Microbial synthesis of medium-chain α,ω-dicarboxylic acids and ω-aminocarboxylic acids from renewable long-chain fatty acids

Article abstract of DOI:10.1002/adsc.201300784

Biotransformation of long-chain fatty acids into medium-chain α,ω-dicarboxylic acids or ω-aminocarboxylic acids could be achieved with biocatalysts. This study presents the production of α,ω-dicarboxylic acids (e.g., C₉, C₁₁, C ₁₂, C₁₃) and ω-aminocarboxylic acids (e.g., C ₁₁, C₁₂, C₁₃) directly from fatty acids (e.g., oleic acid, ricinoleic acid, lesquerolic acid) using recombinant Escherichia coli-based biocatalysts. ω-Hydroxycarboxylic acids, which were produced from oxidative cleavage of fatty acids via enzymatic reactions involving a fatty acid double bond hydratase, an alcohol dehydrogenase, a Baeyer-Villiger monooxygenase and an esterase, were then oxidized to α,ω- dicarboxylic acids by alcohol dehydrogenase (ADH, AlkJ) from Pseudomonas putida GPo1 or converted into ω-aminocarboxylic acids by a serial combination of ADH from P. putida GPo1 and an ω-transaminase of Silicibacter pomeroyi. The double bonds present in the fatty acids such as ricinoleic acid and lesquerolic acid were reduced by E. coli-native enzymes during the biotransformations. This study demonstrates that the industrially relevant building blocks (C₉ to C₁₃ saturated α,ω- dicarboxylic acids and ω-aminocarboxylic acids) can be produced from renewable fatty acids using biocatalysis.

Full text of DOI:10.1002/adsc.201300784

FULL PAPERS
DOI: 10.1002/adsc.201300784
Microbial Synthesis of Medium-Chain a,w-Dicarboxylic Acids
and w-Aminocarboxylic Acids from Renewable Long-Chain Fatty
Acids
Ji-Won Song,a Jung-Hoo Lee,a Uwe T. Bornscheuer,b and Jin-Byung Parka,c,*
a
Department of Food Science and Engineering, Ewha Womans University, Seoul 120-750, Republic of Korea
Fax : (+82)-2-3277-4213; phone: (+82)-2-3277-4509; e-mail: jbpark06@ewha.ac.kr
Institute of Biochemistry, Department of Biotechnology & Enzyme Catalysis, Greifswald University, 17487 Greifswald,
b
Germany
c
Global Top5 Research Program, Ewha Womans University, 11-1 Daehyeon-dong, Seodaemun-gu, Seoul 120-750, Republic
of Korea
Received: August 29, 2013; Revised: March 3, 2014; Published online: April 30, 2014
Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/adsc.201300784.
Abstract: Biotransformation of long-chain fatty acids putida GPo1 or converted into w-aminocarboxylic
into medium-chain a,w-dicarboxylic acids or w-ami- acids by a serial combination of ADH from P. putida
nocarboxylic acids could be achieved with biocata- GPo1 and an w-transaminase of Silicibacter pomer-
lysts. This study presents the production of a,w-dicar- oyi. The double bonds present in the fatty acids such
boxylic acids (e.g., C9, C11, C12, C13) and w-aminocar- as ricinoleic acid and lesquerolic acid were reduced
boxylic acids (e.g., C11, C12, C13) directly from fatty by E. coli-native enzymes during the biotransforma-
acids (e.g., oleic acid, ricinoleic acid, lesquerolic tions. This study demonstrates that the industrially
acid) using recombinant Escherichia coli-based bio- relevant building blocks (C9 to C13 saturated a,w-di-
catalysts. w-Hydroxycarboxylic acids, which were carboxylic acids and w-aminocarboxylic acids) can
produced from oxidative cleavage of fatty acids via be produced from renewable fatty acids using bioca-
enzymatic reactions involving a fatty acid double talysis.
bond hydratase, an alcohol dehydrogenase,
a Baeyer–Villiger monooxygenase and an esterase,
were then oxidized to a,w-dicarboxylic acids by alco- Keywords: amination; carboxylic acids; enzyme cat-
hol dehydrogenase (ADH, AlkJ) from Pseudomonas alysis; fatty acids; oxidation
Introduction
and w-aminocarboxylic acids are widely used for the
production of various chemical products and inter-
The huge demand for fuels and plastics has stimulated mediates, such as nylons and other polyamides, poly-
the development of sustainable processes for the pro- esters, resins, hot-melt adhesives, powder coatings,
duction of biofuels and bioplastics. Low molecular corrosion inhibitors, lubricants, plasticizers, greases,
weight biofuels and bioplastic monomers (e.g., etha- and perfumes,[7,9–11] the commercial processes are ex-
nol, butanol, 1,3-propanediol, lactic acid, succinic posed to harsh reaction conditions that require high
acid) can now be produced on a large scale in an en- temperature and pressure, strong acids (e.g., H2SO4,
vironmentally friendly way.[1–4] However, it is still dif- HNO3), and/or toxic oxidants (e.g., ozone).
ficult to produce medium to large molecular weight
A number of emerging ideas to tackle the problems
chemicals (e.g., azelaic acid, brassyllic acid, 11-amino- in producing such chemicals have been report-
undecanoic acid) using a green process.[5,6] Azelaic ed.[8,10,12–17] 11-Aminoundecanoic acid has been synthe-
acid and brassyllic acid are produced from oleic acid sized from vernolic (cis-12,13-epoxy-cis-9-octadeceno-
and erucic acid, respectively, via ozonolysis.[5,7] 11- ic) acid via a reaction sequence that includes the for-
Aminoundecanoic acid, which is a monomer of mation of 12-oxododecanoic acid oxime.[8] Sebacic
Nylon-11, is mostly produced from castor oil via an acid and azelaic acid were produced from hydrocar-
energy-intensive pyrolysis (450–5008C) reaction.[8] Al- bons via fermentation of Candida tropicalis.[10] How-
though these medium-chain a,w-dicarboxylic acids ever, these processes can be constrained by the limita-
1782
ꢀ 2014 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Adv. Synth. Catal. 2014, 356, 1782 – 1788

FULL PAPERS
Microbial Synthesis of Medium-Chain a,w-Dicarboxylic Acids
Scheme 1. Designed biotransformation pathway. 12-Hydroxystearic acid (1) is converted into w-hydroxyundecanoic acid (4)
and n-heptanoic acid (5) by an alcohol dehydrogenase, a Baeyer–Villiger monooxygenase, and an esterase. w-Hydroxyunde-
canoic acid (4) is oxidized into 1,11-undecanedioic acid (7) by the AlkJ from P. putida GPo1. Otherwise, it is converted into
11-aminoundecanoic acid (8) via the tandem reactions catalyzed by the AlkJ and w-transaminases. Q=ubiquinone.
tions in the availability of the substrates used and/or were produced from fatty acids via multi-step enzy-
low product yields.
matic reactions as reported in our earlier studies,[18]
Renewable fatty acids such as oleic acid, ricinoleic were oxidized to a,w-dicarboxylic acids by alcohol de-
acid, and lesquerolic acid were recently reported to hydrogenase (ADH, AlkJ) from P. putida GPo1 or
be enzymatically cleaved into C9 to C13 and C7 to C9 converted into w-aminocarboxylic acids by the combi-
carboxylic acids.[18] For instance, oleic acid was enzy- nation of ADH from P. putida GPo1 and an w-trans-
matically cleaved resulting in a production of 9-hy-
ACHTUNGTRENaNUNG minase from Silicibacter pomeroyi expressed in
droxynonanoic acid and n-nonanoic acid without for- a single whole-cell catalyst (Scheme 1).
mation of by-products under mild reaction conditions.
Another innovative study was able to produce 12-
aminododecanoic acid from dodecanoic acid methyl Results and Discussion
ester via 12-hydroxydodecanoic acid methyl ester and
12-oxododecanoic acid methyl ester.[19] The first two Biosynthesis of a,w-Dicarboxylic Acids
reactions were catalyzed by the alkane hydroxylase
AlkBGT from Pseudomonas putida GPo1 and the last A representative example was the production of 1,11-
step was driven by an w-transaminase from Chromo- undecanedioic acid (7) from 12-hydroxystearic acid
bacterium violaceum.
In this study, a biocatalytic process was designed acid (4) and n-heptanoic acid (5) by the recombinant
and evaluated to produce medium-chain a,w-dicar- Escherichia coli BL21(DE3) pACYC-ADH-BVMO,
(1). Acid 1 was cleaved into 11-hydroxyundecanoic
AHCTUNGTRENNUNG
boxylic acids (e.g., C9, C11, C12, C13) and w-aminocar- pCOLA-PFEI expressing the ADH from Micrococcus
boxylic acids (e.g., C11, C12, C13) directly from long- luteus NCTC2665, the Baeyer–Villiger monooxyge-
chain fatty acids (e.g., oleic acid, ricinoleic acid, les- nase (BVMO) from P. putida KT2440, and the ester-
querolic acid). w-Hydroxycarboxylic acids, which ase from P. fluorescens SIK WI, as reported previous-
Adv. Synth. Catal. 2014, 356, 1782 – 1788
ꢀ 2014 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
asc.wiley-vch.de
1783

FULL PAPERS
Ji-Won Song et al.
dioic acid (7) (see the Supporting Information, Fig-
ure S1.1). The final product concentration reached
3.6 mM in the reaction medium, indicating that 72%
of the starting material was transformed into the
diacid. The target product was purified via solvent ex-
traction, concentration via evaporation, and crystalli-
zation resulting in an isolated yield of 34% with
a purity of 85% (see the Supporting Information, Fig-
ure S1.2). This rather low isolated yield (34%) com-
pared to the bioconversion (72%) was due to low re-
covery of the target product from the reaction
medium, which contained large amounts of impurities
[e.g., 3.8 mM n-heptanoic acid (5), 0.1 mM oleic acid,
0.4 mM stearic acid (see the Supporting Information,
Figure S1.1)]. The product loss occurred during re-
moval of the impurities via washing with hexane (see
the Experimental Section for details). Overall, the
biotransformation result supports that the AlkJ
indeed catalyzes oxidation of the w-hydroxy group of
alkanoic acids into the corresponding aldehydes.
Figure 1. Time course of the biotransformation of 12-hy-
droxystearic acid (1) into 1,11-undecanedioic acid (7). 11-
Hydroxyundecanoic acid (4) was produced by the recombi-
nant E. coli BL21ACHTNUGRTENUNG(DE3), expressing the ADH from M.
luteus, the BVMO from Ps. putida KT2440, and the esterase
from P. fluorescens SIK WI (left side from the dotted line).
Biotransformations of 12-hydroxydodecanoic acid,
10-hydroxystearic acid, oleic acid, ricinoleic acid (12-
11-Hydroxyundecanoic acid (4) was converted into 1,11-un- hydroxyoleic acid), and lesquerolic acid [(11Z,14R)-
decanedioic acid (7) by adding the recombinant E. coli
BL21(DE3) expressing the AlkJ from P. putida GPo1 into
14-hydroxyicos-11-enoic acid] into n-alkanoic acids
and a,w-dicarboxylic acids were also performed using
a similar protocol. In the case of oleic acid biotrans-
formation, a fatty acid double bond hydratase was es-
sential to introduce the hydroxy group into the
carbon skeleton. Thereby, the first step in the bio-
transformation was hydratation of oleic acid to yield
ACHTUNGTRENNUNG
the reaction medium (right side from the dotted line). The
symbols indicate concentration of 12-hydroxystearic acid (1)
~
!
&
( ), 12-ketostearic acid (2) ( ), 3 ( ), w-hydroxyundeanoic
~
*
acid (4) ( ), and 1,11-undecanedioic acid (7) ( ).
ly[20] (Scheme 1, Figure 1). 11-Hydroxyundecanoic 10-hydroxystearic acid catalyzed by the oleate hydra-
acid (4) was then oxidized by the recombinant E. coli tase from S. maltophilia.[21] The biotransformations
BL21ACHTUNGTRENNUNG(DE3) pCOLA-PFEI-AlkJ expressing the ester- exhibited reaction dynamics similar to those of the
ase from P. fluorescens SIK WI and the AlkJ from P. biotransformation of 12-hydroxystearic acid. Interest-
putida GPo1 leading to formation of 1,11-undecane- ingly, 1,11-undecanedioic acid (7) and 1,13-tridecane-
Table 1. a,w-Dicarboxylic acids accessible via the multistep biocatalysis.
Starting material
Final products
Product yield [%][a]
12-hydroxydodecanoic acid[b]
10-hydroxystearic acid
12-hydroxystearic acid
oleic acid[d]
ricinoleic acid
lesquerolic acid
1,12-dodecanedioic acid
1,9-nonanedioic acid
1,11-undecanedioic acid
1,9-nonanedioic acid
1,11-undecanedioic acid
1,13-tridecanedioic acid
62Æ5 (46)[c]
48Æ4 (22)[c]
72Æ5 (34)[c]
46Æ4 (21)[c]
51Æ4 (21)[c]
20Æ2
[a]
The product yield was calculated based on the substrate depletion and the product concentration determined by GC/MS
(Supporting Information, Figure S1). The starting material (5.0 mM) was added to Tris-HCl buffer (pH 8.0, 50 mM) con-
taining 7.2 g dry cellsLÀ1 of recombinant E. coli, expressing the ADH from M. luteus, the BVMO from Ps. putida
KT2440, and the esterase from P. fluorescens SIK WI. Two hours after the biotransformation, 7.2 g dry cellsLÀ1 of the re-
combinant E. coli BL21 expressing the AlkJ from P. putida GPo1 was added into the reaction medium. The experiments
were carried out in duplicate while the ricinoleic acid biotransformation was conducted in triplicate.
The recombinant E. coli BL21 expressing the AlkJ from P. putida GPo1 was added into the reaction medium to 7.2 g dry
cellsLÀ1.
The numbers in parenthesis indicate the isolated yield of the target products, which was calculated on the basis of the
amount of substrate added and amount of product isolated after preparative scale biotransformation.
The oleate hydratase from S. maltophilia[21] was added to 5 UmLÀ1 in the reaction medium 1 h before initiation of bio-
transformation.
[b]
[c]
[d]
1784
asc.wiley-vch.de
ꢀ 2014 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Adv. Synth. Catal. 2014, 356, 1782 – 1788

FULL PAPERS
Microbial Synthesis of Medium-Chain a,w-Dicarboxylic Acids
dioic acid were produced from ricinoleic acid and les-
querolic acid, respectively, via 11-hydroxyundec-9-
enoic acid and 13-hydroxytridec-11-enoic acid
(Table 1). The cis-double bond of the compounds
must have been reduced by E. coli-native enzymes
during oxidation of the w-hydroxy group into the car-
boxyl group (see the Supporting Information, Fig-
ures S1.3 to S1.6). The rather low isolated yields com-
pared to the bioconversion data were due to difficul-
ties in the recovery of the target products from the re-
action medium. The product loss occurred during re-
moval of the impurities, present in the reaction
medium. These include n-heptanoic acid, which was
produced from the cleavage reaction of ricinoleic
acid, and n-nonanoic acid, which was produced in the
cleavage reaction from 10-hyroxystearic acid and
oleic acid. Oleic acid, linoleic acid, and stearic acid,
which were already present in the starting materials
also contributed to the impurities.
Figure 2. Time course of the biotransformation of 12-hy-
droxydodecanoic acid into 12-aminododecanoic acid by the
recombinant E. coli BL21, expressing the AlkJ from P.
putida GPo1 and the w-transaminase of S. pomeroyi. The
symbols indicate concentration of 12-hydroxydodecanoic
~
*
acid ( ), 1,12-dodecanedioic acid ( ), and 12-aminododeca-
noic acid (&).
Biosynthesis of w-Aminocarboxylic Acids
Amination of w-hydroxycarboxylic acids into w-ami-
nocarboxylic acids was examined next. This was ex-
ploited with serial combinations of AlkJ from P. to 12-ADA by the w-transaminase. Overexpression
putida GPo1 and w-transaminases from S. pomeroyi, and thus high activity of the cytosolic w-transaminase
Rhodococcus sphaeroides, Mesorhizobium loti, or Sili- compared to the membrane-associated AlkJ[23] in the
cibacter sp. (Scheme 1), which were reported to cata- E. coli cells (see the Supporting Information, Fig-
lyze the conversion of short-chain w-oxocarboxylic ure S2) seemed to allow more substrate (i.e., 12-oxo-
acids into w-aminocarboxylic acids (e.g., conversion dodecanoic acid) to be directed to the amination.
of succinic semialdehyde into g-aminobutyric acid) in
the presence of alanine as an amino donor.[22] The nant E. coli BL21
first example was the biotransformation of 12-hy- w-transaminase from R. sphaeroides, M. loti, or Silici-
droxydodecanoic acid (12-HDA) into 12-aminodode- bacter sp. showed reaction dynamics similar to those
The biotransformations of 12-HDA by the recombi-
AHCTUNGTRENNUNG
A
ACHTUNGTRENNUNG
canoic acid (12-ADA), which is a monomer of poly- of the w-transaminase from S. pomeroyi. However,
amide 12. In this reaction 4 mM 12-HDA was convert- the 12-ADA concentration in the reaction medium
ed into 2.6 mM 12-ADA and 0.8 mM 1,12-dodecane- varied, indicating differences in the catalytic activity
dioic acid (DDA) in the presence of 10 mM l-alanine of the w-transaminases for this substrate (Table 2).
by the recombinant E. coli BL21
G
12-Hydroxystearic acid (1), ricinoleic acid, and les-
AlkJ from P. putida GPo1 and the w-transaminase of querolic acid were subjected to an oxidative cleavage
S. pomeroyi (Figure 2) (see the Supporting Informa- followed by oxidation and amination with AlkJ and
tion, Figures S2 and S3.1). DDA was first purified via w-transaminase from S. pomeroyi, respectively. 11-Hy-
solvent extraction, concentration via evaporation, and droxyundecanoic acid (4), which had been produced
crystallization as done for the isolation of 1,11-unde- from 12-hydroxystearic acid (1) as in Figure 1, was
canedioic acid described above. 12-ADA was purified converted into 11-aminoundecanoic acid (8) via 11-
after recovery of DDA from the reaction medium; oxoundcecanoic acid (6) (Figure 3) (see the Support-
the aqueous phase remaining after solvent extraction ing Information, Figure S3.3). The final product accu-
of the diacid was concentrated via evaporation under mulated in the reaction medium to 2.5 mM to a rate
vacuum leading to the formation of solids including of 11.6 mmolg dry cellsÀ1 minÀ1. The concentration of
12-ADA. The resulting product was washed with the by-product 1,11-undecanedioic acid (7) remained
water to give a purity of ca. 80%. Finally, the w-ami- below 0.7 mM. 11-Aminoundecanoic acid was isolated
nocarboxylic acid was isolated in a yield of 43% (see in a yield of 36% (Table 3) (see the Supporting Infor-
the Supporting Information, Figure S3.2). Overall, mation, Figure S3.4).
these results indicate that 12-HDA was first converted
The biotransformations of lesquerolic acid and rici-
into 12-oxododecanoic acid, which was in turn oxi- noleic acid exhibited reaction profiles similar to that
dized to DDA by the AlkJ or subjected to amination of 12-hydroxystearic acid. The cis-double bond was
Adv. Synth. Catal. 2014, 356, 1782 – 1788
ꢀ 2014 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
asc.wiley-vch.de
1785

FULL PAPERS
Ji-Won Song et al.
Table 2. Production of 12-aminododecanoic acid with AlkJ
and w-transaminases[a]
Conclusions
.
We have demonstrated that AlkJ was able to catalyze
the oxidation of long-chain primary alcohols into the
carboxylic acids via the aldehydes. w-Transaminases
from S. pomeroyi, R. sphaeroides, M. loti, and Silici-
bacter sp. were capable of catalyzing conversion of
long-chain carboxyaldehydes into the corresponding
amines. The combination of the AlkJ and w-transami-
nases with the enzymes involved in fatty acid cleavage
Origin of w-
transaminase
12-aminododecanoic 1,12-dodecanedioic
acid [mM]
acid [mM]
S. pomeroyi
R. sphaeroides
M. loti
2.6Æ0.2
1.7Æ0.1
1.7Æ0.1
1.3Æ0.1
0.8Æ0.06
0.9Æ0.06
0.7Æ0.05
0.5Æ0.04
Silicibacter sp.
[a]
12-Hydroxydodecanoic acid (4.0 mM) was added to Tris-
HCl buffer (pH 9.5, 50 mM) containing 7.2 g dry cellsLÀ1 reactions (i.e., hydratase, ADH, BVMO, esterase) en-
of recombinant E. coli, expressing the AlkJ from P.
putida GPo1 and w-transaminases from various bacteria.
Concentrations of the reaction products were determined
by GC/MS 2 h after biotransformation. The experiments
were carried out in duplicate.
abled the production of medium-chain a,w-dicarbox-
ylic acids (e.g., C9, C11, C12, C13) and w-aminocarbox-
ylic acids (e.g., C11, C12, C13) directly from fatty acids
(e.g., oleic acid, ricinoleic acid, lesquerolic acid).
Experimental Section
Microbial Strains and Culture Media
Recombinant E. coli BL21ACTHNUTRGNE(NUG DE3) was cultivated in Riesen-
berg medium,[24] which was supplemented with 10 gLÀ1 glu-
cose and the appropriate antibiotics for plasmid mainte-
nance (see the Supporting Information, Table S1). The Rie-
senberg medium consisted of 4 gLÀ1 (NH4)2HPO4, 13.5 gLÀ1
KH2PO4, 1.7 gLÀ1 citric acid, 1.4 gLÀ1 MgSO4, and
10 mLLÀ1 trace metal solution [10 gLÀ1 FeSO4, 2.25 gLÀ1
ZnSO4, 1.0 gLÀ1 CuSO4, 0.5 gLÀ1 MnSO4, 0.23 gLÀ1
Na2B4O7, 2.0 gLÀ1 CaCl2, and 0.1 gLÀ1 (NH4)6Mo7O24]. The
recombinant gene expression was induced by adding 0.1 mM
isopropyl b-d-thiogalactopyranoside (IPTG) and/or 2 gLÀ1
rhamnose in the culture medium at an OD600 of 0.5.
Reagents
Ricinoleic acid, oleic acid, palmitic acid, n-heptanoic acid, n-
nonanoic acid, w-hydroxydodecanoic acid, w-hydroxynona-
noic acid, 1,9-nonanedioic acid, 1,11-undecanedioic acid,
1,12-dodecanedioic acid, 1,13-tridecanedioic acid, w-amino-
undecanoic acid, w-aminododecanoic acid, and ethyl acetate
were obtained from Sigma–Aldrich. Lesquerolic acid methyl
ester was purchased from Santa Cruz Biotechnology. 10-Hy-
droxystearic acid, 12-hydroxystearic acid, w-hydroxyundec-
9-enoic acid, and other carboxyl products were purified in
our lab as described earlier.[18]
Figure 3. Time course of the biotransformation of 12-hy-
droxystearic acid (1) into 11-aminoundecanoic acid (8). 11-
Hydroxyundecanoic acid (4) was produced by the recombi-
nant E. coli BL21ACHTNUGRTENUNG(DE3), expressing the ADH from M.
luteus, the BVMO from Ps. putida KT2440, and the esterase
from P. fluorescens SIK WI (left side from the dotted line).
11-Hydroxyundecanoic acid (4) was converted into 11-ami-
noundecanoic acid (8) by adding the recombinant E. coli
BL21, expressing the AlkJ from P. putida GPo1 and the w-
transaminase of S. pomeroyi into the reaction medium (right
side from the dotted line). The symbols indicate concentra-
Gene Cloning
~
tion of 12-hydroxystearic acid (1) ( ), 12-ketostearic acid
The pCOLA-PFE1-AlkJ was constructed by transferring the
alcohol dehydrogenase gene (GenBank accession code:
AJ245436.1) of P. putida GPo1 from the vector pGEc47[25]
into the BamHI-NotI site of the plasmid pCOLA-PFE1.[20]
The PCR primer forward was 5’-GCGCGGATCCGATGTACGAC
!
~
&
(2) ( ), 3 ( ), 11-hydroxyundecanoic acid (4) ( ), 1,11-un-
*
decanedioic acid (7) ( ), and 11-aminoundecanoic acid (8)
(&).
TATATAATCGTT-3’
and
reverse
primer
was
5’-
GCGCGCGGCCGCTTAGTGGTGATGGTGATGATGCATGCAGA
again reduced by E. coli-native enzymes during bioca-
talysis (see the Supporting Information, Figure S3.5
and S3.6). The final product concentration and prod-
uct yield in ricinoleic acid biotransformation were
similar to those of the 12-hydroxystearic acid bio-
transformation (Table 3).
CAGCTAT-3’. All the recombinant DNA manipulations were
conducted as described previously.[26]
1786
asc.wiley-vch.de
ꢀ 2014 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Adv. Synth. Catal. 2014, 356, 1782 – 1788

FULL PAPERS
Microbial Synthesis of Medium-Chain a,w-Dicarboxylic Acids
Table 3. w-Aminocarboxylic acids accessible via the multistep biocatalysis.
Starting material
Final products
Product yield [%][a]
12-hydroxystearic acid
ricinoleic acid
lesquerolic acid
11-aminoundecanoic acid
11-aminoundecanoic acid
13-aminotridecaneoic acid
50Æ4 (36)[b]
51Æ5 (36)[b]
20Æ2
[a]
The product yield was calculated based on the substrate depletion and the product concentration determined by GC/MS
(Supporting Information, Figure S3). The starting material (5.0 mM) was added to Tris-HCl buffer (pH 8.0, 50 mM) con-
taining 7.2 g dry cellsLÀ1 of recombinant E. coli, expressing the ADH from M. luteus, the BVMO from Ps. putida
KT2440, and the esterase from P. fluorescens SIK WI. Two hours after the biotransformation, the pH of the reaction
medium was shifted to 9.5 with NaOH and the recombinant E. coli BL21, expressing the AlkJ from P. putida GPo1 and
the w-transaminase of S. pomeroyi were added. The experiments were carried out in duplicate while the ricinoleic acid
biotransformation was conducted in triplicate.
[b]
The numbers in parenthesis indicate the isolated yield of the target products, which was calculated on a basis of the
amount of substrate added and amount of product isolated after preparative scale biotransformation.
droxyundec-9-enoic acid, w-hydroxytridec-11-enoic acid, w-
aminoundecanoic acid, w-aminododecanoic acid, w-amino-
tridecanoic acid) were determined as described previous-
ly.[18] The reaction medium was mixed with an equal volume
of ethyl acetate containing 2 or 5 gLÀ1 palmitic acid as an
internal standard. The organic phase was harvested after
vigorous vortexing and then subjected to derivatization with
N-methyl-N-(trimethylsilyl)trifluoroacetamide (TMS). The
TMS derivatives were analyzed using a Thermo Ultra Trace
GC system connected to an ion trap mass detector (Thermo
ITQ1100 GC-ion Trap MS, Thermo Scientific). The deriva-
tives were separated on a non-polar capillary column (30 m
length, 0.25 mm film thickness, HP-5MS, Agilent). A linear
temperature gradient was programmed as follows; 908C,
158C minÀ1 to 2008C; 2008C, 58C minÀ1 to 2508C or 908C,
158C minÀ1 to 2008C; 2008C, 5 8C minÀ1 to 2808C. The
inject port temperature was 2308C. Mass spectra were ob-
tained by electron impact ionization at 70 eV. Scan spectra
were obtained within the range of 100–600 m/z. Selected ion
monitoring (SIM) was used for the detection and fragmenta-
tion analysis of the reaction products.
Whole Cell Biotransformations
Biotransformations with E. coli cells were carried out on the
basis of our earlier work.[18] Briefly, the recombinant E. coli
cells were cultivated in Riesenberg medium at 308C and ex-
pressions of target genes were induced with 0.1 mM IPTG
and/or 2.0 gLÀ1 rhamnose at an OD600nm of 0.5. Afterwards,
cultivation temperature was reduced to 208C to facilitate
soluble expression of the target genes. When added glucose
was consumed, the recombinant cells were harvested by cen-
trifugation at 3,500 g for 15 min at 48C and used as biocata-
lysts. The biotransformation was initiated by adding 5 mM
of a fatty acid into 50 mM Tris-HCl buffer (pH 8.0) contain-
ing 0.5 gLÀ1 Tween80 and 7.2 g dry cellsLÀ1 of the recombi-
nant E. coli pACYC-ADH-BVMO, pCOLA-PFEI that ex-
pressed the ADH from M. luteus, the BVMO from Ps.
putida KT2440, and the esterase from P. fluorescens SIK
WI. The biotransformations were conducted in a shaking in-
cubator (358C and 200 rpm). Two hours after the biotrans-
formation, 7.2 g dry cellsLÀ1 of the recombinant E. coli
pCOLA-PFEI-AlkJ, which expressed the AlkJ of P. putida
GPo1, was added into the reaction medium for the produc-
tion of diacids. In case of the biotransformation of oleic
acid, the oleate hydratase of S. maltophilia, which was pre-
pared according to our earlier study,[18] was added to
5 UmLÀ1 in the reaction medium 1 h before initiation of the
biotransformation.
The concentration of biotransformation products in the
reaction medium was determined on a basis of the calibra-
tion curves. The signals from w-aminocarboxylic acids on
GC/MS chromatogram were markedly weaker than a,w-di-
carboxylic acids (see the Supporting Information, Fig-
ure S3). However, linearity of their calibration curves was
acceptable with R2 >0.99 (see the Supporting Information,
Figure S4).
For the production of w-aminocarboxylic acids, w-hydroxy
fatty acids were first produced as described above. Then, the
recombinant E. coli BL21 pCOLA-ADH-AlkJ, pET-3HMU,
expressing the AlkJ of P. putida GPo1 and w-transACTHNUGRTNEUNGaminase
of S. pomeroyi, and 10 mM alanine as the amino donor were
added into the reaction medium after adjustment of the re-
action pH from 8.0 to 9.5 with NaOH. The reaction medium
was incubated in a shaking incubator at 200 rpm and 358C.
One unit (U) of whole cell activity refers to 1 mmol of prod-
ucts formed per minute at 358C by 1.0 g dry cells.
Identification of the Biotransformation Products
The fatty acid derivatives were identified via GC/MS analy-
sis, as done in our previous study.[18] For instance, 1,9-nona-
nedioic acid, 1,11-undecanedioic acid, 1,12-dodecanedioic
acid, 1,13-tridecanedioic acid, w-aminoundecanoic acid, and
w-aminododecanoic acid were identified by comparison to
the authentic reference compounds (see the Supporting In-
formation, Figures S1 and S3). The w-aminotridecanoic acid
was identified on a basis of the GC/MS analysis data of the
authentic compounds w-aminoundecanoic acid and w-ami-
nododecanoic acid, which have the same functional group in
the fatty acid skeleton (see the Supporting Information, Fig-
ure S4).
Product Analysis by GC/MS
Concentrations of remaining fatty acids and accumulating
carboxylic acids in the medium (i.e., n-heptanoic acid, n-
nonanoic acid, 1,9-nonanedioic acid, 1,11-undecanedioic
acid, 1,12-dodecanedioic acid, 1,13-tridecanedioic acid, w-
hydroxynonanoic acid, w-hydroxyundecanoic acid, w-hy-
Adv. Synth. Catal. 2014, 356, 1782 – 1788
ꢀ 2014 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
asc.wiley-vch.de
1787

FULL PAPERS
Ji-Won Song et al.
[6] S. Huf, S. Krugener, T. Hirth, S. Rupp, S. Zibek, Eur. J.
Lipid Sci. Technol. 2011, 113, 548–561.
[7] A. Kockritz, A. Martin, Eur. J. Lipid Sci. Technol.
Isolation of the Biotransformation Products
The a,w-dicarboxylic acids were isolated via extraction with
ethyl acetate, concentration via evaporation, and crystalliza-
tion; the biotransformation products were extracted with
ethyl acetate three times. The extract was dried over MgSO4
and concentrated via evaporation under vacuum. The con-
centrate was subjected to crystallization at À708C. The
solids were isolated by centrifugation at 3,500 g for 20 min
and impurities (e.g., n-alkanoic acids coproduced during bio-
transformations, long-chain fatty acids originating from the
starting materials) were removed by washing with hexane
until the purity reached over 80%.
The w-aminocarboxylic acids were isolated after recovery
of the diacids coproduced during biotransformations. The
first step was to reduce pH of the reaction medium to pH 2
to increase solubility of w-aminocarboxylic acids, which was
followed by extraction of fatty acids including diacids with
ethyl acetate. Then, cell mass was removed by centrifugation
at 3,500 g for 5 min. The remaining aqueous phase (100 mL)
containing ca. 2.5 mM products was concentrated and dried
via evaporation under vacuum. The resulting solids contain-
ing the target product and the reaction buffer salt (i.e., Tris)
were washed with water until the product purity reached
over 70%. The washing and drying step was conducted usu-
ally twice with 5 mL and 2 mL water each.
2011, 113, 83–91.
[8] F. O. Ayorinde, E. Y. Nana, P. D. Nicely, A. S. Woods,
E. O. Price, C. P. Nwaonicha, J. Am. Oil Chem. Soc.
1997, 74, 531–538.
[9] F. Zhang, C. H. Huang, T. W. Xu, Ind. Eng. Chem. Res.
2009, 48, 7482–7488.
[10] K. Kroha, Inform – Champaign 2004, 15, 568–571.
[11] Y. Suzuki, O. Kurita, Y. Kono, H. Hyakutake, A. Sakur-
ai, Biochem. Biotechnol. Biochem. 1995, 59, 2049–2051.
[12] W. H. Lu, J. E. Ness, W. C. Xie, X. Y. Zhang, J. Min-
shull, R. A. Gross, J. Am. Chem. Soc. 2010, 132, 15451–
15455.
[13] E. J. Steen, Y. S. Kang, G. Bokinsky, Z. H. Hu, A.
Schirmer, A. McClure, S. B. del Cardayre, J. D. Keas-
ling, Nature 2010, 463, 559–562.
[14] U. Biermann, U. Bornscheuer, M. A. R. Meier, J. O.
Metzger, H. J. Schafer, Angew. Chem. 2011, 123, 3938–
3956; Angew. Chem. Int. Ed. 2011, 50, 3854–3871.
[15] J. O. Metzger, Eur. J. Lipid Sci.Technol. 2009, 111, 865–
876.
[16] E.-Y. Jeon, J.-H. Lee, K.-M. Yang, Y.-C. Joo, D. K. Oh,
J.-B. Park, Process Biochem. 2012, 47, 941–947.
[17] J. Y. Kim, Y. A. Lee, C. Wittmann, J. B. Park, Biotech-
nol. Bioeng. 2013, 110, 2846–2855.
[18] J.-W. Song, E.-Y. Jeon, D.-H. Song, H.-Y. Jang, U. T.
Bornscheuer, D.-K. Oh, J.-B. Park, Angew. Chem. 2013,
125, 2594–2597; Angew. Chem. Int. Ed. 2013, 52, 2534–
2537.
Acknowledgements
This study was supported by the Marine Biomaterials Re-
search Center grant from Marine Biotechnology Program
funded by the Ministry of Marine Affairs and Fisheries,
Korea. UTB thanks Matthias Hçhne and Steffen Fabian-
Munsberg (Greifswald University) for useful discussions.
[19] M. Schrewe, N. Ladkau, B. Bꢁhler, A. Schmid, Adv.
Synth. Catal. 2013, 355, 1693–1697.
[20] H.-Y. Jang, E.-Y. Jeon, A.-H. Baek, S.-M. Lee, J.-B.
Park, Process Biochem. 2014, 49, 617–622.
[21] Y.-C. Joo, E.-S. Seo, Y.-S. Kim, K.-R. Kim, J.-B. Park,
D.-K. Oh, J. Biotechnol. 2012, 158, 17–23.
[22] F. Steffen-Munsberg, C. Vickers, A. Thontowi, S. Schat-
zle, T. Meinhardt, M. S. Humble, H. Land, P. Berglund,
U. T. Bornscheuer, M. Hohne, Chemcatchem 2013, 5,
154–157.
References
[1] J. B. McKinlay, C. Vieille, J. G. Zeikus, Appl. Microbiol.
Biotechnol. 2007, 76, 727–740.
[23] J. B. van Beilen, G. Eggink, H. Enequist, R. Bos, B.
Witholt, Mol. Microbiol. 1992, 6, 3121–3136.
[24] D. Riesenberg, Curr. Opin. Biotechnol. 1991, 2, 380–
384.
[2] U. T. Bornscheuer, G. W. Huisman, R. J. Kazlauskas, S.
Lutz, J. C. Moore, K. Robins, Nature 2012, 485, 185–
194.
[3] Y. S. Jang, A. Malaviya, C. Cho, J. Lee, S. Y. Lee,
Biores. Technol. 2012, 123, 653–663.
[4] M. T. Reetz, J. Am. Chem. Soc. 2013, DOI: 10.1021/
ja405051f.
[5] U. Schorken, P. Kempers, Eur. J. Lipid Sci. Technol.
2009, 111, 627–645.
[25] S. A. Rothen, M. Sauer, B. Sonnleitner, B. Witholt, Bio-
technol. Bioeng. 1998, 58, 92–100.
[26] J. Sambrook, R. W. Russell, Molecular cloning: a labo-
ratory manual, 3rdedn., Cold Spring Harbor Laboratory
Press, Cold Spring, NY, 2001.
1788
asc.wiley-vch.de
ꢀ 2014 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Adv. Synth. Catal. 2014, 356, 1782 – 1788