
reaction also proceeds at
a
further elevated substrate
concentration of 100 mM, leading to a conversion of 43% after
100 h reaction time. This corresponds to a product formation of
43 mM, which is comparable to the biotransformation running at
50 mM substrate concentration. In this case, after 100 h a

concentration under homogeneous conditions as well as the
option to operate at the maximum reaction rate, vmax. Therefore,
the five water soluble co-solvents ethanol, isopropanol, methanol,
acetonitrile and DMSO were selected and examined when being
utilized in a volumetric amount of up to 30%(v/v). When
studying their impact on the stability of the EsLeuDH-DM, in
initial studies ethanol, isopropanol, acetonitrile and methanol led
to a rapid loss of enzyme activity (data not shown). Thus, a more
detailed investigation of the solvent impact on the stability was
then carried out for DMSO (Figure 4).
the resin-type solid support (for ring-opening reactions with
nucleophilic functional groups of the protein such as free amino
groups resulting from Lys moieties), whereas the hydrophobic
carrier forms non-polar, hydrophobic interactions with the
enzyme. For immobilization both carriers were washed with
buffer (hydrophobic carrier with 0.05 M KPi buffer, the epoxy
carrier with 0.5 M KPi buffer). Afterwards the immobilization
was performed for 18 h in the same buffer. We investigated the
variation of the mass ratio of protein and carrier and therefore the
effects on yield, loading and efficiency (see Supplementary
Material).
The immobilization with the covalent carrier gave the
heterogenized (R)-amine dehydrogenase with an immobilization
efficiency of 48% and an amount of protein of 11.8 mg/g of solid
support, whereas the hydrophobic carrier was obtained with an
immobilization efficiency of 54% and a very high amount of
protein of 63.2 mg/g support. Furthermore, no leaching of the
enzyme was observed with both carriers. When using the
hydrophobic carrier with the immobilized biocatalyst in a
synthetic transformation, a conversion of 78% was achieved
compared to 77% when utilizing the same amount of enzyme
enzyme in free, non-immobilized form (Figure5). In addition, the
enantioselectivity was studied for the biotransformation with the
heterogenized biocatalyst and revealed for all taken samples (for
details about the reaction times for taking the samples, see Figure
5) excellent enantiomeric excess of >99% for the resulting amine.
To the best of our knowledge this heterogenized biocatalyst
represents the first example of an immobilized EsLeuDH-DM.
Figure 4: Stability of EsLeuDH-DM towards DSMO. Activity was measured
in NH4Cl buffer (2 M, pH 9.5) with a certain amount of DMSO containing
0.1 mM NADH and 20 mM 1 at 30°C in a 1 mL volume.
These results show that DMSO represents the best co-solvent
when being utilized in a volumetric amount of up to 20%(v/v).
Furthermore, the relative activity increased and the enzyme
stability is comparable to the one when using EsLeuDH-DM
without a co-solvent. However, for methanol as a co-solvent no
activity was found after three hours independently of its
volumetric amount (which was 10%, 20% or 30%). The
utilization of 20%(v/v) of DMSO also enables a higher
concentration of substrate being dissolved in the aqueous phase.
2.5 Immobilization of the biocatalyst
Besides optimizing the substrate concentration and other reaction
parameters, also utilization of an heterogenized (bio-)catalyst can
contribute to the attractiveness of a synthetic process. So far the
immobilization of amine dehydrogenase have been rarely
studied. This year, the Li group reported the immobilization of
the phenylalanine dehydrogenase from Rhodococcus sp. M4 on
magnetic nanoparticels via a his-tag, and the Wang group
immobilized the amine dehydrogenase from Bacillus badius to
polyethylene imine-titan nanoparticles.10
In our work, now for the first time two commercially available,
well established and ready-to-use carriers were chosen to
immobilize the EsLeuDH-DM. In detail, we selected
a
hydrophobic carrier from Lanxess® and a carrier for covalent
binding from Sigma Aldrich® for this purpose. Furthermore, we
chose this carriers to compare a carrier with and without covalent
interactions, to evaluate the behavior of our enzyme on both
supports. The carrier for covalent binding carries epoxy groups at
Figure 5: Biotransformation with the immobilized amine dehydrogenase
EsLeuDH-DM. Biotransformations were made with acetophenone (1, 50
mM) in NH4CL-buffer (2M, pH 9.5), immobilized EsLeuDH-DM on a
hydrophobic carrier (3 g), glucose (50 mM), NAD+ (1 mM) and GDH (22.5
U) in a total volume of 25 mL at 30°C for 100 h.

performed by QuikChange® -PCR with 5’- GAAAATCATTGC
CGGAGCAGCACTAAACCAACTCAAAGAAGATCGTC-3’
3. Summary and outlook
In conclusion, we characterized the recombinant amine
dehydrogenase EsLeuDH-DM in terms of its substrate scope and
studied its stability in dependency on the presence of water
miscible co-solvents, the kinetic data as well as inhibition effects.
We further demonstrated the suitability of this enzyme for
synthetic purpose. For example, the desired reductive amination
of acetophenone (1) proceeds with full conversion at an elevated
substrate concentration of 50 mM. In addition, for the first time
successful immobilization of the EsLeuDH-DM was
demonstrated utilizing a hydrophobic support and a support for
co-valent binding, respectively, as a carrier. Further process
development in particular with increase of substrate loading and
usage of co-solvent are currently in progress as well as a study on
recyclability of the immobilized biocatalyst.
and
3’-
GACGATCTTCTTTGAGTTGGTTTAGTGCTGCTCCGGCA
ATGATTTTC -5’. After construction of the first mutant, the
PCR product was digested via DpnI (10 U) for 1.5 h at 37 °C and
transformed into E.coli DH5α, after cultivation the plasmid was
again isolated for the next round of mutation. After introduction
of double mutation, EsLeuDH-DM was transformed into E.coli
BL21(DE3).
4.3 Transformation of competent cells with plasmid-DNA
After digestion 10 μL Plasmid DNA was added to chemical
competent cells (50 μL) and incubated for 30 minutes on ice. The
cells were heated at 42°C for 90 seconds and incubated again for
five minutes on ice. Afterwards 1 mL of LB media was added.
The mixture was heated for three hours at 37°C and 800 rpm.
Subsequently, the cells were cultured on LB agar plates with
suitable antibiotic and incubated overnight at 37°C.
4. Experimental section
4.1 General
4.1.1 HPLC
4.4 Protein expression and purification
For analytical HPLC a system of Jasco® was used. The system
consisted of a degasser LC-Net II / ADC device, pumps (PU-
2080 plus), a multiwavelength detector MD-2010 plus, an
TB medium with kanamycin (50 μg/mL) were inoculated with
1% overnight culture. The cultures were grown at 37 °C and 180
rpm. When the culture reached an OD of 0.5, cell cultures were
induced with 200 μL of IPTG (1M). For expression temperature
was reduced to 20°C. Afterwards cells were harvested (4000x g,
4 °C, 30 min). For purification cells were suspended in binding
buffer (25 % cell suspension) and digested under ultrasound (3x
3 min, 5x10 cycles). The suspension was centrifuged at 20,000×
g for 20 min. The pellet was discarded and the crude extract was
used for further purification. The supernatant was loaded to the
Ni2+-NTA and eluted with 250 mM imidazole.
autosampler AS-2059-SF,
a thermostat CO-2060 and a
backpressure controller BP-2080. The supercritical carbon
dioxide was cooled via cryostat from JulaboF250. The Chiralpak
AD H® with a 5μm silica-gel column with 250 x 4.6 mm ID was
used for the separation. A mixture of CO2 and isopropanol in the
ratio 95: 5 with a flow rate of 1.5 ml/min at 20 °C as a mobile
phase were used.
4.1.2 GC
4.5 Enzyme activity assay
The gas chromatographic analyzes were carried out with the GC-
2010 Plus from Shimadzu® using the autoinjector AOC-20i on
the non-chiral Phenomenex® ZB-SMS column. The following
temperature program was used: start at 90 °C, with 20 °C/min to
107 °C and 15 °C/min to 150 °C. For 1-phenylethylamine (13) a
retention time of 2.5 min, and for acetophenone (1) a retention
time 2.7 min was observed.
For the activity assay the oxidation of NADH to NAD+ was
measured by decrease in absorbance at 340 nm at 30°C. The
enzyme activity is defined as µmolmin-1. The extinction
coefficient is 6.3 103 L mol-1 cm-1. The reaction was performed
in a 1 mL cuvette consisting of 980 µL buffer 2M ammonium
chloride buffer, pH 9.5 with ketone (5-20 mM), 10 µL NADH
(10 M, final concentration 0.1 mM) and 10 µL enzyme crude
extract. The activity was measured with a V-630 UV/-vis
spectrophotometer from Jasco®.
4.2 Construction of EsLeuDH-DM mutant
For the mutagenesis of EsLeuDH, the gene was isolated via
innuPREP Plasmid Mini Kit® after cultivation of the
Exiguobacterium sibiricum. The strain was purchased from
DSMZ (DSM No. 17290). In the following, EsLeuDH gene was
amplified via PCR. The following primers were used: 5’-
GCGGCGTCA TATGGTTGAAACAAACGTAGAAGC -3’, for
4.6 Kinetic constants
For determination of the Michaelis-Menten constant (KM) 1 was
used as a substrate. The activity was measured according to the
enzyme activity assay with 0.1 mM NADH, but in a microtiter
plate via TecanReader® at 30°C with a volume of 250 µL. The
activity was examined at various substrate concentrations and a
fixed enzyme amount.
NdeI
restriction
site
and
3’-
GCGCCAACTCGAGTTAACCGCGTGATCCTA AAATG -5’
for XhoI restriction site. The mutation of the codon for K77S was
performed
by
QuikChange®-PCR
with
5’-
CGTTTGGCAAAAGGCATGACGTATAGCAATGCGGCAG
CCGG-3’and 5’- CCGGCTGCCGCATTGCTATACGTCATG
CCTTTTGCCAAACG-3’. Mutation of the codon for N270L was
4.7 Biotransformation with acetophenone (1)

1 (2.4mg, 0.02 mmol; 6.0 mg, 0.05 mmol; 11.3 mg, 0.09 mmol)
were dissolved in ammonium chloride buffer (660 µL, 2 M, pH
9.5). EsLeuDH-DM (250 µL; 10 U), glucose (100 µL,1M, 100
mM final concentration), NAD+ (20 µL, 50 mM, 1 mM final
concentration) and GDH (20 µL, 18 U) were added and the
mixture was heated to 30°C. The total volume of reaction
mixture was 1 mL. At fixed times, samples were taken. The
conversion was measured via gas chromatography. For
measurement of the ee-value, the samples were acetylated with
acetyl chloride (1.1 eq) and triethylamine (1.5 eq) in methylene
chloride for one hour. The suspension was washed with hydrogen
chloride (1:1, v/v). The solvent was removed in vacuo.
Enantiomeric excess of the amine (R)-13 was determined via
HPLC. For one experiment 1 (6.0 mg, 0.05 mmol), EsLeuDH-
DM (500 µL; 20 U), ammonium chloride buffer (410 µL, 3.2 M,
pH 9.5), glucose (100 µL,1M, 100 mM final concentration),
NAD+ (20 µL, 50 mM, 1 mM final concentration) and GDH (20
µL, 18 U) were added and the mixture was heated to 30°C, the
reaction was stopped after 100h. The conversion was measured
via gas chromatography. For measurement of the ee-value, the
samples were acetylated with acetyl chloride (1.1 eq) and
triethylamine (1.5 eq) in methylene chloride for one hour. The
suspension was washed with hydrogenchlorid (1:1, v/v). The
solvent was removed in vacuo. Enantiomeric excess of the amine
(R)-13 was determined via HPLC.
solution (0.5 M) in KPi buffer (0.01 M, pH 7.0). The protein
concentration in the supernatant was determined via Bradford
assay for calculation of the immobilization yield.11
4.9.3 Examination of leaching-process
For the examination of the leaching process the heterogenized
catalyst was incubated in 1.3 M NH4Cl-Buffer, 0.65 M NH4Cl-
buffer and H2O for seven days. The protein concentration in the
supernatant was determined via Bradford assay for calculation of
the rate of enzyme leaching.11
4.10 Biotransformation with immobilized EsLeuDH-DM
1 (58 mg, 0.5 mmol) was dissolved in ammonium chloride buffer
(8.1 ml, 2 M, pH 9.5), in a 25 ml Erlenmeyer flask. After
addition of a glucose solution (1.25 ml, 1M, 50 mM final
concentration), crude GDH extract (125 μL, 22.5 U) and an
NAD+ solution (10 M, 500 μl, 1 mM final concentration), the
immobilized EsLeuDH-DM (3 g) was added to the suspension.
Subsequently, the mixture was shaken for a total of 100 hours at
30 ° C. and 180 rpm. Samples were taken at various time, which
were extracted with ethyl acetate (2x 500 μL), the conversion
was determined via gas chromatography. Enantiomeric excess of
the amine (R)-13 was determined via HPLC according to the
protocol described above in section 4.7.
4.8 Co-solvent screening
Into a microtiter plate 190/175/150 μL ammonium chloride
buffer, 2 M, pH 9.5 with 20 mM 1, 15 μL crude extract
EsLeuDH-DM and water-soluble co-solvent (25/50/75 μL)
were added. The suspension was incubated for 0/1/3 h and the
assay was started by addition of 10 μL NADH (5 mM, final
concentration of 0.2 mM). The activity was measured according
to the enzyme activity assay.
Acknowledgements
The authors thank PharmaZell GmbH for financial support and
Dr. Daniel Bakonyi for helpful discussions and technical support
of the microbiological part of this work.
References and notes
1.
a) Ghislieri, D.; Turner, N. J. Top. Catal. 2014, 57, 284-300; b)
Nugent, T. C. (ed.) Chiral Amine Synthesis. Methods, Developments
and Applications, Wiley-VCH, Weinheim, 2010.
Liese, A.; Seelbach, K.; Wandrey, C. Industrial Biotransformations,
Wiley-VCH, Weinheim, 2006.
4.9 Immobilization of the biocatalyst
4.9.1 Immobilization on hydrophobic carrier
2.
3.
4.
Breuer, M.; Ditrich, K.; Habicher, T.; Hauer, B.; Keßeler, M.;
Stürmer, R.; Zelinski, T. Angew. Chem. Int. Ed. 2004, 43, 788-824.
a) Savile, C.; Janey, J. M.; Mundorff, E. C.; Moore, J. C.; Tam, S.;
Jarvis, W. R.; Colbeck, J. C.; Krebber, A.; Fleitz, F. J.; Brands, J.;
Devine, P. N.; Huisman, G. W.; Hughes, G. J. Science 2010, 329, 305-
309; b) Desai, A. A.; Angew. Chem. 2011, 123, 2018-2020; Angew.
Chem. Int. Ed. 2011, 50, 1974-1976; c) Fuchs, M. J.; Farnberger, E.;
Kroutil, W. Eur. J. Org. Chem. 2015, 6965-6982.
Abrahamson, M. J.; Vázquez-Figueroa, E.; Woodall, N. B.; Moore, J.
C.; Bommarius, A. S. Angew. Chem. 2012, 124, 4036-4040; Angew.
Chem. Int. Ed. 2012, 51, 3969-3972; b) Abrahamson, M. J.; Wong, J.
W.; Bommarius, A. S. Adv. Synth. Catal. 2013, 355, 1780-1786; c)
Bommarius, B. R.; Schürmann, M.; Bommarius, A. S. Chem.
Commun. 2014, 50, 14953-14955.
The purchased carrier material was washed with KPi buffer
(0.05 M, pH 7.0). The ratio of carrier to buffer was 1:1 (m/v).
Subsequently, the washed carrier material was suspended in an
enzyme solution (in KPi buffer (0.05 M, pH 7.0)) and shaken for
18 h at 20 °C and 80 rpm. The supernatant was removed with a
pipette and the immobilizate was washed with KPi buffer (0.01
M, pH 7.0). The protein concentration in the supernatant was
determined via Bradford assay for calculation of the
immobilization yield.11
5.
6.
7.
Mutti, F. G.; Knaus, T.; Scrutton, N. S.; Breuer, M.; Turner, N. J.
Science 2015, 349, 1525-1529.
T. Knaus, W. Böhmer, F. G. Mutti, Green Chem. 2017, 19, 453-463; b)
Ye, L. J.; Toh, H. H.; Yan, Y.; Adams, J. P.; Snajdrova, R.; Li, Z. ACS
Catal. 2015, 5, 1119-1122
Chen, F.-F.; Liu, Y.-Y.; Zheng, G.-W.; Xu, J.-H. ChemCatChem 2015,
7, 3838-3841.
Recent examples: a) Enzymatic resolution with a lipase: Uthoff, F. ;
Sato, H.; Gröger, H. ChemCatChem 2017, 9, 555-558; b) Enzymatic
transamination: Uthoff, F. ; Reimer, A.; Liese, A.; Gröger, H.
Sustainable Chem. Pharm. 2017, 5, 42-45; c) Enzymatic imine
4.9.2 Immobilization on covalent carrier
The purchased carrier material was washed three times with KPi
buffer (0.5 M, pH 7.0). The ratio of carrier to buffer
corresponded to 1:1 (m/V). The washed immobilizate was then
suspended in an enzyme solution in KPi buffer (0.5 M, pH 7.0)
and shaken for 18 h at 20 °C and 80 rpm. The supernatant was
removed with a pipette and the immobilizate was washed three
times with KPi buffer (0.01 M, pH 7.0) and once with NaCl
8.
9.

reduction: Zumbrägel, N.; Wetzl, D.; Iding, H.; Gröger, H.
Heterocycles 2017, 95, 1261-1271.
10. Liu, J.; Pang, B. Q. W.; Adams, J. P.; Snajdrova, R.; Li; Z.
ChemCatChem 2017, 9, 425-431; b) Ren, H.; Zhang, Y.; Su, J.; Lin,
P.; Wang, B.; Fang, B.; Wang, S. J. Biotechnol. 2017, 241, 33–41.
11. Bradford, M. M. Anal. Biochem 1976, 72, 248-254.
Supplementary Material
Supplementary Information for this article is available from the
internet, see DOI: xxx.