Palladium and platinum complexes of folic acid as new drug delivery systems for treatment of breast cancer cells

Article abstract of DOI:10.1016/j.molstruc.2020.129806

Cisplatin is administrated as an agent in treatment of various cancers by intercalation between DNA strands and inhibition of DNA replication. Among the various factors, two important reasons like inhibition of apoptosis by anti-apoptotic mechanisms and i

Full text of DOI:10.1016/j.molstruc.2020.129806

Journal of Molecular Structure 1229 (2021) 129806
Contents lists available at ScienceDirect
Journal of Molecular Structure
journal homepage: www.elsevier.com/locate/molstr
Palladium and platinum complexes of folic acid as new drug delivery
systems for treatment of breast cancer cells
Chenyang He , Mostafa Heidari Majd , Fereshteh Shiri , Somaye Shahrakic
a
b,∗
c
a
Department of Oncology, The Second Affiliated Hospital of Xi’an Jiaotong University, Xi’an, 710004, China
b
Department of Medicinal Chemistry, Faculty of Pharmacy, Zabol University of Medical, Sciences, Zabol, Iran
c
Department of Chemistry, University of Zabol, Zabol, Iran
a r t i c l e i n f o
a b s t r a c t
Article history:
Cisplatin is administrated as an agent in treatment of various cancers by intercalation between DNA
strands and inhibition of DNA replication. Among the various factors, two important reasons like inhibi-
tion of apoptosis by anti-apoptotic mechanisms and inability to distinguish normal cells from cancerous
led us to synthesize two new complexes of platinum and palladium containing folic acid (FA). Following,
the cytotoxic effects of complexes were studied using MTT assay in MCF-7 cells, then expression levels
of Bak1, Bclx and Caspase-3 genes were elucidated by Real-time RT-PCR technique. Also, the behavior of
complexes in the binding sites of folate receptor was described by molecular docking. All experiments
have confirmed that presence of FA could improve cytotoxicity, apoptosis and cellular uptake of cisplatin
Received 10 November 2020
Revised 19 December 2020
Accepted 21 December 2020
Available online 24 December 2020
Keywords:
Metallo-complexes
Real-time PCR
Targeting drug delivery
Molecular docking
Bak1/Bclx ratios
ꢀ
in MCF-7 breast cancer cells. In addition, formation of 2,2 -bipyridine palladium(II) chelate with FA de-
creased the anti-apoptotic Bclx levels in comparison with cisplatin.
©
2020 Elsevier B.V. All rights reserved.
1
. Introduction
Amongst these ligands, bipyridine (bpy) has gained popular-
ity because of their π stacking interactions with DNA base pairs
through van der waals forces and also hydrophobic forces. More-
over, the two nitrogen atoms in the heterocyclic rings allow
them to maximize their potential and acting as versatile chelating
agents. Several studies have shown that these nitrogen-chelating
compounds show individual anticancer activities through interac-
tions with cancer-related receptors, on the other hand, they can
bind to human serum albumin (HSA) which plays a significant role
in delivery of metal-based complexes to their cellular targets. In
general, it is confirmed that bipyridine can coordinate with pal-
ladium to form strong enough and soluble complexes in aqueous
media [8]. For instance, Asensio and co-workers [9] and Didgikar
et al. [10] have synthesized and characterized water-soluble palla-
dium complexes with bpy, and have studied their application as
anticancer agent against cancer cells.
One of the most important of transition metal complexes is
cisplatin and its analogs (carboplatin, oxaliplatin) which are used
in treatment of various cancers such as ovarian, colorectal, breast,
stomach and prostate [1]. This yellow crystalline powder is slightly
soluble in water and may transform slowly over time to the trans-
isomer [2]. Cisplatin has a square planar geometry because of
the four dsp2 hybrid orbitals, so it can intercalate between DNA
strands and inhibit its replication. According to this mechanism, it
is probably that cisplatin does not distinguish the difference be-
tween normal cells and cancerous cells, and causing inadvertent
severe side effects [3, 4]. On the other hand, the treatment of mul-
tiple cancers with cisplatin is accompanied by drug-resistant, be-
cause they can change the cellular uptake, inhibit the apoptosis
by anti-apoptotic mechanisms and also increase the detoxification,
drug efflux and DNA repair [4]. To overcome cisplatin resistance
and side effects, over 1000 complexes of platinum (Pt), platinum-
group metals such as palladium (Pd), transition metals and also
other rare earth metals were synthesized during the last decades
Although, only 40 agents from over 600,000 compounds in
testing phase were used in clinical stage; because many of them
haven’t specific effects on target tumor cells and their usage have
been limited as drugs for malignancies [11]. Furthermore, current
platinum drugs and analogues cannot target a specific receptor and
this poorly differentiating between cancer and normal cells is still
a major drawback of them. The active delivery of metal-based com-
plex drugs toward special receptors may significantly improve drug
penetration into tumors, as well as reducing the off-target side ef-
fects of the chemotherapeutic drugs. Active targeting can be per-
[
5-7]. Also, various ligands with crucial biological activities were
considered to developing the metal complexes.
∗
Corresponding author.
E-mail address: mostafamajd@live.com (M. Heidari Majd).
https://doi.org/10.1016/j.molstruc.2020.129806
0
022-2860/© 2020 Elsevier B.V. All rights reserved.

C. He, M. Heidari Majd, F. Shiri et al.
Journal of Molecular Structure 1229 (2021) 129806
formed by conjugation of a receptor mediated endocytosis agent
to recognize the specific high-expressed receptors and also reduce
the incidence of side effects.
by filtration and washed with acetone and kept in a vacuum des-
iccator over dried silica gel. The steps of synthesis were validated
by FTIR spectroscopy using Shimadzu IR PRESTIGE 21 spectropho-
tometer (Shimadzu Scientific Instruments, Tokyo, Japan). Also NMR
In our previous works, we had used of folic acid (FA) as a tar-
geting moiety for the folate receptors (FRs) that are often highly
expressed on the surface of breast cancer cells [12, 13]. Addition to
its biological functions, formation of cisplatin chelates with FA may
be led to extended release half-life, long blood circulation time
plus specific and efficient cellular uptake. To test all possibilities,
analysis of final complexes was taken up in D O by a BRUKER
2
500 MHz AVANCE III (Bruker, Rheinstetten, Germany) instrument.
2.4. Cell culture and in vitro cytotoxicity testing: MTT assay
ꢀ
we began by formation of eight-membered rings of 2,2 -bipyridine
Human breast cancer MCF-7 cells were routinely grown in 25
cm2 culture flasks at a seeding density of 5.0 × 10 cells/cm2 us-
ing RPMI 1640 media supplemented with 10% FBS plus 100 μL
of Penicillin G/Streptomycin [16, 17]. A CO2 incubator was used to
culture cells according to existing standards during cultivation and
during experiments. When MCF-7 cell lines reach about 80% con-
4
palladium(II) and also cisplatin via folic acid, then evaluated the
cytotoxicity of them on MCF-7.
2. Materials and method
4
fluence, the cells at a density of 1.2 × 10 cells/well were trans-
All chemicals were purchased from Sigma-Aldrich (St. Louis,
ferred onto 96-well culture plates and incubated for 24 h. There-
upon, the cells were treated with [Pd(bpy)FA], cis-[Pt(NH ) FA] and
MO, USA). MCF-7 cell line was obtained from Pasture Institute
Tehran, Iran). All media and cell culture components were ob-
(
3 2
cisplatin at eight different concentrations (ranging from 6.25 to
00 μM) for two period of 48 and 72 h. In timely manner, the
tained from either Caisson labs (North Logan, UT) or Gibco (Carls-
bad, CA). High Pure RNA Isolation Kit was obtained from Roche
8
Rotkreuz, Switzerland). EasyTM cDNA Synthesis kit was purchased
media was removed and cells were subjected to 200 μL of MTT
solutions composed of 150 μL of fresh media plus 50 μL of MTT
solutions (prepared as 2 mg/mL in PBS). Thereafter, plates were
incubated for 4 h at 37 °C in a CO2 incubator. Finally, the media
was aspirated off and absorbance of formed formazan crystals was
recorded at 570 nm utilizing a spectrophotometer (BioTek Instru-
ments, Inc., Bad Friedrichshall, Germany) and by adding 200 μL of
DMSO.
(
from Pars Tous Biotechnology (Mashhad, Iran).
ꢀ
2
.1. Synthesis of 2,2 -bipyridine palladium(II) dichloride complex
[
Pd(bpy)Cl2]
As described in previous works [14], PdCl2 (0.885 g, 5.0 mmol)
and NaCl (2.922 g, 50 mmol) was dissolved in a 100 ml flask con-
taining 50 ml distilled water and was stirred for 30 min at 60 °C.
2
.5. Real-time PCR analysis
ꢀ
2
,2 -bipyridine (0.780 g, 5.0 mmol) was dissolved in 100 ml of
water-ethanol (1:1 v/v) and then was added dropwise to the above
solution while stirring vigorously with the aid of the magnetic stir-
rer. . Stirring continued for another 2 h at RT and the crude yel-
lowish precipitate was filtered and then washed several times with
water, ethyl alcohol and acetone, respectively. Finally, the products
were dried at 40 °C. Yield was 93%.
For an incubation period of 24 h, MCF-7 cells (acceptable range:
6
1
.0 × 10 in T-25 culture flask) were treated with 50, 100 and
3
00 μM of cisplatin, cis-[Pt(NH ) FA] and [Pd(bpy)FA], respectively
3 2
[
18]. One flask without any treatment was also prepared as con-
trol. After which the cells were washed with PBS and were disso-
ciated from adherent surface using trypsin, they were centrifuged
at 3000 rpm for 5 min and resuspended in 200 μL PBS. Isolation of
total RNA from cultured cells was performed using High Pure RNA
Isolation Kit according to the manufacturer’s protocol. Briefly, cells
were lysed using 400 μL Lysis/-Binding buffer and were adjacent
to 90 μL DNase Incubation buffer plus 10 μL DNase I to remove
genomic DNA contamination. Total isolated RNA was collected by
adding of 100 μL Elution buffer into a clean, sterile 1.5 mL micro-
centrifuge tube. Purity and concentration of the isolated RNA were
determined by WPA Biowave II spectrophotometer (Biochrom Ltd,
Cambridge, UK) which absorbs over the 230–260 nm range. They
were stored at −80 °C for later analysis.
2
.2. Replacement of chloride ligands by aqua groups
Converting of [Pd(bpy)Cl ] to [Pd(bpy)(H O) ](NO ) was done
2
2
2
3 2
as described previously works [15]. For this purpose, [Pd(bpy)Cl2]
(
9 mg, 0.027 mmol) was suspended in 15 mL of buffer solution
of acetic acid and sodium acetate with pH of 3.5. Then, 9.17 mg
of AgNO3 (0.054 mmol) was added to the reaction mixture while
stirring was done in darkness for 7 h at 60 °C and then 12 h at
RT (30 °C). Whereupon the precipitated AgCl immediately removed
by centrifugation. Also, this process was done entirely for cisplatin
(
10 mg, 0.033 mmol) utilizing 11.21 mg of AgNO3 (0.066 mmol) to
Complementary DNA (cDNA) was synthesized using Pars Tous
EasyTM cDNA Synthesis kit according to the manufacturer’s pro-
tocol. Accordingly, four separate mixtures of 10 μL 2X buffer
mix, 2 μL enzyme mix, 6 μL isolated RNA and 2 μL DEPC-treated
water were prepared for total volume of 20 μL. Then, the re-
action mixtures were incubated at 25 °C for 10 min, 47 °C for
60 min and 85 °C for 5 min. Relative quantitation with RT-PCR
was done for apoptotic genes GAPDH- TTGCCATCAATGACCC-
CTTCA, CGCCCCACTTGATTTTGGA, Bak1-TCTGGGACCTCCTTAGCCCT,
form the diaqua species of it, cis-[Pt(NH ) (H O) ](NO ) .
3
2
2
2
3 2
2
.3. Synthesis of metal complexes of folic acid
For the first step, the pH of the folic acid solution is adjusted to
about 7.6–7.8 by adding 2.2 equivalent excess of NaHCO3 at about
60 °C with 125 rpm shaking for 10 min. Synthesis of two com-
plexes were done in two separate flasks. i, [Pd(bpy)(H O) ] com-
~
2
2
plex was stirred in 70 °C for 30 min and then the FA solution
11.92 mg, 0.027 mmol) was added dropwise to the reaction mix-
ture over 1 h and was stirred for another 6 h at 50 °C. ii, cis-
Pt(NH ) (H O) ] complex was stirred in 70 °C for 30 min and then
the FA solution (14.57 mg, 0.033 mmol) was added dropwise to the
reaction mixture over 1 h and was stirred for another 6 h at 50 °C.
The products were vacuum rotary evaporated to dryness (60°C,
AATGGGCTCTCACAAGGGTATT,
Bclx-TGGAAAGCGTAGACAAGGAGA,
(
TGCTGCATTGTTCCCATAGA and Caspase-3- TGCAGTCATTATGA-
GAGGCAAT, AAGGTTTGAGCCTTTGACCA using Applied Biosystems
StepOneTM instrument (Thermo Fisher Scientific, Massachusetts,
USA) through the following thermal cycling conditions: an holding
stage at 95 °C for 12 min followed by 40 cycles of 95 °C for 20 s,
55 °C for 20 s and 72 °C for 20 s, and finally melt curve stage
at 95 °C for 15 s, 60 °C for 60 s and 95 °C for 15 s. All reactions
were independently performed in duplicate, and the average cycle
[
3
2
2
2
2
50 rpm). The metal folate complexes were dispersed in 10 ml ace-
tonitrile/methanol (1:1) and then separated out from its solution
2

C. He, M. Heidari Majd, F. Shiri et al.
Journal of Molecular Structure 1229 (2021) 129806
threshold (CT) value was used for analysis. The GAPDH was used
as housekeeping gene for the normalization of CT values and the
fold change expression was calculated by ꢀꢀCT method [19].
2.7. Molecular docking
The binding pose, key interactions and the binding affinity of
the protein-ligand complex were anticipated using molecular dock-
ing [25, 26]. The mol structures of two complexes were generated
by Chem3D 15.0 and converted into single SDF chemical table for-
mat using Open Babel (v2.3.0). Since the X-ray crystallography of
the complex structures is not available, for this purpose we used
the DFT model described in the methodology section. The struc-
tures were optimized by Gaussian 09 at Density Functional The-
ory (DFT) procedure in B3LYP level with a LanL2DZ basis set for
Pd and Pt and 6–31 G basis set for other atoms. The LANL2DZ
basis set contains diffuse and polarization functions, as well as
effective core potential [27]. The output trajectories of MD sim-
ulation was using to molecular docking simulation. An evaluated
flexible molecular docking was performed using GOLD [28] using
ChemScore fitness function. The Genetic algorithm (GA) is used in
GOLD ligand docking to examine the ligand conformational flexi-
bility, along with the partial flexibility of the protein. The maxi-
mum number of runs was set to 10 for each complex, with the
default parameters (100 population size, 5 for the number of is-
lands, 100,000 number of operations and 2 for the niche size). De-
2
.6. Molecular dynamic simulation
The molecular dynamics simulation technique was performed
in order to provide a more refined and flexible structure systems
model for the docking procedure [20]. The crystal structures of
folate receptor (FR) was downloaded from the Protein Data Bank
(
PDB), along with the ID numbers of 4LRH [21]. Preparation the
protein including added hydrogens and missing atoms were done
using the web application playmolecule (www.playmolecule.org)
[
22]. Then, the water molecules removed. MD simulation was done
using the Gromacs 2019 simulation package running on a GPU
server. Amber99sb force field at a mean temperature of 300 K and
the physiological pH of 7 was applied. Chimera software [23] cal-
culated the AM1 partial charges and acpype program [24] gener-
ated the topology and coordinate files for the docked inhibitor. A
solute box distance of 1.0 nm was specified which sets the min-
imum distance of 2.0 nm between any two periodic images of a
protein complex. The box was filled with TIP3P water molecules
˚
˚
fault cut off values of 2.5 A (dH-X) for hydrogen bonds and 4.0 A
for van-der-Waals distance were used. When the solutions attained
+
and the system was neutralized with the addition of Na ions. Op-
timization of the system was applied using the steepest descent
algorithm through a 100 ps run. Then, during the first equilib-
rium step, atom positions of the macromolecule and ligand were
targeted to a position restraint using a force constant of 1000 kJ
˚
RMSD values within 2 A, GA docking was terminated. According
to the subsequent docking results, the lowest energy docked con-
formation, was selected as the binding mode. The visualization of
the docking results was conducted by applying BIOVIA Discovery
Studio client 2016. The interacting energies between each amino
acid with the lowest docking energy of the complexes into binding
site of protein, separately were calculated by Molegro Molecular
Viewer 2.5 (MMV) (http://www.molegro.com/mmv-product.php).
mol 1 nm
−
−2
in an NVT ensemble for 500 ns and the tempera-
ture was regulated to 300 K via V-rescale thermostats. Afterward,
the pressure of the system was stabilized under the NPT ensem-
ble over the course of the 500 ps equilibration phases. Finally, a
100 ns production MD simulation was run for data collection un-
der a well equilibrated system with a desired temperature and
pressure. The long-ranged electrostatic contributions were treated
using the particle-mesh Ewald (PME) method. The LINCS constraint
algorithm was used to constrain lengths of all covalent bonds. Fi-
nally, the protein was returned to the box center and the trajectory
was corrected in terms of the periodic boundary condition. The
root-mean-square deviation (RMSD) was calculated for the protein
backbone atoms of each frame over the entire course of the MD
simulation against the first frame as the reference to further de-
fine the equilibrium time range.
3. Result and discussion
3.1. Infrared spectra of metal complexes
In this study, prepared complex between folic acid and cis-
platin, as well as complex formed between folic acid and palla-
dium(II) were confirmed using FTIR. This method is an appropri-
ate technique to understand the intermolecular interaction of com-
plexes and a comparison of FTIR spectra of folic acid with that of
Fig. 1. FTIR spectra of A) pure Folic acid, B) cis-[Pt(NH3)2FA] and C) [Pd(bpy)FA].
3

C. He, M. Heidari Majd, F. Shiri et al.
Journal of Molecular Structure 1229 (2021) 129806
Fig. 2. Structures of newly synthesized complexes. A) cis-[Pt(NH3)2FA] and B)
[
Pd(bpy)FA].
the products after interaction. As shown in Fig. 1A, the bands for
−1
pure FA between 3300–3550 cm
are due to the hydroxyl (OH)
and NH groups of glutamic acid moiety and of pterin ring, respec-
tively. Also, the stretching vibration peak related to C=O of car-
−1
boxyl groups appears at 1701cm , while the bending mode of
NH groups are clear at 1604cm 1. One highlight of the pure FA
−
spectrum is that there is no absorption peak between 2000 and
800cm 1 [29].
−
2
When folic acid formed a complex with Pt or Pd, small shifts
in the absorption peaks position with respect to pure FA occur,
as obvioused in Fig. 1B and C. Furthermore, a new band appears
at ~2300cm 1 which is ascribed to C=N H of pterin ring [30],
−
+
−1
while the stretching vibration of C=O (1701cm ) of free carboxylic
groups is shifted or disappeared in the spectra of prepared com-
−
plexes which is depended on the coordination mode of the COO
group with the metal ions [31]. This fact revealed that both car-
boxyl groups would change by the same amount and participate as
monodentate ligand, therefore the expected structures of the two
complexes are according to Fig. 2 [32]. In other words, FA generally
acts as a bidentate ligand via two monodentate carboxylate groups
[
31].
If pay special attention to FTIR spectrum of cis-[Pt(NH ) FA]
3
2
−
(
Fig. 1B), two strong peaks are seen at 3294 and 3394 cm 1 which
ascribed to primary amines of cisplatin [33], while Fig. 1C showed
−1
an absorbance in 3410 cm related to secondary amine groups of
FA.
Fig. 3. The theoretical IR spectra for (a) complex A (b) complex B (c) Folic acid.
DFT calculations can provide molecular-level information that
used to valid the experimental IR spectra. As can be seen in Fig. 3
our DFT/B3LYP calculations show that the experimental and quan-
tum chemical calculations are consistent.
tunately, cytotoxicity or apoptosis are sometimes induced in nor-
mal cells, thus, platinum complexes might also lead to diverse
side-effects such as bone marrow-suppression, peripheral neuro-
or renal-toxicity [35]. Hence, there is particular interest in the syn-
thesis of the anticancer agents with new metals and ligands to
minimize severe side effects. One of the best metals with simi-
lar hypoallergenic properties with platinum is palladium, and one
of the best DNA intercalator ligands is bipyridine. Many works
confirmed that Pd complexes containing bpy are highly effective
against several cancer cell lines [36-38], but in none of them the
targeted delivery into tumor cells weren’t anticipated.
From the 1H NMR results, it is conceivable that two complexes
are formed. The specific frequencies related to cis-[Pt(NH ) FA]
3
2
showed clearly chemical groups attributable to FA moiety: (δ 1.98–
.28 related to 4H of methylene groups, –CH –CH -), (δ 4.39 re-
2
2
2
lated to 2H of another methylene, Ph-NH-CH -), (δ 4.42 related
2
to 1H of methine, -CO–NH–CH–CO-), (δ 6.71–7.2 related to 4H of
phenyl group), (δ 8.34 related to 1H of amide group, Ph–CO–NH-),
(
δ 8.61 related to 2H of amine group of pteridine ring) and (δ 9.03
related to 1H of 2-pyrazine ring).
In 1H NMR spectrum of [Pd(bpy)FA], in addition to the specific
frequencies of FA, peaks related to 8H of –CH- groups attributable
to bpy are also detected at δ 7.09, 7.57, 8.59, and 8.78.
Therefore, we decided to synthesis two new complexes of Pt
and Pd utilizing folic acid with the aim of prolong drug action
and maintenance of prescribed dose within a therapeutic window.
Since the FRs are overexpressed on MCF-7 cell lines [12], they
3
.2. Cytotoxicity effects of metal complexes
were selected for cytotoxicity evaluation of cis-[Pt(NH ) FA] and
3 2
[
Pd(bpy)FA] in comparison to cisplatin. As it is illustrated in Fig. 4,
Due to the efficacy of DNA crosslinkers in broad number of ma-
the viability of MCF-7 cell lines is reliant on concentrations of new
complexes and time of treatment, while pure cisplatin display only
a trend of time dependent inhibitory effect.
lignancies, almost half of patients with cancer receive cisplatin or
its analogues as standard chemotherapeutic regimens [34]. Unfor-
4

C. He, M. Heidari Majd, F. Shiri et al.
Journal of Molecular Structure 1229 (2021) 129806
Fig. 4. Cytotoxicity evaluation of cisplatin, cis-[Pt(NH3)2FA] and [Pd(bpy)FA] on MCF-7 cell lines after 48 and 72 h of exposure.
Fig. 5. The root-mean-square deviation (RMSD) (nm) of FR for the backbone atoms in 100 ns MD simulation for two states of apo (blue) and complex (red). (For interpreta-
tion of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Table 1
3
.3. Apoptotic gene expression
IC50 (μM) values of used compounds
in MTT assay.
Cisplatin is able to exert its cytotoxicity to cancer cells via inter-
Compounds
48 h
72 h
action with DNA and proteins which can ultimately result in DNA
Cisplatin
43
33
damage and also cell death [39]. A similar performance is also ob-
ꢀ
cis-[Pt(NH3)2FA]
96
87
served for other planar metal complexes like 2,2 -bipyridine Pd(II),
[
Pd(bpy)FA]
266
190
which act as DNA intercalator [38]. Also, several studies have re-
vealed that cisplatin exhibited signs of apoptosis to some extent in
leukemic, renal and prostate cells, contrary to earlier reports [38-
4
0]. But, it is clearly confirmed that MCF-7 cell lines are relatively
resistant to cisplatin, and by enhancing the sensitivity in MCF-7 us-
ing p53 dependent apoptotic pathway or down-regulation of cyclin
D1 could increase cisplatin-induced apoptosis [41, 42].
So that, the high concentrations of cis-[Pt(NH ) FA] can reduce
3
2
Accordingly, we decided to synthesis two new complexes of Pt
and Pd using FA and evaluated the apoptosis ability of them on ex-
pression of Bclx, Bak1 and Caspase-3 in MCF-7 cell lines. Because,
we hypothesize that on one hand, they are able to specifically tar-
get the FR-positive MCF-7 cells; on the other hand, FA may have
a noticeable impact on apoptosis of MCF-7 cells. This hypothesis
was originated from role of FA in inducing the apoptosis in pre-
malignant gastric lesions [43]; Da-Zhong Cao et al. confirmed that
treatment by FA affects up-regulation of tumor suppressor gene
p53 and down-regulation of apoptosis-associated gene bcl-2.
Therefore investigation on Bcl-2 protein family can provide
an initial knowledge about the mitochondria-mediated apoptotic
both cell proliferation and viability to about 5% of the control after
2 h of treatment. In high concentrations, cis-[Pt(NH ) FA] showed
7
3
2
better effects as comparison to cisplatin, while [Pd(bpy)FA] had a
somewhat weaker effect at all concentrations in contrast with cis-
platin.
According to Table 1, the IC50 values of 33, 87 and 190 μM
were achieved for cisplatin, cis-[Pt(NH ) FA] and [Pd(bpy)FA] fol-
3
2
lowing 72 h of treatment, respectively. All of findings confirm that
cis-[Pt(NH ) FA] and [Pd(bpy)FA] could be potential compounds to
3
2
target FRs on breast cancer cells, and also existence of FA in con-
struction of complexes substantially sustain the release kinetics of
cisplatin from the pseudo-carriers.
5

C. He, M. Heidari Majd, F. Shiri et al.
Journal of Molecular Structure 1229 (2021) 129806
Fig. 6. Atomic positional fluctuations ( A˚ ) of Cα atoms in the ligand-bound protein (blue line) compared to the ligand-free protein (red dotted line). (For interpretation of the
references to colour in this figure legend, the reader is referred to the web version of this article.)
Table 2
Real-time PCR analysis of mRNA levels of apoptotic genes in MCF-7 cells
−
ꢀꢀCT
(
Values expressed using RQ which is equal with2
).
Control
cis-[Pt(NH3)2FA]
[Pd(bpy)FA]
Cisplatin
Bclx
1
1
1
0.00247
7.73
0.0213
0.226
1.56
1.59
1.62
Bak1
Caspase-3
2.98
0.0486
tein levels of Bak1 mRNA were significantly upregulated after 24 h
of treatment by cis-[Pt(NH ) FA] (Table 2).
3
2
As it is evident from Table 2, Bak1/Bclx ratios of synthesized
complexes containing FA were increased compared with cisplatin
(
P-value < 0.05) which confirmed the ability of them in induc-
ing of apoptosis. These ratios for cis-[Pt(NH ) FA] and [Pd(bpy)FA]
3
2
were 3129 and 10.61, while this ratio for cisplatin was calculated
.02. Thus the role of FA in inducing apoptosis in the MCF-7 breast
1
cell lines is well characterized.
Fig. 7. Optimized geometries of A and B complexes in the gas-phase obtained with
Unlike the Bcl-2 family of proteins which are the regulators of
the intrinsic apoptotic pathway, caspase-3 can active via the in-
trinsic and extrinsic apoptotic pathways [46]. Thus, the level of
caspase-3 activation was determined to further elucidate the apop-
tosis pathway in MCF-7 cell lines. Results of Table 2 illustrates
the DFT/B3LYP theoretical method.
pathway [44]. Some proteins of this family, including Bcl-2 and
Bclx, inhibit apoptosis, while some of them such as Bax and Bak,
promote apoptosis. So it seems anti-apoptotic proteins with pro-
apoptotic proteins regulate the sensitivity of a cell against apop-
tosis [45]. For these reasons, we analyzed all complexes’ poten-
tial capability in expression levels of Bclx and Bak1 in MCF-7 cell
lines using real-time PCR. The result demonstrated that the pro-
that cis-[Pt(NH ) FA] increases the levels of caspase-3 associated
3
2
with apoptosis, therefore it suggests that during treatment with
this new complex, the mitochondrial (intrinsic) pathway sensitive
to Bak is responsible for caspase-3 activation. While, [Pd(bpy)FA]
regulates apoptosis by decreasing the expression of anti-apoptotic
Fig. 8. The 2D and 3D interaction pattern of complex A with FR (pdb ID: 4lrh) Hydrogen bond and hydrophobic interactions were shown as green and pink dotted line,
respectively. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
6

C. He, M. Heidari Majd, F. Shiri et al.
Journal of Molecular Structure 1229 (2021) 129806
Fig. 9. The 2D and 3D interaction pattern of complex B with FR (pdb ID: 4lrh) Hydrogen bond and hydrophobic interactions were shown as green and pink dotted line,
respectively. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Table 3
ChemScore, binding energy and amino acid residues involved in docking results of complex A and B with FR.
System
Hydrophobic interaction
Hydrogen bond
Van der Waals
binding energy(kcal/mol)
Score
Complex A-FR
Complex B-FR
TYR60, TYR85,TRP102,TRP140,TRP171
PHE62,TRP102,TRP171,TYR175
PHE78,ASP81,HIS135
TYR60, ASP81
PHE62,TRP64,THR82,ARG103
−38.71
−32.23
35.72
30.58
LYS19, TYR85,ARG106,VAL110SER174
Table 4
Hydrogen bond interaction energies and bond length between the complexes A and B with responsive amino acid
in molecular docking .
Complex A
Amino acid
Complex B
Amino acid
Energy(kcal/mol)
Bond length ( A˚ )
Energy(kcal/mol)
Bond length ( A˚ )
ASP81
ASP81
HIS135
PHE78
−2.5
2.64
3.48
3.19
2.76
ASP81
TYR60
−2.23
−2.01
2.97
−0.31
−2.02
−2.5
3.019
Bclx levels, but don’t have any noticeable effect on expression of
caspase-3.
3.5. Molecular docking analysis
The behavior of small molecules in the binding sites of target
proteins can be described by molecular docking, as a complemen-
tary method. The method aims to identify correct poses of ligands
in the binding site of a protein and to anticipate the affinity be-
tween the ligand and the protein. The optimized structures of A
and B complexes using DFT calculated are presented in Fig. 7.
Here, complexes A and B were located binding site of the pro-
tein by flexible docking using the GOLD program. Table 3 shows
the ChemScores fitness value and binding energies of GOLD molec-
ular docking of folate receptor to complexes A and B. The predicted
binding energy of complex A-FR interactions (−38.71 kcal/mol and
Score=35.72) was higher (more negative) than that complex B−FR
interactions (−32.23 kcal/mol and Score=30.58), confirming that
complex A could form a more stable complex with FR compared
with complex B. In addition, from Table 1 the calculated IC50 val-
ues are 87 and 190 μM for complex A and B in MTT assay follow-
ing 72 h of treatment, respectively (or 96 and 266 μM for com-
plex A and B following 48 h). As the inhibition constant can in-
dicate the effectiveness of the ligand in inhibiting biological func-
tion of the protein and a smaller value means a greater inhibition
potency [50], complex A have a more effective than complex B.
This has also been proven by better induction of genes associated
with apoptosis. The results of the docking experiments, type of
important interaction including hydrogen bond, hydrophobic, and
Van der Waals interactions and all near residues for each system
docking are shown in Table 3. When a distance between a non-
3
.4. Molecular dynamic analysis
MD simulation was done in order to provide a more refined and
flexible structure systems model for the docking procedure. In this
regard, a 100 ns MD simulation was performed on the two-ligand
free and ligand-bound systems to obtain multiple conformations of
the protein structure. For assessing the conformational stability of
the complex and apo enzymes, the trajectory stability and flexi-
bility of the system was analyzed by root-mean-square deviation
as functions of time (Fig. 5). The RMSD curve of the simulation
confirms that both ligand-bound complex and ligand-free enzymes
have reached a stable steady state after 100 ns. Therefore, the tra-
jectories of the MD simulation after equilibrium were reliable for
using post-simulation analyses [47-49].
With the aim of determining whether the binding of ligand af-
fects the dynamic behavior of residues, the root mean square fluc-
tuation (RMSF) plot of the backbone Cα atoms of the ligand-bound
and ligand-free was used to describe flexibility differences among
residues. The RMSF of the backbone Cα atoms of each residue of
apo and in complex with ligand structures were calculated in order
to analyze the flexibility of the backbone structure. Higher RMSF
value is related to more flexible movement for ligand-free whereas
the low one shows less flexibility for ligand-bound forms (Fig. 6).
7

C. He, M. Heidari Majd, F. Shiri et al.
Journal of Molecular Structure 1229 (2021) 129806
Table 5
teins predicted that these complexes could form stable binds with
folate receptors and treat the breast cancer cells.
Interaction energy between the complex A and responsive
amino acid residues of FR in molecular docking. .
Amino acid residues
Interaction energy kJ mol 1
−
Declaration of Competing Interest
ASP81
−8.32647
−1.20127
−21.1998
−2.22426
−15.6633
−1.30742
−11.9158
−1.12735
−29.2222
−0.3644
GLN100
HIS135
LYS136
PHE62
PHE78
THR82
TRP64
The authors declare that they have no known competing finan-
cial interests or personal relationships that could have appeared to
influence the work reported in this paper.
CRediT authorship contribution statement
TRP102
TRP134
TRP138
TRP140
TRP171
TYR60
TYR85
Chenyang He: Writing - review & editing. Mostafa Heidari
Majd: Supervision, Investigation, Data curation, Writing - original
draft. Fereshteh Shiri: Conceptualization, Visualization, Software.
Somaye Shahraki: Methodology, Validation.
−1.53823
−17.5196
−21.6453
−17.3048
−13.7086
Acknowledgments
Table 6
Interaction energy between the complex B and responsive
amino acid residues of FR in molecular docking. .
The authors thank the Deputy of Research and Technology of
Zabol University of Medical Sciences, for all support provided.
Interaction energy kJ mol 1
−
Amino acid residues
ARG61
ARG103
ARG106
ASP81
−0.48313
−5.41557
−4.6137
References
[
1] H. Mansouri-Torshizi, S. Zareian-Jahromi, A. Ghahghaei, S. Shahraki, F. Khos-
ravi, M. Heidari Majd, Palladium(II) complexes of biorelevant ligands. Synthe-
sis, structures, cytotoxicity and rich DNA/HSA interaction studies, J. Biomol.
Struct. Dyn. 36 (2018) 2787–2806.
−12.1029
−4.33754
−0.31284
−13.8942
−0.35241
−1.49955
−7.53746
−7.46916
−0.39465
−35.6766
−20.5384
−30.3602
−12.0476
−25.0334
−5.74559
−6.38852
LEU84
LEU108
PHE62
PHE78
SER101
SER174
THR82
TRP64
[2] S. Dasari, P.B. Tchounwou, Cisplatin in cancer therapy: molecular mechanisms
of action, Eur. J. Pharmacol. 740 (2014) 364–378.
[3] B.J. Pages, D.L. Ang, E.P. Wright, J.R. Aldrich-Wright, Metal complex interactions
with DNA, Dalton Trans. 44 (2015) 3505–3526.
[4] A.-.M. Florea, D. Büsselberg, Cisplatin as an anti-tumor drug: cellular mecha-
nisms of activity, drug resistance and induced side effects, Cancers 3 (2011)
1351–1371.
TRP102
TRP140
TRP171
TYR60
TYR85
TYR175
VAL107
[
5] S. Shahraki, F. Shiri, Z. Razmara, M.H. Majd, A comparative study of the impact
of metal complex size on the in vitro biological behavior of hetero di- and
poly-nuclear Mn-Co complexes, J. Mol. Struct. 1178 (2019) 617–629.
6] A.I. Matesanz, I. Leitao, Souza P., Palladium (II) and platinum (II) bis (thiosemi-
carbazone) complexes of the 2, 6-diacetylpyridine series with high cytotoxic
activity in cisplatin resistant A2780cisR tumor cells and reduced toxicity, J. In-
org. Biochem. 125 (2013) 26–31.
[
[
7] M. Tanaka, H. Kataoka, S. Yano, H. Ohi, K. Kawamoto, T. Shibahara, T. Mi-
zoshita, Y. Mori, S. Tanida, T. Kamiya, Anti-cancer effects of newly developed
chemotherapeutic agent, glycoconjugated palladium (II) complex, against cis-
platin-resistant gastric cancer cells, BMC cancer 13 (2013) 237.
hydrogen atom of a protein and ligand is smaller than the sum of
[
8] G. Sz o˝ ke, A. Takács, Z. Berente, A. Petz, L. Kollár, Synthesis of amino-substi-
tuted pyridylglyoxylamides via palladium-catalysed aminocarbonylation, Tetra-
hedron 72 (2016) 3063–3067.
˚
their VDW radii plus a threshold of 0.5 A, a VDW contact can be
founded. Nitrogen and oxygen are hydrogen bond acceptors while
hydroxyl and amine groups are donor. To form a hydrogen bond,
[9] J.M. Asensio, S. Tricard, Y. Coppel, R. Andrés, B. Chaudret, E. de Jesus, Synthesis
of Water-Soluble Palladium Nanoparticles Stabilized by Sulfonated N-Hetero-
cyclic Carbenes, Chem. Eur. J. 23 (2017) 13435–13444.
˚
the distance and angle between donor-acceptor should be ≤ 3.5 A
and ≤ 30, respectively [51]. Hydrogen bonding is the predomi-
nant phenomenon in two systems. Hydrogen bond interaction en-
ergies and bond length between the two complexes and responsive
amino acid in molecular docking are depicted in Table 4. Also, two-
and three-dimensional schemes of molecular docking are shown in
Figs. 8 and 9. In the end, list of all target residues involved in an
interaction with the inspected ligands were display in Tables 5 and
[
10] M.R. Didgikar, S.S. Joshi, S.P. Gupte, M.M. Diwakar, R.M. Deshpande,
R.V. Chaudhari, Oxidative carbonylation of amine using water-soluble palla-
dium catalysts in biphasic media, J Mol Catal A Chem 334 (2011) 20–28.
[11] G. Schwartsmann, B. Winograd, H.M. Pinedo, The main steps in the develop-
ment of anticancer agents, Radiother. Oncol. 12 (1988) 301–313.
[12] A. Sargazi, M. Azhoogh, S. Allahdad, M. Heidari Majd, Evaluation of
supramolecule conjugated magnetic nanoparticles as a simultaneous carrier
for methotrexate and tamoxifen, J. Drug Deliv. Sci. Technol. 47 (2018) 115–122.
[
[
[
[
13] M. Heidari Majd, D. Asgari, J. Barar, H. Valizadeh, V. Kafil, A. Abadpour,
E. Moumivand, J.S. Mojarrad, M.R. Rashidi, G. Coukos, Y. Omidi, Tamoxifen
loaded folic acid armed PEGylated magnetic nanoparticles for targeted imaging
and therapy of cancer, Colloid. Surf. B: Biointerface. 106 (2013) 117–125.
6
.
4
. Conclusion
14] M. Saeidifar, H. Mansouri-Torshizi, A. Divsalar, A.A. Saboury, Novel 2,
ꢀ
2
-bipyridine palladium (II) complexes with glycine derivatives: synthesis,
Folic acid acts as a bidentate ligand via two monodentate car-
characterization, cytotoxic assays and DNA-binding studies, J. Iran. Chem. Soc.
0 (2013) 1001–1011.
1
boxylate groups to form newly complexes with Pt or Pd and con-
trol specific endocytosis in breast cancer cells. In line with this
claim, MTT assay confirmed that newly synthesized complexes
could be potential compounds to target FRs on breast cancer cells
and exhibited cytotoxic activity against them. On the other hand,
the results of real-time PCR demonstrated that Bak1/Bclx ratios of
synthesized complexes containing FA increased compared with cis-
platin, and confirmed the ability of them in inducing of apoptosis.
Also, the behavior of molecules in the binding sites of target pro-
15] H. Mansouri-Torshizi, M. Eslami-Moghadam, A. Divsalar, A.A. Saboury,
DNA-Binding Studies of Some Potential Antitumor 2, 2ꢀ-bipyridine Pt (II)/Pd
(II) Complexes of piperidinedithiocarbamate. Their synthesis, Acta Chim. Slov.
(2011) 58.
16] A. Sargazi, F. Shiri, S. Keikha, M.H. Majd, Hyaluronan magnetic nanoparticle
for mitoxantrone delivery toward CD44-positive cancer cells, Colloid. Surf. B:
Biointerfaces 171 (2018) 150–158.
[
17] S. Shahraki, M.H. Majd, A. Heydari, Novel tetradentate Schiff base zinc(II) com-
plex as a potential antioxidant and cancer chemotherapeutic agent: Insights
from the photophysical and computational approach, J. Mol. Struct. 1177 (2019)
536–544.
8

C. He, M. Heidari Majd, F. Shiri et al.
Journal of Molecular Structure 1229 (2021) 129806
[
18] A. Sargazi, A. Barani, M. Heidari Majd, Synthesis and Apoptotic Efficacy of
Biosynthesized Silver Nanoparticles Using Acacia luciana Flower Extract in
MCF-7 Breast Cancer Cells: Activation of Bak1 and Bclx for Cancer Therapy,
Bionanoscience 10 (2020) 683–689.
[36] M. Saeidifar, H. Mirzaei, N.A. Nasab, H. Mansouri-Torshizi, Mononuclear Pd
(II) complex as a new therapeutic agent: Synthesis, characterization, biologi-
cal activity, spectral and DNA binding approaches, J. Mol. Struct. 1148 (2017)
339–346.
[
19] J. Barar, V. Kafil, M.H. Majd, A. Barzegari, S. Khani, M. Johari-Ahar, D. As-
gari, G. Cokous, Y. Omidi, Multifunctional mitoxantrone-conjugated magnetic
nanosystem for targeted therapy of folate receptor-overexpressing malignant
cells, J. Nanobiotechnol. (2015) 13.
[37] Y. Yamada, D. Koori, Y. Oshikawa, M. Koikawa, Stereospecific interaction of op-
tically active sulfur-bridged dinuclear Co(III)–Pt(II) complex with pseudo-enan-
tiomeric Co(III)–M(II) (M: pd or Pt) complex involving unequivalent π elec-
tronic system, Inorganica Chim. Acta 450 (2016) 225–231.
[
20] F. Shiri, S. Pirhadi, J.B. Ghasemi, Dynamic structure based pharmacophore
modeling of the Acetylcholinesterase reveals several potential inhibitors, J.
Biomolecul. Struct. Dyn. 37 (2019) 1800–1812.
[38] Z. Sorinezami, H. Mansouri-Torshizi, M. Aminzadeh, A. Ghahghaei, N. Jamgo-
hari, M. Heidari Majd, Synthesis of new ultrasonic-assisted palladium oxide
nanoparticles: an in vitro evaluation on cytotoxicity and DNA/BSA binding
properties, J. Biomolecul. Struct. Dyn. 37 (2019) 4238–4250.
[39] K.M. Henkels, J.J. Turchi, Cisplatin-induced apoptosis proceeds by cas-
pase-3-dependent and-independent pathways in cisplatin-resistant and-sensi-
tive human ovarian cancer cell lines, Cancer research 59 (1999) 3077–3083.
[40] B.S. Cummings, R.G. Schnellmann, Cisplatin-induced renal cell apoptosis: cas-
pase 3-dependent and-independent pathways, J. Pharmacol. Exp. 302 (2002)
8–17.
[
21] C. Chen, J. Ke, X.E. Zhou, W. Yi, J.S. Brunzelle, J. Li, E.L. Yong, H.E. Xu,
K. Melcher, Structural basis for molecular recognition of folic acid by folate
receptors, Nature 500 (2013) 486–489.
[
22] G. Martínez-Rosell, T. Giorgino, G. De Fabritiis, PlayMolecule ProteinPrepare: a
web application for protein preparation for molecular dynamics simulations, J.
Chem. Inf. Model. 57 (2017) 1511–1516.
[
23] E.F. Pettersen, T.D. Goddard, C.C. Huang, G.S. Couch, D.M. Greenblatt, E.C. Meng,
T.E. Ferrin, UCSF Chimera—A visualization system for exploratory research and
analysis, J. Comput. Chem. 25 (2004) 1605–1612.
[41] C.W. Yde, O.G. Issinger, Enhancing cisplatin sensitivity in MCF-7 human breast
cancer cells by down-regulation of Bcl-2 and cyclin D1, Int J Oncol 29 (2006)
1397–1404.
[42] O. Kutuk, E.D. Arisan, T. Tezil, M.C. Shoshan, H. Basaga, Cisplatin overcomes
Bcl-2-mediated resistance to apoptosis via preferential engagement of Bak:
critical role of Noxa-mediated lipid peroxidation, Carcinogenesis 30 (2009)
1517–1527.
[
24] A.W.S. Da Silva, W.F. Vranken, ACPYPE-Antechamber python parser interface,
BMC research notes 5 (2012) 367.
[
25] J.B. Ghasemi, A. Abdolmaleki, F. Shiri, Molecular docking challenges and limi-
tations, in: Pharmaceutical Sciences: Breakthroughs in Research and Practice,
IGI Global, 2017, pp. 770–794.
[
26] A. Abdolmaleki, F. Shiri, J.B. Ghasemi, in: Computational Multi-Target Drug
Design, Multi-Target Drug Design Using Chem-Bioinformatic Approaches,
Springer, 2018, pp. 51–90.
27] C.E. Check, T.O. Faust, J.M. Bailey, B.J. Wright, T.M. Gilbert, L.S. Sunderlin, Addi-
tion of polarization and diffuse functions to the LANL2DZ basis set for p-block
elements, J. Phys. Chem. A. 105 (2001) 8111–8116.
[43] D.Z. Cao, W.H. Sun, X.L. Ou, Q. Yu, T. Yu, Y.Z. Zhang, Z.Y. Wu, Q.P. Xue,
Y.L. Cheng, Effects of folic acid on epithelial apoptosis and expression of Bcl-2
and p53 in premalignant gastric lesions, World J 11 (2005) 1571.
[44] N. Susnow, L. Zeng, D. Margineantu, D.M. Hockenbery, Bcl-2 family proteins as
regulators of oxidative stress, in: SSemin Cancer Biol, Elsevier, 2009, pp. 42–49.
[45] C. Bauer, C. Hees, A. Sterzik, F. Bauernfeind, R. Mak’Anyengo, P. Duewell,
H.-.A. Lehr, E. Noessner, R. Wank, A. Trauzold, Proapoptotic and Antiapoptotic
Proteins of the Bcl-2 Family Regulate Sensitivity of Pancreatic Cancer Cells To-
ward Gemcitabine and T-Cell–mediated Cytotoxicity, J. Immunother. 38 (2015)
116–126.
[
[
28] G. Jones, P. Willett, R.C. Glen, A.R. Leach, R. Taylor, Development and validation
of a genetic algorithm for flexible docking, J. Mol. Biol. 267 (1997) 727–748.
29] J. Zhang, S. Rana, R. Srivastava, R. Misra, On the chemical synthesis and drug
delivery response of folate receptor-activated, polyethylene glycol-functional-
ized magnetite nanoparticles, Acta Biomater 4 (2008) 40–48.
[
[46] K. Boland, L. Flanagan, J.H. Prehn, Paracrine control of tissue regeneration and
cell proliferation by Caspase-3, Cell Death Dis 4 (2013) 725.
[
30] Y. He, X. Wang, P. Jin, B. Zhao, X. Fan, Complexation of anthracene with folic
acid studied by FTIR and UV spectroscopies, Spectrochim. Acta A Mol. Biomol.
Spectrosc. 72 (2009) 876–879.
[47] K. Kumar, A. Anbarasu, S. Ramaiah, Molecular docking and molecular dynamics
studies on β-lactamases and penicillin binding proteins, Mol Biosyst. 10 (2014)
891–900.
[
31] E. Hamed, M. Attia, K. Bassiouny, Applications, Synthesis, spectroscopic and
thermal characterization of copper (II) and iron (III) complexes of folic acid
and their absorption efficiency in the blood, Bioinorg Chem Appl. (2009
[48] E.J. Chaves, I.c.Q. Padilha, D.t.A. Araújo, G.B. Rocha, Determining the Relative
Binding Affinity of Ricin Toxin A Inhibitors by Using Molecular Docking and
Nonequilibrium Work, J Chem Inf Model 58 (2018) 1205–1213.
[49] N. Sharma, A. Murali, S.K. Singh, R. Giri, Epigallocatechin gallate, an active
green tea compound inhibits the Zika virus entry into host cells via binding
the envelope protein, Int. J. Biol. Macromol. 104 (2017) 1046–1054.
[50] A. Madeswaran, M. Umamaheswari, K. Asokkumar, T. Sivashanmugam, V. Sub-
hadradevi, P. Jagannath, silico docking studies of phosphodiesterase inhibitory
activity of commercially available flavonoids, Orient. Pharm. Exp. Med. 12
(2012) 301–306.
(2009).
[
32] M.A. El-Wahed, M. Refat, S. El-Megharbel, Synthesis, spectroscopic and thermal
characterization of some transition metal complexes of folic acid, Spectrochim.
Acta A Mol. Biomol. Spectrosc. 70 (2008) 916–922.
[
33] Y.L. Lai, C.C. Lin, S.R. Hsu, S.K. Yen, Electrochemical Deposition of Cisplatin on
Pure Magnesium, J. Electrochem. Soc. 165 (2018) 196–205.
[
34] S.N. Senadheera, T. Zhang, C.E. Groer, M.L. Forrest, Formation of platinum (II)
as a six member ring for sustained polymeric delivery, Eur. J. Med. Chem. 136
(
2017) 452–456.
[51] T. Damghani, T. Sedghamiz, S. Sharifi, S. Pirhadi, Critical c-Met-inhibitor inter-
actions resolved from molecular dynamics simulations of different c-Met com-
plexes, J. Mol. Struct. 1203 (2020) 127456.
[
35] A.M. Florea, D. Büsselberg, Cisplatin as an anti-tumor drug: cellular mecha-
nisms of activity, drug resistance and induced side effects, Cancers 3 (2011)
1351–1371.
9