Probing mammalian spermine oxidase enzyme-substrate complex through molecular modeling, site-directed mutagenesis and biochemical characterization

Article abstract of DOI:10.1007/s00726-010-0735-8

Spermine oxidase (SMO) and acetylpolyamine oxidase (APAO) are FAD-dependent enzymes that are involved in the highly regulated pathways of polyamine biosynthesis and degradation. Polyamine content is strictly related to cell growth, and dysfunctions in polyamine metabolism have been linked with cancer. Specific inhibitors of SMO and APAO would allow analyzing the precise role of these enzymes in polyamine metabolism and related pathologies. However, none of the available polyamine oxidase inhibitors displays the desired characteristics of selective affinity and specificity. In addition, repeated efforts to obtain structural details at the atomic level on these two enzymes have all failed. In the present study, in an effort to better understand structure-function relationships, SMO enzyme-substrate complex has been probed through a combination of molecular modeling, site-directed mutagenesis and biochemical studies. Results obtained indicate that SMO binds spermine in a similar conformation as that observed in the yeast polyamine oxidase FMS1-spermine complex and demonstrate a major role for residues His82 and Lys367 in substrate binding and catalysis. In addition, the SMO enzyme-substrate complex highlights the presence of an active site pocket with highly polar characteristics, which may explain the different substrate specificity of SMO with respect to APAO and provide the basis for the design of specific inhibitors for SMO and APAO.

Full text of DOI:10.1007/s00726-010-0735-8

Amino Acids (2011) 40:1115–1126
DOI 10.1007/s00726-010-0735-8
ORIGINAL ARTICLE
Probing mammalian spermine oxidase enzyme–substrate complex
through molecular modeling, site-directed mutagenesis
and biochemical characterization
•
Paraskevi Tavladoraki Manuela Cervelli Fabrizio Antonangeli
•
•
•
•
•
•
Giovanni Minervini Pasquale Stano Rodolfo Federico Paolo Mariottini
Fabio Polticelli
Received: 14 July 2010 / Accepted: 26 August 2010 / Published online: 14 September 2010
Ó Springer-Verlag 2010
Abstract Spermine oxidase (SMO) and acetylpolyamine
oxidase (APAO) are FAD-dependent enzymes that are
involved in the highly regulated pathways of polyamine
biosynthesis and degradation. Polyamine content is strictly
related to cell growth, and dysfunctions in polyamine
metabolism have been linked with cancer. Specific inhib-
itors of SMO and APAO would allow analyzing the precise
role of these enzymes in polyamine metabolism and related
pathologies. However, none of the available polyamine
oxidase inhibitors displays the desired characteristics of
selective affinity and specificity. In addition, repeated
efforts to obtain structural details at the atomic level on
these two enzymes have all failed. In the present study, in
an effort to better understand structure–function relation-
ships, SMO enzyme–substrate complex has been probed
through a combination of molecular modeling, site-directed
mutagenesis and biochemical studies. Results obtained
indicate that SMO binds spermine in a similar conforma-
tion as that observed in the yeast polyamine oxidase
FMS1-spermine complex and demonstrate a major role for
residues His82 and Lys367 in substrate binding and
catalysis. In addition, the SMO enzyme–substrate complex
highlights the presence of an active site pocket with highly
polar characteristics, which may explain the different
substrate specificity of SMO with respect to APAO and
provide the basis for the design of specific inhibitors for
SMO and APAO.
Keywords Polyamines ꢀ Spermine oxidase ꢀ
Molecular modeling ꢀ Site-directed mutagenesis ꢀ
Enzyme–substrate complex
Introduction
The natural polyamines (PAs), putrescine (PUT), spermidine
(SPD) and spermine (SPM), are ubiquitous, low molecular
weight, aliphatic cations found in all eukaryotic cells (Pegg
2009; Cohen 1998; Wallace et al. 2003). The molecular
functions of PAs involve reversible electrostatic interactions
with nucleic acids, affecting chromatin status and gene
expression, proteins, membranes and ion channels.
Polyamines affect cell growth, differentiation and
apoptosis (Pegg 2009; Schipper et al. 2000; Thomas and
Thomas 2001). Cells finely regulate the synthesis of PAs
from precursors and PAs uptake from the diet, as well as
inter-conversion, degradation and efflux (Persson 2009;
Wallace et al. 2003). PA catabolism is dependent on
the activity of spermidine/spermine N1-acetyltransferase,
which transfers acetyl groups from acetyl-coenzyme A to
the N1 position of either SPD (to produce N1Ac-SPD) or
SPM (to produce N1Ac-SPM). N1Ac-SPD and N1Ac-SPM
can be oxidized by the peroxisomal FAD-dependent
enzyme N1-acetylpolyamine oxidase (APAO) to produce,
respectively, 1,3-diaminopropane and SPD, 3-aceto-am-
inopropanal and H2O2. SPM can be also directly oxidized
by spermine oxidase (SMO, first cloned by Wang et al.
(2001) and originally named PAOh1), a flavoprotein of the
polyamine oxidase family, which specifically recognizes
P. Tavladoraki and M. Cervelli contributed equally to this work.
Electronic supplementary material The online version of this
article (doi:10.1007/s00726-010-0735-8) contains supplementary
material, which is available to authorized users.
P. Tavladoraki ꢀ M. Cervelli ꢀ F. Antonangeli ꢀ G. Minervini ꢀ
P. Stano ꢀ R. Federico ꢀ P. Mariottini ꢀ F. Polticelli (&)
Department of Biology, University Roma Tre, Viale Guglielmo
Marconi 446, 00146 Rome, Italy
e-mail: polticel@uniroma3.it
123

1116
P. Tavladoraki et al.
Fig. 1 Substrate oxidation mode in PAOs. APAO oxidizes the carbon
on the exo side of the N5-nitrogens of N1Ac-SPD and N1Ac-SPM
producing 1,3-diaminopropane (DAP) and SPD, respectively, in
addition to 3-aceto-aminopropanal and H2O2 (a and b bottom
reactions). SMO oxidizes the carbon on the exo side of the
N5-nitrogen of SPM producing SPD, 3-aminopropanal (3AP) and
H2O2 (a bottom reaction). ZmPAO oxidizes the carbon on the endo
side of the N5-nitrogens of SPD and SPM producing 4-aminobutyr-
aldehyde (4AB) and 3-(aminopropyl)-4-aminobutyraldehyde (AP-
4AB), respectively, in addition to 1,3-diaminopropane (DAP) and
H2O2 (a and b top reaction). FMS1 oxidizes the carbon on the exo
side of the N5-nitrogens of SPM, N1Ac-SPM and N1Ac-SPD (but not
SPD) (a and b bottom reactions)
SPM as a substrate and produces SPD, 3-aminopropanal
and H2O2 (Wang et al. 2001; Cervelli et al. 2003; Vujcic
et al. 2002; Fig. 1).
Several inhibitors of SMO and APAO have been
studied, the most prominent example being MDL 72527
(N1,N4-bis(2,3-butadienyl)-1,4-butanediamine), which inhi-
bits FAD-containing polyamine oxidases (Bellelli et al.
2004; Bey et al. 1985; Bianchi et al. 2006; Wu et al. 2005).
However, MDL 72527 does not show any selectivity
between SMO and APAO (Bianchi et al. 2006), and
inhibitors with strict selectivity for either SMO or APAO
are not known (Bianchi et al. 2006).
Polyamines content is strictly related to cell growth, and
dysfunctions in PAs metabolism have been linked with
cancer (Casero and Pegg 2009; Gerner and Meyskens
2004; Thomas and Thomas 2003). Nowadays, the impor-
tance of the PA catabolic pathway in cancer therapeutics
has been re-evaluated, as it has been shown to be involved
in determining the cell response to PA analogs with anti-
tumor activity (Amendola et al. 2009; Casero and Marton
2007; Casero et al. 2003; Pledgie et al. 2005). Thus,
interest has been growing regarding the precise physio-
logical role of the mammalian catabolic enzymes SMO and
APAO. For instance, increasing evidences indicate that
induction of SMO expression by inflammation or infectious
agents has the potential to produce sufficient reactive
oxygen species (ROS) in normal cells to potentially lead
to carcinogenesis transformation (Babbar et al. 2007;
Chaturvedi et al. 2004). In line with these assumptions, it
has been observed that tissue from patients diagnosed with
prostate cancer display locally increased SMO expression
levels in the region of prostatic disease as compared to
healthy individuals (Goodwin et al. 2008).
In addition, from a structural viewpoint, no experimental
data at the atomic level are available for SMO and APAO,
which greatly hinders our ability to develop selective
inhibitors needed to investigate in deeper detail the phys-
iological role of these two enzymes. Atomic resolution
three-dimensional structures are available only for two
members of the polyamine oxidase family, namely the Zea
mays polyamine oxidase (ZmPAO; Binda et al. 2001,
1999) and the yeast enzyme FMS1 (Huang et al. 2005).
The two enzymes share the typical fold of FAD-dependent
amine oxidases, characterized by an FAD binding domain
and a substrate binding domain, whose contact interface
defines the catalytic site (Binda et al. 1999). Interestingly,
these two enzymes differ in substrate specificity and oxi-
dation mode. In fact ZmPAO oxidizes the carbon on the
123

Probing spermine oxidase enzyme–substrate complex
1117
endo-side of the N5-nitrogens of SPD and SPM producing
4-aminobutyraldehyde and 3-(aminopropyl)-4-aminobu-
tyraldehyde, respectively, in addition to 1,3-diaminopro-
pane and H2O2 (Binda et al. 1999; Polticelli et al. 2005;
Fig. 1). FMS1 oxidizes the carbon on the exo side of the
N5-nitrogens of SPM, N1Ac-SPM, N1Ac-SPD and N8Ac-
SPD (but not SPD; Landry and Sternglanz 2003). In the
latter case, the products of SPM oxidation are SPD,
3-aminopropanal and H2O2 (Fig. 1). Thus, FMS1 mode of
substrate oxidation is the same as observed for APAO and
SMO (Wang et al. 2001; Cervelli et al. 2003; Vujcic et al.
2002; Wu et al. 2003).
of ZmPAO (PDB code 1B5Q) (Binda et al. 1999) as a
template, and a combined threading/ab initio modeling
approach using the online server I-TASSER (Zhang 2008).
Regarding homology modeling, protein structures dis-
playing significant sequence similarity with MmSMO were
¨
retrieved through two PSI-Blast (Schaffer et al. 2001)
iterations against the PDB-derived sequence database using
the sequence coded NP_663508 as a bait. The lowest
E-value sequence retrieved by PSI-Blast was that of
ZmPAO (E-value of 3 9 10-78). Amino acid sequence
alignment between the template ZmPAO and MmSMO
was then obtained through multiple sequence alignment of
the amino acid sequences of ZmPAO, FMS1 and mam-
malian SMOs using ClustalW (Larkin et al. 2007). This
procedure yielded the alignment shown in Fig. 2. Based on
this alignment, the molecular model of MmSMO was built
using the program NEST (Petrey et al. 2003), a fast model
building program that applies an ‘‘artificial evolution’’
algorithm to construct a model from a given template and
alignment. The NEST option tune 2 was used to refine the
alignment avoiding the unlikely occurrence of insertions
and deletions within template secondary structure ele-
ments. MmSMO molecular model was then stereochemi-
cally regularized through energy minimization in explicit
solvent using CHARMM macromolecular mechanics
package (Brooks et al. 1983), c33b1 version, and the
CHARMM27 parameters and force field (MacKerell et al.
1998). The stereochemical quality of the model was eval-
uated using PROCHECK (Laskowski et al. 1993).
Recently, in our laboratory, the mouse SMO (MmSMO)
cDNA has been cloned and expressed in Escherichia coli
BL21 DE3 cells, and the corresponding enzyme has been
biochemically characterized (Bellelli et al. 2004; Cervelli
et al. 2003). However, repeated attempts from independent
laboratories to obtain protein crystals suitable for X-ray
diffraction studies have been unsuccessful (A. Mattevi,
personal communication; A. Fiorillo and A. Ilari, personal
communication). On the other hand, multiple amino acid
sequence alignment of mammalian SMOs with ZmPAO
and FMS1 highlights a fairly high degree of sequence
similarity (Fig. 2). In detail, MmSMO displays 41%
sequence similarity with ZmPAO and 35% with FMS1. In
addition, many of the residues building up the FMS1 active
site and involved in enzyme–substrate interactions (Huang
et al. 2005) are conserved in MmSMO (see ‘‘Results’’).
This observation, together with the common oxidation
mode of the substrate (oxidation of the carbon on the exo
side of the N5-nitrogens of the substrate), point to similar
structural determinants for substrate binding in FMS1 and
MmSMO.
The MmSMO-SPM complex was built by manually
docking SPM into MmSMO active site in the same con-
formation observed in the crystal structure of the FMS1-
SPM complex. In detail, MmSMO molecular model was
˚
best fitted onto FMS1-SPM complex structure (rmsd 1.64 A
Here, we have extended the study of MmSMO by
probing the enzyme–substrate complex through a multi-
disciplinary approach involving molecular modeling, site-
directed mutagenesis and biochemical studies. Results
presented in this work show that MmSMO binds SPM in a
similar conformation as that observed in the FMS1-SPM
complex and highlight peculiar stereochemical character-
istics of the MmSMO-SPM complex, which could be
exploited for the design of inhibitor molecules selectively
targeted to SMO or APAO.
over 1084 superimposed atoms) and the SPM molecule was
merged with the MmSMO model. The MmSMO complex
has then been stereochemically regularized through energy
minimization in explicit solvent using CHARMM macro-
molecular mechanics package (Brooks et al. 1983;
MacKerell et al. 1998). The structural model of MmSMO–
SPM complex is available in the PMDB database
(http://mi.caspur.it/PMDB/) under the accession number
PM0076222.
DNA methodology and construction of pMnSMO-HT
expression plasmid
Materials and methods
Molecular modeling of MmSMO and MmSMO-SPM
complex
The methods described by Sambrook et al. (1989) were
used for the extraction and manipulation of plasmid DNA
and general DNA in in vitro methods. To clone the murine
cDNA (GenBank accession number BC004831) by PCR
amplification, the full-length cDNA was generated pos-
sessing modified 50 and 30 ends. In particular, the two
Two alternative methods were used to build MmSMO
structural model, a homology modeling approach using the
program NEST (Petrey et al. 2003) and the crystal structure
123

1118
P. Tavladoraki et al.
Fig. 2 Amino acid sequence alignment of ZmPAO, FMS1 and
selected mammalian SMOs and APAOs. Green arrows and pink bars
indicate secondary structure elements (b strands and a helices,
respectively) of ZmPAO. Red stars indicate active site residues.
Sequence blocks are colored according to BLOSUM62 score.
Sequence-specific numbering is given on the right end side of the
figure. The alignment has been obtained using CLUSTALW2 (Larkin
et al. 2007) and visualized using JalView (Waterhouse et al. 2009)
(color figure online)
123

Probing spermine oxidase enzyme–substrate complex
1119
following synthetic oligonucleotides were used to intro-
duce NdeI and XhoI restriction sites at the 50 and 30 ends of
mSMO cDNA: SMO1-DIR, 50-TTTCATATGCAAAGT
TGTGAATCCAG-30 and SMO2-REV, 50-AAATAT TCA
ATGATGATGATGATGATGGGGCCCCTGCTGGAAG
AGG-30, respectively. The amplified PCR product was
restricted by NdeI and XhoI and ligated with the restricted
NdeI/XhoI pET17b vector (Novagen), to obtain the genetic
construct named pMmSMO-HT and containing the mature
form of MmSMO protein joined to COOH-terminal
HisTAG,. The recombinant cDNA construct was sequenced
to check the accuracy of the nucleotide sequence and then
utilized to transform E. coli BL21 DE3 (Novagen) com-
petent cells.
suspension was then centrifuged (10,000g for 10 min at 4°C)
and the cell pellet resuspended in 5 mM imidazole, 0.5 M
NaCl and 20 mM Tris–HCl (pH 7.9), and was sonicated.
After centrifugation (12,000g for 30 min at 4°C), the soluble
cell extract was purified using a slightly modified procedure
of the His-Bind chromatography kit (Novagen). In particu-
lar, the supernatant was applied to a column (3-ml) with Ni2?
cations immobilized on the HisꢀBind resin (Novagen), and
equilibrated with the binding buffer (5 mM imidazole,
0.5 M NaCl, 20 mM Tris–HCl pH 7.9). The column was
washed with binding buffer and then elution was performed
with 200 mM imidazole, 0.5 M NaCl and 20 mM Tris–HCl
of pH 7.9. The SDS/PAGE electrophoretic analysis was
performed on purified recombinant mSMO proteins to assess
the grade of purification.
Site-directed mutagenesis of the SMO recombinant
protein
CD spectroscopy
To make mutants of the SMO protein, site-directed muta-
genesis was carried out on the plasmid pMmSMO-HT
using the QuikChangeTM Site-directed Mutagenesis kit
(Stratagene) and following the manufacturers’ protocol.
The mutagenic primer sequences used (Table 1), available
upon request from the first author, produced the recombi-
nant plasmid pMmSMO-HT-H82Q, pMmSMO-HT-H82E
and pMmSMO-HT-K367M carrying the mutations descri-
bed in the text. The introduction of the mutation was fur-
ther confirmed by sequence analysis.
CD spectra were recorded at 25°C using a Jasco J-600
spectropolarimeter and quartz cells having 0.05 cm path
length. Wild-type and mutant MmSMOs were solubilized in
5 mM sodium phosphate buffer, pH 8.0, at a concentration
of about 0.2 mg/ml. Actual concentrations (*3 lM) were
calculated by means of the 460 nm molar extinction coef-
ficient (e460 = 9,000 M-1cm-1), which accounts for FAD
absorption. Instrumental ellipticity h (mdeg) was converted
into mean residue molar ellipticity [h] (deg cm2/dmolres) by
taking into account the cell path length and the protein
concentration. For each sample, nine CD spectra in the far-
UV region (190–250 nm) were recorded, averaged and
smoothed. Secondary structures were estimated by using
CONTIN, K2D and SELCON3 algorithms provided by
the free software Dicroprot2000 (Deleage and Geourjon
1993).
Expression and purification of MmSMO recombinant
proteins in E. coli cells
The recombinant cDNA constructs pMmSMO-HT-
H82Q, pMmSMO-HT-H82E, pMmSMO-HT-K367M and
pMmSMO-HT-T528Y were used to transform E. coli BL21
DE3 cells. Induction and over-expression were carried out
according to (Cervelli et al. 2004). The E. coli BL21 DE3
cells were harvested by centrifugation (4°C, 10 min,
10,000g), washed with 0.4 culture volume of 30 mM Tris–
HCl (pH 8.0), containing 20% sucrose and 1 mM EDTA,
and incubated for 5–10 min at room temperature. The
Determination of MPAO catalytic parameters
The catalytic parameters (Km and kcat) for the oxidation of
SPMbyrecombinantwild-typeandmutantMmSMOenzymes
were determined by following spectrophotometrically the
formation of a pink adduct (e515 = 2.6 9 104 M-1 cm-1),
Table 1 Primer sequences and
plasmids used in this study
Primer
Sequence
Plasmid
SMOH82Q-F
SMOH82Q-R
SMOH82E-F
SMOH82E-R
SMOK367M-F
SMOK367M-R
SMOS528Y-F
SMOT528Y-R
50-AGCCACCTGGATCCAGGGATCCCACGGGAAT-30
50-ATTCCCGTGGGATCCCTGGATCCAGGTGGCT-30
50-AGCCACCTGGATCGAGGGATCCCACGGGAAT-30
50-ATTCCCGTGGGATCCCTCGATCCAGGTGGCT-30
50-TTGGTACCACTGACATGATCTTCCTTGAATT-30
50-AATTCAAGGAAGATCATGTCAGTGGTACCAA-30
50-GCAAGTACTACTCCTACACCCACGGTGCTCT-30
50-AGAGCACCGTGGGTGTAGGAGTAGTACTTGC-30
pMmSMO-HT-H82Q
pMmSMO-HT-H82Q
pMmSMO-HT-H82E
pMmSMO-HT-H82E
pMmSMO-HT-K367M
pMmSMO-HT-K367M
pMmSMO-HT-T528Y
pMmSMO-HT-T528Y
123

1120
P. Tavladoraki et al.
as a result of the oxidation of 4-aminoantipyrine and 3,5-
dichloro-2-hydroxybenzesulfonic acid catalyzed by horse-
radish peroxidase in 0.2 M sodium phosphate buffer at pH 8.5
and 25°C (Polticelli et al. 2005). kcat values were calculated
using saturating concentrations of SPM (4 mM) and keeping
the O2 concentration constant at the air-saturated level. Km
values for recombinant wild-type and mutant MmSMO for
SPM were determined from Michaelis–Menten plots and
nonlinear least-squares fitting of data was performed using
the GraphPad Prism 4.0 software. Studies of the pH depen-
dence of wild-type and mutant MmSMO activity were con-
ducted in 0.2 M sodium phosphate buffer and in 100 mM
sodium borate buffer at 25°C using saturating concentrations
of SPM. Best fit of the experimental pH dependence curves
was carried out with GraphPad Prism using the following
equation to simulate a two-pKas dissociation equilibrium:
molecular modeling techniques. Two alternative methods
were used to build MmSMO structural model, a homology
modeling approach using the program NEST (Petrey et al.
2003) and the crystal structure of ZmPAO (PDB code
1B5Q; Binda et al. 1999) as a template, and a combined
threading/ab initio modeling approach using the program
I-TASSER (Zhang 2008). Figure 3 shows a comparison of
the two models, which are highly consistent with each
other, the rmsd between the two structures being only 0.93
˚
A over 1692 superimposed atoms. Differences between the
two models are observed mainly in the conformation of
surface loops, while all the residues building up the active
˚
site precisely match, with a Ca rmsd of only 0.41 A over 12
superimposed residues, giving essentially the same picture
of the chemical environment of the MmSMO catalytic site
and reinforcing the reliability of the predicted structural
models. However, the homology modeled structure
obtained using NEST appears more ordered as, consistent
with the ZmPAO template, it displays a higher percent-
age of secondary structure (Fig. 3). In addition, overall
G-value calculated for the latter model using PROCHECK
(Laskowski et al. 1993) is -0.39, well above the threshold
of -0.5 for good quality models, and approximately 97%
of residues were observed to lie in the allowed regions of
the Ramachandran plot. Thus, further analyses were con-
ducted on the homology-based structural model.
A ¼ Amaxðꢁð½Hþꢂ=ðK1 þ ½HþꢂÞÞ þ ð½Hþꢂ=ðK2 þ ½HþꢂÞÞÞ
where A is the catalytic activity of the enzyme at a given
pH value, Amax is the maximum catalytic activity and K1
and K2 are the equilibrium dissociation constants. Catalytic
parameters reported in Table 2 and Fig. 6 represent the
average of at least three independent experiments each in
duplicate.
Analysis of MmSMO structural model highlights inter-
esting characteristics of the active site shared with the yeast
polyamine oxidase FMS1 (Fig. 4). In particular, MmSMO
active site resembles that of FMS1 for the presence of
His82 and Tyr482, which are conserved in FMS1 as His67
and Tyr450, while are substituted in ZmPAO by Glu62 and
Phe403. It must be remembered that the only available
enzyme–substrate complex for a PAO-like enzyme is the
FMS1–SPM complex in which the substrate binds in a
U-shaped conformation around the imidazole ring of
His67. In addition, both MmSMO and FMS1 oxidize the
exo carbon atom with respect to the secondary amino group
of SPM as opposed to ZmPAO, which oxidizes the endo
carbon atom (Fig. 1). Thus, SPM was docked into the
active site of MmSMO structural model in the same con-
formation as that observed in the FMS1 enzyme–substrate
complex, and the resulting complex was equilibrated in
water through energy minimization. Analysis of the
MmSMO-SPM complex, shown in Fig. 4, indicates that the
substrate is bound with the C4 atom in the correct position
to undergo oxidation (the distance between SPM C4 atom
Results
Modeling MmSMO enzyme–substrate complex
Several attempts were made to obtain crystals of the
MmSMO enzyme without success (A. Mattevi, personal
communication; A. Fiorillo and A. Ilari, personal com-
munication), likely due to protein regions, which, by
comparison with the ZmPAO amino acid sequence and
secondary structure (Fig. 2), are predicted to be flexible
surface loops. For this reason, details about the three-
dimensional structure of MmSMO were obtained by
Table 2 Kinetic parameters determined for wild-type and mutant
MmSMOs
MmSMO
kcat (s-1
)
Km (lM)
k )
cat/Km (lM-1 s-1
Wild-type 3.57 0.02
242 18
530 80
0.015
H82Q
H82E
0.024 0.01
0.00005
Not detectable Not detectable
0.10 0.02 21
Not detectable Not detectable
/
5
˚
and FAD N atom being 4.9 A in the model) through a
K367M
T528Y
5
0.005
/
series of polar interactions involving all the substrate amine
groups. In detail, starting from the inner part of the cata-
lytic site, the SPM N1 atom is hydrogen bonded to Ser527
O and Oc atoms, the N5 atom is hydrogen bonded to
Tyr482 OH atom and Gln200 Oe1 atom, the N10 atom is
Catalytic parameters for the oxidation of SPM by recombinant wild-
type and mutant MmSMOs were determined in 0.2 M sodium phos-
phate buffer at pH 8.5 and 25°C (for details see ‘‘Materials and
methods’’)
123

Probing spermine oxidase enzyme–substrate complex
1121
Fig. 3 Schematic
representation of the molecular
models of MmSMO obtained by
(a) homology modeling using
the program NEST (Petrey et al.
2003) and the three-dimensional
structure of ZmPAO (PDB code
1B5Q) (Binda et al. 1999) as a
template, and (b) by the
ab initio automatic modeling
program I-TASSER (Zhang
2008)
hydrogen bonded to His82 Ne2, while the N14 atom is
hydrogen bonded to Glu224 O atom. MmSMO structural
model predicts an important role for His82 in the binding
of the substrate. Furthermore, MmSMO His82 is conserved
both in FMS1 and APAOs, proteins which share the exo
carbon oxidation mode. Another interesting feature of
MmSMO model is the presence of Thr528 in the place of
the bulkier Tyr439 found in ZmPAO (Fig. 4), a residue
which has been implicated in SPM correct binding for endo
carbon oxidation (Binda et al. 2001). In particular, the
presence of a Tyr residue in position 528 in MmSMO
would not be compatible with SPM binding in the position
predicted by our model, as the phenol ring of the Tyr
residue would occupy the position of the N1 and C2 atoms
of SPM, thus preventing substrate binding (data not
shown). Finally, MmSMO, as all the polyamine oxidase
like enzymes, displays the conservation of Lys367,
orthologous to Lys300 residue forming in ZmPAO the
Lys–H2O–FAD structural motif, which has been shown to
be essential for catalysis in the latter protein (Polticelli
et al. 2005).
properties of His, and with a Glu residue (H82E) present in
orthologous position in ZmPAO. Lys367 was substituted
with the isosteric neutral Met residue (K367M) and Thr528
with the bulkier Tyr residue (T528Y) present in ortholo-
gous position in ZmPAO.
Recombinant wild-type and mutant MmSMOs were
produced by heterologous expression in E. coli BL21 DE3
cells. Proteins were purified by His-Bind chromatography
and their purity was assessed by SDS/PAGE electropho-
retic analysis (not shown). Kinetic analysis of wild-type
and mutant MmSMOs was then carried out to characterize
their catalytic features (Table 2). Mutations H82Q and
K367M lead to a 150 and 36-fold reduction of kcat
,
respectively, while MmSMO mutants H82E and T528Y
resulted to be inactive enzymes. The Km value increases
about twofold in H82Q, in line with a role of this residue in
the binding of the substrate, while the opposite is observed
in K367M, probably as a consequence of the reduced
repulsion between the basic substrate and the enzyme
active site. The absence of any detectable activity in the
T528Y mutant is in agreement with the structural model of
the MmSMO-SPM complex proposed in this work, in that
it suggests that introduction of a bulky side chain at posi-
tion 528 prevents substrate binding due to steric repulsion.
Mutation H82E, mimicking ZmPAO active site, probably
leads to an out-of-register binding of the substrate (Binda
et al. 2001), resulting in an inactive enzyme. This is in line
with the different substrate oxidation mode of ZmPAO
(which oxidizes the endo carbon atom adjacent to the
secondary amino group of SPM; Binda et al. 1999) with
Characterization of wild-type and mutant MmSMOs
To experimentally validate the MmSMO-SPM complex
structural model discussed above, and to characterize the
MmSMO catalytic properties, residues His82, Lys367 and
Thr528 were selected for site-directed mutagenesis exper-
iments. In detail, His82 was substituted with a Gln residue,
(H82Q), which partly preserved the hydrogen bonding
123

1122
P. Tavladoraki et al.
absorbing region are practically superimposable for
wild-type and mutant MmSMOs (data not shown), further
confirming the correct folding and cofactor binding in all
the proteins under study.
The pH dependence of the catalytic activity has also
been studied for the wild-type and the two active mutant
enzymes. Wild-type MmSMO enzymatic activity increases
in the pH range 6.5–8.5, reaching a maximum at pH 8.5
and decreasing for higher pH values (Fig. 6). The pH
dependence of the catalytic activity of H82Q is essentially
unchanged with respect to the wild type, while a slight shift
toward higher pH values is observed for the K367M mutant
(Fig. 6; Table 3).
pKas calculations
To further investigate the identity of the ionizable group(s)
controlling the pH dependence of the catalytic activity of
MmSMO, pKa values were calculated using the PROPKA
software (Bas et al. 2008), for the ionizable active site
residues and substrate groups in the substrate-free and
substrate-bound wild-type MmSMO (Table 4). Results
obtained predict that His82 deprotonates at very acidic pH
values, while Lys367 deprotonation is predicted to occur at
approximately pH 6.0. Thus, both residues would be
already deprotonated in the pH range 6.5–8.5 in which the
pH-dependent increase of MmSMO catalytic activity
occurs. Interestingly, the N1 and N5 substrate amino groups
located in the vicinity of FAD, the deprotonation of which
is considered essential for catalytic activity to occur
(Henderson Pozzi et al. 2009; Polticelli et al. 2005), are
predicted to deprotonate at approximately pH 7.5 and 7.0,
respectively, consistent with deprotonation of the substrate
being responsible for the observed pH dependence of the
catalytic activity.
Fig. 4 Comparison of the enzyme–substrate interactions in ZmPAO
(Polticelli et al. 2005), MmSMO (present work) and FMS1 (PDB
code 1XPQ; Huang et al. 2005). For clarity, spermine carbon atoms
are colored in green, the FAD moiety in magenta and the backbone
atoms in yellow. The structural model of MmSMO-SPM complex is
available in the PMDB database (http://mi.caspur.it/PMDB/) under
the accession number PM0076222 (color figure online)
Discussion
Polyamines affect cell growth, differentiation and apopto-
sis, and PA metabolism defects have been linked to cancer
by a number of independent studies (Amendola et al. 2009;
Casero and Marton 2007). It is thus highly desirable to
have specific inhibitors of SMO and APAO to be able to
analyze their precise role in PA metabolism. However,
none of the available PAO inhibitors displays the desired
characteristics of selective affinity and specificity (Bianchi
et al. 2006).
respect to MmSMO (which oxidizes the exo carbon atom
adjacent to the secondary amino group of SPM; see Fig. 1;
Cervelli et al. 2003; Wang et al. 2003).
To rule out that major structural rearrangements could
contribute to the results obtained, circular dichroism
spectra were recorded for recombinant wild-type and
mutant enzymes. Results obtained indicate that wild-type
and mutant proteins share essentially the same structural
properties (Fig. 5). In addition, optical spectra in the FAD
In this work, given the difficulties encountered in the
experimental structure determination of MmSMO, we have
attempted to obtain structural information regarding the
enzyme–substrate complex through molecular modeling
techniques and validation of the model obtained by means
123

Probing spermine oxidase enzyme–substrate complex
1123
Fig. 5 Circular dichroism
spectra of wild-type and mutant
MmSMOs. For experimental
details see ‘‘Materials and
methods’’
Table 4 Calculated pKa values for ionizable active site residues and
substrate groups for MmSMOs
Residue
wt
wt-SPM
Asp104
Glu106
Glu224
Glu391
His82
1.97
4.01
4.50
6.62
2.81
1.02
1.97
4.01
4.50
6.62
\0.0
0.12
His530
Tyr201
[14.0
[14.0
[14.0
10.28
5.90
[14.0
[14.0
[14.0
10.41
5.76
Tyr482
Tyr484
Tyr526
Lys367
Spm (N14)
Spm (N10)
Spm (N5)
Spm (N1)
Fig. 6 pH dependence of the catalytic activity of wild-type (circles),
H82Q (squares) and K367M (triangles) MmSMOs. For experimental
details see ‘‘Materials and methods’’
9.18
7.47
6.99
7.48
Table 3 pKa values of the pH dependence of the catalytic activity of
wild-type and mutant MmSMOs
˚
Selected ionizable active site residues are those within 8 A distance
from the substrate. pKa values were calculated using PROPKA
(Bas et al. 2008)
Wild type
H82Q
K367M
pK1
pK2
R2
7.98 0.22
9.19 0.17
0.97
7.61 0.22
9.46 0.17
0.97
8.67 0.24
9.59 0.16
0.98
which is hydrogen bonded to one of the SPM N10 hydrogen
atoms. Indeed, mutation of His82 to Gln or Glu greatly
reduces or even abolishes (in the latter case) MmSMO
activity, confirming that this residue is essential for correct
SPM binding within the MmSMO active site. The effect of
His82Gln mutations seems to be limited to SPM binding
mode, leading to a 150-fold decrease of kcat, and not to
affect either the enzyme affinity for the substrate (Km value
is only doubled in the mutant with respect to the wild type;
of site-directed mutagenesis and functional characteriza-
tion of MmSMO variants. The model presented in this
paper is consistent with a binding mode of SPM within
MmSMO active site similar to that observed in the FMS1-
SPM complex (Fig. 4; Huang et al. 2005). In particular, a
relevant role in the binding of SPM is predicted for His82,
123

1124
P. Tavladoraki et al.
Table 2) or the catalytic mechanism, since the pH depen-
dence of the catalytic activity is essentially unchanged with
respect to the wild-type enzyme (see Table 3; Fig. 6).
Another feature of the MmSMO-SPM complex is that SPM
binding would not be compatible with the presence of a
bulky residue in position 528, at variance with what is
observed for ZmPAO, in which a Tyr residue (Tyr439) is
present in orthologous position (see Fig. 4). In agreement
with the proposed model, mutation of Thr528 to Tyr yields
an inactive enzyme, a fact that seems to be justified only by
the steric hindrance of the bulky Tyr side chain, which
would partly occlude the SPM binding pocket.
some kind of structural rearrangement of the protein and/or
of the environment and conformation of the FAD cofactor.
However, structural characterization of the ZmPAO
Lys300Met mutant rules out this hypothesis at least as far
as ZmPAO is concerned. In fact, the three-dimensional
structure of Lys300Met ZmPAO is practically identical to
that of the wild-type enzyme, the backbone rmsd between
˚
the two structures being only 0.39 A and the FAD position
and conformation perfectly superimposable (A. Fiorillo,
manuscript in preparation).
From the data presented in this work, it must be con-
cluded that there are differences in the mechanistic details
of polyamine oxidation between MmSMO and APAO,
despite their similarity in substrate oxidation mode (oxi-
dation of the exo carbon atom), as only a minor decrease of
the catalytic activity has been observed upon mutation of
the Lys367 orthologous residue in APAO (Henderson
Pozzi et al. 2009).
An interesting structural feature shared by MmSMO
with many other FAD-dependent amine oxidases such as
ZmPAO, FMS1, L-amino acid oxidase, monoamine oxi-
dase B, monomeric sarcosine oxidase and lysine specific
demethylase 1 (LSD1) is the presence of a Lys residue in
the vicinity of the FAD cofactor, which, in the structurally
characterized enzymes, has been shown to form a
Lys–H2O–FAD structural motif (Binda et al. 1999, 2002;
Huang et al. 2005; Stavropoulos et al. 2006). This struc-
tural motif has been shown to be essential for the catalytic
activity in ZmPAO and LSD1 (Polticelli et al. 2005;
Stavropoulos et al. 2006), while only a limited decrease of
the activity has been observed upon mutation of the Lys
residue in APAO (Henderson Pozzi et al. 2009). In this
regard, mutation of Lys367 in MmSMO leads to a sub-
stantial decrease of the activity with respect to the wild-
type enzyme, indicating that this residue, as already
observed in ZmPAO, plays a relevant role in the catalytic
mechanism of MmSMO. Characterization of ZmPAO
Lys300Met mutant, which displays a 1400-fold reduction
in the rate of flavin reduction, led to the hypothesis that
Lys300 could have the properties of a strong base at neutral
pH (Polticelli et al. 2005). In addition, analysis of the
solvent isotope effect (SIE) in stopped-flow and steady-
state turnover studies of wild-type ZmPAO gave support
for a role of the water molecule forming the Lys–H2O–
FAD structural motif in catalysis. In fact, stopped-flow
analysis revealed that a sizeable SIE (SIE = 5) accompa-
nied flavin reduction, and an SIE of value 2.3 was also
observed in steady-state turnover of the wild-type enzyme
(Polticelli et al. 2005). According to the results of pKas
calculation shown in Table 4, this could be the case also in
MmSMO. In fact, Lys367 pKa value is predicted to be
below pH 6.0 and thus this residue could play a similar
role, though less critical, to that of Lys300 in ZmPAO. It
must be recalled that also in the case of LSD1, mutation of
the Lys residue forming the Lys–H2O–FAD structural
motif (Lys661) leads to a dramatic decrease ([95%) of
catalytic activity (Stavropoulos et al. 2006).
Analysis of the structural details of MmSMO active site
model highlights interesting features, which can shed light
on the different substrate specificity of MmSMO and
APAO. In fact, docking of N1Ac-SPM into MmSMO active
site indicates that the methyl group of N1Ac-SPM would be
located in a highly polar pocket made up of the side chains
of Glu216 and Ser218 (see Supplementary materials,
Figure S1). This is clearly energetically unfavorable lead-
ing to the hypothesis that SMOs exploit this feature to
selectively bind SPM and not N1Ac-SPM. Interestingly,
Glu216 and Ser218 are substituted in APAO by a Leu and
Ala residue, respectively (Fig. 2), making the correspond-
ing pocket in APAO perfectly fit to host the methyl group
of the acetylated polyamine. Site-directed mutagenesis
experiments are being carried out to confirm this hypoth-
esis, which would form the structural basis for the design of
selective inhibitors of SMOs and APAOs.
The differences in substrate specificity between SMO
and FMS1 also deserve some comments. In fact, both
proteins oxidize SPM and not SPD, but FMS1 is also
active on the acetylated polyamines N1Ac-SPM, N1Ac-
SPD and N8Ac-SPD. Comparative analysis of the SMO
molecular model described in this work and of the crystal
structure of FMS1 reveal that the active site of the latter
protein is much wider than that of SMO and that the
highly polar pocket made up of Ser216 and Glu218 in
SMO is not present in FMS1. This probably explains the
ability of FMS1 to bind and oxidize acetylated poly-
amines at variance with SMO. The lack of activity on
SPD for both proteins is more puzzling, but it could be
due to electrostatic factors. In fact, deprotonation of the
N1 and N5 substrate amino groups located in the vicinity
of FAD is considered essential for catalytic activity to
occur (Henderson Pozzi et al. 2009; Polticelli et al. 2005).
In the case of SPM, the interaction of the N14 amino
It may be argued that the effects of Lys367 mutation in
MmSMO and Lys300 mutation in ZmPAO could be due to
123

Probing spermine oxidase enzyme–substrate complex
1125
References
group with an acidic residue (Asp93 in FMS1 and Glu224
in SMO; Fig. 4) keeps this group protonated well above
neutral pH, as confirmed by pKas calculations shown in
Table 4, and facilitates the deprotonation of the N1 and
N5 amino groups. No such interaction would be possible
with the shorter SPD molecule, which in turn would lead
to a higher basic character of the N1 and N5 amino
groups, making SPD a very poor substrate for the two
proteins.
Amendola R, Cervelli M, Fratini E, Polticelli F, Sallustio D,
Mariottini (2009) Spermine metabolism and anticancer
therapy. Curr Cancer Drug Targets 9:118–130
Babbar N, Murray-Stewart T, Casero RJ (2007) Inflammation and
polyamine catabolism: the good, the bad and the ugly. Biochem
Soc Trans 35:300–304
Bas D, Rogers D, Jensen J (2008) Very fast prediction and
rationalization of pK(a) values for protein-ligand complexes.
Proteins Struct Funct Bioinform 73:765–783
P
Bellelli A, Cavallo S, Nicolini L, Cervelli M, Bianchi M, Mariottini P,
Zelli M, Federico R (2004) Mouse spermine oxidase: a model
of the catalytic cycle and its inhibition by N, N1-bis(2, 3-
butadienyl)-1, 4-butanediamine. Biochem Biophys Res Commun
322:1–8
Conclusions
Bey P, Bolkenius F, Seiler N, Casara P (1985) N-2, 3-Butadienyl-1,
4-butanediamine derivatives: potent irreversible inactivators of
mammalian polyamine oxidase. J Med Chem 28:1–2
Bianchi M, Polticelli F, Ascenzi P, Botta M, Federico R, Mariottini P,
Cona A (2006) Inhibition of polyamine and spermine oxidases
by polyamine analogues. FEBS J 273:1115–1123
Binda C, Coda A, Angelini R, Federico R, Ascenzi P, Mattevi A
(1999) A 30-angstrom-long U-shaped catalytic tunnel in the
crystal structure of polyamine oxidase. Structure 7:265–276
Binda C, Angelini R, Federico R, Ascenzi P, Mattevi A (2001)
Structural bases for inhibitor binding and catalysis in polyamine
oxidase. Biochemistry 40:2766–2776
It is well known that in mammals, PAs affect cell
growth, differentiation and apoptosis, and PA metabolism
defects have been linked to cancer (Amendola et al.
2009; Casero and Marton 2007). It is thus highly desir-
able to have specific inhibitors of SMO and APAO
enzymes to analyze their precise role in PAs metabolism.
The results presented in this paper, exploiting the synergy
between molecular modeling, site-directed mutagenesis
and biochemical characterization, provide a molecular
view of the enzyme–substrate interactions in MmSMO
and represent a first step toward the design of new SPM-
derived inhibitors. In detail, SPM is predicted to be
bound in MmSMO active site through interactions with
Ser527, Tyr482, Gln200, His82 and Glu224. In addition,
we have shown that His82 and Lys367 play an important
role in MmSMO catalytic activity. His82 is most likely
involved in the correct binding of SPM, as already
observed for the orthologous His67 residue in FMS1,
while a direct participation of this residue in the catalytic
mechanism seems unlikely as its mutation to Gln does
not lead to a significant change of the pH profile of the
activity. On the contrary, the results obtained point to a
direct involvement of Lys367 in MmSMO catalytic
mechanism as its mutation to Met causes a substantial
decrease of kcat and a shift of the pH profile of the
activity. In this regard, pKas calculations support the
hypothesis that substrate deprotonation, facilitated by
electrostatic interactions with Lys367, is responsible for
the observed pH dependence of the activity. Finally, the
MmSMO-SPM model highlights the presence of an active
site pocket, which displays highly polar characteristics in
MmSMO (being formed by a Glu and a Ser residue) and
hydrophobic characteristics in APAO (being formed by a
Leu and a Val residue). This difference may explain the
different substrate specificity of the two enzymes and
provide the basis for the design of specific inhibitors for
SMO and APAO.
Binda C, Mattevi A, Edmondson
D (2002) Structure-function
relationships in flavoenzyme-dependent amine oxidations: a
comparison of polyamine oxidase and monoamine oxidase.
J Biol Chem 277:23973–23976
Brooks B, Bruccoleri R, Olafson B, States D, Swaminathan S,
Karplus M (1983) CHARMM: a program for macromolecular
energy, minimization, and dynamics calculations. J Comp Chem
4:187–212
Casero RJ, Marton L (2007) Targeting polyamine metabolism and
function in cancer and other hyperproliferative diseases. Nat Rev
Drug Discov 6:373–390
Casero RA, Pegg AE (2009) Polyamine catabolism and disease.
Biochem J 421:323–338
Casero RJ, Wang Y, Stewart T, Devereux W, Hacker A, Smith R,
Woster P (2003) The role of polyamine catabolism in anti-
tumour drug response. Biochem Soc Trans 31:361–365
Cervelli M, Polticelli F, Federico R, Mariottini P (2003) Heterologous
expression and characterization of mouse spermine oxidase.
J Biol Chem 278:5271–5276
Cervelli M, Bellini A, Bianchi M, Marcocci L, Nocera S, Polticelli F,
Federico R, Amendola R, Mariottini P (2004) Mouse spermine
oxidase gene splice variants—nuclear subcellular localization of
a novel active isoform. Eur J Biochem 271:760–770
`
Chaturvedi R, Cheng Y, Asim M, Bussiere F, Xu H, Gobert A,
Hacker A, Casero RJ, Wilson K (2004) Induction of polyamine
oxidase 1 by Helicobacter pylori causes macrophage apoptosis
by hydrogen peroxide release and mitochondrial membrane
depolarization. J Biol Chem 279:40161–40173
Cohen SS (1998) A guide to the polyamines. Oxford University Press,
New York
Deleage G, Geourjon C (1993) An interactive graphic program for
calculating the secondary structure-content of proteins from
circular-dichroism spectrum. Comput Appl Biosci 9:197–199
Gerner E, Meyskens FJ (2004) Polyamines and cancer: old molecules,
new understanding. Nat Rev Cancer 4:781–792
Goodwin A, Jadallah S, Toubaji A, Lecksell K, Hicks J, Kowalski J,
Bova G, De Marzo A, Netto G, Casero RJ (2008) Increased
Acknowledgments The authors wish to thank the University of
Roma Tre for financial support.
123

1126
P. Tavladoraki et al.
spermine oxidase expression in human prostate cancer and
prostatic intraepithelial neoplasia tissues. Prostate 68:766–772
Henderson Pozzi M, Gawandi V, Fitzpatrick P (2009) pH dependence
of a mammalian polyamine oxidase: insights into substrate
specificity and the role of lysine 315. Biochemistry 48:1508–
1516
Huang Q, Liu Q, Hao Q (2005) Crystal structures of Fms1 and its
complex with spermine reveal substrate specificity. J Mol Biol
348:951–959
Landry J, Sternglanz R (2003) Yeast Fms1 is a FAD-utilizing
polyamine oxidase. Biochem Biophys Res Commun 303:771–
776
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a
laboratory manual, 2nd edn. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY
¨
Schaffer A, Aravind L, Madden T, Shavirin S, Spouge J, Wolf Y,
Koonin E, Altschul S (2001) Improving the accuracy of PSI-
BLAST protein database searches with composition-based statis-
tics and other refinements. Nucleic Acids Res 29:2994–3005
Schipper R, Penning L, Verhofstad A (2000) Involvement of
polyamines in apoptosis. Facts and controversies: effectors or
protectors? Semin Cancer Biol 10:55–68
Stavropoulos P, Blobel G, Hoelz A (2006) Crystal structure and
mechanism of human lysine-specific demethylase-1. Nat Struct
Mol Biol 13:626–632
Larkin M, Blackshields G, Brown N, Chenna R, McGettigan P,
McWilliam H, Valentin F, Wallace I, Wilm A, Lopez R,
Thompson J, Gibson T, Higgins D (2007) Clustal W and clustal
X version 2.0. Bioinformatics 23:2947–2948
Thomas T, Thomas T (2001) Polyamines in cell growth and cell
death: molecular mechanisms and therapeutic applications. Cell
Mol Life Sci 58:244–258
Laskowski R, MacArthur M, Moss D, Thornton J (1993) PRO-
CHECK—a program to check the stereochemical quality of
protein structures. J Appl Crystallogr 26:283–291
Thomas T, Thomas T (2003) Polyamine metabolism and cancer.
J Cell Mol Med 7:113–126
Vujcic S, Diegelman P, Bacchi C, Kramer D, Porter C (2002)
Identification and characterization of a novel flavin-containing
MacKerell AJ, Bashford D, Bellott M, Dunbrack RJ, Evanseck J,
Field M, Fischer S, Gao J, Guo H, Ha S, Joseph-McCarthy D,
Kuchnir L, Kuczera K, Lau F, Mattos C, Michnick S, Ngo T,
Nguyen D, Prodhom B, Reiher WI, Roux B, Schlenkrich M,
Smith J, Stote R, Straub J, Watanabe M, Wiorkiewicz-Kuczera J,
Yin D, Karplus M (1998) All-atom empirical potential for
molecular modeling and dynamics studies of proteins. J Phys
Chem 102:3586–3616
spermine oxidase of mammalian cell origin. Biochem
367:665–675
J
Wallace H, Fraser A, Hughes A (2003) A perspective of polyamine
metabolism. Biochem J 376:1–14
Wang Y, Devereux W, Woster PM, Stewart TM, Hacker A, Casero
RA Jr (2001) Cloning and characterization of
a human
polyamine oxidase that is inducible by polyamine analogue
exposure. Cancer Res 61:5370–5373
Pegg AE (2009) Mammalian polyamine metabolism and function.
IUBMB Life 61:880–894
Wang Y, Murray-Stewart T, Devereux W, Hacker A, Frydman B,
Woster P, Casero RJ (2003) Properties of purified recombinant
human polyamine oxidase, PAOh1/SMO. Biochem Biophys Res
Commun 304:605–611
Waterhouse A, Procter J, Martin D, Clamp M, Barton G (2009)
Jalview Version 2—a multiple sequence alignment editor and
analysis workbench. Bioinformatics 25:1189–1191
Wu T, Yankovskaya V, McIntire W (2003) Cloning, sequencing, and
heterologous expression of the murine peroxisomal flavoprotein,
N1-acetylated polyamine oxidase. J Biol Chem 278:20514–20525
Wu T, Ling K, Sayre L, McIntire W (2005) Inhibition of murine
N1-acetylated polyamine oxidase by an acetylenic amine and the
allenic amine, MDL 72527. Biochem Biophys Res Commun
326:483–490
Persson L (2009) Polyamine homoeostasis. Essays Biochem 46:11–24
Petrey D, Xiang Z, Tang C, Xie L, Gimpelev M, Mitros T, Soto C,
Goldsmith-Fischman S, Kernytsky A, Schlessinger A, Koh I,
Alexov E, Honig B (2003) Using multiple structure alignments,
fast model building, and energetic analysis in fold recognition
and homology modeling. Proteins 53(Suppl 6):430–435
Pledgie A, Huang Y, Hacker A, Zhang Z, Woster P, Davidson N,
Casero RJ (2005) Spermine oxidase SMO(PAOh1), not N1-
acetylpolyamine oxidase PAO, is the primary source of cytotoxic
H2O2 in polyamine analogue-treated human breast cancer cell
lines. J Biol Chem 280:39843–39851
Polticelli F, Basran J, Faso C, Cona A, Minervini G, Angelini R,
Federico R, Scrutton N, Tavladoraki P (2005) Lys300 plays a
major role in the catalytic mechanism of maize polyamine
oxidase. Biochemistry 44:16108–16120
Zhang Y (2008) I-TASSER server for protein 3D structure prediction.
BMC Bioinform 9:40
123