Asymmetric whole-cell bio-reductions of (R)-carvone using optimized ene reductases

Article abstract of DOI:10.3390/molecules24142550

(2R,5R)-dihydrocarvone is an industrially applied building block that can be synthesized by site-selective and stereo-selective C=C bond bio-reduction of (R)-carvone. Escherichia coli (E. coli) cells overexpressing an ene reductase from Nostoc sp. PCC7120 (NostocER1) in combination with a cosubstrate regeneration system proved to be very effective biocatalysts for this reaction. However, the industrial applicability of biocatalysts is strongly linked to the catalysts’ activity. Since the cell-internal NADH concentrations are around 20-fold higher than the NADPH concentrations, we produced E. coli cells where the NADPH-preferring NostocER1 was exchanged with three different NADH-accepting NostocER1 mutants. These E. coli whole-cell biocatalysts were used in batch operated stirred-tank reactors on a 0.7 l-scale for the reduction of 300 mM (R)-carvone. 287 mM (2R,5R)-dihydrocarvone were formed within 5 h with a diasteromeric excess of 95.4% and a yield of 95.6%. Thus, the whole-cell biocatalysts were strongly improved by using NADH-accepting enzymes, resulting in an up to 2.1-fold increased initial product formation rate leading to a 1.8-fold increased space-time yield when compared to literature.

Full text of DOI:10.3390/molecules24142550

molecules
Article
Asymmetric Whole-Cell Bio-Reductions of
(R)-Carvone Using Optimized Ene Reductases
Christoph Mähler 1 , Christian Burger 1, Franziska Kratzl 1, Dirk Weuster-Botz 1
and Kathrin Castiglione 2,
*
1
Institute of Biochemical Engineering, Technical University of Munich, Boltzmannstr. 15,
D-85748 Garching, Germany
Institute of Bioprocess Engineering, Friedrich-Alexander-University Erlangen-Nürnberg, Paul-Gordan-Str. 3,
D-91052 Erlangen, Germany
2
*
Correspondence: kathrin.castiglione@fau.de; Tel.: +49-9131-85-23003
ꢀꢁꢂꢀꢃꢄꢅꢆꢇ
Academic Editor: Paola Vitale
Received: 25 June 2019; Accepted: 11 July 2019; Published: 12 July 2019
ꢀꢁꢂꢃꢄꢅꢆ
Abstract: (2R,5R)-dihydrocarvone is an industrially applied building block that can be synthesized
by site-selective and stereo-selective C=C bond bio-reduction of (R)-carvone. Escherichia coli (E. coli)
cells overexpressing an ene reductase from Nostoc sp. PCC7120 (NostocER1) in combination with
a cosubstrate regeneration system proved to be very effective biocatalysts for this reaction. However,
the industrial applicability of biocatalysts is strongly linked to the catalysts’ activity. Since the
cell-internal NADH concentrations are around 20-fold higher than the NADPH concentrations,
we produced E. coli cells where the NADPH-preferring NostocER1 was exchanged with three different
NADH-accepting NostocER1 mutants. These E. coli whole-cell biocatalysts were used in batch
operated stirred-tank reactors on a 0.7 l-scale for the reduction of 300 mM (R)-carvone. 287 mM
(2R,5R)-dihydrocarvone were formed within 5 h with a diasteromeric excess of 95.4% and a yield of
95.6%. Thus, the whole-cell biocatalysts were strongly improved by using NADH-accepting enzymes,
resulting in an up to 2.1-fold increased initial product formation rate leading to a 1.8-fold increased
space-time yield when compared to literature.
Keywords: asymmetric reduction; biotransformation; ene reductase; formate dehydrogenase; (R)-carvone;
(2R,5R)-dihydrocarvone
1. Introduction
Biocatalysts may represent a green and sustainable alternative to chemical catalysts. They can
be used under mild conditions and are biodegradable [
specificity, biocatalysis is becoming more the method of choice for the industrial preparation of
chiral compounds [ ]. Nevertheless, the application of wild type biocatalysts for industrial purposes is
often not cost-effective, due to low activities and space-time yields [ ]. This can be circumvented by
the usage of recombinant microorganisms and optimized enzymes [3].
The asymmetric reduction of C=C double bonds is a widely employed reaction, since up to
two stereogenic centers can be generated [ ]. In this context, ene reductases (ERs) from the old
yellow enzyme family (OYE, EC 1.6.99.1) represent highly interesting biocatalysts for anti-specific
hydrogenations of activated alkenes [ ]. Thus, these enzymes have already been applied in industrial-scale
biotransformations [ ]. However, large-scale production processes with OYEs are cost-intensive and
1]. Due to their high selectivity and
2
1,3
4
5
5
only applicable when products of high value are produced, e.g., active pharmaceutical compounds.
One reason for this is that the majority of these oxidoreductases prefer Nicotinamide adenine
dinucleotide phosphate (NADPH) over the less expensive and more stable Nicotinamide Adenine
Dinucleotide (NADH) as a cosubstrate [6–8]. This is not only a drawback if the biocatalysts are
Molecules 2019, 24, 2550; doi:10.3390/molecules24142550
www.mdpi.com/journal/molecules

Molecules 2019, 24, 2550
2 of 13
used as isolated enzymes and the expensive cosubstrate has to be added externally, but also if the
cosubstrate is supplied through the application of whole-cell biocatalysts. The greater intracellular
concentration of NAD(H), which is, for instance, up to 20-fold higher than the concentration of NADP(H)
in exponentially growing Escherichia coli (E. coli) cells [9], makes the utilization of this cosubstrate more
effective. Additionally, to further reduce process costs, industrial-scale biotransformations necessitating
nicotinamide-based cosubstrates are generally conducted with a regeneration system. Thus, an additional
advantage of NAD(H)-usage is represented by a larger variety of NAD(H)-regenerating instead of
NADP(H)-regenerating systems [10], which facilitates their implementation in industrial processes [11].
Enzyme engineering was applied to reduce the strong NADPH-dependency of OYEs. In a previous
work, wewereabletoinfluencethecosubstratepreferenceofthecyanobacterialenereductase1fromNostocsp.
PCC7120 (NostocER1) [12]. This was achieved by swapping loop regions that participate in cosubstrate
binding. Different regions of NostocER1 were exchanged for the respective regions of two native donor
OYEs with a high activity with NADH or a high affinity toward NADH. Thus, the NADH-binding properties
of the donors could be transferred to the cyanobacterial ER. This enabled a combination of the very high
stereospecifity and broad substrate spectrum of NostocER1 [13] with a high NADH activity. Kinetic
parameters of NostocER1 and the three best performing NostocER1-variants are listed in Table 1.
Table 1. Kinetic parameters of the NostocER1 wildtype and three NostocER1-variants with altered
NADH-binding properties as published by Mähler et al. [12]. Listed are the catalytic constant (kcat),
Michaelis-Menten constant (Km), and the resulting catalytic efficiency (keff) with NADH, as well as the
specific activity using 500 µM NADH (k500).
kcat, s−1
k500, s−1
Enzyme
Km, µM
keff, s−1 mM−1
NostocER1
Loop 1,2a
Loop 1,5
15.2 ± 1.9
29.1 ± 0.4
8.6 ± 0.9
1050 ± 220
224 ± 11
73 ± 13
14.4 ± 3.5
130.0 ± 6.7
119.0 ± 25.3
118.4 ± 8.7
3.9 ± 0.2
19.2 ± 1.3
7.5 ± 0.9
13.3 ± 1.5
Loop 1,5,2a
19.0 ± 0.4
161 ± 11
In this study, these optimized enzymes should be applied in a biotransformation of industrial
relevance. Therefore, the reduction of (R)-carvone to (2R,5R)-dihydrocarvone was carried out.
Dihydrocarvone is used in the synthesis of different molecules of biological interest, e.g., tetraoxane
derivatives as compounds with antimalarial activity [14], keto decalin derivatives as insect
antifeedants [15], or the terpenes (
appearance of undesired side products during the reduction of (R)-carvone, especially when compared
−
)-thujopsene [16] and (+)-decipienin A [17]. Due to the reduced
to Baker’s yeast [18
were applied.
,19], recombinant E. coli biocatalysts overexpressing optimized NostocER1 mutants
2. Results
2.1. Strain Construction
First different vectors for the transformation of E. coli BL21(DE3) cells were constructed (Figure 1).
These vectors are based on a pET28a(+) vector, with the exception of the expression cassettes.
An additional T7 promotor as well as a ribosome binding site (rbs) were inserted for an improved
co-expression of the genes encoding for NostocER1 and the formate dehydrogenase (FDH) from
Mycobacterium vaccae, which was used for cosubstrate regeneration [19]. Four different NostocER1
variants were applied, i.e., the wild type, a loop 1,2a swapped mutant with a highly increased activity
with NADH, a loop 1,5 swapped mutant with a highly increased affinity toward NADH, and the
combination of these two, a loop 1,5,2a swapped mutant with an increased activity and affinity with
NADH. Details of differences in the primary structure and kinetic parameters can be found in a previous
work [12] and Table 1.

Molecules 2019, 24, 2550
3 of 13
Figure 1. Modified pET28a(+) vector constructs for the co-expression of the respective NostocER1
variants and FDH genes. Indicated are the expression cassettes, including the locations of the T7
promotors (T7), ribosome binding sites (rbs), the genes (NostocER1 and FDH), and the T7 terminators
(t7 term).
2.2. Biocatalyst Production
A protocol adjusted from Wilms et al. was established for the production of the whole-cell
biocatalysts [20]. Studies showed that, for E. coli, growth rates should be maintained between 0.1 h−1
and 0.3 h−1 during the biomass production phase in order to reduce overflow metabolism, which leads
to inhibitory concentrations of acetate [21]. Control of the growth rate can be achieved by a fed-batch
process with an exponential feeding strategy of the limiting substrate. Consequently, after an initial
◦
batch phase (Phase I) with 1 g L−1 glucose at 37 C, an exponential feeding profile of glucose was
initiated in order to maintain a specific growth rate of
set = 0.15 h−1 at 30 ◦C for biocatalyst production
(Phase II). This was followed by an enzyme production phase (Phase III), which was induced by 200
isopropyl -d-1-thiogalactopyranoside (IPTG) after 23.1 h. The exponential feeding protocol was
adjusted to a reduced specific growth rate of
set = 0.04 h−1 at an initial temperature of 20 ◦C. With this
µ
µM
β
µ
strategy, four parallel fed-batch processes were conducted to achieve identical biocatalyst production
conditions. Thereby, a comparable course and maximum of the biocatalyst concentrations for each
variant could be accomplished (Figure 2). The initial glucose concentration of 1 g L−1 was consumed
after 2.5 h (Phase I) and it was possible to control the specific growth rates between 0.139 ± 0.001 h−1
and 0.155
±
0.006 h−1 by exponential glucose feeding (Phase II). During the enzyme production phase
(Phase III), the specific growth rates were successfully maintained between 0.035
±
0.001 h−1 and
0.038 ± 0.001 h−1 by exponential glucose feeding. Since the additional energy required for protein
production can influence the biomass yield coefficient, an increased substrate supply was set at the
beginning of this phase. Since no change of the coefficient was observable, glucose was overfed
and accumulated up to 2.4 g L−1. Thus, to enhance the growth metabolism, the temperature was
increased from 20 to 23 ◦C after 30.5 h of process time. Hereby, glucose concentrations could be kept
below 0.2 g L−1
A maximal cell dry weight (CDW) concentration of 53.5
.
±
1.6 g L−1 was achieved after 48.3 h
with the E. coli strain overexpressing the wild type enzymes (NostocER1-FDH). The constructs with
the two NostocER1-variants Loop 1,2a-FDH and Loop 1,5-FDH showed comparable maximal CDW
concentrations after 48.3 h (54.2 ± 1.1 g L−1 and 57.1 ± 2.0 g L−1, respectively). The lowest final CDW
concentration of 50.6
±
1.6 g L−1 was observed with the NostocER1-variant Loop 1,5,2a-FDH. This was,
however, due to an oxygen limitation because of a blocked waste-gas filter of the stirred-tank bioreactor
between 12.3 h and 16.3 h of process time.

Molecules 2019, 24, 2550
4 of 13
Figure 2. Cell dry weight (CDW) concentrations of fed-batch cultivations of E. coli BL21 (DE3) with
constructs NostocER1-FDH (
#
), Loop 1,2a-FDH (
ꢀ
), Loop 1,5-FDH (
ꢀ
), and Loop 1,5,2a-FDH (
ꢀ
)
in a stirred-tank bioreactor on an L-scale. The vertical dotted lines separate the biomass production
in the batch phase (I), the fed-batch phase (II), and the enzyme production phase (III). All values
represent means ± standard deviation of triplicate determinations.
To further evaluate possible differences of the whole-cell biocatalysts produced, the final enzymatic
activities of all NostocER1-variants and all FDHs were determined. A comparison of these activities
allows a direct comparison of the intracellular enzyme amount. Therefore, part of the harvested E. coli
cells were mechanically disrupted and the enzymatic activities were determined in the supernatant.
Since the four applied NostocER1-variants possess different activities with NADH [12], a direct
comparison of the specific activities is not possible. Therefore, the determined activities were normalized
to the specific activity using 500 µM NADH (k500) of the respective purified NostocER1-variant
(Table 1). All optimized NostocER1-variants revealed an insignificantly changed (Loop 1,5 and Loop
1,5,2a) or significant lower (Loop 1,2a) normalized activity compared to the NostocER1 wild type
(Figure 3a). Thus, higher enzyme amounts of the optimized ERs can be excluded as reason for different
biotransformation rates compared to the E. coli biocatalyst possessing the wild types (NostocER1-FDH).
In order to ensure the same for the cosubstrate regeneration activity, the supernatant activities of the
FDHs were determined and compared to one of the cells possessing the wild type enzymes. Since all
constructs hold the gene encoding for the same FDH, a direct comparison of the FDH activities was
possible (Figure 3b). Again, none of the FDHs of the E. coli cells with a construct holding an optimized
NostocER1 revealed a significantly higher activity than the ones with the construct with the wild type
NostocER1, which indicates comparable expression levels. Hence, the biotransformation rates of the
whole-cell biocatalysts possessing optimized NostocER1-variants are directly comparable to the cells
possessing the wild types.

Molecules 2019, 24, 2550
5 of 13
Figure 3. Activities in the supernatant of the disrupted E. coli cells after a process time of 48.3 h. (
reductase (ER) activity normalized to the activity of respective purified NostocER1-variant. Activities
were determined by measuring the oxidation rate of 500 M NADH. ( ) Formate dehydrogenase (FDH)
a) Ene
µ
b
activities of the E. coli cells with optimized NostocER1-variants relative to the FDH activity of the
E. coli cells possessing wild type enzymes (NostocER1-FDH construct). Activities were determined by
measuring the reduction rate of 500 µM NAD+.
2.3. Biotransformation of (R)-Carvone
The recombinant E. coli cells were used in whole-cell biotransformations of (R)-carvone (
(2R,5R)-dihydrocarvone ( ). Intracellular NADH is consumed by the NostocER1 wild type or the
three optimized enzyme variants. The formed NAD+ is recycled inside the whole-cell biocatalysts via
the formate dehydrogenase (FDH) from Mycobacterium vaccae by oxidation of formate ( ) to carbon
dioxide ( ). Since
is poorly soluble in aqueous media and shows antimicrobial activity, the Amberlite®
1) to form
2
3
4
1
XAD4 resin was added for in situ substrate feeding and product removal (SFPR). This resin resulted
in beneficial results compared to other SFPR strategies, i.e., different organic solvents or ionic liquids [19].
A schematic representation of the reaction setup applied is shown in Figure 4.
Figure 4. Schematic representation of the applied biocatalytic whole-cell reduction of (R)-carvone
(
1
) to (2R,5R)-dihydrocarvone (
consumed. Therefore, NAD+ gets recycled inside the cells via a formate dehydrogenase (FDH) under
the oxidation of formate ( ) to carbon dioxide (
). The adsorbent resin (AR) Amberlite® XAD4 is used
for in situ substrate feeding and product removal (SFPR).
2). During this NostocER1 catalyzed reaction, intracellular NADH is
3
4

Molecules 2019, 24, 2550
6 of 13
First, this reaction setup was applied in stirred small-scale batch biotransformations to evaluate
technical replicability. Second, the evaluation of preparative biotransformations with all biocatalysts
was performed on a 0.7 L scale in stirred-tank bioreactors.
2.3.1. Technical Replicability
Toensureatechnicallyreplicableapplicationoftheproducedwhole-cellbiocatalysts, biotransformations
of (R)-carvone were conducted on a 15 mL scale in triplicates. The E. coli BL21 (DE3) cells possessing
optimized NostocER1-variants (i.e., the vectors Loop 1,2a-FDH, Loop 1,5-FDH, and Loop 1,5,2a-FDH)
were applied in three parallel batch biotransformations per construct (Figure 5). The means and standard
deviations of these three replicates were calculated. Thereby, a maximal relative standard deviation of
±
9.9%
and average relative standard deviations of 5.7% were determined for the Loop 1,2a-FDH construct (a),
±
±5.2% for the Loop 1,5-FDH construct (b), or ±5.6% for the Loop 1,5,2a-FDH construct (c).
To compare the biocatalysts’ activity, the initial product formation rates were determined
per biocatalyst amount. Loop 1,2a-FDH construct (a) revealed the highest rate with an initial
(2R,5R)-dihydrocarvone formation rate of 2.2
±
0.2 mmol h−1 gCDW−1. The rates of the Loop 1,5-FDH
0.1 mmol h−1
−1
construct (b) (1.4
±
0.1 mmol h
g
−1) and the Loop 1,5,2a-FDH construct (c) (1.9
±
CDW
gCDW−1) were reduced by 38.0 ± 5.3% and 14.9 ± 1.6%, respectively.
Figure 5. (2R,5R)-dihydrocarvone concentration over process time during batch biotransformation
on a 15 mL scale. E. coli BL21 (DE3) whole-cell biocatalysts were applied after expression of ( ) Loop
1,2a-FDH construct, ( ) Loop 1,5-FDH construct, and ( ) Loop 1,5,2a-FDH construct. The reactions
were performed with 300 mM (R)-carvone, 450 mM formate, a biocatalyst cell dry weight (CDW)
concentration of ( ) 40.2 gCDW ) 51.3 gCDW ) 39.6 gCDW
−1, ( −1, and ( −1. A resin to substrate ratio
a
b
c
a
L
b
L
c
L
of 3:1 in sodium phosphate buffer (0.3 M, pH 7.0) at 25 ◦C. The values are means of three technical
replicates ± standard deviations.
2.3.2. Preparative Biotransformations
Parallel batch processes were performed with three recombinant E. coli strains possessing
an optimized NosctocER1-variant and the strain with the NostocER1 wild type in stirred-tank
bioreactors on a 0.7 L scale. All whole-cell biocatalysts led to an almost complete conversion of
(R)-carvone to (2R,5R)-dihydrocarvone within 8 h of a reaction time (Figure 6a). Thereby, the usage of
all E. coli cells possessing an optimized NostocER1-variant resulted in a faster reaction rate. While the
biocatalysts with the wild type (NostocER1-FDH) showed a product concentration of 97.9 ± 1.5 mM
after 2 h process time, the other three E. coli strains ranged between 187.0
and 126.6
(2R,5R)-dihydrocarvone formation rates per applied biomass (Figure 6b). E. coli cells with the
NostocER1 wild type possessed the slowest of all determined product formation rates (1.3 0.1 mmol
−1). The application of the Loop 1,2a-FDH construct increased the product formation rate
±
1.4 mM (Loop 1,2a-FDH)
0.8 mM (Loop 1,5-FDH). The same differences were observed with respect to the initial
±
±
−1
h
g
CDW

Molecules 2019, 24, 2550
7 of 13
by a factor of 2.1 to 2.8 ± 0.1 mmol h−1 gCDW−1. The other two biocatalysts also showed an increased
product formation rate. −T1he Loop 1,5-FDH construct resulted in an increase by a factor of 1.3 to
−1
1.8 ± 0.1 mmol h
g
and the Loop 1,5,2a-FDH construct in an increase by a factor of 1.7 to
CDW
2.3
±
0.2 mmol h−1 gCDW−1. A comparable stereospecificity of all biocatalysts could be observed,
which results in similar diastereomeric excesses (de) of the product (2R,5R)-dihydrocarvone compared
to the side product (2S,5R)-dihydrocarvone. The whole-cell biocatalysts with NostocER1-FDH and
the Loop 1,2a-FDH revealed the highest stereospecificity after 96% conversion with a de of 95.4%.
≥
The corresponding de of Loop 1,5-FDH (93.6%) and Loop 1,5,2a-FDH (94.3%) were slightly lower.
Figure 6. Batch biotransformations in stirred-tank bioreactors on a 0.7 L scale using the recombinant E. coli
BL21 (DE3) whole-cell biocatalysts NostocER1-FDH (white), Loop 1,2a-FDH (green), Loop 1,5-FDH (red),
and Loop 1,5,2a-FDH (blue). The reactions were performed with 300 mM (R)-carvon, 450 mM formate,
0.1 mM NAD+, a biocatalyst cell dry weight (CDW) concentration of 30.5–33.7 gCDW
substrate ratio of 3:1 in sodium phosphate buffer (0.3 M, pH 7.0) at 25 ◦C. (
) (2R,5R)-dihydrocarvone
concentration over process time. ( ) Initial (2R,5R)-dihydrocarvone formation rates of the applied
biocatalysts per biomass. All values represent means ± standard deviation of triplicate determinations.
L
−1, and a resin to
a
b
3. Discussion
In this study, (R)-carvone was successfully reduced to (2R,5R)-dihydrocarvone using recombinant
E. coli whole-cell biocatalysts overexpressing nostocER1 variants and fdh genes. The application of
bacterial whole-cell biocatalysts for this reduction reaction was already demonstrated to be beneficial
in comparison to other microorganisms, since conversions of
undesired reduction of carbonyl bonds by endogenous carbonyl reductases was not observed [19
≥
96% were reached whereas the
22 23].
,
,
The reduction of the C=O bonds of substrate or product was mostly an issue when applying other
organisms like yeasts [18,24,25] and other fungi [24,26], plant cells [27], or microalgae [28].
In a previous work, the overexpression of the NADPH-preferring cyanobacterial ene reductase
from Nostoc sp. PCC7120 (NostocER1) in combination with a NADP+-accepting mutant of formate
dehydrogenase (FDH3M) from Mycobacterium vaccae resulted in highly active E. coli whole-cell
biocatalysts [19]. 300 mM (R)-carvone were converted to 290.4 mM (2R,5R)-dihydrocarvone in a batch
process on a liter-scale after 9 h by applying a biocatalyst concentration of 36 gCDW L
−1. A space-time
yield of 32.3 mmol L−1 h−1 was achieved with an initial (2R,5R)-dihydrocarvone formation rate of
1.3 mmol h−1 gCDW−1. In this study, the NostocER1 wild type was overexpressed in combination with
the NAD+-preferring FDH wild type. Thereby, E. coli biocatalysts could be provided showing a similar
activity compared to literature. On a 0.7 L scale 285.4 mM (2R,5R)-dihydrocarvone were formed
−1
in a batch process within 8 h with an initial product formation rate of 1.3
±
0.1 mmol h−1 gCDW
,

Molecules 2019, 24, 2550
8 of 13
which results in a space-time yield of 35.7 mmol L−1
h
−1. Thus, within this process time, a yield of
95.1% was achieved based on 210 mmol applied substrate (R)-carvone. However, further improved
biocatalysts were generated by exchanging the NostocER1 wild type with different NADH-accepting
NostocER1-variants (Table 2). The implementation of the Loop 1,2a NostocER1-variant, which possesses
a highly increased catalytic constant with NADH [12], resulted in significant improvement. Thereby,
a yield of 95.7% was achieved after a process time of 5 h. The initial product formation rate was
−1
increased 2.1-fold to 2.8
increased 1.8-fold to 57.4
even though the expression level of this ER was between 24.3
±
0.1 mmol h
±
g
−1 and the space-time yield after
≥
96% conversion was
CDW
0.1 mmol L−1 h−1 when compared to literature [19]. This was achieved
±
3.6% and 33.4
±
4.9% lower than the
levels of the other biocatalysts. Additionally, the application of the two other NostocER1-variants
(Loop 1,5 resp. Loop 1,5,2a) led to higher initial (2R,5R)-dihydrocarvone formation rates. However,
no further improved space-time yields were observed with these two variants in comparison to the
NostocER1 wild type biocatalysts.
Table 2. Comparison of the generated biocatalysts.
Final Conversion,
%
Space-Time Yield 2,
mmol L−1 h−1
Initial Product Formation Rate,
Biocatalyst
−1
mmol h−1 gCDW
NostocER1-FDH
Loop 1,2a-FDH
Loop 1,5-FDH
Loop 1,5,2a-FDH
NostocER1-FDH3M
1
99.9
99.9
99.6
99.5
96.8
1.3 ± 0.1
2.8 ± 0.1
1.8 ± 0.1
2.3 ± 0.2
1.3 ± 0.1
35.7 ± 0.1
57.4 ± 0.1
35.1 ± 0.1
35.4 ± 0.1
32.3 ± 0.1
1
Data from Reference [19]; 2 Space-time yields were determined after ≥96% conversion.
The bio-reduction of (R)-carvone has already been studied using many different microorganisms,
including bacteria [19
With more than 30 different strains, yeasts and yeast-like fungi are the largest group studied for this
reaction [18 24 25]. High substrate conversions of 96%, which are a crucial requirement for a cost-effective
,23], yeasts [18,24,25], other fungi [24,26], plant cells [27], or microalgae [28].
,
,
≥
industrial biotransformation, were only achieved with one strain, i.e., Hanseniaspora guilliermondii [24].
However, only a moderate substrate concentration of 6.9 mM was converted. A significantly reduced
conversion (63.6%) was detected after the substrate concentration was increased to 10 mM for the
bio-reduction with this organism [25]. Through the application of the yeast Saccharomyces cerevisiae and
the addition of trehalose to the reaction mixture, the substrate loading could be increased to 16.6 mM and
a conversion of 74% was reached [18].
Besides yeasts, bacteria proved to be beneficial for the selective reduction of (R)-carvone. In this
context, Pseudomonas putida was used to fully convert 6.9 mM of the substrate with a high stereospecificity
within 84 h [23]. A strong improvement was achieved by the application of E. coli cells overexpressing
the ene reductase NostocER1 and a FDH for cosubstrate regeneration. The high effectiveness of this
biocatalyst was demonstrated in a biphasic system with the adsorbent resin XAD4, which results
in the, by far, highest product formation rate and space-time yield for the bio-reduction of (R)-carvone
in literature [19]. Furthermore, a high and stereospecific conversion of 96.8% of the substrate was
reached within 9 h of processing time [19]. In this study, this biocatalyst was further improved by
applying NADH-accepting variants of NostocER1 [12], which results in up to 99.4% conversion of
300 mM (R)-carvone within 6 h of process time. The product formation rate was increased by a factor
of up to 2.1 and the space-time yield by a factor of 1.8. Thereby, the Loop 1,2a NostocER1-variant,
i.e., the variant with the highest kcat with NADH of the three applied NostocER1-variants (Table 1),
revealed the biggest improvement. This is indicative of a stronger influence of kcat with NADH
compared to Km towards NADH on the productivity of the biocatalyst in the given reaction system.
This observation is in accordance with the high NAD(H) concentration in E. coli, which is up to
20-fold higher compared to NADP(H) in exponentially growing cells [9]. Through a high cosubstrate

Molecules 2019, 24, 2550
9 of 13
concentration, the apparent activity is closer to the maximal turnover number (kcat), which increases
the importance of this parameter.
Another important aspect of this study is that we could not only improve the bioreduction
of (R)-carvone, but also demonstrate that cosubstrate engineering of an NADPH-dependent
oxidoreductase is useful, even if whole-cell biocatalysts are applied.
4. Materials and Methods
4.1. Chemicals, Enzymes, and Bacterial Strains
(R)-carvone (98%), dihydrocarvone (mixture of isomers 77% (2R,5R), and 20% (2S,5R)) and
Amberlite® XAD4 were obtained from Sigma Aldrich (St. Louis, MO, USA). Media components,
Kanamycin sulfate, and NAD(H) were purchased from Carl Roth (Karlsruhe, Germany). Enzymes
for DNA manipulation were bought from New England Biolabs (Ipswich, MA, USA) and primers
were synthesized by Eurofins Genomics (Ebersberg, Germany). E. coli DH5α (Invitrogen, Carlsbad,
CA, USA) was used for cloning and E. coli BL21 (DE3) (Novagen, San Diego, CA, USA) for protein
expression and biotransformation.
4.2. Cloning
Standard procedures were used for polymerase chain reaction, ligation, transformation,
and plasmid and cell preparation as described by Mülhart [29]. The constructs for co-expression
of the NostocER1-variants and FDH based on a pET28a(+) vector (Novagen, San Diego, CA, USA).
The vectors expression cassettes were modified with an additional T7 promotor and ribosome binding
site (rbs) as described before [19]. Genes encoding for the NostocER1-variants [12] and the fdh gene
from Mycobacterium vaccae (GenBank BAB69476.1) were amplified using the primers listed in Table 3.
For amplification Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA)
was applied according to the manufacturer’s protocol. For nostocER1 and all variants of this gene,
the restriction sites NcoI and BamHI were used. Additionally, fdh NdeI and KpnI was applied.
Table 3. Primers used for amplification of the nostocER1 and fdh genes. The 50
restriction site shown in bold and the start/stop codon underlined are listed.
→
30 sequences with the
Primer
Sequence, 50 → 30
GGAATTCCCATGGGCTCTACCAACATCAACCTATTCTCT
CGCGGATCCTTACTTATTAGCAACTGCTAAAAATGG
AGGAATTCCATATGGCAAAGGTCCTGTGCGT
nostocER1-NcoI-for
nostocER1-BamHI-rev
fdh-NdeI-for
fdh-KpnI-rev
CGGGGTACCTCAGACCGCCTTCTTGAACTTGG
4.3. Cultivation of E. coli
Biocatalyst production in l-scale was performed in four-fold parallel lab-scale stirred-tank
reactors with an initial volume of 0.3 L (DASGIP® Bioblock, DASGIP® reactor with two GL45 sides
and overhead propulsion, Eppendorf AG, Hamburg, Germany). Temperature, dissolved oxygen
concentration (DO), pH, and gas flow rate were monitored during the production of the whole-cell
biocatalysts. The temperature was initially set to 37 ◦C for the batch phase, which was reduced to 30 ◦C
for the fed-batch phase and was further reduced to 20–23 ◦C after induction for the enzyme production
phase. The pH was controlled to pH 7.0 by 12.5% (v/v) ammonia and 1 M phosphoric acid addition.
Solved oxygen availability was achieved in the reactors by the supply of sterile air with a sparger at the
bottom and dispersion of the gas bubbles with two six-blade Rushton turbines mounted on the axes
at a distance of 25 mm. The DO concentration was controlled to a set point of 20% air saturation by
varying the stirrer speed between 500 and 1600 rpm. The air flow was set to 60 L h−1 representing an air
flow of at least 3.33 volume per volume of the vessel capacity per minute (vvm). DO sensor calibration

Molecules 2019, 24, 2550
10 of 13
was performed prior to inoculation and 100% air saturation was achieved by stripping with air at
37 ◦C. Afterward, the reactors were stripped with nitrogen gas until 0% air saturation was achieved.
Pre-cultures were produced with terrific broth (TB) medium containing 12 g L−1 peptone from
casein, 24 g L−1 yeast extract, 5.1 g L−1 glycerol, 2.1 g L−1 KH2PO4, 12.6 g L−1 K2HPO4, and 34 mg L−1
kanamycin. The pH was adjusted to pH 7.2 and 4 mL of the TB medium were inoculated either
with a single cell colony or cells from a cryo-stock in a 13 mL single use cultivation tube (Sarstedt,
Nümbrecht, Germany). Seed cultures and biocatalyst production in stirred-tank bioreactors were
carried out in defined medium, according to Wilms et al. [20]. Seed cultures with an initial glucose
concentration of 5 g L−1 were grown overnight at 37 ◦C in shaking flasks without baffles (250 rpm,
shaking diameter of 5 cm). Cells from the seed cultures were harvested by centrifugation (3250 g,
×
10 min) and the required amount of the cell pellet was resuspended in fresh medium, according
to Wilms et al. Afterward the re-suspended cells were used for inoculation of the stirred-tank bioreactors
by sterile single-use syringes through a cannula.
Glucose served as a substrate for the initial batch phase at a concentration of 1 g L−1. Kanamycin
was used as a selection marker at a concentration of 34 mg L−1. For fed-batch cultiva−ti1ons, a growth
rate of
µ
= 0.15 h−1 was set by using a biomass yield coefficient of 0.4 gCDW gS and, adding
set
a feeding solution with 100 g L−1 glucose, 19.8 g L−1 (NH4)2HPO4 and 34 mg L−1 kanamycin,
according to Sun et al. [30]. Temperature was reduced to 20 ◦C after a process time of 19.5 h and 1 h
prior to the induction of enzyme production with 200
was raised to 23 ◦C due to glucose accumulation in the stirred-tank reactor. During the production
phase, the growth rate was reduced to
set = 0.04 h−1 and a feeding solution with 500 g L−1 glucose,
99 g L−1 (NH4)2HPO4, and 34 mg L−1 kanamycin was used. Furthermore, 0.5 g L−1 MgSO4
7 H2O
µM IPTG. 7.5 h after induction, the temperature
µ
·
and 3 mL L−1 trace element solution [20] were added to the stirred-tank reactors after 5.5 and 24.5 h.
At 24.5 h, an additional 0.1 g L−1 thiamin was supplemented to the reaction medium. Cells were
transferred to centrifugation tubes after cell cultivation and were stored for less than 24 h at 4 ◦C until
further use for preparative biotransformations. The cells for the analysis of the technical replicability
were mixed with 12.5% (w/v) glycerol and stored at −60 ◦C.
4.4. Enzyme Activity Assay
Enzyme activities were determined in cell lysates. Therefore, 1 mL E. coli cell suspension was mixed
with 0.5 g glass beads (ø 0.25–0.5 mm, Carl Roth, Karlsruhe, Germany) and disrupted for 5 min and 25 s−1
in a Mixer Mill MM 400 (Retsch, Haan, Germany). Debris was separated by centrifugation (17,200× g
10 min, 4 ◦C) and the activity in the supernatant was determined photometrically by oxidation (ER) or
reduction (FDH) of 500 M NAD(H) at 340 nm. Assays were conducted in sodium phosphate buffer
(100 mM, pH 7.0) at 30 ◦C using F96 microwell plates (Nunc, Roskilde, Denmark) and a Multiscan
FC
,
µ
™
Photometer (Thermo Fisher Scientific, Waltham, MA, USA). Reactions were initiated by the addition of
10 mM maleimide (ER) or 250 mM sodium formate (FDH) as a substrate. Reaction rates were determined
by automated linear regression using MATLAB R2015b (The MathWorks, Natick, MA, USA).
4.5. Biotransformations of (R)-Carvone
Biotransformations of (R)-carvone were carried out on two different scales: 15 mL for the
evaluation of technical replicability and 0.7 L for the preparative biotransformation in the stirred-tank
bioreactors. All biotransformations were performed with 300 mM (R)-carvone and 450 mM sodium
formate in 300 mM sodium phosphate buffer (pH 7.0). Amberlite® XAD4 with a wet mass ratio of 3:1
to (R)-carvone was used for in situ substrate feeding and product removal. (R)-carvone and adsorbent
resin (harmonic mean size 0.49–0.69 mm, uniformity coefficient 2) were incubated for at least 2 h
≤
in buffer (50% (v/v) of the total reaction volume) prior to the biotransformations. Reactions were
initiated by the addition of the whole-cell biocatalysts resuspended in 300 mM sodium phosphate
buffer and the samples were incubated at 25 ◦C.

Molecules 2019, 24, 2550
11 of 13
On the 15 mL scale, batch biotransformations were performed in glass vials with rolled rim equipped with
snap caps (Vmax 20 mL, Carl Roth, Karlsruhe, Germany). Mixing was achieved with x-shaped magnetic stir
bars (ø 1 cm, VWR, Darmstadt, Germany) using a multiple stirrer plate Variomag Poly 15 (HP-Labortechnik,
Oberschleißheim, Germany) at 900 rpm. Sampling was done with a volume of 300 µL each.
On the 0.7 L scale, batch biotransformations were performed in parallel stirred-tank reactors
(DASGIP® Bioblock, DASGIP® reactor with two GL45 sides and overhead propulsion, Eppendorf,
Hamburg, Germany). Furthermore, 100 µ
M NAD+ were added to the reaction mixture. Mixing and
dispersion of the gas phase was achieved with two six-bladed Rushton turbines mounted on the axes at
a distance of 25 mm and a speed of 700 rpm. The pH was controlled to pH 7.0 by automated addition
of 1 M phosphoric acid. Sampling was done with a volume of 1 mL each.
4.6. Analytics
Prior to the analytical procedure, the samples had to be extracted using EtOAc. Therefore, between
33% and 50% (v/v), EtOAc was added to the aqueous-adsorbent resin samples and extraction was
performed for 15 min at 25 s−1 in a Mixer Mill MM 400 (Retsch, Haan, Germany) for enhanced mass
transfer. The phases were separated by centrifugation (17,200
was dissolved in 300 µL EtOAc and 100 µL (R)-limonene (36 mM in EtOAc) as an internal standard.
×
g, 5 min) and 100 µL of the organic phase
¯
Analytics were performed using a gas chromatograph GC-2010 Plus (Shimadzu, Kyoto, Japan)
equipped with a flame ionization detector (FID) and a chiral Lipodex-E column (length 25 m, ø 0.25 mm,
Macherey-Nagel, Düren, Germany). The injection volume was set to 1
µ
L and the split ratio was
◦
◦
10. The injector temperature was set to 200 C and the detector temperature was set to 250 C.
All runs were performed with the same oven temperature program, i.e., 60 ◦C for 3 min followed by
3 ◦C min−1 up to 120 ◦C. Typical retention times were: (R)-limonene 7.5 min, (2R,5R)-DHC 17.4 min,
(2S,5R)-DHC 18.8 min, and (R)-carvone 20.2 min. Compound concentrations were determined using
a standard from 0.1 mM to 30 mM of the reference compounds. The application of a biphasic
system led to high fluctuations of the determined concentrations. Therefore, substrates and products
were summarized and normalized to the applied total concentration of 300 mM. Diastereomeric
excesses (de) were determined by comparison of the (2R,5R)-dihydrocarvone concentration with the
(2S,5R)-dihydrocarvone concentration. Corresponding standard deviations of three technical replicates
were between 0.01% and 0.04%. Initial (2R,5R)-dihydrocarvone formation rates were determined by
linear regression until a product concentration of 150 mM was achieved.
Author Contributions: Conceptualization, C.M., D.W.-B. and K.C. Data curation, K.C. Formal analysis, C.M. Funding
acquisition, D.W.-B. and K.C. Investigation, C.M., C.B. and F.K. Methodology, C.M., D.W.-B. and K.C. Project
administration, C.M., D.W.-B. and K.C. Resources, D.W.-B. Supervision, D.W.-B. and K.C. Validation, C.M., C.B.
and F.K. Visualization, C.M. Writing—original draft, C.M. Writing—review & editing, C.B., F.K D.W.-B. and K.C.
Funding: The Bavarian State Ministry of the Environment and Consumer Protection, BayBiotech, grant number
TLK01U-69036 gratefully funded this research. The German Research Foundation (DFG) and the Technical
University of Munich (TUM) in the framework of the Open Access Publishing Program funded the APC.
Acknowledgments: The authors would like to thank Maurits Brinkman and Melanie Knesebeck for their help with the
laboratory work as well as Ingmar Polte and Dominik Schäfer for sharing their distinct knowledge of bioprocesses.
The support of Christoph Mähler and Christian Burger by the TUM Graduate School is acknowledged as well.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
Sheldon, R.A.; Woodley, J.M. Role of Biocatalysis in Sustainable Chemistry. Chem. Rev. 2018, 118, 801–838.
[CrossRef] [PubMed]
Nestl, B.M.; Hammer, S.C.; Nebel, B.A.; Hauer, B. New generation of biocatalysts for organic synthesis.
Angew. Chem. 2014, 53, 3070–3095. [CrossRef] [PubMed]
Buchholz, K.; Kasche, V.; Bornscheuer, U.T. Biocatalysts and Enzyme Technology; 2. Aufl.; Wiley-VCH Verlag
GmbH & Co. KGaA: Weinheim, Deutschland, 2012.

Molecules 2019, 24, 2550
12 of 13
4.
Stuermer, R.; Hauer, B.; Hall, M.; Faber, K. Asymmetric bioreduction of activated C=C bonds using enoate
reductases from the old yellow enzyme family. Curr. Opin. Chem. Biol. 2007, 11, 203–213. [CrossRef]
[PubMed]
5.
6.
7.
8.
9.
Toogood, H.S.; Scrutton, N.S. New developments in ‘ene’-reductase catalysed biological hydrogenations.
Curr. Opin. Chem. Biol. 2014, 19, 107–115. [CrossRef] [PubMed]
Scholtissek, A.; Tischler, D.; Westphal, A.; van Berkel, W.; Paul, C. Old Yellow Enzyme-Catalysed Asymmetric
Hydrogenation: Linking Family Roots with Improved Catalysis. Catalysts 2017, 7, 130. [CrossRef]
Wang, X.; Saba, T.; Yiu, H.H.P.; Howe, R.F.; Anderson, J.A.; Shi, J. Cofactor NAD(P)H Regeneration Inspired
by Heterogeneous Pathways. Chem 2017, 2, 621–654. [CrossRef]
Wu, J.T.; Wu, L.H.; Knight, J.A. Stability of NADPH: Effect of Various Factors on Kinetics of Degradation.
Clin. Chem. 1986, 32, 314–319. [PubMed]
Bennett, B.D.; Kimball, E.H.; Gao, M.; Osterhout, R.; van Dien, S.J.; Rabinowitz, J.D. Absolute metabolite
concentrations and implied enzyme active site occupancy in Escherichia coli. Nat. Chem. Biol. 2009, 5, 593–599.
[CrossRef] [PubMed]
10. You, C.; Huang, R.; Wei, X.; Zhu, Z.; Zhang, Y.-H.P. Protein engineering of oxidoreductases utilizing
nicotinamide-based coenzymes, with applications in synthetic biology. Synthetic Syst. Biotechnol. 2017, 2,
208–218. [CrossRef] [PubMed]
11. Uppada, V.; Bhaduri, S.; Noronha, S.B. Cofactor regeneration—An important aspect of biocatalysis. Curr. Sci.
2014, 106, 946–957.
12. Mähler, C.; Kratzl, F.; Vogel, M.; Vinnenberg, S.; Weuster-Botz, D.; Castiglione, K. Loop Swapping as
a Potent Approach to Increase Ene Reductase Activity with Nicotinamide Adenine Dinucleotide (NADH).
Adv. Synth. Catal. 2019, 106, 946. [CrossRef]
13. Fu, Y.; Castiglione, K.; Weuster-Botz, D. Comparative Characterization of Novel Ene-Reductases from
Cyanobacteria. Biotechnol. Bioeng. 2013, 110, 1293–1301. [CrossRef] [PubMed]
14. Dong, Y.; McCullough, K.J.; Wittlin, S.; Chollet, J.; Vennerstrom, J.L. The structure and antimalarial activity of
dispiro-1,2,4,5-tetraoxanes derived from (+)-dihydrocarvone. Bioorg. Med. Chem. Lett. 2010, 20, 6359–6361.
[CrossRef] [PubMed]
15. Jansen, B.J.M.; Kreuger, J.A.; Groot, A.d. The conversion of (
−
)-and (+)-dihydrocarvone into chiral
intermediates for the synthesis of (
1447–1452. [CrossRef]
−
)-polygodial,(
−
)-warburganal and ( )-muzigadial. Tetrahedron 1989, 45,
−
16. Zhang, C.X.; Fang, L.J.; Bi, F.Q.; Li, Y.L. An enantioselective formal synthesis of ( )-thujopsene. Chin. Chem. Lett.
−
2008, 19, 256–258. [CrossRef]
17. Macías, F.A.; Aguilar, J.M.; Molinillo, J.M.G.; Rodríguez-Luís, F.; Collado, I.G.; Massanet, G.M.; Fronczek, F.R.
Studies on the Stereostructure of Eudesmanolides from Umbelliferae: Total Synthesis of (+)-Decipienin, A.
Tetrahedron 2000, 56, 3409–3414. [CrossRef]
18. Silva, V.D.; Stambuk, B.U.; Nascimento, M.d.G. Asymmetric reduction of (4R)-(-)-carvone catalyzed by
Baker’s yeast in aqueous mono- and biphasic systems. J. Mol. Catal. B Enzym. 2012, 77, 98–104. [CrossRef]
19. Castiglione, K.; Fu, Y.; Polte, I.; Leupold, S.; Meo, A.; Weuster-Botz, D. Asymmetric whole-cell bioreduction of
(R)-carvone by recombinant Escherichia coli with in situ substrate supply and product removal. Biochem. Eng. J.
2017, 117, 102–111. [CrossRef]
20. Wilms, B.; Hauck, A.; Reuss, M.; Syldatk, C.; Mattes, R.; Siemann, M.; Altenbuchner, J. High-cell-density
fermentation for production of L-N-carbamoylase using an expression system based on the Escherichia coli
rhaBAD promoter. Biotechnol. Bioeng. 2001, 73, 95–103. [CrossRef]
21. Lee, S.Y. High cell-density culture of Escherichia coli. Trends. Biotechnol. 1996, 14, 98–105. [CrossRef]
22. Hirata, T.; Matsushima, A.; Sato, Y.; Iwasaki, T.; Nomura, H.; Watanabe, T.; Toyoda, S.; Izumi, S. Stereospecific
hydrogenation of the CC double bond of enones by Escherichia coli overexpressing an enone reductase of
Nicotiana tabacum. J. Mol. Catal. B Enzym. 2009, 59, 158–162. [CrossRef]
23. Cramarossa, M.R.; Nadini, A.; Bondi, M.; Messi, P.; Pagnoni, U.M.; Forti, L. Biocatalytic reduction of (+)- and
(−)-carvone by bacteria. C. R. Chim. 2005, 8, 849–852. [CrossRef]
24. Van Dyk, M.S.; van Rensburg, E.; Rensburg, I.P.B.; Moleleki, N. Biotransformation of monoterpenoid ketones
by yeasts and yeast-like fungi. J. Mol. Catal. B Enzym. 1998, 5, 149–154. [CrossRef]

Molecules 2019, 24, 2550
13 of 13
25. Goretti, M.; Turchetti, B.; Cramarossa, M.R.; Forti, L.; Buzzini, P. Production of flavours and fragrances via
bioreduction of (4R)-(-)-carvone and (1R)-(-)-myrtenal by non-conventional yeast whole-cells. Molecules 2013
,
18, 5736–5748. [CrossRef] [PubMed]
26. Santos, R.A.M.d.; Souza, F.d.O.; Pilau, E.J.; Porto, C.; Gonçalves, J.E.; Oliveira, A.J.B.d.; Gonçalves, R.A.C.
Biotransformation of (+)-carvone and ( )-carvone using human skin fungi: A green method of obtaining
−
fragrances and flavours. Biocatal. Biotrans. 2017, 36, 396–400. [CrossRef]
27. Hamada, H.; Yasumune, H.; Fuchikami, Y.; Hirata, T.; Sattler, I.; Williams, H.J.; Ian Scott, A. Biotransformation
of geraniol, nerol and (+)- and (
1997, 44, 615–621. [CrossRef]
−)-carvone by suspension cultured cells of Catharanthus roseus. Phytochemistry
28. Hook, I.L.; Ryan, S.; Sheridan, H. Biotransformation of aliphatic and aromatic ketones, including several
monoterpenoid ketones and their derivatives by five species of marine microalgae. Phytochemistry 2003, 63,
31–36. [CrossRef]
29. Mülhart, C. Der Experimentator Molekurlarbiologie/Genomics; Spektrum Akademischer Verlag: Heidelberg, Germany,
2011; ISBN 9783827423689.
30. Sun, B.; Kantzow, C.; Bresch, S.; Castiglione, K.; Weuster-Botz, D. Multi-enzymatic one-pot reduction of
dehydrocholic acid to 12-keto-ursodeoxycholic acid with whole-cell biocatalysts. Biotechnol. Bioeng. 2013
110, 68–77. [CrossRef]
,
Sample Availability: Not available.
©
2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).