Substrate Recognition and Catalytic Mechanism of the Phosphate Acyltransferase PlsX from Bacillus subtilis

Article abstract of DOI:10.1002/cbic.202000015

Phosphate: acyl-acyl carrier protein (ACP) acyltransferase PlsX is a peripheral enzyme catalysing acyl transfer to orthophosphate in phospholipid synthesis. Little is known about how it recognises substrates and catalyses the acyl transfer. Here we show that its active site includes many residues lining a long, narrow gorge at the dimeric interface, two positive residues forming a positive ACP docking pad next to the interfacial gorge, and a number of strictly conserved residues significantly contributing to the catalytic activity. These findings suggest a substrate recognition mode and a catalytic mechanism that are different from those of phosphotransacetylases catalysing a similar acyl transfer reaction. The catalytic mechanism involves substrate activation and transition-state stabilization by two strictly conserved residues, Lys184 and Asn229. Another noticeable feature of the catalysis is the release of the acyl phosphate product near the membrane, which might facilitate its membrane insertion.

Full text of DOI:10.1002/cbic.202000015

Accepted Article
Title: Substrate recognition and catalytic mechanism of the phosphate
acyltransferase PlsX from Bacillus subtilis
Authors: Yiping Jiang, Mingming Qin, and Zhihong Guo
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: ChemBioChem 10.1002/cbic.202000015
Link to VoR: http://dx.doi.org/10.1002/cbic.202000015
A Journal of
www.chembiochem.org

10.1002/cbic.202000015
ChemBioChem
FULL PAPER
Substrate recognition and catalytic mechanism of the phosphate
acyltransferase PlsX from Bacillus subtilis
Yiping Jiang,[a] Mingming Qin,[a] Zhihong Guo*[a]
[a]
Dr. Yiping Jiang, Dr. Mingming Qin, and Professor Zhihong Guo
Shenzhen Research Institute, Hong Kong Branch of Guangdong Southern Marine Science and Engineering Laboratory (Guangzhou) and Department of
Chemistry
The Hong Kong University of Science and Technology
Clear Water Bay, Kowloon, Hong Kong SAR, China
E-mail: chguo@ust.hk
Abstract: Phosphate: acyl-acyl carrier protein (ACP) acyltransferase
PlsX is peripheral enzyme catalyzing acyl transfer to
reversible transfer of an acetyl or butyryl group between
orthophosphate and coenzyme A (CoA-SH), respectively. It has
not been examined for its catalytic mechanism except simple
steady-state kinetic characterization,[2] but Pta has been
mechanistically investigated in depth using both biochemical and
structural methods. Early kinetic studies suggested that a ternary
complex is involved in the catalysis of Clostridium kluyveri Pta,[12,
13] which is consistent with the failed attempt to detect an acetyl-
enzyme intermediate.[14] In addition, kinetic and mutational
analysis of Pta from Methanosarcina thermophila identified a
nonessential cysteine and three conserved arginine residues at
a
orthophosphate in phospholipid synthesis. Little is known about how
it recognizes substrates and catalyzes the acyl transfer reaction. Here
we show that its active site include many residues lining a long narrow
gorge at the dimeric interface, two positive residues forming a positive
ACP docking pad next to the interfacial gorge, and a number of strictly
conserved residues significantly contributing to the catalytic activity.
These findings suggest a substrate recognition mode and a catalytic
mechanism that is different from phosphotransacetylases catalyzing
a similar acyl transfer reaction. The catalytic mechanism involves
substrate activation and transition state stabilization by two strictly
conserved residues, lysine-184 and asparagine-229. Another
noticeable feature of the catalysis is the release of the acyl phosphate
product to membrane proximity which may facilitate its membrane
insertion.
the active site, of which one residue (Arg310) was suggested to
16]
be a catalytic residue.[15,
In 2004, the crystal structure of
Methanosarcina thermophila Pta was determined in its apo form,
which features a dimeric architecture containing two α/β domains
in a monomer and a potential active site locating at the domain
interface.[17] Subsequently, CoA-SH was successfully soaked into
the active site,[18] revealing its stabilization by hydrogen bonds
and hydrophobic interaction by multiple residues including the
previously identified arginine residues. Importantly, the soaked
crystal structure shows that three residues, namely Ser309,
Arg310, and Asp316, are proximal to the sulfhydryl group of the
CoA-SH substrate. On this basis, kinetic characterization of site-
directed mutants allowed proposal of a catalytic mechanism in
which Asp316 serves as a base to deprotonate CoA-SH for the
nucleophilic reaction, Arg310 orients and positions the acetyl
phosphate substrate, and Ser309 stabilizes the negative charge
of transition state by hydrogen bonding. The proposed roles of
Ser309 and Arg310 appear to be supported by a Pta-acetyl
phosphate complex structure in which their equivalents in the
Bacillus subtilis enzyme (Ser303 and Arg304) interact directly
with the phosphate group of one acetyl phosphate ligand, despite
the fact that they make no contact with another acetyl phosphate
ligand bound in proximity of the first one.[19]
Three PlsX crystal structures have been determined for
comparison with Pta, two from Bacillus subtilis [10, 20] and one from
Enterococcus faecalis.[21] They are all dimeric without a natural
ligand and have an α/β/α sandwich structure consisting of a
twisted β-sheet of 11 mostly parallel strands flanked by 13 helices.
Two of the helices (α8 and α10) protrude from the main domain
as a long hairpin and form a four-helix bundle at the dimer
interface, which contains the amphipathic α-peptide sensor of
RIFs.[10] Structural comparison found that PlsX and Pta are close
structural neighbors by DaliLite.[22] In addition, two large
symmetric cavities are found at the PlsX dimer interface, which
occupy equivalent positions of the active sites in Pta. However,
the catalytic residues (Ser309, Arg310 and Asp316) and other
conserved residues in the M. thermophila Pta active site find no
Introduction
Fatty acids are a major component of phospholipids and are
synthesized de novo by the type II fatty acid synthase in
bacteria.[1] They are generated as a thioester of an acyl carrier
protein (ACP) that is either directly used in synthesis of
phosphatidic acid or converted first to an acyl phosphate through
transferring its acyl group to inorganic orthophosphate by a
phosphate acyltransferase called PlsX.[2,3] In a large set of
bacteria including many Gram-positive pathogens such as
Staphylococcus aureus and Streptococcus pneumonia,[4] PlsX is
the only connecting enzyme between fatty acid synthesis and
phospholipid synthesis and is an attractive drug target.[5] Besides
its catalytic function, PlsX has been scrutinized for its peripheral
localization to membrane, which features a punctate pattern in
either fixed cells[2, 5] or live cells.[6] These punctate foci are only
observed in the early log phase[7] and have been identified as fluid
membrane microdomains termed regions of increased fluidity
(RIFs).[8,9] A short amphipathic α-peptide in the middle of the helix-
turn-helix interface of the dimeric enzyme has been found to
mediate RIFs localization through modulating its hydrophobic
interaction with the fatty acyl moieties of the cytoplasmic
membrane leaflet.[10] Mutations disrupting this membrane
association were found to delay transition to the log phase and
cause a lower cell density in stationary phase, demonstrating
significance of the peripheral localization.[10,11]
PlsX shares sequence homology with members of the
protein family Pfam01515 that includes phosphotransacetylase
(Pta) and phosphotransbutarylase (Ptb), which catalyze the
1
This article is protected by copyright. All rights reserved.

10.1002/cbic.202000015
ChemBioChem
FULL PAPER
equivalents in the PlsX cavities, suggesting that the two enzymes
likely adopt a different strategy to recognize the substrates for
catalysis of the similar acyl transfer reaction.
To understand how PlsX recognizes its substrate and
catalyzes the acyl transfer reaction, we used bioinformatics
analysis and docking of natural ligands to identify potential active
site residues. The suspected residues were then varied by site-
directed mutagenesis and the resulting mutant proteins were
characterized for their steady-state kinetics. Based on the
assessment of their catalytic contribution, we successfully
identified the residues involved in the catalysis and recognition of
various moieties of the natural substrates/products including ACP,
its phosphopantetheinyl linker, the phosphate group and the acyl
group. These results support a PlsX catalytic mechanism that is
different from that of phosphotransacetylases.
Figure 1. Steady-state kinetics of PlsX. (A) The reversible reaction catalysed by PlsX. (B) Reductive SDS-PAGE of the purified PlsX and ACP (apo form). apo-ACP
has a calculated molecular weight of 8.5 kDa and shows an abnormal mobility due to its low binding affinity for SDS. (C) UREA-PAGE of apo-ACP and its derivatives.
Both holo-ACP and palmitoyl-ACP were purified after preparation. (D) Michaelis–Menten kinetics of the forward reaction and Triton X-100 effect on the reaction rate.
(E) Michaelis–Menten kinetics of the reverse reaction and Triton X-100 effect on the reaction rate. See experimental section for the detailed conditions in the
determination of the steady-state kinetics. In (D) and (E), the solid lines are curve-fitting results using the Michaelis-Menten equation. Effects of Triton X-100 were
determined at saturating substrate concentrations: 10 μM palmitoyl-ACP and 500 μM phosphate for the forward reaction and 5 μM holo-ACP and 20 μM palmitoyl
phosphate for the reverse reaction.
2
This article is protected by copyright. All rights reserved.

10.1002/cbic.202000015
ChemBioChem
FULL PAPER
reverse reaction became significant enough to affect the
measurement accuracy. In contrast, the rate measurement took a
much longer time in the previous study,[2] which should be
significantly affected by the reverse reaction in consideration of
the fact that the reverse reaction is much faster than the forward
reaction. Taking these factors into consideration, PlsX is likely to
have a much higher activity as determined for the Bacillus subtilis
orthologue in this study.
Results and Discussion
Steady-state kinetic characterization
Using radiolabeled substrates, Streptococcus pneumoniae
PlsX has been shown to catalyze both the forward and reverse
transfer of palmitoyl group between ACP and orthophosphate
(Figure 1A).[2] For the forward reaction, the enzyme is specific for
palmitoyl-ACP with no activity for palmitoyl-CoA and has a KM
value of 300 μM and 140 μM for palmitoyl-ACP and
orthophosphate, respectively. To better correlate the kinetic
properties to crystal structures, we characterized the steady-state
kinetics of Bacillus subtilis PlsX, which shares 52.9% sequence
identity with the Streptococcus pneumoniae orthologue and has
had its structure determined to high resolution.[10, 20] The protein
was overexpressed in E. coli with a C-terminal hexahistidine tag
and successfully purified to homogeneity (Figure 1B). apo-ACP
(8.5 kDa) from Bacillus subtilis was also prepared and purified to
homogeneity, which showed an abnormal mobility on SDS-PAGE
(~25 kDa, Figure 1B) due to its low binding affinity of the
detergent.[23] holo-ACP and palmitoyl-ACP were subsequently
prepared from apo-ACP (Figure 1C) and used as substrates
together with palmitoyl phosphate or phosphate in the kinetic
characterization. The enzymic reaction was found to conform to
the Michaelis-Menten equation in both forward (Figure 1D) and
reverse (Figure 1E) reactions. For the forward reaction, KM is 1.4
μM and 104 μM and kcat is 0.76 min-1 and 0.62 min-1 for palmitoyl-
ACP and orthophosphate, respectively; while for the reverse
reaction, KM is 0.39 μM and 3.7 μM and kcat is 148 min-1 and 167
min-1 for holo-ACP and palmitoyl phosphate, respectively (Table
1). These kinetic data show that the reverse reaction is more than
200 time faster than the forward reaction under saturation
conditions and the enzyme’s catalytic efficiency (kcat/KM) is the
Docking simulation
To understand how PlsX interacts with its substrates, the
natural ligands or their analogs were docked to the suspected
active site cavity using AutoDock.[24] Palmitoyl phosphate, a
product of the forward reaction and a substrate of the reverse
reaction, was first successfully docked at a long channel formed
by both subunits of the enzyme. The docked ligand is shown in
Figure 2A with all contact residues, of which most are from α8, the
β7-to-α6 loop and the β8-to-7 loop from the other monomer. Its
alkyl chain binds in a twisted conformation to the lower part of the
interfacial channel, whereas the carboxyl phosphate head group
binds in the upper part. Interestingly, the alkyl chain interacts
favorably with hydrophobic side chain residues that form a
tortuous open channel, while the polar head group is stabilized by
highest for holo-ACP with a value of 6.3  106 M-1s-1. Considering
the fact that PlsX is a membrane protein,[5-8,
the neutral
10]
detergent Triton X-100 was added to the enzymic reaction and
found to more than double the forward reaction rate at a high
concentration of 1% but have no effect at a lower concentration
of 0.1% (Figure 1D). However, this detergent had no effect on the
reverse reaction even at the high concentration (Figure 1E).
Table 1. Kinetics constant of Bacillus subtilis PlsX.
Substrate
kcat (min-1)
0.76 ± 0.08
0.62 ± 0.05
148 ± 8
KM (μM)
1.4 ± 0.4
104 ± 19
0.39 ± 0.07
3.7 ± 0.7
Palmitoyl-ACP
Phosphate
holo-ACP
Palmitoyl phosphate
167 ± 10
Figure 2. Docking of ligands to the active site of PlsX. (A) Stereo diagram of the
active site with the docked palmitoyl phosphate. (B) Stereo diagram of the active
site with the docked palmitoyl 4’-phosphopantetheinyl thioester. The protein is
represented in cartoon and colored according to subunit with active site residues
in sticks, while palmitoyl phosphate and palmitoyl 4’-phosphopantetheinyl
thioester are represented in yellow and brown sticks, respectively. Underlined
residues interact with polar head group of palmitoyl phosphate and likely play
important roles in the catalysis. Gold dashed lines denote hydrogen bonds with
a distance  3.6 Å and the grey dashed line in (A) indicates a short distance of
2.9 Ǻ. Amino acid residues from a different subunit are labeled with a primed
number.
For the forward reaction, Bacillus subtilis PlsX exhibits a
much higher affinity (lower KM) for palmitoyl-ACP than
Streptococcus pneumoniae PlsX, demonstrating that it has a
much higher activity. There are two probable contributors to this
high activity of the Bacillus enzyme. One important factor is the
use of ACP from the same bacterial strain in the current study,
whereas the source of ACP was not specified in the previous
study.[2] Another factor is the current use of real time
measurement of the rate, which was completed before the
3
This article is protected by copyright. All rights reserved.

10.1002/cbic.202000015
ChemBioChem
FULL PAPER
ionic interactions and multiple hydrogen bonds. The carboxyl
oxygen atom of the acyl group is within a hydrogen-bonding
distance of 3.0 Å to the amide nitrogen atom in the sidechain of
Asn229 in α8 and is interestingly close to the backbone carbonyl
oxygen atom of Gly141 at a distance of 2.9 Å, which is apparently
positioned by a hydrogen bond between its -N and the sidechain
carboxylate of Asp139 in the β7-to-α6 loop. The phosphoryl group
is mainly stabilized by residues in the loop connecting β8 to 7
from the other monomer, forming two ionic hydrogen bonds with
the sidechain ammonium ion of Lys184’ and one hydrogen bond
with the backbone carbonyl group of Val178’. It is also close to
the side chain amide of Asn229 with a distance of 3.6 Å.
Palmitoyl 4’-phosphopantetheinyl thioester, a surrogate of
the palmitoyl-ACP substrate in the forward reaction, was also
successfully docked to the large cavity at the PlsX dimeric
interface with a similar orientation as palmitoyl phosphate (Figure
2B). Its acyl chain takes an alternative twisted conformation but
its carbonyl group makes similar contacts with Asn229, Lys184’
and Gly141 in comparison to the acyl group of the docked
palmitoyl phosphate. Interestingly, the positive side chains of
Arg73 and Arg120 are located at the edge of the cavity at a short
distance of less than 7 Å from the 4’-phosphoryl group of the
docked ligand (Figure 3). These residues, together with nearby
positive residues such as Arg70, Arg114 and Lys183’ on the
protein surface (Figure 3), may form a docking pad for recognition
of the negatively chargedα2-helix of ACP,[25-27] similar to those
found on acyl-ACP hydrolases such as BioW and BioH from the
biotin biosynthetic pathway.[28, 29] Thus, this docking simulation
gives rise to a model for the binding of palmitoyl-ACP in which the
ACP moiety docks to the positively charged pad at the edge of the
interfacial cavity and allows the palmitoyl 4’-phosphopantetheinyl
thioester moiety to bind the full length of the long channel at the
dimer interface in a largely extended conformation. Such a
binding model is consistent with another recent structural
modeling of the substrates to PlsX.[11]
the docking simulation are conserved, all reviewed PlsX
sequences in the UniProt database were withdrawn and filtered
at 50% sequence identity to obtain 95 non-redundant sequences
for multiple sequence alignment. A total of 13 amino acid residues
were found to be absolutely conserved, of which ten residues are
located in the long 8 helix, the β7-to-6 loop and the β8-to-7
loop from the other subunit (Figure 2 and Figure 4). The other
three residues include Gly99, Gly207’ and Glu209’ , of which the
last two are close to the active site channel as shown in Figure 2.
Besides these strictly conserved residues, many other residues
forming the interfacial cavity are also conserved, including the few
residues interacting with the 4’-phosphoryl group of the docked
palmitoyl 4’-phosphopantetheinyl thioester (Figure 2) and the
residues that form most of the large hydrophobic pocket for the
acyl chain in two orientations (Figure 2A and Figure 2B). In
addition, Arg73 and Arg120 of the suspected ACP docking pad
(Figure 3) are replaced by lysine residues in a few orthologues
and are thus also highly conserved. However, the other suspected
positive residues, namely Arg70, Arg114 and Lys183’, are not
conserved at all and are thus very unlikely to be part of the
docking pad.
Figure 4. Strictly conserved amino acid residues at the active site of PlsX. The
residues shaded in red are strictly conserved among 95 reviewed PlsX
sequences filtered at 50% sequence identity from the UniProt database. The
aligned sequences are selected from these PlsX orthologues and named
directly with their UniProtKB mnemonic identifiers. The aligned secondary
structures are from the Bacillus subtilis PlsX structure (PDB ID: 6A1K).
Active site mutants and their kinetic properties
Conservation of potential active site residues
To test the veracity of the docking models, site-directed
mutagenesis was used to assess the contribution of key amino
acid residues to enzyme catalysis. The strictly conserved non-
glycine residues in direct contact with the docked ligands
including Lys184, Asn229, Lys233 and Glu236, were each
mutated to alanine. Lys184 was additionally mutated to arginine
or glutamine and Asn228 was additionally mutated to glutamine
because either residue interacts with the key functionalities in the
docked palmitoyl phosphate (Figure 2A). In addition, the strictly
conserved residues in proximity of the direct-contact residues,
including Glu181 and Glu209, were also individually mutated to
alanine. Moreover, the conserved positive residues of the
suspected ACP docking site, Arg73 and Arg120, were mutated
into alanine, while the non-conserved Arg114 in proximity was
also mutated to alanine as a negative control. A double mutant
with both Arg73 and Arg120 mutated to alanine, R73A/R120A,
was also constructed. All these mutation proteins were
overexpressed to a high level and were readily purified to
homogeneity like the hexahistidine-tagged wild-type PlsX.
Analysis by circular dichroism spectroscopy showed no difference
between these mutant proteins and the wild-type protein,
indicative of negligible effect of the point mutations on the overall
structure of PlsX.
To understand whether the identified amino acid residues in
Figure 3. The identified ACP docking pad. It is viewed along the axis of the
active site channel between the two subunits and is comprised of conserved
Arg73 and Arg120 labeled in purple. Other positive residues (labeled in black)
are not conserved. PlsX is represented in electron potential surface with all
positive residues in sticks, while the docked palmitoyl 4’-phosphopantetheinyl
thioester is represented in ball and stick with brown carbon atoms and only part
of the 4’-phosphopantetheinyl group is visible.
The steady-state kinetic constants, kcat and KM, were
determined for the forward reaction for the mutant proteins. As
4
This article is protected by copyright. All rights reserved.

10.1002/cbic.202000015
ChemBioChem
FULL PAPER
Table 2. Kinetic constants of PlsX mutant proteins in the forward reaction.
Protein
WT
Substrate
Palmitoyl-ACP
Phosphate
kcat(min-1)
0.76 ± 0.08
0.62 ± 0.05
0.85 ± 0.06
0.72 ± 0.04
0.72 ± 0.04
0.73 ± 0.04
0.77 ± 0.03
0.74 ± 0.03
kcat(wt)/kcat
1.0
KM (μM)
1.37 ± 0.42
104 ± 19
KM/KM(wt)
1.0
kcat/KM (M·min)-1 [kcat/KM](wt)/ kcat/KM
(5.6 ± 3.1)  105
(6.0 ± 1.9)  103
(1.9 ± 0.4)  105
(6.5 ± 2.0)  103
(4.2 ± 1.4)  105
(5.7 ± 1.7)  103
(2.3 ± 0.4)  105
(5.6 ± 1.4)  103
1.0
1.0
2.9
0.92
1.3
1.1
2.4
1.1
1.0
1.0
Palmitoyl-ACP
Phosphate
0.89
4.50 ± 0.46
111 ± 21
3.28
1.07
1.24
1.22
2.45
1.26
R73A
R114A
R120A
0.86
Palmitoyl-ACP
Phosphate
1.06
1.70 ± 0.35
127 ± 23
0.85
Palmitoyl-ACP
Phosphate
0.99
3.36 ± 0.34
131 ± 21
0.84
R73A/
Palmitoyl-ACP
Phosphate
nda
--
nd
nd
--
nd
nd
--
--
R120A
nd
--
--
(2.0 ± 0.4)  105
(1.8 ± 0.3)  103
(8.1 ± 3.1)  104
(1.7 ± 0.5)  102
(7.4 ± 2.8)  104
(4.0 ± 0.9)  102
(2.9 ± 0.7)  105
(7.9 ± 1.9)  103
(1.8 ± 0.6)  105
(2.2 ± 0.6)  103
(1.0 ± 0.4)  104
(2.2 ± 1.1)  102
(2.9 ± 0.8)  105
(6.0 ± 2.0)  103
(1.3 ± 0.3)  105
(1.5 ± 0.4)  103
(2.3 ± 0.8)  105
(1.8 ± 0.3)  103
Palmitoyl-ACP
Phosphate
0.27 ± 0.02
0.26 ± 0.01
2.81
2.38
1.35 ± 0.20
239±37
0.99
2.30
2.8
3.3
E181A
K184A
K184Q
K184R
E209A
N229A
N229Q
K233A
E236A
Palmitoyl-ACP
Phosphate
0.12 ± 0.01
0.14 ± 0.01
0.15 ± 0.01
0.17 ± 0.01
0.40 ± 0.02
0.41 ± 0.02
0.22 ± 0.02
0.20 ± 0.02
0.06±0.01
6.33
4.43
5.00
3.65
1.90
1.51
3.45
3.10
12.7
10.3
0.87
0.83
4.22
3.10
3.04
2.30
1.49 ± 0.32
802 ± 137
2.02 ± 0.46
425 ± 59
1.09
7.71
1.47
4.09
1.01
0.50
0.91
0.89
4.38
2.57
2.22
1.21
1.04
1.31
0.79
1.45
6.9
35.3
7.6
Palmitoyl-ACP
Phosphate
15.0
1.9
Palmitoyl-ACP
Phosphate
1.39 ± 0.20
52 ± 8
0.76
3.1
Palmitoyl-ACP
Phosphate
1.24 ± 0.24
93 ± 14
2.7
Palmitoyl-ACP
Phosphate
6.00 ± 0.86
267 ± 60
56.0
27.3
1.9
0.06 ± 0.01
0.87 ± 0.08
0.75 ± 0.05
0.18 ± 0.01
0.20 ± 0.02
0.25 ± 0.02
0.27 ± 0.01
Palmitoyl-ACP
Phosphate
3.04 ± 0.41
126 ± 25
1.0
Palmitoyl-ACP
Phosphate
1.43 ± 0.24
136 ± 18
4.3
4.0
Palmitoyl-ACP
Phosphate
1.08 ± 0.22
151 ± 18
2.4
3.3
[a] nd: not detected; no activity was detected with 1-10 M mutant enzyme, 2-30 M palmitoyl-ACP and 0.5-2 mM phosphate.
shown in Table 2, the catalytic activity of the negative control
mutant protein R114A is essentially the same as the wild-type
protein for both substrates. In comparison, R73A and R120A
cause a significant 2.5~3.3-fold increase in KM for palmitoyl-ACP
without adverse effect on other kinetic constants, whereas double
mutations (R73A/R120A) diminish the activity to an undetectable
level even when measured at an increased concentration for the
protein and the substrates. This pattern of activity change is
consistent with those observed for known ACP docking pads, for
which removal of one positive residue leads to only mild decrease
in activity whilst removal of all positive residues causes severe
activity loss.[28, 29] Among the remaining mutations, N229A causes
the greatest kcat decrease by more than 10 fold and increases KM
by 4.4 and 2.6 fold for palmitoyl-ACP and phosphate, respectively.
However, most of the catalytic activity is recovered with a 2.2-fold
KM increase for palmitoyl-ACP when glutamine is introduced into
the mutated position (in N229Q). These kinetic changes strongly
suggest an important role of the Asn229 side chain in stabilizing
the transition state and are fully consistent with its simultaneous
interaction with the carboxyl oxygen and phosphoryl group of the
docked palmitoyl phosphate (Figure 2A). In contrast, K184A
causes the greatest KM increase of 7.7 fold for phosphate with no
KM effect on the other substrate and also a significant 4.4~6.3 fold
kcat decrease. The damage in catalytic activity remains little
changed when a glutamine is used to replace the strictly
conserved Lys184 (in K184Q), but the activity is basically
recovered with a mild ~2-fold kcat decrease when an arginine is
introduced into the mutated position (in K184R). Consistent with
the docking results (Figure 2), these mutational results support a
crucial role of Lys184 in binding of the phosphate substrate and
in stabilizing the transition state. Finally, E181A is another mutant
protein that exhibits a significant 2.3-fold KM increase for
phosphate without affecting the other substrate, suggesting that
Glu181 also contributes to binding of phosphate. The remaining
mutant proteins including E209A, K233A and E236A are similar
to the wild-type protein in KM for both substrates, but exhibit a
modest 2-4 fold kcat decrease like E181A. Taken together, results
from these kinetic studies strongly support the interactions
between the ligands and the conserved active site residues
identified in the docking simulations (Figure 2), although the
5
This article is protected by copyright. All rights reserved.

10.1002/cbic.202000015
ChemBioChem
FULL PAPER
kinetic parameters of the mutant proteins were not determined for
the reverse reaction due to the chemical instability of palmitoyl
phosphate.
with the positive docking pad consisting of two conserved
residues Arg73 and Arg120 and a few hydrogen bonds at the 4’-
phosphoryl group and the pantothenate carbonyl (with the Gly141
backbone, Figure 2B). Meanwhile, its acyl carbonyl is likely
stabilized by a hydrogen bond with the side chain of Asn229 as
supported by a similar hydrogen bond for the docked palmitoyl
phosphate (Figure 2A) and a significant KM increase for the
substrate caused by the N229A mutation (Table 2). Moreover, the
acyl group of this substrate is stabilized by many hydrophobic
Substrate recognition
The modeling and mutational results reveal the mode of
substrate recognition of PlsX in which acyl-ACP is recognized by
multiple-pronged interactions spread throughout its structure
(Figure 5). Its ACP moiety is recognized by the ionic interactions
Figure 5. Proposed catalytic mechanism for PlsX. (A) The reaction mechanism of the forward reaction. (B) The reaction mechanism of the reverse reaction.
6
This article is protected by copyright. All rights reserved.

10.1002/cbic.202000015
ChemBioChem
FULL PAPER
side chains lining the binding channel (Figure 2B). The multiplicity
of the interactions and their balanced distribution throughout the
full length of the substrate ensure the high substrate specificity.
However, this multivalent mode of substrate recognition implies
that any individual binding residue contributes only a limited
portion to the overall binding energy. In consistence with this
binding mode, only moderate KM increase of 4.4-fold or less is
found for any single point mutation (Table 2). This multivalent
binding mode may also underlie the fact that only two conserved
positive residues form the ACP docking pad, while at least three
such residues are involved in other ACP-binding proteins such as
BioH and BioW.[28, 29]
The other substrate, phosphate, is recognized mostly by the
highly conserved β8-to-7 loop from the other subunit through two
ionic hydrogen bonds with Lys184’ and one neutral hydrogen
bond with the backbone amide of Val178’, like the binding of the
phosphoryl group of the docked palmitoyl phosphate (Figure 2A).
Glu181’ of this loop also contributes to phosphate binding as
indicated by the significant increase in KM for E181A (Table 2).
This residue may directly interact with the substrate through
hydrogen bonding or may interact with the Lys184’ side chain to
orient it for optimal interaction with the substrate. In addition,
Asn229 also contributes to phosphate binding as suggested by its
hydrogen bonding with the phosphate group of the docked
palmitoyl phosphate (Figure 2A) and by the significant KM
increase for N229A (Table 2). Since the Asn229 side chain also
interacts with the other substrate, this residue likely couples the
phosphate binding to the binding of acyl-ACP. This potential
coupling suggests that the phosphate binding site is fully formed
only after binding of acyl-ACP. In the phosphate binding, Lys184’
likely plays a dominant role as suggested by the largest KM
increase for its alanine mutant (Table 2).
reaction. Finally, the products are formed from the resulting
tetrahedral intermediate through a low barrier collapsing reaction.
In both forward and reverse reactions catalyzed by PlsX,
Asn229 plays the most important catalytic role by activating the
electrophile and stabilizing the transition state as well as serving
the oxyanion hole to stabilize the tetrahedral oxyanion
intermediate. No equivalent residue can be found in
Methanosarcina thermophila Pta that was proposed to use a
conserved serine (Ser309) to stabilize the oxyanionic tetrahedral
intermediate.[18] The proposed activation of the thiol substrate by
a conserved aspartate (Asp316) in Pta is another mechanistic
difference from PlsX, which has no apparent activation
mechanism for the thiol substrate and most likely uses a water
molecule to deprotonate the thiol group. Nevertheless, both PlsX
and Pta use a conserved positive residue to bind the acyl
phosphate substrate, namely Lys184’ in the former and Arg310 in
the latter, although this residue takes a totally different position in
the structure of the proteins (Figure 6). This comparison clearly
shows that PlsX uses a very different set of amino acid residues
to accomplish the similar acyl transfer reaction through a distinct
catalytic strategy (Figure 6).
Figure 6. Comparison of key active site residues distributed in three structural
motifs in Bacillus subtilis PlsX and Methanosarcina thermophila
phosphotransacetylase (Pta). Catalytic residues in PlsX are indicated by brown
triangles while those in Pta are indicated by red triangles. The sequences of the
two proteins are aligned with the secondary structure in their corresponding
crystal structures (PlsX PDB ID: 6A1K and Pta PDB ID: 2AF4).
Catalytic mechanism
After active site binding, acyl-ACP and phosphate are well
positioned for the acyl transfer from ACP to phosphate through a
nucleophilic addition reaction. The transition state is likely
stabilized by the side-chain amide of Asn229, the Lys184’ side
chain and the backbone amide of Val178’ (Figure 5A). In addition,
the strictly conserved Glu181’ may also contribute to this
transition state stabilization either directly through interaction with
phosphate or indirectly through interacting with the proximal
Lys184’. The catalytic roles of these residues are consistent with
the significant kcat decrease for the corresponding site-directed
mutant proteins, particularly for N299A (Table 2).
The same set of the binding and catalytic residues are also
suitable for binding the substrates of the reverse reaction and
efficiently catalyzing their reaction (Figure 5B). Specifically, the
palmitoyl phosphate substrate is tightly bound to the active site by
the polar interactions (with Asn229, Glu184’ and the backbone
amide of Val178’) and the hydrophobic interactions for the acyl
group, while holo-ACP is bound to the active site through the
interactions at the docking pad and the 4’-phosphoryl group and
pantothenate carbonyl in the prosthetic group. These binding
interactions are consistent with the docking results (Figure 2) that
are supported by kinetics of the site-directed mutant proteins.
Again, the bound substrates are well aligned for nucleophilic
attack of the thiol group of holo-ACP on the carbonyl group of
palmitoyl phosphate, going through a similar transition state that
is stabilized by the same conserved residues as for the forward
Conclusion
In summary, we have successfully identified the active site
of PlsX that allows the acyl-ACP product from the fatty acid
biosynthetic pathway to dock on protein surface facing the cytosol,
with its prosthetic phosphopantetheinyl and the attached acyl
chain to bind vertically and linearly in a long and narrow interfacial
channel all the way down to the other side of the protein facing
plasma membrane. This mode of interaction facilitates not only
the binding of the acyl-ACP substrate from the cytosol and release
of the ACP product after acyl transfer to the cytosol, but also likely
the insertion of the acyl phosphate product into cell membrane
where it is used to synthesize phosphatidic acid precursor of
phospholipids. In catalysis of PlsX,
asparagine (Asn229) plays dual role of activating the
electrophilic substrate and stabilizing the transition state of the
acyl transfer reactions in mechanism distinct from the
Pta[18]
structurally homologous or other bacterial
a strictly conserved
a
a
acyltransferases.[30] These findings for the first time establish the
catalytic mechanism of PlsX as a representative peripheral acyl
transferase and allow better understanding of the first chemical
step of the biosynthesis of phospholipids in most bacteria.
Experimental Section
7
This article is protected by copyright. All rights reserved.

10.1002/cbic.202000015
ChemBioChem
FULL PAPER
Synthesis of palmitoyl-phosphate and palmitoyl-CoA. Palmitoyl-
phosphate was synthesized according to a reported method with minor
modifications.[2, 31] Briefly, 1.20 mmol silver phosphate and 12.25 mmol
anhydrous phosphoric acid were dissolved in 10 ml dry diethyl ether and
stirred at room temperature for 15 h. Palmitoyl chloride (2.90 mmol)
dissolved in 5 ml diethyl ether was added dropwise and the reaction
mixture was stirred at room temperature for 1.5 h. After filtering and
washing the precipitate twice with 5 ml ethyl ester, the palmitoyl phosphate
product in the filtrate was removed off the solvent by rotavaporation. The
Holo-ACP and palmitoyl-ACP were prepared from apo-ACP using
the 4'-phosphopantetheinyl transferase Sfp, which was expressed and
41]
purified as described previously.[40,
Following a previously reported
method,[42] palmitoyl-ACP was formed from a mixture of 240 μM apo-ACP,
500 μM palmitoyl-CoA, 3.4 μM Sfp, 1 mM MgCl2, 150 mM NaCl in 50 mM
MES (2-(N-morpholino) ethanesulfonic acid) at pH 6.0. The reaction
mixture was incubated at 37℃ for 4 h and then at room temperature
overnight to increase yield and to oxidize holo-ACP to its dimeric form. In
this step, almost all apo-ACP was converted to palmitoyl-ACP and most
holo-ACP was converted to a dimer as examined by UREA-PAGE. The
reaction solution was concentrated with Amicon® Ultra 4 mL Centrifugal
Filters (3 kDa, Millipore) and further purified by Superdex-200 10/30 gel
filtration column (GE Healthcare) pre-equilibrated with the buffer
containing 20 mM Tris, pH 8.0 and 150 mM NaCl. The eluted protein was
collected and concentrated to 4 mg/ml, flash-frozen in liquid nitrogen and
stored at -20℃. The concentration of the protein was determined by
measuring the UV absorbance at 280 nm using an extinction coefficient of
1490 M-1 cm-1 calculated with ProtParam.[43] The purity of the isolated
palmitoyl-ACP was over 90% as estimated from UREA-PAGE and
densitometry analysis.
product was then re-dissolved in
2 ml warm benzene and was
recrystallized by cooling to room temperature. After removal of benzene
by filtration, the resulting white crystals were washed once with cold
benzene and dried in vacuo. The final isolated yield of palmitoyl phosphate
was 1.5%. 1H NMR (CD3OD, 400 MHz): δ 0.92 (t, J = 6.0 Hz,3 H), 1.31 (s,
25 H), 1.65 (m, 2 H), 2.46 (t, 2 H, J = 7.0 Hz).
Palmitoyl-CoA was also synthesized with previously reported
methods with modifications.[32-35] In the synthesis, 25 mg CoA-SH (Sigma)
was dissolved in 10 ml THF-H2O solution (v/v, 7:3) and the resulting
solution was adjusted to pH = 8.0 by sodium hydroxide, added 50 μl of
palmitoyl chloride, and then stirred for 1.5 h. The reaction mixture was kept
at pH 7-8 by adding sodium hydroxide during the reaction. After the
reaction, the mixture was removed of THF by rotavaporation and
centrifuged at 15,000 g for 2 min to obtain aqueous supernatant, which
was collected and added 200 μl 10% HClO4 to precipitate the palmitoyl-
CoA product as white solid. The precipitated product was collected by
centrifugation at 15,000 g for 2 min and washed twice with cold diethyl
ether before being dried in vacuo. The final isolated yield of palmitoyl-CoA
was 45%. Identity of the product was confirmed through comparison with
commercial palmitoyl-CoA (Sigma) by its retention factor on silica thin-
layer chromatography plates and mass spectrometry (ESI MS: m/z = 1028
[M + Na]+).
Similarly, holo-ACP was prepared by mixing 500 μM ACP, 1 mM
CoA-SH and 10 μM Sfp in the buffer containing 50 mM MES (2-(N-
morpholino) ethanesulfonic acid) pH 6.0, 10 mM MgCl2 and 150 mM NaCl.
After incubation at 37℃ for 4 h, the reaction mixture was loaded onto a 5
ml HisTrap HP column (GE Healthcare) that was pre-equilibrated with the
start buffer (20 mM Tris.HCl, pH 8.0, 500 mM NaCl, 20 mM imidazole and
10% glycerol) and eluted out by the same buffer to remove Sfp.
Subsequently, the eluted protein solution was concentrated with Millipore
YM-3 and further purified by HiPrep 26/10 desalting column (GE
Healthcare) that was pre-equilibrated with the storage buffer (20 mM Tris,
pH 8.0, 150 mM NaCl and 10% glycerol). The purified holo-ACP was
collected and concentrated to 8 mg/ml, flash cooled by liquid nitrogen and
stored at -20℃. Protein purity was over 85% examined by UREA-PAGE
and densitometry analysis. Since holo-ACP was easily oxidized to its
dimeric form, 1 mM dithiothreitol (DTT) was added to the stock solution
prior to use.
Preparation of holo-ACP and palmitoyl-ACP. Apo-ACP from Bacillus
subtilis was expressed as a C-terminal fusion of the protein Gb1 with a N-
terminal hexahistidine tag and a HRV protease 3C cleavable linker in E.
coli BL21 (DE3) transformed with a plasmid from laboratory stock. For
protein expression, the recombinant cells were streaked on LB agar plates
supplemented with 100 μg/ml ampicillin and incubated at 37℃ overnight.
Next day, a single colony was picked to inoculate 10 ml Luria-Bertani broth
(LB) containing 100 μg/ml ampicillin and grown overnight at 37℃ with
shaking at 250 rpm to give a starter culture. The starter culture was used
to inoculate 4 L LB medium supplemented with 100 μg/ml ampicillin and
the cells were grown at 37℃ with shaking at 250 rpm until OD600 reached
0.8-1.0. Then isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a
final concentration of 0.2 mM to induce protein expression at 37℃ for 3 h.
The cell culture was cooled on ice and the cells were harvested by
centrifugation and washed once with ice-cold TE buffer (10 mM Tris.HCl,
pH 8.0, 1 mM EDTA). The harvested cells were then re-suspended in the
start buffer (20 mM Tris.HCl, pH 8.0, 500 mM NaCl, 20 mM imidazole, 10%
glycerol) and lysed by sonication. The cell lysate was centrifuged at 30,000
g for 15 min to remove cell debris and the supernatant was loaded onto a
5 ml HisTrap HP column (GE Healthcare) pre-equilibrated with the start
buffer. The column was washed by 50 ml start buffer and Gb1-ACP was
eluted in ~20 ml 20 mM Tris.HCl buffer (pH 8.0) containing 500 mM NaCl,
200 mM imidazole, and 10% glycerol. The eluted protein solution was
concentrated with Amicon® Ultra 15 mL Centrifugal Filters (3 kDa,
Millipore) and was desalted into the storage buffer (20 mM Tris pH8.0, 150
mM NaCl) using a HiPrep 26/10 desalting column (GE Healthcare).
Subsequently, the desalted protein solution was added 100 μl 8 mg/ml
HRV protease 3C with C-terminal hexahistidine tag from laboratory stock,
incubated at 25℃ for 1 h, and reloaded onto 5 ml HisTrap HP column (GE
Healthcare) pre-equilibrated with storage buffer. ACP was collected from
the earliest fractions, concentrated to 28 mg/ml using Amicon® Ultra 15
mL Centrifugal Filters (3 kDa, Millipore), and flash-cooled by liquid nitrogen
for storage at -20℃. Protein purity was over 95% examined by SDS-PAGE
and densitometry analysis. However, using Urea Polyacrylamide Gel
Electrophoresis (UREA-PAGE),[36-39] the resulting protein solution was
found to contain apo-ACP as a major component and to also contain holo-
ACP and oxidized holo-ACP dimer as minor components.
Preparation and activity assay of PlsX and its mutants. A previously
reported procedure was followed exactly to express and purify B. subtilis
PlsX.[10] The expression plasmid in the pET28a vector (Novagen) was
used as the template for mutation using the QuikChange II XL site-directed
mutagenesis kit (Agilent) and the primers listed in Table 3. For production
of the double mutant, the R73A-expressing plasmid was used as the
template for introducing the second mutation, R120A, into the plsX gene.
The sequence of the mutated codon and the rest of the gene was verified
with full-length DNA sequencing by Beijing Genomics Institute (BGI,
Shenzhen, China). The resulting plasmids were transformed into E. coli
C43 (DE3) (Lucigen) and the resulting cells were used for expression and
purification of the mutant proteins exactly like the wild-type PlsX. The
proteins were stored until use at -20℃ in 10 mM HEPES, pH 7.5, 150 mM
NaCl, and 10% glycerol. Oligodeoxynucleotide primers used in the site-
directed mutagenesis are listed in Table 3.
The activity of PlsX or its mutant for the forward reaction was
determined by measuring the release of free coenzyme A through coupling
with the Ellman's Reagent (5,5’-dithio-bis-(2-nitrobenzoic acid) or
DTNB).[44] A typical assay reaction contained 0.5-1.0 μM PlsX, 500 μM
DTNB, 1 mM MgCl2, and phosphate and palmitoyl-ACP at varied
concentrations in 50 mM Tris pH 7.5. The enzyme was added last to initiate
the reaction for real-time monitoring of the formation of 2-nitro-5-
thiobenzoate (TNB) by its UV absorbance at 412 nm with an extinction
coefficient of 14,150 M-1 cm-1.[45] Under these conditions, the coupling
reaction was tested to be significantly faster than the enzymatic reaction
without rate-limiting the overall reaction. The enzyme-catalyzed reverse
reaction was assayed with the EnzChek™ Phosphate Assay Kit that used
purine nucleoside phosphorylase (PNP) to convert 2-amino-6-mercapto-7-
methylpurine riboside (MESG) and the released phosphate ion to ribose
1-phosphate and 2-amino-6-mercapto-7-methylpurine, the latter of which
could be monitored by its specific UV absorbance at 360 nm with an
extinction coefficient of 11,000 M-1 cm-1.[46] The assay was performed in
8
This article is protected by copyright. All rights reserved.

10.1002/cbic.202000015
ChemBioChem
FULL PAPER
200 μl solution containing 5 nM PlsX, 200 μM MESG, 1 unit of PNP, 1 mM
MgCl2, and holo-ACP and palmitoyl phosphate at varied concentrations in
50 mM Tris pH 7.5. The reaction was also initiated by addition of the
enzyme and monitored at 360 nm by a UV-VIS spectrometer (Shimadzu).
Again, the coupling reaction was carefully tested not to limit the overall
reaction. All assay experiments were performed in triplicate at 25 ℃ and
the rate data were fitted with the Michaelis-Menten equation using
GraphPad Prism 5.
Structural analysis, sequence alignment and docking simulation.
PyMOL version 1.3[47] was used to perform structural analysis of the
protein crystal structures and to generate all graphics. The protein
interfaces were analyzed and the quaternary structure was determined
using PISA,[48] while the electrostatic potential surface was calculated
using PDB2PQR plus APBS.[49] Reviewed PlsX or Pta orthologues from
UniProt[50] were clustered with a 50% sequence identity and were aligned
and analyzed by Clustal Omega.[51] The alignment was presented with the
Bacillus subtilis PlsX crystal structure (PDB ID: 6A1K) using ESPript 3.0.[52]
Docking of small molecule ligands to the crystal structure of PlsX
from Bacillus subtilis (PDB ID: 6A1K) was performed with Autodock (4.2.6)
and the graphical user interface AutoDockTools (1.5.6.).[24] The ligands
palmitoyl-phosphate, palmitoyl 4’-phosphopantetheinyl thioester or others
were created by the online SMILES translator and structure file generator
and optimized by eLBOW in Phenix software suite.[53] The grid box was
centered near the interface of the PlsX dimer and set to 100 spots in each
dimension with a spacing of 0.3 Å. The Genetic Algorithm was chosen for
the docking calculation process with its run number set to 25 and with a
population size of 150. All other parameters were set to their default values.
The docking results were visualized by AutoDockTools (1.5.6.) and the
structure with the lowest binding energy was selected for analysis.
Table 3. Oligodeoxyribonucleotide primers.
Name
Sequence
K184A-1
CGTCAGTTCGTTTCCTGCTTTATCTTCTGTTCCGACATTTA
AAAGTCCG
K184A-2
K184Q-1
K184Q-2
K184R-1
K184R-2
CGGACTTTTAAATGTCGGAACAGAAGATAAAGCAGGAAAC
GAACTGACG
TCGTCAGTTCGTTTCCCTGTTTATCTTCTGTTCCGACATTTA
AAAGTCCG
CGGACTTTTAAATGTCGGAACAGAAGATAAACAGGGAAAC
GAACTGACGA
Acknowledgements
CGTCAGTTCGTTTCCTCTTTTATCTTCTGTTCCGACATTTAA
AAGTCC
This work was financially supported by National Natural Science
Foundation of China (Grant 21877094) and the Hong Kong
Branch of Guangdong Southern Marine Science and Engineering
Laboratory (Guangzhou) (Grant SMSEGL20SC01-E).
GGACTTTTAAATGTCGGAACAGAAGATAAAAGAGGAAACG
AACTGACG
N229A-1
N229A-2
N229Q-1
N229Q-2
R73A-1
CAGCGTTTTGAGTGTAACAGCCCCGGTAAAGCCGTCTGTT
AACAGACGGCTTTACCGGGGCTGTTACACTCAAAACGCTG
CAGCGTTTTGAGTGTAACCTGCCCGGTAAAGCCGTCTGT
ACAGACGGCTTTACCGGGCAGGTTACACTCAAAACGCTG
GATGAGTTCTTTTTTCTTGCCACGGCACGGACCGGTT
AACCGGTCCGTGCCGTGGCAAGAAAAAAGAACTCATC
Keywords: phosphatidic acid biosynthesis • phosphate
acyltransferase • active site • substrate recognition • enzyme
mechanism
[1]
[2]
S. W. White, J. Zheng, Y. M. Zhang, C. O. Rock CO, Annu. Rev.
Biochem. 2005, 74, 791-831.
Y.-J. Lu, Y. M. Zhang, K. D. Grimes, J. Qi, R. E. Lee, C. O. Rock, Mol.
Cell 2006, 23, 765-772.
R73A-2
[3]
[4]
[5]
J. Yao, C. O. Rock, Biochim. Biophys. Acta 2013, 1831, 495-502.
Y.-M. Zhang, C. O. Rock, J. Lipid Res. 2008, 49, 1867-1874.
L. Paoletti, Y.-J. Lu, G. E. Schujman, D. de Mendoza, C. O. Rock, J.
Bacteriol. 2007, 189, 5816-5824.
R114A-1
GACGGTCAATTCCTTTAATTGCCCCGACAATAAAGAGACC
GG
R114A-2
CCGGTCTCTTTATTGTCGGGGCAATTAAAGGAATTGACCG
TC
[6]
H. Takada, S. Fukushima-Tanaka, M. Morita, Y. Kasahara, S. Watanabe,
T. Chibazakura, H. Hara, K. Matsumoto, H. Yoshikawa, Mol. Microbiol.
2014, 91, 242-255.
R120A-1
R120A-2
E181A-1
GAGCAAGCGCCGGAGCGTCAATTCCTTTAATTCTCC
GGAGAATTAAAGGAATTGACGCTCCGGCGCTTGCTC
[7]
[8]
D. E. Sastre, A. Bisson-Filho, D. de Mendoza, F. J. Gueiros-Filho, Mol.
Microbiol. 2016, 100, 621-634.
A. Müllera, M. Wenzel, H. Strahl, F. Grein, T. N. V. Saaki, B. Kohl, T.
Siersma, J. E. Bandow, H.-G. Sahl, T. Schneider, L. W. Hamoen, Proc.
Natl. Acad. Sci. USA 2016, 113, E7077-E7086.
CAGTTCGTTTCCTTTTTTATCTGCTGTTCCGACATTTAAAAG
TCC
[9]
H. Strahl, F. Bürmann, L. W. Hamoen, Nat. Commun. 2014, 5, 3442.
E181A-2
GGACTTTTAAATGTCGGAACAGCAGATAAAAAAGGAAACG
AACTG
[10] Y. P. Jiang, X. Dai, M. M. Qin, Z. Guo, Commun. Biol. 2019, 2, 316.
[11] D. E. Sastre, L. G. M. Basso, B. Trastoy, J. O. Cifuente, X. Contreras, F.
Gueiros-Filho, D. de Mendoza, M. V. A. S. Navarro, M. E. Guerin. J. Biol.
Chem. 2019, Online first paper, doi: 10.1074/jbc.RA119.011122.
[12] S. A. Kyrtopoulos, D. P. Satchell, Biochim. Biophys. Acta 1972, 276, 383-
391.
E209A-1
E209A-2
K233A-1
K233A-2
E236A-1
E236A-2
CTAAAAGGTCTCGCGCTGCCACGTTTCCGATAAAA
TTTTATCGGAAACGTGGCAGCGCGAGACCTTTTAG
CAGAGCCTTCCAGCGTTGCGAGTGTAACATTCCCGG
CCGGGAATGTTACACTCGCAACGCTGGAAGGCTCTG
GACAACGCAGAGCCTGCCAGCGTTTTGAGTG
CACTCAAAACGCTGGCAGGCTCTGCGTTGTC
[13] R. A. Pelroy, H. R. Whiteley, J. Bacteriol. 1972, 111, 47–55.
[14] J. Henkin, R. H. Abeles, Biochemistry 1976, 15, 3472-3479.
[15] M. E. Rasche, K. S. Smith, J. G. Ferry, J. Bacteriol. 1997, 179, 7712-
7717.
[16] P. P. Iyer, J. G. Ferry, J. Bacteriol. 2001, 183, 4244–4250.
[17] P. P. Iyer, S. H. Lawrence, K. B. Luther, K. R. Rajashankar, H. P.
Yennawar, J. G. Ferry, H. Schindelin, Structure 2004, 12, 559-567.
[18] S. H. Lawrence, K. B. Luther, H. Schindelin, J. G. Ferry, J. Bacteriol.
2006, 188, 1143–1154.
9
This article is protected by copyright. All rights reserved.

10.1002/cbic.202000015
ChemBioChem
FULL PAPER
[19] Q. S. Xu, J. Jancarik, Y. Lou, K. Kuznetsova, A. F. Yakunin, H. Yokota,
P. Adams, R. Kim, S.-H. Kim, J. Struct. Funct. Genomics 2005, 6, 269–
279.
[33] A. Al-Arif, M. Blecher, J. Lipid Res. 1969, 10, 344-345.
[34] H. Schulz, J. Biol. Chem. 1974, 249, 2704-2709.
[35] J. Knudsen, S. Clark, R. Dils, Biochem. J. 1976, 160, 683-691.
[36] C. O. Rock, J. E. Cronan, I. M. Armitage, J. Biol. Chem. 1981, 256, 2669-
2674.
[20] J. Badger, J. M. Sauder, J. M. Adams, S. Antonysamy, K. Bain, M. G.
Bergseid, S. G. Buchanan, M. D. Buchanan, Y. Batiyenko, J. A.
Christopher, S. Emtage, A. Eroshkina, I. Feil, E. B. Furlong, K. S.
Gajiwala, X. Gao, D. He, J. Hendle, A. Huber, K. Hoda, P. Kearins, C.
Kissinger, B. Laubert, H. A. Lewis, J. Lin, K. Loomis, D. Lorimer, G. Louie,
M. Maletic, C. D. Marsh, I. Miller, J. Molinari, H. J. Muller-Dieckmann, J.
M. Newman, B. W. Noland, B. Pagarigan, F. Park, T. S. Peat, K. W. Post,
S. Radojicic, A. Ramos, R. Romero, M. E. Rutter, W. E. Sanderson, K.
D. Schwinn, J. Tresser, J. Winhoven, T. A. Wright, L. Wu, J. Xu J, T. J.
R. Harris, Proteins: Struct. Funct. Bioinform. 2005, 60, 787-796.
[21] Y. Kim, H. Li, T. A. Binkowski, D. Holzle, A. Joachimiak, J. Struct. Funct.
Genomics 2009, 10, 157-163.
[37] D. Post-Beittenmiller, J. G. Jaworski, J. B. Ohlrogge, J. Biol. Chem. 1991,
266, 1858-1865.
[38] M. A. de la Roche, Z. Shen, D. M. Byers, Arch. Biochem. Biophys. 1997,
344, 159–164.
[39] H. Summer, R. Grämer, P. Dröge, JoVE 2009, 32, e1485.
[40] Z.-F. Guo, Y. Sun, S. Zheng, Z. Guo, Biochemistry 2009, 48, 1712-1722.
[41] Z.-F. Guo, M. Jiang, S. Zheng, Z. Guo, Bioorg. Med. Chem. Lett. 2010,
20, 3855-3858.
[42] Y. Zou, J. Yin, J. Am. Chem. Soc. 2009, 131, 7548-7549.
[43] E. Gasteiger, C. Hoogland, A. Gattiker, S. Duvaud, M. R. Wilkins, R. D.
Appel, A. Bairoch, In The Proteomics Protocols Handbook (Ed.: J. M.
Walker), Humana Press, 2005, pp. 571–607.
[22] L. Holm, L. M. Laakso, Nucleic acids Res. 2016, 44, W351-W355.
[23] J. E. Cronan, J. Thomas J, Methods Enzymol. 2009, 459, 395-433.
[24] G. M. Morris, R. Huey, W. Lindstrom, M. F. Sanner, R. K. Belew, D. S.
Goodsell, A. J. Olson, J. Comput. Chem. 2009, 30, 2785-2791.
[25] Y.-M. Zhang, H. Marrakchi, S. W. White, C. O. Rock, J. Lipid Res. 2003,
44, 1-10.
[44] G. L. Ellman, Arch. Biochem. Biophys. 1959, 82, 70-77.
[45] P. W. Riddles, R. L. Blakeley, B. Zerner, Anal. Biochem. 1979, 94, 75-
81.
[46] M. R. Webb, Proc. Natl. Acad. Sci. U S A 1992, 89, 4884-4887.
[47] W. L. DeLano In DeLano Scientific, San Carlos, CA, 2002.
[48] E. Krissinel, K. Henrick, J. Mol. Biol. 2007, 372, 774-797.
[49] T. J. Dolinsky, J. E. Nielsen, J. A. McCammon, N. A. Baker, Nucleic Acids
Res. 2004, 32, W665-W667.
[26] Y.-M. Zhang, M. S. Rao, R. J. Heath, A. C. Price, A. J. Olson, C. O. Rock,
S. W. White, J. Biol. Chem. 2001, 276, 8231-8238.
[27] Y.-M. Zhang, B. Wu, J. Zheng, C. O. Rock, J. Biol. Chem. 2003, 278,
52935–52943.
[28] V. Agarwal, S. Lin, T. Lukk, S. K. Nair, J. E. Cronan, Proc Natl Acad Sci
U S A 2012, 109, 17406-17411.
[50] The UniProt Consortium. Nucleic Acids Res. 2019, 47, D506-D515.
[51] F. Sievers, A. Wilm, D. Dineen, T. J. Gibson, K. Karplus, W. Z. Li, R.
Lopez, H. McWilliam, M. Remmert, J. Soding, J. D. Thompson, D. G.
Higgins, Mol. Syst. Biol. 2011, 7, 539.
[29] J. Shi, X. Cao, Y. Chen, J. E. Cronan, Z. Guo, Biochemistry 2016, 55,
6705-6717.
[30] A. Röttig, A. Steinbüchel icrobiol. Mol. Biol.Rev. 2013, 77, 277-321.
[31] A. L. Lehninger, J. Biol. Chem. 1946, 162, 333-342.
[32] Y. Lapidot, S. Rappoport, Y. Wolman, J. Lipid Res. 1967, 8, 142-145.
[52] X. Robert, P. Gouet, Nucleic Acids Res. 2014, 42, W320-W324.
[53] N. W. Moriarty, R. W. Grosse-Kunstleve, P. D. Adams, Acta Crystallogr.
Sect. D Biol. Crystallogr. 2009, 65, 1074-1080.
10
This article is protected by copyright. All rights reserved.

10.1002/cbic.202000015
ChemBioChem
FULL PAPER
Entry for the Table of Contents
The peripheral phosphate acyltransferase PlsX is shown to have an active site architecture different from phosphotransacetylases
and to catalyze a similar acyl transfer reaction through a different mechanism. The catalysis likely involves substrate activation and
transition state stabilization by two conserved residues, a lysine and an asparagine.
11
This article is protected by copyright. All rights reserved.