A xylenol orange-based screening assay for the substrate specificity of flavin-dependent para-phenol oxidases

Article abstract of DOI:10.3390/molecules23010164

Vanillyl alcohol oxidase (VAO) and eugenol oxidase (EUGO) are flavin-dependent enzymes that catalyse the oxidation of para-substituted phenols. This makes them potentially interesting biocatalysts for the conversion of lignin-derived aromatic monomers to value-added compounds. To facilitate their biocatalytic exploitation, it is important to develop methods by which variants of the enzymes can be rapidly screened for increased activity towards substrates of interest. Here, we present the development of a screening assay for the substrate specificity of para-phenol oxidases based on the detection of hydrogen peroxide using the ferric-xylenol orange complex method. The assay was used to screen the activity of VAO and EUGO towards a set of twenty-four potential substrates. This led to the identification of 4-cyclopentylphenol as a new substrate of VAO and EUGO and 4-cyclohexylphenol as a new substrate of VAO. Screening of a small library of VAO and EUGO active-site variants for alterations in their substrate specificity led to the identification of a VAO variant (T457Q) with increased activity towards vanillyl alcohol (4-hydroxy-3-methoxybenzyl alcohol) and a EUGO variant (V436I) with increased activity towards chavicol (4-allylphenol) and 4-cyclopentylphenol. This assay provides a quick and efficient method to screen the substrate specificity of para-phenol oxidases, facilitating the enzyme engineering of known para-phenol oxidases and the evaluation of the substrate specificity of novel para-phenol oxidases.

Full text of DOI:10.3390/molecules23010164

molecules
Article
A Xylenol Orange-Based Screening Assay for the
Substrate Specificity of Flavin-Dependent
para-Phenol Oxidases
Tom A. Ewing 1, Aster van Noord 1, Caroline E. Paul 2
and Willem J. H. van Berkel 1,
*
ID
ID
1
Laboratory of Biochemistry, Wageningen University & Research, Stippeneng 4, 6708 WE Wageningen,
The Netherlands; tom.ewing@wur.nl (T.A.E.); aster.vannoord@wur.nl (A.v.N.)
Laboratory of Organic Chemistry, Wageningen University & Research, Stippeneng 4, 6708 WE Wageningen,
The Netherlands; caroline.paul@wur.nl
2
*
Correspondence: willem.vanberkel@wur.nl; Tel.: +31-317-482861
Received: 15 December 2017; Accepted: 11 January 2018; Published: 14 January 2018
Abstract: Vanillyl alcohol oxidase (VAO) and eugenol oxidase (EUGO) are flavin-dependent enzymes
that catalyse the oxidation of para-substituted phenols. This makes them potentially interesting
biocatalysts for the conversion of lignin-derived aromatic monomers to value-added compounds.
To facilitate their biocatalytic exploitation, it is important to develop methods by which variants
of the enzymes can be rapidly screened for increased activity towards substrates of interest. Here,
we present the development of a screening assay for the substrate specificity of para-phenol oxidases
based on the detection of hydrogen peroxide using the ferric-xylenol orange complex method.
The assay was used to screen the activity of VAO and EUGO towards a set of twenty-four potential
substrates. This led to the identification of 4-cyclopentylphenol as a new substrate of VAO and
EUGO and 4-cyclohexylphenol as a new substrate of VAO. Screening of a small library of VAO and
EUGO active-site variants for alterations in their substrate specificity led to the identification of a
VAO variant (T457Q) with increased activity towards vanillyl alcohol (4-hydroxy-3-methoxybenzyl
alcohol) and a EUGO variant (V436I) with increased activity towards chavicol (4-allylphenol) and
4-cyclopentylphenol. This assay provides a quick and efficient method to screen the substrate
specificity of para-phenol oxidases, facilitating the enzyme engineering of known para-phenol oxidases
and the evaluation of the substrate specificity of novel para-phenol oxidases.
Keywords: enzyme kinetics; flavoprotein; oxidase; screening assay; substrate specificity
1. Introduction
Lignin, one of the major constituents of lignocellulosic biomass, is a heterogenous aromatic
polymer, formed from the monolignols para-coumaryl alcohol, coniferyl alcohol and sinapyl alcohol
through a radical coupling process [1,2]. It is obtained as a by-product during the processing of
plant biomass in biorefineries and as such represents an attractive renewable feedstock of aromatic
compounds. In order to harness the full potential of lignin as a renewable chemical feedstock,
it is desirable to develop novel methods to depolymerise it to monomeric aromatic compounds
and subsequently convert these to value-added compounds. One way in which lignin-derived
aromatic molecules can be converted to value-added compounds is through the action of oxidative
enzymes. Two such enzymes are the flavin-dependent oxidases vanillyl alcohol oxidase (VAO) from
Penicillium simplicissimum and eugenol oxidase (EUGO) from Rhodococcus jostii RHA1 [3,4], which both
belong to auxiliary activity family 4 (AA4) of the carbohydrate active enzyme (CAZy) database [5].
VAO (EC 1.1.3.38) and EUGO (EC 1.1.3.x) are members of the VAO/PCMH flavoprotein family,
which includes flavoenzymes characterised by the presence of a conserved FAD-binding domain [6,7].
Molecules 2018, 23, 164; doi:10.3390/molecules23010164
www.mdpi.com/journal/molecules

Molecules 2018, 23, 164
2 of 18
VAO and EUGO both catalyse the two-electron oxidation of para-substituted phenols at the C
α
position of their substituent (Scheme 1). Molecular oxygen acts as the electron acceptor for the
reaction, being converted to hydrogen peroxide. Despite the fact that VAO and EUGO share significant
sequence similarity (45% identical) and very similar secondary and tertiary structures, they differ in
terms of their oligomerisation state and substrate specificity [8,9]. VAO displays a broad substrate
specificity, catalysing the oxidation of alcohols to aldehydes, the oxidative deamination of amines,
the oxidative demethylation of ethers, the dehydrogenation or hydroxylation of alkyl groups and
the hydroxylation of allyl groups [10
Although alcohols and 4-allylphenols are good substrates for the enzyme, 4-alkylphenols and ethers
are hardly accepted [ ]. In terms of its oligomerisation state, VAO is predominantly octameric in
solution, though active dimers may also be present under certain conditions [ 12]. In contrast, EUGO
,11]. EUGO displays a somewhat narrower substrate specificity.
4
3,
is exclusively dimeric in solution, with its structure strongly resembling that of a dimer of VAO [9].
Scheme 1. Examples of reactions catalysed by vanillyl alcohol oxidase (VAO) and/or eugenol oxidase
(EUGO). Both enzymes can catalyse the oxidation of vanillyl alcohol (14) to the aldehyde vanillin and of
eugenol (18) to coniferyl alcohol. VAO converts 4-ethylphenol (
3
) to a mixture of products consisting of
0
4-vinylphenol and 1-(4 -hydroxyphenyl)ethanol. The hydroxylation reaction occurs enantioselectively,
predominantly yielding the (R)-enantiomer of the alcohol. In contrast, previous studies failed to reveal
any activity towards 3 for EUGO [13].
A number of the reactions catalysed by VAO and EUGO are of interest for potential industrial
applications. The oxidation of vanillyl alcohol (4-hydroxy-3-methoxybenzyl alcohol) or vanillyl
amine [4-(aminomethyl)-2-methoxyphenol] yields vanillin (4-hydroxy-3-methoxybenzaldehyde), the
main flavour and fragrance compound in vanilla [14]. VAO can also be used for the synthesis
of chiral secondary alcohols, with the oxidation of short-chain linear 4-alkylphenols yielding the
(R)-enantiomers of the corresponding alcohols in high enantiomeric excess [15]. The hydroxylation
of 4-allylphenols by VAO or EUGO has been employed in multi-enzyme cascades for the synthesis
of the plant lignan pinoresinol and model lignin compounds [16–18]. The hydroxylation of eugenol
(4-allyl-2-methoxyphenol) by VAO has also garnered interest as the first step in fermentation processes
for the conversion of eugenol to ferulic acid, which can be used as a precursor for vanillin [19–24].
Up to now, the molecular determinants of the differences in substrate specificity between VAO
and EUGO are unclear. The differing oligomerisation states of the enzymes do not appear to be

Molecules 2018, 23, 164
3 of 18
involved, as a VAO variant that exclusively forms dimers displayed similar catalytic properties to the
wild-type enzyme [13]. To improve our understanding of the determinants of the substrate specificity
of these para-phenol oxidases and to facilitate efforts to modify their reactivity by enzyme engineering,
it would be beneficial to be able to rapidly screen variants of VAO and EUGO for activity towards
multiple substrates. To enable this, we here describe a method for the rapid screening of the substrate
specificity of para-phenol oxidases using the ferric-xylenol orange complex method for the detection of
hydrogen peroxide.
The ferric-xylenol orange complex method (xylenol orange assay) is a colorimetric method for
the determination of the concentration of hydroperoxides. When an assay solution containing Fe2+
ions and xylenol orange is added to a sample containing a hydroperoxide under acidic conditions, the
hydroperoxide will oxidise Fe2+ to Fe3+. The Fe3+ subsequently forms a complex with xylenol orange
that can be quantified from its absorbance at 560 nm [25
the concentration of lipid or protein hydroperoxides in biological samples and as an activity assay
for the lipid hydroperoxide-forming enzyme lipoxygenase [27 29]. Detection of hydrogen peroxide
via the ferric-xylenol orange complex method can be used to detect the activity of oxidases and has
,26]. The assay has been applied to measure
–
been applied in a biosensor for lactose and in an in-gel screening assay for
activity [30,31].
L-amino acid oxidase
Methods used previously to determine the activity of VAO or EUGO typically relied on the
measurement of the absorption of reaction products or the consumption of oxygen [ 10]. These assays
4,
are not suitable for high-throughput substrate specificity screening as they are either dependent on
the identity of the phenolic reaction product (measuring absorption of the product) or cannot easily
be performed for multiple samples simultaneously (measuring consumption of oxygen). In contrast,
the xylenol orange assay does not depend on the identity of the phenolic reaction product and
multiple samples can be evaluated simultaneously by performing the assay in a 96-wells plate.
The xylenol orange assay is also better suited for our purpose than assays based on the detection
of hydrogen peroxide via the formation of a coloured compound by peroxidases, as the phenolic
substrates converted by VAO and EUGO are typically also substrates for peroxidases [32].
The method reported here consists of an efficient benchtop purification of His-tagged versions of
VAO and EUGO, followed by a rapid screening of their activity towards a set of twenty-four potential
substrates using the xylenol orange assay. After developing the procedure using the wild-type
enzymes, we applied the assay to screen fourteen active-site variants for alterations in their substrate
specificity. This led to the identification of new substrates of the wild-type enzymes and two variants
that displayed increased activity towards at least one substrate.
2. Results
2.1. Purification and Characterisation of His-VAO and EUGO-His
To enable screening of the substrate specificity of multiple VAO and EUGO variants, we first
needed a method for the rapid and efficient purification of the enzymes. To this end, we expressed the
enzymes from new expression vectors containing genes encoding His-tagged variants of the enzymes.
VAO was expressed as an N-terminally His-tagged protein, His-VAO, and EUGO was expressed as a
C-terminally His-tagged protein, EUGO-His. To evaluate whether these constructs can be used for
our study, we expressed and purified the His-tagged wild-type enzymes and evaluated whether their
catalytic properties are similar to those of the non-His-tagged proteins.
Both His-tagged enzymes were successfully expressed in E. coli and purified by a simple benchtop
procedure consisting of a single affinity chromatography step using a Ni-NTA column followed by
buffer exchange using a desalting column. The purified enzymes contained flavin, as determined from
their characteristic flavin absorption spectra (Figures S1 and S2). Upon precipitation of the proteins
using trichloroacetic acid, a yellow pellet and colourless supernatant were obtained, demonstrating that
the flavin cofactor is covalently bound to the protein. To determine whether the presence of a His-tag

Molecules 2018, 23, 164
4 of 18
on the protein affects catalysis, we determined the steady-state kinetic parameters for the oxidation of
vanillyl alcohol by His-VAO and EUGO-His (Table 1). This revealed that the catalytic properties of
the His-tagged enzymes are highly similar to those of the non-His-tagged enzymes, demonstrating
that the introduction of the His-tag does not affect catalysis. Therefore, these His-tagged variants of
VAO and EUGO provide a suitable experimental system to rapidly purify variants of the enzymes and
study their catalytic properties.
Table 1. Steady-state kinetic parameters for the oxidation of vanillyl alcohol by vanillyl alcohol oxidase
(VAO), His-tagged vanillyl alcohol oxidase (His-VAO), eugenol oxidase (EUGO) and His-tagged
◦
eugenol oxidase (EUGO-His) in 50 mM potassium phosphate buffer, pH 7.5, at 25 C.
−1
−1
−1
)
Enzyme
kcat (s
2.6 a
)
Km (µM)
kcat/Km (s mM
VAO
His-VAO
EUGO
149 a
129 ± 15
79 a
17
19
90
2.5 ± 0.1
7.1 a
EUGO-His
8.0 ± 0.2
47 ± 5
Data from [13].
170
a
2.2. Development of the Xylenol Orange Assay Using His-VAO and EUGO-His
To determine whether the xylenol orange assay can be used to accurately measure the activity of
His-VAO and EUGO-His, we used it to follow the oxidation of vanillyl alcohol and eugenol by the
enzymes in time. To this end, 2 mM vanillyl alcohol or eugenol was allowed to react with EUGO-His
or His-VAO for time periods ranging from one to twenty min, after which the amount of hydrogen
peroxide formed was determined using the xylenol orange assay. In all cases, the measured hydrogen
peroxide concentration was found to increase in time. The increase was linear for the first ten min of
the reactions, with the exception of the oxidation of vanillyl alcohol by EUGO-His, where the increase
was linear for the first 7.5 min of the reaction (Figure 1).
Figure 1. Conversion of eugenol or vanillyl alcohol by His-tagged vanillyl alcohol oxidase (His-VAO)
or His-tagged eugenol oxidase (EUGO-His) followed in time using the xylenol orange assay. His-VAO
([ ] for vanillyl alcohol, [ꢀ] for eugenol) or EUGO-His ([ꢁ] for vanillyl alcohol, [N] for eugenol) was
incubated with 2 mM substrate in 50 mM potassium phosphate buffer, pH 7.5, at room temperature
(19–20 ◦C). Reactions were allowed to proceed for the specified time, after which the amount of
hydrogen peroxide formed was determined using the xylenol orange assay. Error bars represent the
standard deviation of triplicate measurements. Broken lines are fits to the linear range of the data that
were used to determine reaction rates (see Table 2).

Molecules 2018, 23, 164
5 of 18
Reaction rates were determined by fitting the linear range of the data. These rates (Table 2) were
similar to the kcat values determined previously using other methods, as would be expected considering
that our reactions were performed using saturating substrate concentrations. Thus, determination of
the amount of hydrogen peroxide formed using the xylenol orange assay is a suitable way to determine
the rates of reactions catalysed by His-VAO or EUGO-His.
Table 2. Reaction rates for the oxidation of 2 mM vanillyl alcohol or eugenol by His-tagged vanillyl
alcohol oxidase (His-VAO) or His-tagged eugenol oxidase (EUGO-His) in 50 mM potassium phosphate
buffer, pH 7.5, at room temperature (19–20 ◦C) as determined using the xylenol orange assay. The
kcat values for the non-His-tagged enzymes measured previously using other methods are shown
for comparison. These kcat values were mea◦sured under identical experimental conditions, with the
◦
exception of the temperature, which was 25 C instead of 19–20 C.
(His)-VAO
Vanillyl-alcohol
EUGO-(His)
Vanillyl-alcohol
Eugenol
Eugenol
−1
1.5 ± 0.1
8.0 ± 0.3
6.6 ± 0.1
3.2 ± 0.1
kobs Xylenol Orange Assay (s
)
2.6 a
11a
7.1 a
2.9 a
−1
kcat (s
)
a
Data taken from [13].
Subsequently, we used the xylenol orange assay to evaluate the conversion of a set of twenty-four
(potential) substrates by wild-type His-VAO and EUGO-His. The set of compounds contained
various 4-(cyclo)alkylphenols, 4-hydroxybenzyl alcohols, 4-allylphenols and a 4-hydroxybenzylic
amine. In addition to these para-substituted phenols, 2-hydroxy- and 3-hydroxybenzyl alcohol were
included in the set of compounds in order to screen for variants that no longer have a strict specificity
for para-substituted phenols. For a full list of the compounds and their structural formulae, see Table 3.
Table 3. Compounds tested in the substrate specificity screening.
Entry
1
Compound Name (Trivial Name)
Structure
4-methylphenol (para-cresol)
HO
2
2-methoxy-4-methylphenol (para-creosol)
3
4
4-ethylphenol
4-n-propylphenol
5
6
4-isopropyphenol
4-n-butylphenol
7
4-sec-butylphenol
8
9
4-n-pentylphenol
4-n-hexylphenol

Molecules 2018, 23, 164
6 of 18
Table 3. Cont.
Compound Name (Trivial Name)
4-n-nonylphenol
Entry
10
Structure
11
2-hydroxybenzyl alcohol
12
13
3-hydroxybenzyl alcohol
4-hydroxybenzyl alcohol
4-hydroxy-3-methoxybenzyl alcohol
(vanillyl alcohol)
14
15
4-hydroxy-3,5-dimethoxybenzyl alcohol
4-hydroxy-2-methoxybenzyl alcohol
16
17
18
4-allylphenol (chavicol)
4-allyl-2-methoxyphenol (eugenol)
19
4-allyl-2,6-dimethoxyphenol
20
21
5-indanol
5,6,7,8-tetrahydro-2-naphthol
22
23
24
4-cyclopentylphenol
4-cyclohexylphenol
4-(aminomethyl)-2-methoxyphenol
(vanillyl amine)
The rate of conversion of these compounds by His-VAO and EUGO-His at a substrate
concentration of 2 mM was determined by allowing the enzymes to react with the substrate for
ten min and measuring the amount of hydrogen peroxide formed using the xylenol orange assay.

Molecules 2018, 23, 164
7 of 18
Rates of the reactions of His-VAO and EUGO-His with the tested substrates, calculated by assuming
that the formation of hydrogen peroxide in time is linear during the reaction period, are shown in
Figure 2. For substrates where a kcat value has been determined for the non-His-tagged enzymes under
similar experimental conditions, this value is shown for comparison.
The reaction rates measured using the xylenol orange assay are generally in good agreement
with previously obtained data regarding the substrate specificity of VAO and EUGO. For compounds
for which the kcat had previously been determined and found to lie above the detection limit, the
reaction rates measured with the xylenol orange assay typically lie close to the kcat values. This is to
be expected, as the substrate concentration used for the xylenol orange assay (2 mM) is at least ten
times the Km for all these compounds and as such the measurements were performed under saturating
substrate concentrations. The only cases where no activity was observed with the xylenol orange assay
despite the kcat lying above the detection limit were the oxidation of 4-n-butylphenol (6) by His-VAO
and 5-indanol (20) by EUGO-His. The kcat for the oxidation of 4-n-butylphenol by VAO (1.2 s−1) is
only slightly higher than the detection limit of the assay (0.83 s−1) and therefore it is not too surprising
that no activity was detected for its oxidation using the xylenol orange assay. However, the kcat for
the oxidation of 5-indanol by EUGO (2.4 s−1) lies well above the detection limit of the xylenol orange
assay. To investigate this discrepancy further, the rate of oxidation of 2 mM 5-indanol by EUGO-His
was determined by monitoring the consumption of oxygen during the reaction. The rate of oxygen
consumption was found to be 0.064 s−1, significantly lower than the detection limit for the xylenol
orange assay. This is in reasonable agreement with the rate of oxidation of 2 mM 5-indanol by EUGO
determined by Nguyen et al. (0.18 s−1; the higher activity may be attributable to the addition of 10%
DMSO as a co-solvent). Therefore, at a substrate concentration of 2 mM, the rate of conversion of
5-indanol by EUGO-His is significantly lower than the detection limit of the xylenol orange assay.
For all substrates where the previously determined kcat value is lower than the detection limit, no
activity was observed using the xylenol orange assay.
Figure 2. Rate of the reactions of His-tagged vanillyl alcohol oxidase (His-VAO) and His-tagged
eugenol oxidase (EUGO-His) with the compounds used in the substrate specificity screening in 50 mM
◦
potassium phosphate buffer, pH 7.5, at room temperature (19–20 C) as determined using the xylenol
orange assay. Solid bars give the reaction rates measured with the xylenol orange assay for His-VAO
(green) and EUGO-His (blue). Error bars represent the standard deviation of duplicate measurements.
Striped bars give kcat values measured previously by other methods with the non-His-tagged enzymes.
These kcat values were measured under identical experimental conditions, with the exception of the
◦
◦
temperature, which was 25 C instead of 19–20 C. The striped horizontal line indicates the detection
limit of the xylenol orange assay, which corresponds to a reaction rate of 0.83 s−1. The kcat values were
from the following sources. VAO: compounds
1, 4 [33], 5–8, 20, 21 [11], 2, 24 [14], 3, 14, 18 [13], 17 [34].
EUGO: 20, 24 [4], 19 [9], 14, 18 [13]. Numbering is according to Table 3.

Molecules 2018, 23, 164
8 of 18
Interestingly, our substrate specificity screening revealed that a number of compounds not
previously described as substrates of VAO or EUGO are converted by the enzymes. Chavicol (17),
which had previously been shown to be a substrate for VAO, was also converted by EUGO-His, though
at a lower rate than by His-VAO. More surprisingly, both His-VAO and EUGO-His were active with
4-cyclopentylphenol (22), which had not previously been shown to be a substrate for either enzyme.
Particularly with His-VAO, 4-cyclopentylphenol was quite efficiently converted, with the observed
rate of 3.9 s−1 being higher than that observed for all other substrates except eugenol and chavicol.
The ability of His-VAO and EUGO-His to convert 4-cyclopentylphenol was confirmed by allowing
◦
1
µ
M His-VAO or EUGO-His to react with 2 mM 4-cyclopentylphenol at 25 C and analysing the
reaction products by GC and GC/MS (Figures S3 and S4). With both enzymes, the substrate was almost
completely converted after two h (>99% conversion). The reaction yielded a single product, which was
identified as 4-(1-cyclopenten-1-yl)phenol by GC/MS and 1H-NMR (25, Scheme 2, Figures S4 and S5).
The rate of oxidation of 2 mM 4-cyclopentylphenol by His-VAO and EUGO-His was also determined
−1
by monitoring oxygen consumption during the reaction. This yielded rates of 3.7 s for His-VAO and
1.7 s−1 for EUGO-His, in good agreement with the rates determined using the xylenol orange assay
(3.9 s−1 and 1.3 s−1 for His-VAO and EUGO-His, respectively).
Scheme 2. Oxidation of 4-cyclopentylphenol (22) to 4-(1-cyclopenten-1-yl)phenol (25) by His-tagged
vanillyl alcohol oxidase (His-VAO) or His-tagged eugenol oxidase (EUGO-His), as catalysed in 50 mM
◦
potassium phosphate buffer, pH 7.5, at 25 C.
Taken together, these results demonstrate that the xylenol orange assay can be used to accurately
measure the activity of His-VAO and EUGO-His towards a range of substrates and to identify hitherto
unknown substrates of the enzymes. Therefore, it is a suitable assay for use in screening the substrate
specificity of His-VAO and EUGO-His variants. Having established this, we set out to use the assay to
screen a small library of His-VAO and EUGO-His variants for changes in their substrate specificity.
2.3. Analysis of the Substrate-Binding Pockets of VAO and EUGO
To design the variants, we examined the active sites of the proteins to identify residues that differ
between them and therefore may be responsible for the observed differences in substrate specificity.
Both enzymes contain a solvent-inaccessible substrate-binding pocket on the si-side of the FAD cofactor.
This pocket is lined by 19 residues of which 12 are identical in both enzymes (Figure 3). The conserved
residues include all those known to be directly involved in catalysis, including Arg-504 (numbering
of amino acids is as in non-His-tagged VAO), which is thought to stabilise the negative charge that
develops at the N1–C2=O2 locus of FAD upon its reduction, Tyr-108 and Tyr-503, which stabilise the
deprotonated form of phenolic substrates in the active site, Asp-170, which promotes flavin reduction
by stabilising the reduced FAD cofactor through hydrogen bonding with the protonated N5 atom, and
His-422, to which the FAD cofactor is covalently bound [8,34,35]. The seven differing residues form a
cluster on the side of the substrate opposite the flavin cofactor. Interestingly, the competitive inhibitor
◦
isoeugenol binds in a different orientation in each enzyme. In EUGO, it is flipped 180 as compared to
in VAO. This is likely due to the presence of Gly-392 in EUGO instead of the bulky Phe-424 found at
this position in VAO. Based on these observations, we hypothesised that differences in the cluster of
differing residues may be responsible for the observed differences in substrate specificity between VAO
and EUGO. To investigate this, we made seven His-VAO and seven EUGO-His variants, exchanging
each of the differing residues for the amino acid that is found at this position in the other enzyme and

Molecules 2018, 23, 164
9 of 18
set out to study their activity and substrate specificity using the xylenol orange assay (for a list of the
residues and variants see Table 4, numbering as in the sequences of non-His-tagged VAO and EUGO).
Figure 3. Structures of the substrate-binding pockets of vanillyl alcohol oxidase (VAO) and eugenol
oxidase (EUGO) with the competitive inhibitor isoeugenol bound. Structures are shown in stick
representation with residues that are identical in each protein shown in grey, residues that are
different in each protein shown with green (VAO) or cyan (EUGO) carbon atoms, the FAD cofactor
shown with yellow carbon atoms and isoeugenol shown with magenta carbon atoms. The VAO and
EUGO structures were downloaded from the PDB website (PDB identifiers: 2VAO [
8] and 5FXD [9]
respectively). Figure was prepared using PyMOL v. 1.3 (Schrödinger LLC, New York, NY, USA).
Table 4. List of residues forming part of the substrate-binding pocket that are different in vanillyl
alcohol oxidase (VAO) and eugenol oxidase (EUGO) and of the His-tagged vanillyl alcohol oxidase
(His-VAO) and His-tagged eugenol oxidase (EUGO-His) variants that were made during this study.
The residues are numbered according to their position in the non-His-tagged wild-type proteins.
Position
Residue in His-VAO
Residue in EUGO-His
His-VAO Variant
EUGO-His Variant
1
2
3
4
5
6
7
Leu-316
Trp-413
Phe-424
Thr-457
Thr-459
Ile-468
Met-282
Leu-381
Gly-392
Gln-425
Ile-427
L316M
W413L
F424G
T457Q
T459I
M282L
L381W
G392F
Q425T
I427T
Val-436
Leu-438
I468V
C470L
V436I
L438C
Cys-470
2.4. Substrate Specificity Screening of His-VAO and EUGO-His Variants
All fourteen variants were successfully expressed in E. coli and purified as described for the
wild-type enzymes. A single variant, F424G His-VAO, did not contain any flavin after purification, as
judged from the lack of a yellow colour and of the distinctive flavin absorption spectrum. Attempts to
incorporate flavin into this variant by incubating it with FAD failed and it was not studied further.
The other six His-VAO variants and all seven EUGO-His variants contained flavin as determined from
their characteristic flavin absorption spectra (Figures S1 and S2). Upon precipitation of the proteins
using trichloroacetic acid, a yellow pellet and colourless supernatant were obtained, demonstrating that
the flavin cofactor is covalently bound to the protein. The absorption spectra of all seven EUGO-His
variants had a similar shape to that of wild-type EUGO-His. A number of the His-VAO variants, most
notably T457Q and C470L, displayed a somewhat altered flavin absorption spectrum, suggesting that
in these variants the electronic environment of the flavin is slightly altered by the introduced mutations.
The variants were screened for changes in their substrate specificity using the xylenol orange assay.
The results of this screening assay are shown in Figure 4.

Molecules 2018, 23, 164
10 of 18
Figure 4. Rates of the reactions of His-tagged vanillyl alcohol oxidase (His-VAO) and His-tagged
eugenol oxidase (EUGO-His) variants with the compounds used in the substrate specificity screening
◦
in 50 mM potassium phosphate buffer, pH 7.5, at room temperature (19-20 C) as determined using the
xylenol orange assay. Error bars represent the standard deviations of duplicate measurements. For all
compounds that are not included in the graphs, no variants gave a signal above the detection limit
of the assay. The F424G His-VAO variant was not studied, as it did not contain any flavin cofactor.
For the L381W, G392F and I427T EUGO-His variants, no response higher than the detection limit was
measured for any compound.
For His-VAO, all six remaining variants displayed activity with at least some of the tested
compounds. Two of the variants, L316M and T459I, displayed substrate specificity profiles that were
similar to that of the wild-type enzyme. The I468V and C470L variants displayed similar activity to the
wild-type enzyme with the substrates vanillyl alcohol (14), chavicol (17) and eugenol (18). However,
these variants did not display any activity towards linear 4-alkylphenols. The T457Q variant was the
only variant to have significantly increased activity with vanillyl alcohol as a substrate, displaying a
reaction rate that was approximately threefold higher than that of the wild-type enzyme. However,
with all other substrates the T457Q variant displayed a decrease in activity. The only variant for which
activity was detected with a compound for which no activity was detected for wild-type His-VAO was
W413L. This variant displayed activity towards 4-cyclohexylphenol (23), a compound that so far had
not been described as a substrate for VAO or EUGO. In addition to this novel reactivity, the W413L
variant displayed activity towards 4-cyclopentylphenol (22), eugenol, chavicol and 4-isopropylphenol
(5). No activity was detected with linear 4-alkylphenols or vanillyl alcohol.
To confirm that W413L His-VAO oxidises 4-cyclohexylphenol, 1
µ
M enzyme was incubated with
◦
2 mM 4-cyclohexylphenol for 4 h at 25 C and the reaction products were analysed by GC and GC/MS
(Figures S6 and S7). This revealed that 4-cyclohexylphenol is indeed converted by the enzyme yielding
a single product, though the degree of conversion was only 27%. GC/MS analysis revealed that the
product displays a molecular ion at m/z 174.1, suggesting that it is formed by the dehydrogenation
of the substrate. As VAO typically dehydrogenates the Cα-Cβ bond of alkyl groups, the product of
4-cyclohexylphenol oxidation is presumably 4-(1-cyclohexen-1-yl)phenol. Similar experiments were

Molecules 2018, 23, 164
11 of 18
performed using wild-type His-VAO and EUGO-His to evaluate whether they are also capable of
converting 4-cyclohexylphenol. This revealed that after a 4 h incubation period, wild-type His-VAO
had converted 51% of the substrate yielding the same product as observed with W413L His-VAO.
In contrast, no conversion of 4-cyclohexylphenol by wild-type EUGO-His was observed under these
reaction conditions.
The substrate specificity screening of the EUGO-His variants revealed that three of the seven
variants, L381W, G392F and I427T, did not display measurable activity towards any of the tested
compounds. One of the four remaining variants, M282L, displayed a substrate specificity profile that
was similar to that of wild-type EUGO-His. Another variant, Q425T, displayed similar activity to the
wild-type enzyme with vanillyl alcohol, but did not display measurable activity towards any other
compounds. The L438C variant displayed lowered activity towards all substrates as compared to the
wild-type enzyme. The V436I variant displayed lowered activity towards vanillyl alcohol and eugenol.
However, this variant had significantly increased activity towards chavicol and 4-cyclopentylphenol
and also displayed activity towards the dimethoxylated substrate 2,6-dimethoxy-4-allylphenol (19).
This compound had previously been described to be a substrate for EUGO [9], but the kcat value for its
oxidation (0.49 s−1) is lower than the detection limit of our assay, explaining the lack of activity detected
for wild-type EUGO-His. No variants were identified that displayed activity towards compounds that
had previously been identified as substrates for VAO, but not for EUGO, such as linear 4-alkylphenols.
In summary, the majority of the studied variants displayed similar or significantly reduced
activity towards all tested compounds when compared to the corresponding wild-type enzyme.
Two variants were identified that had significantly (more than twofold) increased activity towards one
or more substrates.
3. Discussion
Here, we describe the development of a method for the efficient screening of variants of VAO
and EUGO for alterations in their substrate specificities. The method is based on a facile benchtop
purification of His-tagged versions of the enzymes, followed by a substrate specificity screening
using a xylenol orange assay. After demonstrating that this method allows accurate determination of
reaction rates of the wild-type enzymes with a range of substrates, we used it to screen a library
of fourteen His-VAO or EUGO-His variants towards a set of twenty-four (potential) substrates.
The use of the xylenol orange assay, a spectrophotometric detection method for the oxidase product
hydrogen peroxide, allows the simultaneous measurement of activity towards a range of substrates in
a high-throughput fashion. This compares favourably to previous methods for measuring the activity
of VAO and EUGO. These either relied on measuring the absorption of the product of the reaction,
making the detection method dependent on the substrate used and on prior knowledge of the identity
of the product, or on measuring the consumption of oxygen, which is not practical for high-throughput
screening purposes. Although generic methods for the high-throughput screening of oxidase activity
have been developed in the past, they typically rely on peroxidase-coupled activity assays, where a
peroxidase uses the formed hydrogen peroxide to catalyse the production of a coloured product [36].
This type of assay is not suitable for use with VAO or EUGO, as their phenolic substrates are typically
also converted by peroxidases [32].
Although the number of substrates and variants used in our screen is relatively small, the xylenol
orange assay is highly scalable, particularly when robotic pipetting systems are available. In our
case, the limiting factor for the number of variants that can be screened is the protein purification
method, which relies on the use of gravity-flow Ni-NTA columns. However, we did demonstrate that
this single purification step allowed us to obtain sufficiently pure His-VAO and EUGO-His variants.
High-throughput methods for the production and purification of His-tagged proteins using E. coli
expression systems have been described [37]. Such a system could be used to achieve the purification
of a large number of His-VAO or EUGO-His variants for use in the substrate specificity screening.
Alternatively, cell free extracts of E. coli expressing the variants could be used for the assay. However,

Molecules 2018, 23, 164
12 of 18
in our hands this gave poor results, most likely due to degradation of the formed hydrogen peroxide
by catalase present in the E. coli extracts.
The substrate specificity profiling of wild-type His-VAO and EUGO-His led to the identification of
4-cyclopentylphenol as a substrate of the enzymes. Its conversion yielded 4-(1-cyclopenten- 1-yl)phenol
as the sole product. This is in agreement with the previous finding that while VAO can catalyse
both the hydroxylation and the dehydrogenation of 4-alkylphenols, the dehydrogenation reaction is
preferred when the alkyl side chain is relatively large [11]. Our results also revealed that His-VAO
and the W413L His-VAO variant catalyse the dehydrogenation of 4-cyclohexylphenol, presumably to
4-(1-cyclohexen-1-yl)phenol. However, this reaction was not catalysed by EUGO-His.
Although the substrate specificity profiling of fourteen His-VAO or EUGO-His variants did
not lead us to a thorough understanding of the molecular determinants of the differing substrate
specificities of the enzymes, it did give some interesting insights into the importance of certain
non-catalytic active site residues for enzyme activity. One interesting finding was that the F424G
His-VAO variant did not contain any FAD when purified from E. coli and attempts to incorporate
FAD into the protein failed. Possibly, the extra flexibility conferred by the introduction of a glycine
residue in this variant destabilises the structure of the active site, leading to impaired flavin binding.
Three of the seven EUGO-His variants, L381W, G392F and I427T, did not display any activity in the
substrate specificity profiling, despite containing covalently bound flavin. Presumably, the introduced
mutations affect the structure of the active site in such a way that the substrate is no longer bound in
an orientation that is productive for catalysis.
The I468V and C470L His-VAO variants also displayed interesting changes in substrate specificity,
maintaining similar reaction rates to the wild-type enzyme with vanillyl alcohol, chavicol and eugenol,
but displaying no activity towards linear 4-alkylphenols. Ile-468 and Cys-470 are positioned close
together at the top of the substrate-binding pocket (Figure 3). Possibly, the identity of these two
residues is important for maintaining VAO’s reactivity with linear 4-alkylphenols. As the ability
to convert linear 4-alkylphenols is one of the main differences between VAO and EUGO in terms
of substrate specificity, it would be interesting to investigate whether further mutagenesis at these
positions could create a EUGO variant that is capable of catalysing this reaction.
Only two variants that displayed significantly increased activity towards a compound for which
activity was also detected with the wild-type enzymes were identified. T457Q His-VAO had a threefold
increased reaction rate for the oxidation of vanillyl alcohol compared to wild-type His-VAO and
I436V EUGO-His had three- and fourfold increased reaction rates for the oxidation of chavicol and
4-cyclopentylphenol respectively when compared to wild-type EUGO-His. It also displayed increased
activity towards 4-allyl-2,6-dimethoxyphenol, though the magnitude of the increase could not be
quantified as the reaction rate of wild-type EUGO-His with this compound is below the detection limit
of the assay.
In summary, we developed an efficient method for screening variants of VAO and EUGO for
changes in their substrate specificity consisting of the benchtop purification of His-tagged versions of
the enzymes followed by substrate specificity screening using a xylenol orange assay. This method
was employed for the substrate specificity profiling of the wild-type enzymes and of fourteen enzyme
variants, leading to the identification of 4-cyclopentylphenol as a new substrate for both wild-type
enzymes and of 4-cyclohexylphenol as a new substrate for wild-type His-VAO. Two variants, T457Q
His-VAO and V436I EUGO-His were found to display significant increases in activity towards certain
substrates. This method has the potential to be used to screen larger variant libraries in future,
facilitating efforts to design VAO and EUGO variants for biocatalytic applications.

Molecules 2018, 23, 164
13 of 18
4. Materials and Methods
4.1. Materials
4-Hydroxy-3,5-dimethoxybenzyl alcohol was from Alfa Aesar (Haverhill, MA, USA). 4-n-Butylphenol
and 4-n-nonylphenol were from Lancaster Synthesis (Haverhill, MA, USA). Ferrous sulphate heptahydrate
was from Merck (Burlington, MA, USA). 4-Allylphenol (chavicol) was from Quest International
(Naarden, The Netherlands). 4-Allylphenol-2,6-dimethoxyphenol, 4-allyl-2-methoxyphenol (eugenol),
4-(aminomethyl)-2-methoxyphenol hydrochloride (vanillyl amine), 4-sec-butylphenol, 4-cyclohexylphenol,
4-cyclopentylphenol, 4-ethylphenol, 4-n-hexylphenol, 2-hydroxy-benzyl alcohol, 3-hydroxybenzyl
alcohol, 4-hydroxybenzyl alcohol, 4-hydroxy-2-methoxybenzyl alcohol, 4-hydroxy-3-methoxybenzyl
alcohol (vanillyl alcohol), 5-indanol, 4-isopropylphenol, 2-methoxy-4-methylphenol (para-creosol),
4-methylphenol (para-cresol), 4-n-pentylphenol, 4-n-propylphenol, 5,6,7,8-tetrahydronaphthol and
xylenol orange tetrasodium salt were from Sigma-Aldrich (St. Louis, MO, USA). All other
chemicals were from commercial sources and of the purest grade available. The pJ404-His-VAO and
pBAD-EUGO-His plasmids were a kind gift from Prof. Dr. Marco Fraaije (University of Groningen).
4.2. Site-Directed Mutagenesis
Plasmids encoding for the His-VAO and EUGO-His variants were created by linear whole-plasmid
amplification from the pJ404-His-VAO and pBAD-EUGO-His plasmids respectively. The pJ404-His-VAO
plasmid contains a version of the vaoA gene from P. simplicissimum that is codon-optimised for expression
in E. coli behind the IPTG-inducible T5 promoter. The gene is extended with a sequence that encodes
an N-terminal 6x-His-tag followed by a single glycine residue. The pBAD-EUGO-His plasmid contains
the eugo gene from Rhodococcus jostii RHA1 with an extension that encodes the polypeptide sequence
GKLGPEQKLISEEDLNSAVDHHHHHH at the C-terminus of the protein. The extension contains both
a C-terminal 6x-His tag and a Myc-tag (EQKLISEEDL). This construct is placed behind the L-arabinose
inducible pBAD promoter. Constructs encoding variants of the enzymes were amplified from the
corresponding plasmid using the mutagenic primers listed in Table 5. Following the amplification
reaction, remaining template DNA was digested with DpnI and the mutated plasmids were transformed
into DH5α E. coli. Subsequently, plasmid DNA was isolated and the introduction of the correct mutations
was confirmed by sequencing. The mutated plasmids were transformed into BL21 (for His-VAO) or
TOP10 (for EUGO-His) E. coli for protein expression.
Table 5. List of primers used for site-directed mutagenesis in this study. Sites in italics indicate the
position of the mutations introduced to achieve the amino acid substitution. Underlined sites indicate
the position of mutations introduced to remove or introduce a restriction site to enable screening for
the introduction of the correct mutations by restriction enzyme digestion (these are either the same
mutations used for the amino acid substitution or silent mutations close to this site). The identity of the
used restriction enzymes is given in the third column (+ indicates that a restriction site for this enzyme
was introduced,
−
indicates that a restriction site for this enzyme was removed). His-VAO: His-tagged
vanillyl alcohol oxidase, EUGO-His: His-tagged eugenol oxidase.
Variant
Primer
Restriction Site
L316M His-VAO
W413L His-VAO
F424G His-VAO
T457Q His-VAO
T459I His-VAO
ATCCGCCATATTCTGATGGATGCTGCAGTGCTGGGTGACAAG
TATGATGAACTGAAGCTTATTGATTGGTTGCCG
AATGGTGCCCACCTGGGTTTCAGCCCGATTGCGAAGGTGTCTGGT
TGCCAGGAAGCAGGTCTAGACTTCATTGGTCAATTCACTGTTGGTATG
TTCATTGGTACGTTCATTGTTGGTATGCGTGAG
+PstI
+HindIII
−PvuI
+XbaI
None
I468V His-VAO
C470L His-VAO
M282L EUGO-His
L381W EUGO-His
G392F EUGO-His
Q425T EUGO-His
I427T EUGO-His
V436I EUGO-His
L438C EUGO-His
ATGCGTGAGATGCATCATGTTGTTTGCATCGTGTTT
ATGCGTGAGATGCATCATATTGTTTTAATCGTGTTTAACAAG
CTGCGCAACATCTTCTTGGACGCGGCCGCGGTG
CTGGACGAACTGCAGTGGCTGGACTGGGTGCCC
AACGGCGGGCACATCTTTTTCTCACCGGTGTCGGCGCCG
AAGGACTACGCCGCGACATTCATCATCGGGCTC
TACGCCGCGCAATTCACGATCGGGCTCCGCGAG
CGCGAGATGCACCACATATGCCTGTTCATCTAC
CTCCGCGAGATGCATCACGTGTGCTGCTTCATCTACGACACG
+NsiI
+NsiI
None
+PstI
+AgeI
None
+PvuI
+NdeI
+NsiI

Molecules 2018, 23, 164
14 of 18
4.3. Protein Expression and Purification
For the expression of His-VAO and its variants, BL21 E. coli containing the correct plasmid was
grown in 100 mL LB medium (Duchefa Biochemie, Haarlem, The Netherlands) containing 100 µg/mL
ampicillin at 37 ◦C until the OD600 was 0.6. Subsequently, protein expression was induced by adding
IPTG to a final concentration of 0.8 mM and cells were grown overnight at 25 ◦C. Next, cells were
harvested by centrifugation (4200
×
g, 15 min, 4 ◦C) and resuspended in 50 mM potassium phosphate
buffer, pH 7.5, containing 500 mM NaCl, 5% glycerol (v/v), 0.5 mM MgSO4 and one cOmpleteTM
protease inhibitor pill (Roche, Basel, Switzerland) and 1 mg DnaseI (Roche) per 50 mL. Cells were lysed
by sonication using 6 cycles of 30 s at maximum power with an MSE sonication probe. Samples were
cooled on ice during sonication. Following this, cell debris was removed by centrifugation (39,000
×
g,
45 min, 4 ◦C) and the supernatant was loaded onto a gravity flow column containing 2 mL HisPur
Ni-NTA resin (Thermo Scientific, Waltham, MA, USA) equilibrated in 50 mM potassium phosphate
buffer, pH 7.5, containing 500 mM NaCl and 5% glycerol. The column was washed with this buffer
until all unbound proteins had eluted as judged from the absorption of the flow-through at 280 nm.
Subsequently, His-VAO was eluted using 50 mM potassium phosphate buffer, pH 7.5, containing
500 mM NaCl, 5% glycerol (v/v) and 200 mM imidazole. Fractions containing His-VAO were pooled
and transferred to 50 mM potassium phosphate buffer, pH 7.5, containing 150 mM NaCl and 10%
glycerol by passing them over an Econo-Pac 10DG desalting column (Bio-Rad, Hercules, CA, USA)
equilibrated in this buffer. This procedure typically yielded 1–3 mg protein from 100 mL E. coli culture.
After purification of F424G His-VAO, the protein did not contain any flavin cofactor. In an
attempt to obtain flavin-containing protein, the purified F424G His-VAO variant was incubated with
1 mM FAD in 50 mM potassium phosphate buffer, pH 7.5, containing 75 mM NaCl and 5% glycerol
at room temperature for 4 h. Subsequently, free FAD was removed by passing the mixture over an
Econo-Pac 10DG desalting column (Bio-Rad) equilibrated in 50 mM potassium phosphate buffer, pH
7.5, containing 150 mM NaCl and 10% glycerol. Fractions containing the protein were collected and
analysed for flavin content by measuring their absorption spectra. This revealed that the protein did not
contain any FAD. No further attempts were made to incorporate FAD into the F424G His-VAO variant.
For the expression of EUGO-His and its variants, TOP10 E. coli containing the correct plasmid
was grown in 100 mL TB medium (Difco, Becton Dickinson, Franklin Lake, NJ, USA) containing
◦
100
µ
g/mL ampicillin at 37 C until the OD600 was 0.6. Subsequently, protein expression was induced
by◦adding
L
-arabinose to a final concentration of 0.02% (w/v) and cells were grown overnight at
◦
30 C. Next, cells were harvested by centrifugation (4200
×
g, 15 min, 4 C) and resuspended in 50 mM
potassium phosphate buffer, pH 7.5, containing 20 mM imidazole, 0.5 mM MgSO4 and one cOmpleteTM
protease inhibitor pill (Roche) and 1 mg DnaseI (Roche) per 50 mL. Cells were lysed by sonication
using 6 cycles of 30 s at maximum power with an MSE sonication probe. Samples were cooled on◦ice
g, 45 min, 4 C)
during sonication. Following this, cell debris was removed by centrifugation (39,000
×
and the supernatant was loaded onto a gravity flow column containing 2 mL HisPur Ni-NTA resin
(Thermo Scientific) equilibrated in 50 mM potassium phosphate buffer, pH 7.5, containing 20 mM
imidazole. The column was washed with this buffer until all unbound proteins had eluted as judged
from the absorption of the flow-through at 280 nm. Subsequently, EUGO-His was eluted using 50 mM
potassium phosphate buffer, pH 7.5, containing 500 mM imidazole. Fractions containing EUGO-His
were pooled and transferred into 50 mM potassium phosphate buffer, pH 7.5, by passing them over an
an Econo-Pac 10DG desalting column (Bio-Rad) equilibrated in this buffer. This procedure typically
yielded 5–10 mg protein from 100 mL E. coli culture.
4.4. Analytical Methods
All experiments were performed in 50 mM potassium phosphate buffer, pH 7.5, unless
indicated otherwise. Absorption spectra were recorded on a Hewlett Packard 8453 photodiode array
spectrophotometer (Agilent Technologies, Santa Clara, CA, USA). Protein concentrations of His-VAO
and its variants were determined using the extinction coefficient of non-His-tagged VAO at 439 nm

Molecules 2018, 23, 164
15 of 18
(
ε439 = 12,500 M−1 cm−1
[
3
]) and concentrations of EUGO-His and its variants were determined
using the extinction coefficient of non-His-tagged EUGO at 441 nm (ε441 = 14,200 M−1 cm−1
[
4
]).
L 50% (w/v) trichloroacetic acid solution was added
M enzyme solution in 50 mM potassium phosphate buffer, pH 7.5, (EUGO-His and
variants) or 50 mM potassium phosphate buffer, pH 7.5, containing 150 mM NaCl and 10% glycerol
(His-VAO and variants) to yield final concentrations of 5% (w/v) trichloroacetic acid and 10 M enzyme.
Mixtures were incubated on ice for 30 min, after which the precipitate was pelleted by centrifugation
(21,000
g, 15 min, 4 ◦C). The presence of flavin in the pellet or supernatant was judged from their
For trichloroacetic acid precipitations, 10
to 90 L 11
µ
µ
µ
µ
×
colour and fluorescence upon irradiating them with UV-light. Steady-state kinetic parameters for the
oxidation of vanillyl alcohol to vanillin by His-VAO and EUGO-His were determined by following the
absorption of the product at 340 nm (ε340 = 14,000 M−1 cm−1) and fitting the obtained reaction rates
to the Michaelis-Menten equation using IGOR Pro v. 6.10A (Wavemetrics, Lake Oswego, OR, USA).
Oxygen consumption measurements were performed using a Hansatech Oxytherm system (Hansatech
Instruments, King’s Lynn, UK).
4.5. Enzymatic Reactions for the Xylenol Orange Assay
Enzymatic reactions were performed in 96-wells plates. Substrate solution (180
µL) was added
to 20 L enzyme solution to give a reaction mixture containing 20 nM enzyme and 2 mM substrate
µ
in 50 mM potassium phosphate buffer, pH 7.5. For measurements where the oxidation of eugenol
or vanillyl alcohol was followed in time, the reaction mixtures were incubated for the desired time
◦
(ranging from 1–20 min) at room temperature (19–20 C), after which 20
µL of the reaction mixture was
removed and the hydrogen peroxide concentration was determined using the xylenol orange assay
as described below. Reaction rates were determined by fitting a curve to the linear range of the data
using IgorPRO. For substrate specificity screening, the reaction mixtures were incubated for 10 min
at room temperature (19–20 ◦C), after which a 20
µL sample was taken and the hydrogen peroxide
concentration was determined using the xylenol orange assay as described below. Three of the tested
compounds, 4-n-nonylphenol, 4-hydroxybenzyl alcohol and 4-cyclohexylphenol, were poorly soluble
in water at the used concentration and therefore were added to the reaction mixtures as (partial)
suspensions. Reaction rates were estimated by assuming that there is a linear increase in hydrogen
peroxide concentration during the reaction time.
4.6. Xylenol Orange Assay
Twenty
µL of the sample to be analysed was added to 180
µL xylenol orange assay mix in a
96-wells plate. This yielded a final assay mixture containing 100
µ
M xylenol orange, 250 M ferrous
µ
sulphate, 25 mM sulfuric acid and the tenfold diluted analyte solution. This mixture was incubated in
◦
the dark at room temperature (19–20 C) for 30 min, after which the absorption at 560 nm was measured
using an xMark microplate spectrophotometer (Bio-Rad). A calibration curve of hydrogen peroxide
solutions with known concentrations in the range 10–200 µM (concentration prior to addition to the
xylenol orange assay mixture) was used to convert the measured absorbance values to the hydrogen
peroxide concentration in the analyte solution. To ensure that the measured hydrogen peroxide
concentrations reflect actual hydrogen peroxide formed during the enzymatic reaction, a detection
limit of 10 µM hydrogen peroxide, which corresponds to the lowest point of the calibration curve, was
used. All samples where the measured hydrogen peroxide concentration was lower than this were
deemed to have had no significant formation of hydrogen peroxide during the reaction period.
4.7. Conversion of 4-cyclopentylphenol and 4-cyclohexylphenol and Identification of the Reaction Products
For GC and GC/MS analysis, reaction mixtures (100 µL) containing 2 mM substrate and 1 µM
enzyme in 50 mM potassium phosphate buffer, pH 7.5, (EUGO-His) or 50 mM potassium phosphate
buffer, pH 7.5, containing 30 mM NaCl and 2% (w/v◦) glycerol (His-VAO), were incubated for 2 h
(4-cyclopentylphenol) or 4 h (4-cyclohexylphenol) at 25 C under shaking (500 rpm). Subsequently, the

Molecules 2018, 23, 164
16 of 18
reactions were stopped by extracting the reaction mixtures twice with 100
µL ethyl acetate. The ethyl
acetate layers were combined and dried over Na2SO4. Reaction products were analysed by GC and
GC/MS. GC was performed on an Agilent 6890 GC system equipped with an Agilent 7673 injector
using a 60 m
×
0.25 mm
×
0.25 µm DB-1 column (Agilent Technologies). The injector temperature
was 220 ◦C and the FID temperature was 250 ◦C. The split ratio was 10:1. Samples from reactions
with 4-cyclopentylphenol were run at a flow rate of 1.7 mL/min using the following temperature
programme: 100 ◦C for 5 min, followed by a temperature gradient to 230 ◦C with an increment of
◦
◦
10 C per min, followed by 3 min at 230 C. Samples from reactions with 4-cyclohexylphenol were run
at a flow rate of 1.7 mL/min usin◦g the following temperatur◦e programme: 100 ◦C for 4 min, followed
◦
by a temperature gradient to 160 C with an increment of 10 C per min, followed by 10 min at 160 C,
followed by a temperature gradient to 230 ◦C with an increment of 10 ◦C per min, followed by 3 min
at 230 ◦C. Reported conversion percentages are average values from duplicate experiments. GC/MS
was performed on an Agilent 6890 GC system equipped with an Agilent 7975C MS detector and an
Agilent 7683B injector using a 30 m
×
0.25 mm
×
0.25 µm HP-5MS column (Agilent Technologies).
The injector temperature was 275 ◦C. The split ratio was 100:1. Samples were run at a flow rate of
1.1 mL/min using the following programme: 50 ◦C for 3 min, followed by a temperature gradient
to 100 ◦C with an increment of 5 ◦C per min, followed by a temperature gradient to 250 ◦C with an
increment of 10 ◦C per min, followed by 3 min at 250 ◦C.
For 1H-NMR analysis, a reaction mixture (25 mL) containing 2.5 mM 4-cyclopentylphen◦ol and
0.5
µM EUGO-His was incubated in 50 mM potassium phosphate buffer, pH, 7.5, at 25 C for
16 h under shaking (500 rpm). Following this, reaction products were extracted twice with 25 mL
ethyl acetate. The ethyl acetate layers were combined and dried over Na2SO4. Subsequently, ethyl
acetate was removed by evaporation and the remaining solid was dissolved in CDCl3. 1H-NMR
spectra were recorded on an Avance III 400 MHz NMR spectrometer (Bruker, Billerica, MA, USA) at
400 MHz. This revealed that the obtained product was a mixture of 40% 4-cyclopentylphenol and 60%
4-(1-cyclopenten-1-yl)phenol. Chemical shifts (δ) are reported in parts per million (ppm) relative to
CDCl3. Data is reported as follows: br = broad, s = singlet, d = doublet, m = multiplet, ap = apparent;
coupling constant(s) (J) in Hz and integration.
1
4-cyclopentylphenol. H-NMR (400 MHz, CDCl3)
δ 7.12 (ap d, J = 8.5 Hz, 2H), 6.77 (ap d, J = 8.5 Hz, 2H),
4.66 (s, 1H), 2.93 (m, 1H), 2.14–1.96 (m, 2H), 1.87–1.72 (m, 2H), 1.75–1.59 (m, 2H), 1.61–1.46 (m, 2H).
4-(1-cyclopenten-1-yl)phenol. 1H-NMR (400 MHz, CDCl3)
δ
7.33 (ap d, J = 8.6 Hz, 2H), 6.78 (ap d, J = 8.9 Hz,
2H), 6.04 (m, 1H), 4.80 (br s, 1H), 2.73–2.56 (m, 2H), 2.56–2.45 (m, 2H), 2.09–1.96 (m, 2H).
Supplementary Materials: The following are available online. Figure S1: Absorption spectra of His-VAO and
its variants, Figure S2: Absorption spectra of EUGO-His and its variants, Figure S3: GC chromatograms of the
reaction products of the conversion of 4-cyclopentylphenol by His-VAO and EUGO-His; Figure S4: GC/MS
chromatograms and mass spectra of the reaction products of the conversion of 4-cyclopentylphenol by His-VAO
and EUGO-His, Figure S5: 1H-NMR spectra of 4-cyclopentylphenol and the reaction products of its conversion by
EUGO-His, Figure S6: GC chromatograms of the reaction products of the conversion of 4-cyclohexylphenol by
His-VAO, EUGO-His and W413L His-VAO, Figure S7: GC/MS chromatograms and mass spectra of the reaction
products of the conversion of 4-cyclohexylphenol by His-VAO, EUGO-His and W413L His-VAO.
Acknowledgments: We thank Sigrid Berglund for technical assistance and Marco Fraaije and Mohamed Habib
(both from University of Groningen) for providing the pJ404-His-VAO and pBAD-EUGO-His plasmids and
expression and purification protocols for His-VAO and EUGO-His. This research was supported by the European
Union through the INDOX project (FP7-KBBE-2013-7-613549).
Author Contributions: T.A.E. and W.J.H.v.B. conceived and designed the experiments; T.A.E., A.v.N. and C.E.P.
performed the experiments; T.A.E., A.v.N., C.E.P. and W.J.H.v.B. analysed the data; T.A.E. wrote the paper.
Conflicts of Interest: The authors declare no conflict of interest. The funding sponsors had no role in the design
of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the
decision to publish the results.

Molecules 2018, 23, 164
17 of 18
References
1.
2.
3.
Ragauskas, A.J.; Beckham, G.T.; Biddy, M.J.; Chandra, R.; Chen, F.; Davis, M.F.; Davison, B.H.; Dixon, R.A.;
Gilna, P.; Keller, M.; Langan, P.; et al. Lignin valorization: Improving lignin processing in the biorefinery.
Science 2014, 344, 1246843. [CrossRef] [PubMed]
Rinaldi, R.; Jastrzebski, R.; Clough, M.T.; Ralph, J.; Kennema, M.; Bruijnincx, P.C.A.; Weckhuysen, B.M.
Paving the way for lignin valorisation: Recent advances in bioengineering, biorefining and catalysis.
Angew. Chem. Int. Ed. 2016, 55, 8164–8215.
De Jong, E.; Van Berkel, W.J.H.; Van der Zwan, R.P.; Bont, J.A.M. Purification and characterization of
vanillyl-alcohol oxidase from Penicillium simplicissimum: A novel aromatic alcohol oxidase containing
covalently bound FAD. Eur. J. Biochem. 1992, 208, 651–657. [CrossRef] [PubMed]
4.
5.
Jin, J.; Mazon, H.; Van den Heuvel, R.H.H.; Janssen, D.B.; Fraaije, M.W. Discovery of a eugenol oxidase from
Rhodococcus sp. strain RHA1. FEBS J. 2007, 274, 2311–2321. [CrossRef] [PubMed]
Levasseur, A.; Drula, E.; Lombard, V.; Coutinho, P.M.; Henrissat, B. Expansion of the enzymatic repertoire
of the CAZy database to integrate auxiliary redox enzymes. Biotechnol. Biofuels 2013, 6, 41. [CrossRef]
[PubMed]
6.
7.
8.
Fraaije, M.W.; Van Berkel, W.J.H.; Benen, J.A.E.; Visser, J.; Mattevi, A. A novel oxidoreductase family sharing
a conserved FAD-binding domain. Trends Biochem. Sci. 1998, 23, 206–207. [CrossRef]
Ewing, T.A.; Fraaije, M.W.; Mattevi, A.; Van Berkel, W.J.H. The VAO/PCMH flavoprotein family.
Arch. Biochem. Biophys. 2017, 632, 104–117. [CrossRef] [PubMed]
Mattevi, A.; Fraaije, M.W.; Mozzarelli, A.; Olivi, L.; Coda, A.; Van Berkel, W.J.H. Crystal structures and
inhibitor binding in the octameric flavoenzyme vanillyl-alcohol oxidase: The shape of the active-site cavity
controls substrate specificity. Structure 1997, 5, 907–920. [CrossRef]
9.
Nguyen, Q.-T.; De Gonzalo, G.; Binda, C.; Rioz-Martínez, A.; Mattevi, A.; Fraaije, M.W. Biocatalytic properties
and structural analysis of eugenol oxidase from Rhodococcus jostii RHA1: A versatile oxidative biocatalyst.
ChemBioChem 2016, 17, 1359–1366. [CrossRef] [PubMed]
10. Fraaije, M.W.; Veeger, C.; Van Berkel, W.J.H. Substrate specificity of flavin-dependent vanillyl-alcohol
oxidase from Penicillium simplicissimum: Evidence for the production of 4-hydroxycinnamyl alcohols from
4-allylphenols. Eur. J. Biochem. 1995, 234, 271–277. [CrossRef] [PubMed]
11. Van den Heuvel, R.H.H.; Fraaije, M.W.; Laane, C.; Van Berkel, W.J.H. Regio- and stereospecific conversion
of 4-alkylphenols by the covalent flavoprotein vanillyl-alcohol oxidase. J. Bacteriol. 1998, 180, 5646–5651.
[PubMed]
12. Fraaije, M.W.; Mattevi, A.; Van Berkel, W.J.H. Mercuration of vanillyl-alcohol oxidase from Penicillium
simplicissimum generates inactive dimers. FEBS Lett. 1997, 402, 33–35. [CrossRef]
13. Ewing, T.A.; Gygli, G.; Van Berkel, W.J.H. A single loop is essential for the octamerization of vanillyl alcohol
oxidase. FEBS J. 2016, 283, 2546–2559. [CrossRef] [PubMed]
14. Van den Heuvel, R.H.H.; Fraaije, M.W.; Laane, C.; Van Berkel, W.J.H. Enzymatic synthesis of vanillin. J. Agric.
Food Chem. 2001, 49, 2954–2958. [CrossRef] [PubMed]
15. Drijfhout, F.P.; Fraaije, M.W.; Jongejan, H.; Van Berkel, W.J.H.; Franssen, M.C.R. Enantioselective
hydroxylation of 4-alkylphenols by vanillyl alcohol oxidase. Biotechnol. Bioeng. 1998, 59, 171–177. [CrossRef]
16. Ricklefs, E.; Girhard, M.; Koschorreck, K.; Smit, M.S.; Urlacher, V.B. Two-step one-pot synthesis of pinoresinol
from eugenol in an enzymatic cascade. ChemCatChem 2015, 7, 1857–1864. [CrossRef]
17. Ricklefs, E.; Girhard, M.; Urlacher, V.B. Three-steps in one-pot: Whole-cell biocatalytic synthesis of
enantiopure (+)- and (
[PubMed]
−
)-pinoresinol via kinetic resolution. Microb. Cell Fact. 2016, 15, 78. [CrossRef]
18. Habib, M.H.M.; Deuss, P.J.; Loncˇar, N.; Trajkovic, M.; Fraaije, M.W. A biocatalytic one-pot approach for the
preparation of lignin oligomers using an oxidase/peroxidase cascade enzyme system. Adv. Synth. Catal.
2017, 359, 3354–3361. [CrossRef]
19. Overhage, J.; Steinbüchel, A.; Priefert, H. Highly efficient biotransformation of eugenol to ferulic acid and
further conversion to vanillin in recombinant strains of Escherichia coli. Appl. Environ. Microbiol. 2003, 69,
6569–6576. [CrossRef] [PubMed]

Molecules 2018, 23, 164
18 of 18
20. Overhage, J.; Steinbüchel, A.; Priefert, H. Harnessing eugenol as a substrate for production of aromatic
compounds with recombinant strains of Amycolatopsis sp. HR167. J. Biotechnol. 2006, 125, 369–376. [CrossRef]
[PubMed]
21. Plaggenborg, R.; Overhage, J.; Loos, A.; Archer, J.A.C.; Lessard, P.; Sinskey, A.J.; Steinbüchel, A.; Priefert, H.
Potential of Rhodococcus strains for biotechnological vanillin production from ferulic acid and eugenol.
Appl. Microbiol. Biotechnol. 2006, 72, 745–755. [CrossRef] [PubMed]
22. Zucca, J.; Lambert, F.; Mane, J.; Ness, F.; Aigle, M. System for Producing Aromatic Molecules by
Bioconversion. U.S. Patent 8,404,472, 26 March 2013.
23. Lambert, F.; Zucca, J.; Ness, F.; Aigle, M. Production of ferulic acid and coniferyl alcohol by conversion of
eugenol using a recombinant strain of Saccharomyces cerevisiae. Flavour Fragr. J. 2014, 29, 14–21. [CrossRef]
24. Zhou, R.; Xiaodan, Y. Methods of Making Vanillin via the Microbial Fermentation of Ferulic Acid from
Eugenol Using a Plant Dehydrogenase. International Patent Application WO/2015/066722, 7 May 2015.
25. Gupta, B.L. Microdetermination techniques for H2O2 in irradiated solutions. Microchem. J. 1973, 18, 363–374.
[CrossRef]
26. Gay, C.; Collins, J.; Gebicki, J.M. Hydroperoxide assay with the ferric-xylenol orange complex. Anal. Biochem.
1999, 273, 149–155. [CrossRef] [PubMed]
27. Nourooz-Zadeh, J.; Tajaddini-Sarmadi, J.; Wolff, S.P. Measurement of plasma hydroperoxide concentrations
by the ferrous oxidation-xylenol orange assay in conjunction with triphenylphosphine. Anal. Biochem. 1994
,
220, 403–409. [CrossRef] [PubMed]
28. Waslidge, N.B.; Hayes, D.J. A colorimetric method for the determination of lipoxygenase activity suitable for
use in a high throughput assay format. Anal. Biochem. 1995, 231, 354–358. [CrossRef] [PubMed]
29. Gay, C.A.; Gebicki, J.M. Measurement of protein and lipid hydroperoxides in biological systems by the
ferric-xylenol orange method. Anal. Biochem. 2003, 315, 29–35. [CrossRef]
30. Yu, Z.; Wang, J.; Zhou, N.; Zhao, C.; Qiu, J. A highly sensitive method for quantitative determination of
L
-amino acid oxidase activity based on the visualization of ferric-xylenol orange formation. PLoS ONE 2013
8, e82483. [CrossRef] [PubMed]
31. Jasti, L.S.; Dola, S.R.; Fadnavis, N.W.; Addepally, U.; Daniels, S.; Ponrathnam, S. Co-immobilized glucose
oxidase and -galactosidase on bovine serum albumin coated allyl glycidyl ether (AGE)-ethylene glycol
,
β
dimethacrylate (EGDM) copolymer as a biosensor for lactose determination in milk. Enzyme Microb. Technol.
2014, 64–65, 67–73. [CrossRef] [PubMed]
32. BRENDA Enzyme Database EC 1.11.1.7: Peroxidases. Available online: https://www.brenda-enzymes.org/
enzyme.php?ecno=1.11.1.7 (accessed on 11 December 2017).
33. Fraaije, M.W.; Van den Heuvel, R.H.H.; Roelofs, J.C.A.A.; Van Berkel, W.J.H. Kinetic mechanism of
vanillyl-alcohol oxidase with short-chain 4-alkylphenols. Eur. J. Biochem. 1998, 253, 712–719. [CrossRef]
[PubMed]
34. Ewing, T.A.; Nguyen, Q.-T.; Allan, R.C.; Gygli, G.; Romero, E.; Binda, C.; Fraaije, M.W.; Mattevi, A.; Van
Berkel, W.J.H. Two tyrosine residues, Tyr-108 and Tyr-503, are responsible for the deprotonation of phenolic
substrates in vanillyl-alcohol oxidase. J. Biol. Chem. 2017, 292, 14668–14679. [CrossRef] [PubMed]
35. Van den Heuvel, R.H.H.; Fraaije, M.W.; Mattevi, A.; Van Berkel, W.J.H. Asp-170 is crucial for the redox
properties of vanillyl-alcohol oxidase. J. Biol. Chem. 2000, 275, 14799–14808. [CrossRef] [PubMed]
36. Holt, A.; Palcic, M.M. A peroxidase-coupled continuous absorbance plate-reader assay for flavin monoamine
oxidases, copper-containing amine oxidases and related enzymes. Nat. Protoc. 2006, 1, 2498–2505. [CrossRef]
[PubMed]
37. Scheich, C.; Sievert, V.; Büssow, K. An automated method for high-throughput protein purification applied
to a comparison of His-tag and GST-tag affinity chromatography. BMC Biotechnol. 2003, 3, 12. [CrossRef]
[PubMed]
Sample Availability: Samples of the compounds 1–24 are available from the authors.
©
2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).