Fragment-like Chloroquinolineamines Activate the Orphan Nuclear Receptor Nurr1 and Elucidate Activation Mechanisms

Article abstract of DOI:10.1021/acs.jmedchem.0c01779

The ligand-activated transcription factor nuclear receptor related-1 (Nurr1) exhibits great potential for neurodegenerative disease treatment, but potent Nurr1 modulators to further probe and validate the nuclear receptor as a therapeutic target are lacki

Full text of DOI:10.1021/acs.jmedchem.0c01779

pubs.acs.org/jmc
Article
Fragment-like Chloroquinolineamines Activate the Orphan Nuclear
Receptor Nurr1 and Elucidate Activation Mechanisms
Sabine Willems, Julia Ohrndorf, Whitney Kilu, Jan Heering, and Daniel Merk*
Cite This: J. Med. Chem. 2021, 64, 2659−2668
Read Online
sı
*
Metrics & More
Article Recommendations
Supporting Information
ACCESS
ABSTRACT: The ligand-activated transcription factor nuclear
receptor related-1 (Nurr1) exhibits great potential for neuro-
degenerative disease treatment, but potent Nurr1 modulators to
further probe and validate the nuclear receptor as a therapeutic
target are lacking. We have systematically studied the structure−
activity relationship of the 4-amino-7-chloroquinoline scaffold
contained in Nurr1 activators amodiaquine and chloroquine and
discovered fragment-like analogues that activated Nurr1 in several
cellular settings. The most active descendants promoted the
transcriptional activity of Nurr1 on human response elements as
monomer, homodimer, and heterodimer and markedly enhanced
Nurr1-dependent gene expression in human astrocytes. As a tool to
elucidate mechanisms involving in Nurr1 activation, these Nurr1
agonists induced robust recruitment of NCoR1 and NCoR2 co-
regulators to the Nurr1 ligand binding domain and promoted Nurr1 dimerization. These findings provide important insights in
Nurr1 regulation. The fragment-sized Nurr1 agonists are appealing starting points for medicinal chemistry and valuable early Nurr1
agonist tools for pharmacology and chemical biology.
study the role of the orphan nuclear receptor in health and
disease.
INTRODUCTION
■
The ligand-sensing transcription factor nuclear receptor
related-1 (Nurr1, NR4A2)1 is an orphan nuclear receptor
with neuroprotective properties. Nurr1 is found in several
neuronal cells with particularly high expression in dopaminer-
gic neurons.2 It regulates the expression of various genes in
dopamine metabolism and transport, which turned out to be
crucial for the protection and survival of dopaminergic
neurons.2 Altered expression of Nurr1 in patients of
Parkinson’s Disease (PD) and the observation that neuronal
Nurr1 knockout in mice causes a phenotype resembling PD
further point to high therapeutic potential of Nurr1
modulation in PD and other neurodegenerative pathologies.2,3
The prostaglandins PGA1 and PGE1 were recently discovered
as endogenous Nurr1 ligands with intermediate micromolar
potency and neuroprotective effects.4 However, the lack of
potent Nurr1 modulators as tools hinders further evaluation
and validation of Nurr1 as a therapeutic target.
Amodiaquine (AQ, 1), chloroquine (CQ, 2), and glafenine
(3) have been reported as first-in-class activators of Nurr13
with micromolar activity (Table 1). These compounds
importantly demonstrate that Nurr1 can be activated with
small molecules. However, their limited potency and their
effects on various other proteins and signaling pathways5−13
render them insufficient as tools for pharmacology and
chemical biology. Optimized Nurr1 activators are required to
Munoz-Tello et al.13 have recently demonstrated that among
the putative Nurr1 modulators reported in the literature, only
AQ (1), CQ (2), and cytosporone B act as direct ligands of the
nuclear receptor to control its transcriptional activity. More-
over, this recent study confirms previous observations that AQ
(1) and CQ (2) likely target the canonical ligand binding site
of the Nurr1 ligand binding domain (LBD)3 in contrast to
PGA1 and PGE1, which bind to a noncanonical site between
helices H5, H11, and H12.4 These important findings13 make
the AQ/CQ chemotype of Nurr1 modulators an attractive
starting point for the development of Nurr1 targeting tool
compounds.
Using 1−3 as the starting matter, we have assessed the
structure−activity relationship (SAR) of this AQ chemotype of
Nurr1 ligands by a rapid fragment-based strategy. We have
discovered that the 4-amino-7-chloroquinoline (4) scaffold
alone is sufficient for Nurr1 activation despite low potency. By
Received: October 19, 2020
Published: February 25, 2021
© 2021 The Authors. Published
byAmerican Chemical Society
https://dx.doi.org/10.1021/acs.jmedchem.0c01779
J. Med. Chem. 2021, 64, 2659−2668
2659

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
a
Table 1. SAR of Side-Chain Motifs in the AQ/CQ
Chemotype. Biological Activity of 1−10 on Nurr1 In Vitro
Scheme 1. Synthesis of 6 and 29−33
a
a
Reagents and conditions: (a) KI, EtOH, 2 N HCl, 90 °C, 14−20 h;
(b) EtOH, μw, 140 °C, 36−48 h.
a
Scheme 2. Synthesis of 27 and 28
a
Reagents and conditions: (a) HOAc, DCE, room temperature, 30
min; then NaB(OAc)3H, DCE, 50 °C, 24 h.
a
Activity was determined in a Gal4-Nurr1 hybrid reporter gene assay.
EC50 and IC50 values are the mean SD; n ≥ 3. Max. fold activation
refers to fold reporter activity compared to DMSO (0.1%)-treated
chloronapthalen-1-amine (24) and the respective ketones 41
and 42 (Scheme 2).
Biological Evaluation. A cellular hybrid reporter gene
assay in HEK293 cells served as a primary test system to
determine Nurr1 modulation by 1−33. This assay is based on
a hybrid receptor construct composed of the human Nurr1
LBD and the Gal4 DNA binding domain from yeast. A Gal4-
sensitive firefly luciferase construct served as the reporter gene,
and constitutively expressed renilla luciferase (SV40 promoter)
was used to normalize for transfection efficiency and to
monitor test compound toxicity. In agreement with the
constitutively active nature of Nurr1,1 the chimeric Gal4-
Nurr1 receptor displays strong intrinsic transcriptional inducer
activity also in the absence of a ligand. As a control experiment,
all tested compounds were assessed for unspecific effects on
reporter activity in an analogous setting with the potent
transcriptional inducer Gal4-VP1615 replacing Gal4-Nurr1
(Figure S1). By providing insights into the type of activity
(agonist or inverse agonist), potency, and efficacy of the tested
compounds, this hybrid reporter gene assay appeared as the
most suitable primary test system, especially since knowledge
on Nurr1-interacting co-regulators and their response to
ligands as the basis for cell-free recruitment assays is still
limited.16
b
cells. Inactive: no significant effect on reporter activity (≥1.5-fold
activation or compared to Gal4-VP16 at the highest nontoxic
concentration as indicated).
systematically varying its substitution pattern, we discovered
potent, fragment-like Nurr1 agonists (24 and 26), which
activated Nurr1 in cellular and cell-free settings. 26 evolves as a
valuable chemical tool to probe molecular mechanisms of
Nurr1 activation. In contrast to AQ and CQ, whose tool
compound applicability is hindered by nonspecific effects on
transcriptional activity,13 26 overcomes this limitation. Using
26 for functional studies, we observed robust recruitment of
the nuclear receptor co-regulators NCoR1 and NCoR2 to
Nurr1 by 26 and a promoting effect on Nurr1 homodimeriza-
tion, which provide improved understanding of molecular
Nurr1 activation mechanisms.
RESULTS AND DISCUSSION
■
Chemistry. Nurr1 modulators 4−33 were synthesized
according to Schemes 1 and 2 or commercially available. 6
and 29−33 were prepared from the respective 4-chloroquino-
lines 12 and 34 and the respective amines 35−40 by
nucleophilic aromatic substitution according to a previously
reported procedure to 614 with suitable adaptions (Scheme 1).
27 and 28 were generated by reductive amination from 5-
For further insights into cellular Nurr1 modulation in more
physiological settings, selected compounds were profiled for
activation of full-length human Nurr1 as the monomer,
homodimer, or RXR-heterodimer. For this, firefly reporter
2660
https://dx.doi.org/10.1021/acs.jmedchem.0c01779
J. Med. Chem. 2021, 64, 2659−2668

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
constructs comprising a single repeat of the respective human
response elements of monomeric Nurr1 (NBRE), the Nurr1
homodimer (NurRE), or the RXR-Nurr1 heterodimer (DR5)
in front of the reporter gene were used. Nurr1 and, in the case
of DR5, also RXRα were overexpressed using CMV promoter-
dependent expression constructs. As for the hybrid Gal4-Nurr1
assay, constitutively expressed renilla luciferase served for
normalization purposes. In addition, effects of selected
compounds on Nurr1-regulated gene expression were
evaluated in Nurr1 expressing17 T98G glioblastoma cells on
the mRNA level by quantitative real-time polymerase chain
reaction (qRT-PCR).
Table 2. Contribution of Chlorine and Amine Residues in
the Chloroquinolineamine Scaffold. Biological Activity of
a
11−14 on Nurr1 In Vitro
Nurr1 modulation was also studied in cell-free, homoge-
neous time-resolved fluorescence resonance energy transfer
(HTRF)-based settings using Tb3+-cryptate-labeled co-regu-
lator peptides derived from NCoR1 and NCoR2 as FRET
donors and recombinant, GFP-labeled Nurr1 LBD protein as
the FRET acceptor.
Structure−Activity Relationship. All three reported
Nurr1 activators AQ (1), CQ (2), and glafenine (3) share
an identical 4-amino-7-chloroquinoline scaffold prompting the
hypothesis that this shared structural feature strongly
contributes to their biological activity on Nurr1. To
preliminarily test this assumption, we determined the Nurr1
modulatory activity of a small series of further 4-amino-7-
chloroquinoline derivatives (4−10, Table 1).
a
Activity was determined in a Gal4-Nurr1 hybrid reporter gene assay.
EC50 and IC50 values are the mean SD; n ≥ 3. Max. fold activation
refers to fold reporter activity compared to DMSO (0.1%)-treated
cells. Inactive: no significant effect on reporter activity (≥1.5-fold
activation or compared to Gal4-VP16 at the highest nontoxic
concentration as indicated).
b
AQ (1) and CQ (2) activated Gal4-Nurr1 with intermediate
micromolar EC50 values of 36 4 μM (3.6 0.1 max. fold
activation) and 47 5 μM (2.0 0.1 max. fold activation),
respectively, which agreed with their reported activities3 and
validated our in vitro test system. Glafenine (3) turned out to
be too toxic to be reasonably characterized in the cellular
setting. The minimal shared structure 4-amino-7-chloroquino-
line (4) of AQ (1) and CQ (2) was indeed sufficient to
activate Nurr1 despite lower potency in a high micromolar
range. AQ analogue 5 lacking the phenolic hydroxyl group
retained reduced Nurr1 agonistic potency, too, while removal
of the diethylaminomethyl motif (6) resulted in full loss of
activity. Replacement of the basic side chain of AQ (1) and
CQ (2) by a butyric acid motif of similar size in 7 produced an
inverse agonist that markedly reduced the transcriptional
activity of Nurr1. A small lipophilic isopentyl side chain residue
(8) recovered Nurr1 agonism with a remarkable 1.8 μM EC50
value but low activation efficacy. The bulkier 4-methylcyclo-
hexyl- (9) and benzyl- (10) derivatives failed to modulate
Nurr1 activity. These preliminary SAR observations indicate
that the side chain motif contributes to Nurr1 modulation but
characterize the 4-amino-7-chloroquinoline (4) as the key
structural feature for Nurr1 modulation. Intrigued by the
observation that the fragment-sized structure 4 was sufficient
to activate Nurr1, we studied the SAR of the isolated
chloroquinoline-amine motif individually.
chloroquinoline (14) was accompanied with a remarkable gain
in potency by almost a factor of 10 compared to 4.
We then systematically varied the regiochemistry of the
essential chlorine and amine substituents (Table 3). Shifting
the chlorine atom from the 7- (4) to the 6- (15) or 8-position
(16) strongly promoted potency on Nurr1, with 8-chloro-4-
aminoquinoline (16) as the most favored isomer. For the
amine substituent, agonism on Nurr1 was lost when the amino
group was moved from the 4-position in 4 to the 2- (17) or 3-
position (18), while shifting the amine to the benzoid ring in
the 5-position (19) was favored by Nurr1. However, this
structural modification turned out to be incompatible with the
favored 6- (15) or 8-position (16) of the chlorine substituent
since 6-chloro-5-aminoquinoline (20) and 8-chloro-5-amino-
quinoline (21) were inactive. When we replaced the 8-chlorine
substituent of the preferred chloroquinolineamine isomer 16
by a bulkier trifluoromethyl group (22) or by a smaller fluorine
atom (23), we observed a drastic loss in potency, suggesting
that the chlorine atom was highly favored in this position.
Eventually, we also addressed the contribution of the quinoline
nitrogen atom in the favored regioisomer 16 whose removal in
naphthalene 24 was favored and promoted potency by a factor
of 5, whereas shifting the nitrogen by one position to
isoquinoline 25 resulted in inactivity.
First, we evaluated the individual contributions of structural
features of 4 to Nurr1 activation by their systematic removal
(Table 2). 7-Chloroquinoline (11) lacking the 4-amino group
revealed inverse Nurr1 agonism with moderate repressor
efficacy, while 4,7-dichloroquinoline (12) was inactive pointing
to an important contribution of the amino group to Nurr1
activation. 4-Aminoquinoline (13) lacking the 7-chlorine
substituent was inactive, too, indicating the chlorine as another
important feature for Nurr1 agonism. Introduction of an
additional methyl group in the 2-position of the 4-amino-7-
The in vitro activities of 11−25 demonstrated the presence
and regiochemistry of the amine and chlorine substituents as
crucial contributing factors for potency on Nurr1. Additionally,
we observed an increase in potency for a methyl group in the
2-position. Combination of this favorable methyl substituent
(14) with a preferred regiochemistry of the chlorine and amine
substituents (16) in 26 further enhanced potency to a low
micromolar EC50 value (Table 4).
2661
https://dx.doi.org/10.1021/acs.jmedchem.0c01779
J. Med. Chem. 2021, 64, 2659−2668

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
Table 3. SAR and Biological Activity of Chloroquinoline-
Amine Regioisomers 15−25 on Nurr1 In Vitro
Table 4. Fused SAR in the Chloroquinolineamine Fragment.
Biological Activity of 14, 16, and 26 on Nurr1 In Vitro
a
a
a
Activity was determined in a Gal4-Nurr1 hybrid reporter gene assay.
EC50 values are the mean SD; n ≥ 3. Max. fold activation refers to
fold reporter activity compared to DMSO (0.1%)-treated cells.
comprising markedly lower molecular weights. Accordingly, 24
and 26 are superior in terms of ligand efficiency (LE),
lipophilic ligand efficiency (LLE), and size-independent ligand
efficiency (SILE)18 compared to AQ (1) and CQ (2), which
were employed as leads (Table 5).
a
Table 5. Efficiency Metrics of Nurr1 Agonists
b
ID
EC50 (Nurr1)
LE
LLE
SILE
1
2
24
26
36 4 μM
47 5 μM
7.3 0.5 μM
17 6 μM
0.24
0.27
0.59
0.50
−0.39
−0.95
1.85
1.7
1.7
2.4
2.2
1.83
a
b
Metrics were calculated as described in ref 18. alogP for LLE
calculations was retrieved from the ALOGPS 2.1 resource.19
In an attempt to recombine 24 and 26 with the substituents
of the template drugs, we prepared and characterized the
respective CQ analogues (Table 6). Compound 27 resulting
from fusion of CQ (2) and fragment 24 was active but too
toxic for full dose−response characterization on Gal4-Nurr1.
Its potency was inferior to fragment 24 but might be a minor
improvement over CQ (2). To exclude steric hindrance as a
reason for the surprisingly low potency of 27, we studied its
smaller dimethyl analogue 28, which was inactive up to 10 μM
and toxic at higher concentrations. The fusion of 26 and 2 in
29 was nontoxic but inactive on Gal4-Nurr1 up to high 100
μM concentration. Despite the undesirable nonspecific
activities of AQ (1),5−10,20,21 we also fused 26 with the AQ
side chain, but the resulting compound 30 was inactive, too.
These results suggest that recombination of the optimized
fragment with the AQ (1) or CQ (2) side chains was not a
constructive strategy to achieve further optimization.
a
Activity was determined in a Gal4-Nurr1 hybrid reporter gene assay.
EC50 values are the mean SD; n ≥ 3. Max. fold activation refers to
fold reporter activity compared to DMSO (0.1%)-treated cells.
b
Inactive: no significant effect on reporter activity (≥1.5-fold
activation or compared to Gal4-VP16 at the highest nontoxic
concentration as indicated).
The early SAR analysis had also revealed a branched
lipophilic side chain (8) as favored for Nurr1 activation.
Hence, we additionally probed fusion of this isopentyl motif
and related small lipophilic groups with the optimized
chloroquinoline fragment 26 (31−33, Table 6). All three
derivatives comprising an isopropyl (31), n-butyl (32), or
isopentyl (33) substituent activated Nurr1 with micromolar
Our systematic SAR analysis of 4 and analogues as Nurr1
agonists rendered 24 and 26 as the most favorable derivatives.
With EC50 values of 7 and 17 μM, respectively, both fragment-
like molecules 24 and 26 possess slightly higher potencies on
Nurr1 than the template drugs AQ (1) and CQ (2) while
2662
https://dx.doi.org/10.1021/acs.jmedchem.0c01779
J. Med. Chem. 2021, 64, 2659−2668

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
activates Nurr1 despite nonspecific effects. Of note, the
previously reported Nurr1 agonists CQ (2) and especially
AQ (1) cause opposite nonspecific effects on control gene
activity (Figure S2a), indicating nonspecific transcriptional
activation as already observed by Munoz-Tello et al.13
Compound 26, in contrast, did not affect renilla activity
(Figure S2a) and VP16-dependent transcriptional activity
(Figure S1), suggesting it as an improved Nurr1 agonist tool
with reduced nonspecific effects.
Table 6. Biological Activity of Fused Structures 27−33 on
a
Nurr1 In Vitro
Based on these considerations, 26 evolved as the most
attractive fragment descendant of AQ (1) and CQ (2) for
further studies on Nurr1 agonist characteristics. In addition,
fragment 24 presents as an attractive starting point for further
optimization despite nonspecific activity that will require
attention (Figure S2). Hence, we studied the effects of 24 and
26 on Nurr1 activity in more physiological settings involving
the full-length human nuclear receptor (Figure 1a and 1b;
Figure 1. Nurr1 agonism of 24 and 26 in cellular settings. (a, b)
Nurr1 agonist activity of (a) 24 and (b) 26 on full-length human
Nurr1 as the monomer (NBRE), homodimer (NurRE), and RXR-
heterodimer (DR5). Data are the mean S.E.M.; n ≥ 3. Individual
curves are shown in Figure S4, and corresponding EC50 values are
listed in Table S1. (c) Effects of 24 and 26 on mRNA expression of
vesicular monoamine transporter 2 (VMAT2) and tyrosine
hydroxylase (TH) in human astrocytes (T98G). CQ (2) for
comparison. Nurr1 agonists 24 and 26 strongly promoted Nurr1-
regulated VMAT2 and TH expression in a dose-dependent manner.
Data are the mean S.E.M.; n = 4. mRNA levels were determined by
qRT-PCR and analyzed by the 2‑ΔΔCt method. * p < 0.05, ** p < 0.01,
*** p < 0.001 vs. DMSO control (t-test).
a
Activity was determined in a Gal4-Nurr1 hybrid reporter gene assay.
EC50 values are the mean SD; n ≥ 3. Max. fold activation refers to
fold reporter activity compared to DMSO (0.1%)-treated cells.
b
Inactive: no significant effect on reporter activity (≥1.5-fold
activation or compared to Gal4-VP16 at the highest nontoxic
concentration as indicated).
potencies, but neither modification provided an improvement
in potency compared to the fragment 26. Together, the weak
Nurr1 modulatory activities of the fused derivatives 27−33,
hence, indicate that the SAR of the chloroquinoline core and
the side chain motif is not additive and that systematic efforts
are needed for further optimization.
While compound 24 evolved as the most potent Nurr1
agonist in this study, it also exhibited nonspecific effects on the
control gene (renilla luciferase) in our reporter gene assays
(Figures S2a and S3). Its efficacy in Nurr1 activation may
therefore be overestimated. Control experiments on Gal4-
VP16 (Figure S1) and a pronounced increase in Nurr1-
induced reporter activity demonstrate, however, that 24
Figure S4). Both compounds activated the Nurr1 monomer,
homodimer, and RXR-heterodimer on the human Nurr1
response elements NBRE, NurRE, and DR5. In line with the
hybrid reporter gene assay data (Figure S5), 24 revealed higher
potency compared to 26 and CQ (2),16 while 26 activated the
human Nurr1 response elements with higher efficacy. To
confirm Nurr1 modulation also in an orthogonal native cellular
setting, we determined the effects of 24 and 26 on Nurr1-
2663
https://dx.doi.org/10.1021/acs.jmedchem.0c01779
J. Med. Chem. 2021, 64, 2659−2668

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
Figure 2. Effects of Nurr1 agonist 26 (20 and 100 μM) on co-regulator recruitment to the Nurr1 LBD in homogeneous time-resolved fluorescence
resonance energy transfer (HTRF) assays. (a) Recruitment of Tb3+-cryptate-labeled NCoR1 to the sGFP-labeled Nurr1 LBD. (b) Recruitment of
Tb3+-cryptate-labeled NCoR2 to the sGFP-labeled Nurr1 LBD. (c) Homodimerization between the Tb3+-cryptate-labeled and sGFP-labeled Nurr1
LBD. Data are the mean SD; N = 3. Compound 24 exhibits comparable effects (Figure S6).
regulated gene expression in Nurr1 expressing17 human
astrocytes (T98G) on the mRNA level (Figure 1c). Both 24
and 26 caused a marked induction of vesicular monoamine
transporter 2 (VMAT2; SLC18A2) and tyrosine hydroxylase
(TH) in a dose-dependent fashion. These results demonstrate
Nurr1 activation by 24 and 26 in various cellular settings, and
hence, fully characterize the fragments 24 and 26 as Nurr1
agonists useful as lead compounds for medicinal chemistry and
as early tools to study Nurr1 biology.
inverse agonists, these results indicate involvement of NCoR1
and NCoR2 binding in Nurr1 activation. This is further
supported by the fact that Nurr1 acts as a constitutive
transcriptional activator and markedly recruits NCoR1 and
NCoR2 also in the apo state (Figure 2a and 2b, DMSO). In
addition to effects on NCoR1 and NCoR2 recruitment, we
have previously observed a ligand-sensitive dimerization of the
Nurr1 LBD,16 wherein inverse Nurr1 agonists strongly
counteracted Nurr1 homodimer formation. In line with this,
the Nurr1 activators 24 and 26 enhanced Nurr1 homodime-
rization (Figure 2c; Figure S6) as another factor likely
involving in Nurr1 activation. This observation aligns with
the higher agonist efficacy of 26 on the human Nurr1
homodimer response element NurRE (Figure 1b). Hence, the
Nurr1 agonist 26 as a tool in HTRF settings revealed increased
recruitment of NCoR1 and NCoR2 to the Nurr1 LBD as well
as enhanced Nurr1 homodimerization as contributing factors
of Nurr1 activation.
The chloroquinoline 26 comprises a consistent Nurr1
agonist profile in multiple orthogonal cellular settings including
hybrid and full-length Nurr1 reporter gene assays and gene
expression studies in native cells. In addition, the compound is
characterized by reduced nonspecific effects compared to AQ
(1) and CQ (2) and thus seemed suitable as a tool to study
regulatory interactions involving in Nurr1 activation in HTRF-
based systems. Using inverse Nurr1 agonists, we have
previously discovered a ligand-sensitive interaction of Nurr1
with the nuclear receptor co-repressors NCoR1 and NCoR2.16
However, the previously available Nurr1 agonists AQ (1) and
CQ (2) exhibited very weak (CQ) or no (AQ) effects at all on
the binding of these co-regulators to Nurr1.16 In addition, their
nonspecific transcriptional effects put the applicability of AQ
(1) and CQ (2) as tools into question. The regulatory
contributions of the bona fide co-repressors NCoR1 and
NCoR2 to Nurr1 activation, thus, remained elusive. Initial
experiments (not shown) suggested enhanced recruitment of
NCoR1 and NCoR2 upon binding of 26 to the Nurr1 LBD,
which aligned with our previous finding that these co-
regulators are displaced from Nurr1 by inverse agonists. To
avoid any photophysical effects of 26 in studying co-regulator
recruitment to Nurr1, we determined NCoR1 and NCoR2
binding by titrating the GFP-labeled Nurr1 LBD in the
presence of a fixed concentration of 26 and a fixed
concentration of the FRET donor-labeled co-regulator peptide.
The FRET acceptor concentration was also kept constant
throughout the titration by adding respective amounts of free
GFP. This setting ensured that any photophysical effects of 26
were constant over the full curve and that an increase in the
HTRF signal only resulted from binding of the labeled co-
regulator to the labeled Nurr1 LBD. Using this assay setup, we
observed a dose-dependent increase in NCoR1 and NCoR2
recruitment to the Nurr1 LBD in the presence of 26 (20 and
100 μM, Figure 2a and 2b) or 24 (100 μM, Figure S6). In line
with the previously discovered co-regulator displacement by
CONCLUSIONS
■
The available collection of direct Nurr1 modulating small
molecules is scarce, limiting further efforts to validate Nurr1 as
a drug target. Munoz-Tello et al.13 have demonstrated that the
majority of the putative Nurr1 ligands does not directly
interact with the nuclear receptor and thereby characterized
the AQ/CQ chemotype as the most suitable starting point for
further tool compound development. They have also shown
that despite directly activating Nurr1, AQ and CQ have
nonspecific effects on transcriptional activity, limiting their
applicability as tools to study Nurr1. This aligns with several
previously reported activities of the antimalarials5−13 and with
our observation of elevated control gene transcription upon
AQ and CQ treatment.
By fragmentation of the AQ/CQ chemotype of Nurr1
activators and systematic SAR elucidation of the fragment-
sized chloroquinoline scaffold, we discovered 24 and 26 as
novel Nurr1 agonists. Despite providing only moderately
increased potency compared to AQ and CQ, these compounds
have remarkably lower size and molecular weight, which make
them attractive lead compounds for further expansion and
optimization by medicinal chemistry. In addition, while 24 also
exhibited nonspecific (potentially cytotoxic) effects on tran-
scriptional activity, 26 had no such activity. Thereby, 26
overcomes one limitation of AQ and CQ as Nurr1 ligands, and
2664
https://dx.doi.org/10.1021/acs.jmedchem.0c01779
J. Med. Chem. 2021, 64, 2659−2668

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
1H), 7.56 (dd, J = 7.4, 1.0 Hz, 1H), 7.51−7.40 (m, 2H), 7.32 (dd, J =
8.6, 7.3 Hz, 1H), 6.74 (dt, J = 7.3, 1.0 Hz, 1H), 5.43 (s, 1H), 3.80−
3.71 (m, 1H), 2.54−2.45 (m, 6H), 1.86−1.78 (m, 1H), 1.69−1.58
(m, 3H), 1.30 (d, J = 6.3 Hz, 3H), 0.98 (t, J = 7.1 Hz, 6H). 13C NMR
(126 MHz, acetone-d6): δ = 144.93, 132.72, 132.44, 129.17, 126.86,
125.65, 124.43, 121.54, 111.98, 105.72, 53.51, 49.24, 47.55 (2C),
35.01, 24.70, 20.63, 12.12 (2C). HRMS (ESI+): m/z calculated
320.1973 for C19H28ClN2, found 320.1982 ([M + H]+).
hence, is a valuable early Nurr1 agonist tool to study the
receptor’s molecular and cellular function. Using 26 for
extended functional studies, we confirmed the hypothesis
that the inverse Nurr1 agonist responsive16 co-regulators
NCoR1 and NCoR2 are robustly recruited to Nurr1 in the
presence of agonists, which together with strengthened Nurr1
homodimerization upon binding of 26 provides insights in the
activation mechanism of Nurr1.
N4-(5-Chloronaphthalen-1-yl)-N1,N1-dimethylpentane-1,4-diamine
(28). 5-Chloronaphthalen-1-amine (24, 44 mg, 0.25 mmol, 1.0 equiv)
and 5-(dimethylamino)pentan-2-one (42, 50 mg, 0.33 mmol, 1.3
equiv) were dissolved in 1,2-dichloroethane (10 mL), molecular
sieves (4 Å) were added, and the mixture was stirred at room
temperature for 2 h. Then, acetic acid (0.75 mL) was added, and the
mixture was stirred at 50 °C for another 2 h. NaB(OAc)3H (0.16 g,
0.75 mmol, 3.0 equiv) was then added, and the mixture was stirred at
50 °C for 24 h. After quenching with aqueous sodium hydroxide
solution (50 mL, 1 M), phases were separated, and the aqueous layer
was extracted twice with EtOAc (2x 25 mL). The combined organic
layers were dried over Na2SO4, and solvents were removed under
reduced pressure. The crude product was purified by column
chromatography with hexane/EtOAc (1:1) and acetone/toluene
(20:1) + 2% triethylamine to obtain 28 as a pale brown solid in
25% yield. 1H NMR (500 MHz, acetone-d6): δ = 8.16 (dt, J = 8.6, 0.9
Hz, 1H), 7.56 (dd, J = 7.4, 1.0 Hz, 1H), 7.51−7.41 (m, 2H), 7.33 (dd,
J = 8.6, 7.4 Hz, 1H), 6.73 (dt, J = 7.2, 1.1 Hz, 1H), 3.79−3.73 (m,
1H), 2.50 (t, J = 7.0 Hz, 2H), 2.31 (s, 6H), 1.90−1.61 (m, 4H), 1.30
(d, J = 6.3 Hz, 3H). 13C NMR (126 MHz, acetone-d6) δ 144.93,
132.71, 132.39, 129.17, 126.88, 125.68, 124.46, 121.67, 111.98,
105.63, 59.56, 49.15, 44.76 (2C), 34.70, 24.32, 20.76. HRMS (ESI+):
m/z calculated 291.1628 for C17H24ClN2, found 291.1626 ([M +
H]+).
EXPERIMENTAL SECTION
■
Chemistry. General. All chemicals and solvents for synthesis were
obtained from commercial sources in reagent grade and used without
further purification. TLC was performed using TLC plates (silica gel
60 F254, 0.2 mm, Merck or Alugram Xtra Sil G/UV 0.2 mm,
Macherey-Nagel) with detection under UV light (254 and 366 nm).
Preparative column chromatography was performed using Silicagel 60
(Macherey-Nagel) and solvents of technical grade. Reactions with air-
or moisture-sensitive compounds were carried out under an argon
atmosphere and in anhydrous solvents. NMR spectra were recorded
on Bruker AV 500 and AV 600 spectrometers (Bruker Corporation,
Billerica, MA, USA). Chemical shifts (δ) are reported in ppm relative
to TMS and coupling constants (J) in Hz. Multiplicity of signals is
indicated as s for singlet, d for doublet, t for triplet, q for quartet, and
m for multiplet. High-resolution mass spectra were recorded on a
MALDI LTQ ORBITRAP XL instrument (Thermo Fisher Scientific)
or on a Bruker maXis ESI-Qq-TOF-MS instrument (Bruker).
Compound purity was analyzed using a Varian ProStar HPLC
(SpectraLab Scientific Inc., Markham, ON, Canada) equipped with a
MultoHigh100 Phenyl-5 μ 240 + 4 mm column (CS-Chromatogra-
phie Service GmbH, Langerwehe, Germany) using a gradient (H2O/
MeOH 80:20 + 0.1% formic acid isocratic for 5 min to MeOH + 0.1%
formic acid after additional 45 min and MeOH + 0.1% formic acid for
additional 10 min) at a flow rate of 1 mL/min and UV detection at
245 and 280 nm. All final compounds for biological evaluation had a
purity >95% according to the AUC at 245 and 280 nm UV detection.
Final compounds from commercial sources were obtained from Sigma
Aldrich, Enamine, TCI, Fluorochem, abcr, Apollo Scientific or Life
Chemicals and had a purity >95% according to the supplier’s
certificate.
N4-(8-Chloro-2-methylquinolin-4-yl)-N1,N1-diethylpentane-1,4-di-
amine (29). 4,8-Dichloro-2-methylquinoline (34, 106 mg, 0.5 mmol,
1.0 equiv) and N1,N1-diethylpentane-1,4-diamine (37, 0.12 mL, 0.6
mmol, 1.2 equiv) were dissolved in EtOH (6 mL). The mixture was
stirred under microwave irradiation at 140 °C for 36 h. After cooling
to room temperature, the solvent was removed under vacuum. The
crude product was purified by column chromatography using a
gradient of hexane/EtOAc (5:1) + 2% triethylamine to hexane/
EtOAc (1:1) + 2% triethylamine to obtain 29 as a pale yellow solid in
54% yield. 1H NMR (600 MHz, deuterium oxide): δ = 7.90 (d, J = 8.5
Hz, 1H), 7.75 (d, J = 7.7 Hz, 1H), 7.30 (t, J = 8.0 Hz, 1H), 6.58 (s,
1H), 3.90−3.82 (m, 1H), 3.17 (q, J = 7.2 Hz, 4H), 2.96−2.91 (m,
2H), 2.49 (s, 3H), 1.23 (d, J = 6.3 Hz, 3H), 1.15 (t, J = 7.3 Hz, 6H),
1.06−1.01 (m, 4H). 13C NMR (126 MHz, DMSO-d6): δ = 160.90,
150.68, 144.75, 131.99, 130.01, 123.74, 121.57, 119.50, 99.90, 52.34,
49.22, 48.27 (2C), 33.93, 25.84, 23.08, 20.47, 11.44 (2C). HRMS
(ESI+): m/z calculated 334.2050 for C19H29ClN3, found 334.2055
([M + H]+).
4-((8-Chloro-2-methylquinolin-4-yl)amino)-2-((diethylamino)-
methyl)phenol (30). 4,8-Dichloro-2-methylquinoline (34, 0.21 g, 1.0
mmol, 1.0 equiv), 4-amino-2-(diethylamino)methyl)phenol dihydro-
chloride (36, 293 mg, 1.1 mmol, 1.1 equiv), and a catalytic amount of
potassium iodide were dissolved in EtOH (30 mL), aqueous
hydrochloric acid (0.2 mL, 2 N) was added dropwise, and the
mixture was stirred under reflux for 20 h. After cooling to room
temperature, the mixture was filtered, and the filtrate was
concentrated under reduced pressure. The crude product was washed
with cold EtOH to obtain 30 as a yellow solid in 51% yield. 1H NMR
(500 MHz, deuterium oxide): δ = 8.18 (dd, J = 8.6, 1.2 Hz, 1H), 7.99
(dd, J = 7.7, 1.2 Hz, 1H), 7.60 (t, 1H), 7.46−7.41 (m, 2H), 7.19−7.14
(m, 1H), 6.67 (s, 1H), 4.37 (s, 2H), 3.30 (dq, J = 10.1, 7.2 Hz, 4H),
2.62 (s, 3H), 1.38 (t, J = 7.3 Hz, 6H). 13C NMR (126 MHz,
Deuterium Oxide): δ = 156.20, 156.16, 155.95, 135.40, 134.52,
130.28, 129.90, 129.18, 127.36, 124.08, 121.94, 118.78, 117.82,
117.66, 101.72, 52.20, 48.36 (2C), 20.68, 8.83 (2C). HRMS
(MALDI): m/z calculated 370.16807 for C21H25ClN3O, found
370.16737 ([M + H]+).
4-((7-Chloroquinolin-4-yl)amino)phenol (6). 4,7-Dichloroquino-
line (12, 0.99 g, 5.0 mmol, 1.0 equiv), 4-aminophenol (35, 0.60 g, 5.5
mmol, 1.1 equiv), and a catalytic amount of potassium iodide were
dissolved in ethanol (EtOH, 20 mL), aqueous hydrochloric acid (1.0
mL, 2 N) was added dropwise, and the mixture was stirred under
reflux for 14 h. After cooling to room temperature, the crude product
was filtered off and washed with EtOH to obtain 6 as a yellow solid in
1
98% yield. H NMR (500 MHz, DMSO-d6): δ = 10.99 (s, 1H), 9.94
(s, 1H), 8.80 (d, J = 9.1 Hz, 1H), 8.45 (d, J = 7.1 Hz, 1H), 8.14 (d, J =
2.0 Hz, 1H), 7.84 (dd, J = 9.1, 2.1 Hz, 1H), 7.30−7.19 (m, 2H),
7.00−6.93 (m, 2H), 6.62 (d, J = 7.0 Hz, 1H). 13C NMR (126 MHz,
DMSO-d6): δ = 157.09, 155.43, 143.10, 139.02, 138.31, 127.69,
127.23, 127.19 (2C), 125.98, 119.19, 116.49 (2C), 115.66, 99.99.
HRMS (MALDI): m/z calculated 271.06327 for C15H12ClN2O,
found 271.06403 ([M + H]+).
N4-(5-Chloronaphthalen-1-yl)-N1,N1-diethylpentane-1,4-diamine
(27). 5-Chloronaphthalen-1-amine (24, 89 mg, 0.50 mmol, 1.0 equiv)
and 5-(diethylamino)pentan-2-one (41, 73 μL, 0.55 mmol, 1.1 equiv)
were dissolved in 1,2-dichloroethane (10 mL), molecular sieves (4 Å)
were added, and the mixture was stirred at room temperature for 2 h.
Then, acetic acid (0.75 mL) was added, and the mixture was stirred at
50 °C for another 2 h. NaB(OAc)3H (0.32 g, 1.5 mmol, 3.0 equiv)
was then added, and the mixture was stirred at 50 °C for 24 h. After
quenching with aqueous sodium hydroxide solution (100 mL, 1 M),
phases were separated, and the aqueous layer was extracted twice with
EtOAc (2x 100 mL). The combined organic layers were dried over
Na2SO4, and solvents were removed under reduced pressure. The
crude product was purified by column chromatography in hexane/
EtOAc (10:1) + 2% triethylamine to obtain 27 as a brown oil in 45%
yield. 1H NMR (500 MHz, acetone-d6): δ = 8.14 (dt, J = 8.6, 1.0 Hz,
2665
https://dx.doi.org/10.1021/acs.jmedchem.0c01779
J. Med. Chem. 2021, 64, 2659−2668

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
8-Chloro-N-isopropyl-2-methylquinolin-4-amine (31). 4,8-Di-
chloro-2-methylquinoline (34, 0.11 g, 0.50 mmol, 1.0 equiv) and
propan-2-amine (38, 51 μL, 0.60 mmol, 1.2 equiv) were dissolved in
EtOH (6.0 mL), and the mixture was stirred for 36 h at 140 °C under
microwave irradiation. The solvent was evaporated in vacuum,
aqueous sodium hydroxide solution (20 mL) and ethyl acetate (20
mL) were added, phases were separated, and the aqueous layer was
extracted two times with ethyl acetate (2x 20 mL). The combined
organic layers were dried over Na2SO4, and the solvent was
evaporated in vacuum. The crude product was purified by column
chromatography (hexane/ethyl acetate 5:1 + 2% NEt3 and hexane/
ethyl acetate 1:1 + 2% NEt3) to obtain the title compound as a yellow
oil (15 mg, 13%). 1H NMR (500 MHz, Acetone-d6): δ = 8.05 (dd, J =
8.5, 1.3 Hz, 1H), 7.70 (dd, J = 7.4, 1.3 Hz, 1H), 7.29−7.22 (m, 1H),
6.54 (s, 1H), 6.14 (d, J = 6.9 Hz, 1H), 4.01−3.90 (m, 1H), 2.54 (s,
3H), 1.34 (d, J = 6.4 Hz, 6H). 13C NMR (126 MHz, acetone-d6): δ =
160.73, 150.50, 145.82, 133.84, 129.73, 123.57, 120.86, 120.12,
100.33, 44.81, 25.92, 22.31 (2C). HRMS (MALDI): m/z calculated
235.09965 for C13H16ClN2, found 235.10002 ([M + H]+).
N-Butyl-8-chloro-2-methylquinolin-4-amine (32). 4,8-Dichloro-2-
methylquinoline (34, 0.11 g, 0.50 mmol, 1.0 equiv) and butan-1-
amine (39, 73 mg, 1.0 mmol, 2.0 equiv) were dissolved in EtOH (6.0
mL), and the mixture was stirred for 48 h at 140 °C under microwave
irradiation. The solvent was evaporated in vacuum, and the crude
product was purified by column chromatography (hexane/ethyl
acetate 5:1 + 2% NEt3) to obtain the title compound as a yellow oil
(30 mg, 24%). 1H NMR (500 MHz, CDCl3): δ = 7.71−7.64 (m, 2H),
7.20 (t, J = 8.0 Hz, 1H), 6.26 (s, 1H), 3.27−3.22 (m, 2H), 2.62 (s,
3H), 1.72−1.65 (m, 2H), 1.48−1.40 (m, 2H), 0.94 (t, J = 7.4 Hz,
3H). 13C NMR (126 MHz, CDCl3): δ = 159.86, 150.46, 129.63,
123.57, 118.83, 118.61, 99.63, 43.18, 30.92, 25.76, 20.34, 13.85.
HRMS (MALDI): m/z calculated 249.11530 for C14H18ClN2, found
249.11583 ([M + H]+).
pFR-Luc (Stratagene), pRL-SV40 (Promega), and the corresponding
Gal4-fusion nuclear receptor plasmid pFA-CMV-hNR-LBD. Five
hours after transfection, the medium was changed to Opti-MEM
supplemented with penicillin (100 U/mL) and streptomycin (100
μg/mL), now additionally containing 0.1% DMSO and the respective
test compound or 0.1% DMSO alone as untreated control. Each
concentration was tested in duplicates, and each experiment was
performed independently at least three times. The Gal4-VP16 control
experiments were carried out in duplicates as well, with at least four
independent repeats. Following overnight (12−14 h) incubation with
the test compounds, the cells were assayed for luciferase activity using
the Dual-GloTM Luciferase Assay System (Promega) according to the
manufacturer’s protocol. Luminescence was measured with a Spark 10
̈
M luminometer (Tecan Group AG, Mannedorf, Switzerland).
Normalization of transfection efficiency and cell growth were done
by division of firefly luciferase data by renilla luciferase data and
multiplying the value by 1000 resulting in relative light units (RLU).
Fold activation was obtained by dividing the mean RLU of a test
compound at a respective concentration by the mean RLU of
untreated control. The hybrid assay was validated with amodiaquine
and chloroquine as reference agonists, which yielded EC50 values in
agreement with the literature. For dose−response curve fitting and
calculation of EC50/IC50 values, the equations “[Agonist]/[Inhibitor]
vs. response − variable slope (four parameters)” were performed with
mean fold activations
SD using GraphPad Prism (version 7.00,
GraphPad Software, La Jolla, CA, USA).
Full-Length Nurr1 Reporter Gene Assays. Plasmids: The
reporter plasmids pFR-Luc-NBRE,16 pFR-Luc-NurRE,16 and pFR-
Luc-DR516 each containing one copy of the respective human Nurr1
response element NBRE Nl3 (TGATATCGAAAACAAAAGGTCA),
NurRE (from POMC; TGATATTTACCTCCAAATGCCA), or DR5
(TGATAGGTTCACCGAAAGGTCA) were described previously.
The full length human nuclear receptor Nurr1 (pcDNA3.1-hNurr1-
NE; Addgene, entry 102363) and, for DR5, RXRα (pSG5-hRXR23)
were overexpressed. pFL-SV40 (Promega) was used for normalization
of transfection efficacy and evaluation of compound toxicity. Assay
procedure: HEK293T cells were grown in DMEM high glucose,
supplemented with 10% FCS, sodium pyruvate (1 mM), penicillin
(100 U/mL), and streptomycin (100 μg/mL) at 37 °C and 5% CO2.
The day before transfection, HEK293T cells were seeded in 96-well
plates (3 × 104 cells/well). The medium was changed to Opti-MEM
without supplements right before transfection. Transient transfection
was performed using the Lipofectamine LTX reagent (Invitrogen)
according to the manufacturer’s protocol with pFR-Luc-NBRE,16
pFR-Luc-NurRE16 or pFR-Luc-DR5,16 pRL-SV40 (Promega), the
human full length receptor plasmid pcDNA3.1-hNurr1-NE, and, for
DR5, also pSG5-hRXR.23 Five hours after transfection, the medium
was changed to Opti-MEM supplemented with penicillin (100 U/
mL) and streptomycin (100 μg/mL), now additionally containing
0.1% DMSO and the respective test compound or 0.1% DMSO alone
as untreated control. For full dose−response characterization, each
concentration was tested in duplicates and each experiment was
performed independently at least three times. Following overnight
(12−14 h) incubation with the test compounds, the cells were assayed
for luciferase activity using a Dual-GloTM Luciferase Assay System
(Promega) according to the manufacturer’s protocol. Luminescence
was measured with a Spark 10 M luminometer (Tecan Group AG).
Normalization of transfection efficiency and cell growth were done by
division of firefly luciferase data by renilla luciferase data and
multiplying the value by 1000 resulting in RLU. Fold activation was
obtained by dividing the mean RLU of a test compound at a
respective concentration by the mean RLU of untreated control. The
full length Nurr1 reporter gene assays were validated with
amodiaquine and chloroquine as reference agonists.
8-Chloro-2-methyl-N-(3-methylbutan-2-yl)quinolin-4-amine (33).
4,8-Dichloro-2-methylquinoline (34, 0.11 g, 0.50 mmol, 1.0 equiv)
and 3-methylbutan-2-amine (40, 87 mg, 1.0 mmol, 2.0 equiv) were
dissolved in EtOH (6.0 mL), and the mixture was stirred for 48 h at
140 °C under microwave irradiation. The solvent was evaporated in
vacuum, aqueous sodium hydroxide solution (20 mL) and ethyl
acetate (20 mL) were added, phases were separated, and the aqueous
layer was extracted two times with ethyl acetate (2x 20 mL). The
combined organic layers were dried over Na2SO4, and the solvent was
evaporated in vacuum. The crude product was purified by column
chromatography (hexane/ethyl acetate 5:1 + 2% NEt3 and hexane/
ethyl acetate 1:1 + 2% NEt3) to obtain the title compound as a green
1
oil (6 mg, 4%). H NMR (500 MHz, MeOD): δ = 8.08 (dd, J = 8.5,
1.2 Hz, 1H), 7.70 (dd, J = 7.5, 1.2 Hz, 1H), 7.31−7.26 (m, 1H), 6.49
(s, 1H), 3.57 (quint., J = 6.7 Hz, 1H), 2.53 (s, 3H), 1.95−1.84 (m, J =
6.8, 1H), 1.19 (d, J = 6.6, 3H), 0.94−0.91 (m, 6H). 13C NMR (126
MHz, MeOD): δ = 159.03, 152.19, 130.57, 123.81, 120.37, 118.63,
99.28, 54.29, 32.47, 22.35, 18.62, 17.36, 15.44. HRMS (MALDI): m/z
calculated 263.13095 for C15H20ClN2, found 263.13157 ([M + H]+).
Hybrid Gal4-Nurr1 Reporter Gene Assay. Plasmids. The Gal4-
fusion receptor plasmid pFA-CMV-hNURR1-LBD16 coding for the
hinge region and LBD of the canonical isoform of human Nurr1 has
been reported previously. The Gal4-VP1615 fusion protein expressed
from plasmid pECE-SV40-Gal4-VP1622 (Addgene, entry 71728,
Watertown, MA, USA) served as a ligand-independent transcriptional
inducer for control experiments. pFR-Luc (Stratagene, La Jolla, CA,
USA) was used as a reporter plasmid and pRL-SV40 (Promega,
Madison, WI, USA) for normalization of transfection efficiency and
test compound toxicity. Assay procedure. HEK293T cells were grown
in DMEM high glucose, supplemented with 10% fetal calf serum
(FCS), sodium pyruvate (1 mM), penicillin (100 U/mL), and
streptomycin (100 μg/mL) at 37 °C and 5% CO2. The day before
transfection, HEK293T cells were seeded in 96-well plates (3 × 104
cells/well). The medium was changed to Opti-MEM without
supplements right before transfection. Transient transfection was
performed using the Lipofectamine LTX reagent (Invitrogen,
Carlsbad, CA, USA) according to the manufacturer’s protocol with
Nurr1 Co-Regulator Recruitment Assays. Interaction of co-
regulator peptides to the Nurr1-LBD was studied in a homogeneous
time-resolved fluorescence resonance energy transfer (HT-FRET)
assay system. Terbium cryptate as streptavidin conjugate (Tb-SA;
Cisbio Bioassays, Codolet, France) was used as FRET donor for
stable coupling to biotinylated co-regulator peptides NCoR1 or
2666
https://dx.doi.org/10.1021/acs.jmedchem.0c01779
J. Med. Chem. 2021, 64, 2659−2668

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
NCoR2. As FRET acceptor, recombinant Nurr1-LBD protein16 fused
to sGFP was used, which has been reported previously. GFP-Nurr1-
LBD was titrated against biotinylated NCoR1 (1 nM) or NCoR2 (18
nM) copeptide and Tb-SA (2 or 12 nM, respectively) in the presence
of a fixed concentration (20 or 100 μM, in assay buffer containing 1%
DMSO) of the respective ligand or 1% DMSO. To maintain a
constant GFP concentration, free GFP protein was added to the
dilution series. The experiments were performed in HTRF assay
buffer (150 mM KF, 25 mM HEPES pH 7.5 (KOH), 5% (w/v)
Glycerol, supplemented with 0.1% (w/v) CHAPS and 5 mM DTT)
with 1% DMSO in an assay volume of 20 μL. All HTRF experiments
were carried out in a 384-well format using white flat bottom
polystyrol microtiter plates (Greiner Bio-One, Frickenhausen,
Germany), and each concentration was tested in technical triplicates.
After 1 h incubation at room temperature, fluorescence intensities
after excitation at 340 nm were recorded at 520 nm for GFP acceptor
fluorescence and 620 nm for Tb-SA donor fluorescence on a SPARK
plate reader (Tecan Group Ltd.). FI520nm was divided by FI620nm
and multiplied with 10,000 to give a dimensionless HTRF signal.
ΔHTRFs were calculated as differences between each individual
HTFR value and the corresponding untreated control (1% DMSO) of
the same dissolution series. For the dose−response curve fitting, the
equation “[Agonist] vs. response − variable slope (four parameters)”
was performed with three replicate values of ΔHTRF using GraphPad
Prism (version 7.00, GraphPad Software). The co-regulator peptides
were purchased from Eurogentec (Seraing, Belgium), and sequences
were the following: nuclear receptor co-repressor 1 (NCoR1) nuclear
receptor-interaction domain 1 (ID1), Biotin-GMGQVPRTHRLI-
TLADHICQIITQDFARN-COOH; and NCoR2 ID2, Biotin-SQAV-
QEHASTNMGLEAIIRKALMGKYDQW-COOH.
Nurr1 Homodimerization Assay. Modulation of Nurr1 LBD
homodimerization was studied in an HT-FRET assay setup using the
biotinylated recombinant Nurr1 LBD16 and GFP-Nurr1 LBD. Assay
solutions were prepared in HTRF assay buffer supplemented with
0.1% (w/v) CHAPS and 5 mM DTT as well as 1% DMSO with test
compounds 24 (100 μM) and 26 (20 or 100 μM) or DMSO alone as
negative control. The biotinylated Nurr1 LBD (0.375 nM) and Tb-SA
(0.75 nM) served as the FRET donor complex, which was kept
constant, while the GFP-coupled protein as the FRET acceptor was
varied in concentration. Titration of the GFP-Nurr1 LBD started at
500 nM, and each concentration was tested in technical triplicates.
Accordingly, free GFP was added to keep the total GFP content stable
throughout the entire series in order to suppress artifacts from
changes in the degree of diffusion-enhanced FRET. The samples were
equilibrated at room temperature for 2 h before FI520nm and
FI620nm were recorded after excitation at 340 nm, and the HTRF
signal, ΔHTRF, and dose−response curves were calculated as
described above.
(GAPDH) served as the reference gene. Primer sequences for
Nurr1 target genes vesicular monoamine transporter 2 (VMAT2) and
tyrosine hydroxylase (TH) were obtained from OriGene (OriGene
Technologies Inc., Rockville, MD, USA). The following PCR primers
were used: hGAPDH: 5′-ATA TGA TTC CAC CCA TGG CA (fw),
5′-GAT GAT GAC CCT TTT GGC TC (rev), hVMAT2: 5′-GCT
ATG CCT TCC TGC TGA TTG C (fw), 5′-CCA AGG CGA TTC
CCA TGA CGT T (rev), and hTH: 5′-GCT GGA CAA GTG TCA
TCA CCT G (fw), and 5′-CCT GTA CTG GAA GGC GAT CTC A
(rev).
ASSOCIATED CONTENT
* Supporting Information
The Supporting Information is available free of charge at
https://pubs.acs.org/doi/10.1021/acs.jmedchem.0c01779.
■
sı
Control experiments; nonspecific effects and cytotox-
icity; raw luminescence data; effects of Nurr1 agonist 24;
summarized cellular Nurr1 modulatory activities; and
WST-1 toxicity assay (PDF)
HPLC traces of compounds synthesized in this study
(PDF)
Molecular formula strings with structures and activity
data (csv)
AUTHOR INFORMATION
Corresponding Author
■
Daniel Merk − Institute of Pharmaceutical Chemistry, Goethe
University, D-60438 Frankfurt, Germany; orcid.org/
0000-0002-5359-8128; Email: merk@pharmchem.uni-
frankfurt.de
Authors
Sabine Willems − Institute of Pharmaceutical Chemistry,
Goethe University, D-60438 Frankfurt, Germany
Julia Ohrndorf − Institute of Pharmaceutical Chemistry,
Goethe University, D-60438 Frankfurt, Germany
Whitney Kilu − Institute of Pharmaceutical Chemistry, Goethe
University, D-60438 Frankfurt, Germany
Jan Heering − Fraunhofer Institute for Translational Medicine
and Pharmacology ITMP, D-60596 Frankfurt am Main,
Germany
Complete contact information is available at:
https://pubs.acs.org/10.1021/acs.jmedchem.0c01779
Quantification of Nurr1-Regulated mRNA Expression in
T98G Cells by qRT-PCR. T98G cells were grown in 6-well plates
(2.5 × 105 cells/well) in DMEM high glucose, supplemented with
10% FCS, sodium pyruvate (1 mM), penicillin (100 U/mL), and
streptomycin (100 μg/mL) at 37 °C and 5% CO2. Before incubation
with test compounds, the medium was changed to DMEM
supplemented with 1% charcoal-stripped FCS, sodium pyruvate (1
mM), penicillin (100 U/mL), and streptomycin (100 μg/mL) for 24
h. For gene expression analysis, the cells were incubated with 2 (50
μM), 24 (10 or 30 μM), 26 (10 or 30 μM), or 0.1% DMSO as
untreated control for 8 h. The cells were then harvested and directly
used for RNA extraction. Total RNA (3 μg) was extracted from T98G
cells by the E.Z.N.A. Total RNA Kit I (R6834−02, Omega Bio-Tek,
Inc., Norcross, GA). RNA was reverse-transcribed into cDNA using
the High-Capacity RNA-to-cDNA Kit (4387406, Thermo Fischer
Scientific, Inc.) according to the manufacturer’s protocol. Nurr1 target
gene expression was evaluated by qRT-PCR analysis with a
StepOnePlus System (Life Technologies, Carlsbad, CA) using
Power SYBR Green (Life Technologies; 12.5 μL/well). Each sample
was set up in duplicates and repeated in four independent
experiments. The expression was quantified by the comparative
2‑ΔΔCt method, and glyceraldehyde 3-phosphate dehydrogenase
Author Contributions
All authors have given approval to the final version of the
manuscript.
Notes
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
This research was financially supported by the Aventis
Foundation (Life Science Bridge Award to D.M.) and the
LOEWE center Translational Medicine and Pharmacology
(TMP). Gal4-VP16 was a gift from Lea Sistonen (Addgene
plasmid # 71728 ; http://n2t.net/addgene:71728 ; RRI-
D:Addgene_71728). pcDNA3.1-hNurr1-NE was a gift from
Shu Leong Ho (Addgene plasmid # 102363 ; http://n2t.net/
addgene:102363 ; RRID:Addgene_102363).
ABBREVIATIONS
AQ, amodiaquine; CQ, chloroquine; DR5, direct repeats
spaced by five nucleotides; FRET, fluorescence resonance
■
2667
https://dx.doi.org/10.1021/acs.jmedchem.0c01779
J. Med. Chem. 2021, 64, 2659−2668

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
Meyer, B.; Roesch, F.; Vallet, T.; Mac Kain, A.; Miorin, L.; Moreno,
E.; Naing, Z. Z. C.; Zhou, Y.; Peng, S.; Shi, Y.; Zhang, Z.; Shen, W.;
Kirby, I. T.; Melnyk, J. E.; Chorba, J. S.; Lou, K.; Dai, S. A.; Barrio-
Hernandez, I.; Memon, D.; Hernandez-Armenta, C.; Lyu, J.; Mathy,
C. J. P.; Perica, T.; Pilla, K. B.; Ganesan, S. J.; Saltzberg, D. J.; Rakesh,
R.; Liu, X.; Rosenthal, S. B.; Calviello, L.; Venkataramanan, S.; Liboy-
Lugo, J.; Lin, Y.; Huang, X. P.; Liu, Y.; Wankowicz, S. A.; Bohn, M.;
Safari, M.; Ugur, F. S.; Koh, C.; Savar, N. S.; Tran, Q. D.; Shengjuler,
D.; Fletcher, S. J.; O’Neal, M. C.; Cai, Y.; Chang, J. C. J.; Broadhurst,
D. J.; Klippsten, S.; Sharp, P. P.; Wenzell, N. A.; Kuzuoglu-Ozturk, D.;
Wang, H. Y.; Trenker, R.; Young, J. M.; Cavero, D. A.; Hiatt, J.; Roth,
T. L.; Rathore, U.; Subramanian, A.; Noack, J.; Hubert, M.; Stroud, R.
M.; Frankel, A. D.; Rosenberg, O. S.; Verba, K. A.; Agard, D. A.; Ott,
M.; Emerman, M.; Jura, N.; von Zastrow, M.; Verdin, E.; Ashworth,
A.; Schwartz, O.; d’Enfert, C.; Mukherjee, S.; Jacobson, M.; Malik, H.
S.; Fujimori, D. G.; Ideker, T.; Craik, C. S.; Floor, S. N.; Fraser, J. S.;
Gross, J. D.; Sali, A.; Roth, B. L.; Ruggero, D.; Taunton, J.;
Kortemme, T.; Beltrao, P.; Vignuzzi, M.; García-Sastre, A.; Shokat, K.
M.; Shoichet, B. K.; Krogan, N. J. A SARS-CoV-2 Protein Interaction
Map Reveals Targets for Drug Repurposing. Nature 2020, 583, 459−
468.
(12) Nolan, K. A.; Caraher, M. C.; Humphries, M. P.; Bettley, H. A.
A.; Bryce, R. A.; Stratford, I. J. In Silico Identification and Biochemical
Evaluation of Novel Inhibitors of NRH:Quinone Oxidoreductase 2
(NQO2). Bioorganic Med. Chem. Lett. 2010, 20, 7331−7336.
(13) Munoz-Tello, P.; Lin, H.; Khan, P.; De Vera, I. M. S.;
Kamenecka, T. M.; Kojetin, D. J. Assessment of NR4A Ligands That
Directly Bind and Modulate the Orphan Nuclear Receptor Nurr1. J.
Med. Chem. 2020, 63, 15639−15654.
(14) Apelt, J.; Ligneau, X.; Pertz, H. H.; Arrang, J.; Ganellin, C. R.;
Schwartz, J.-C.; Schunack, W.; Stark, H. Development of a New Class
of Nonimidazole Histamine H 3 Receptor Ligands with Combined
Inhibitory Histamine N-Methyltransferase Activity. J. Med. Chem.
2002, 45, 1128−1141.
(15) Sadowski, I.; Ma, J.; Triezenberg, S.; Ptashne, M. GAL4-VP16
Is an Unusually Potent Transcriptional Activator. Nature 1988, 335,
563−564.
energy transfer; GFP, green fluorescent protein; HTRF,
homogeneous time-resolved fluorescence resonance energy
transfer; LBD, ligand binding domain; LE, ligand efficiency;
LLE, lipophilic ligand efficiency; NBRE, NGFI-B response
element; NCoR1, nuclear receptor co-repressor 1; NCoR2,
nuclear receptor co-repressor 2; Nurr1, nuclear receptor
related 1; NurRE, Nur-response element; PD, Parkinson’s
Disease; qRT-PCR, quantitative real-time polymerase chain
reaction; SAR, structure−activity relationship; SILE, size-
independent ligand efficiency; TH, tyrosine hydroxylase;
VMAT2, vesicular monoamine transporter 2; VP16, Herpes
simplex virus protein vmw65
REFERENCES
■
(1) Wang, Z.; Benoit, G.; Liu, J.; Prasad, S.; Aarnisalo, P.; Liu, X.;
Xu, H.; Walker, N. P.; Perlmann, T. Structure and Function of Nurr 1
Identifies a Class of Ligand-Independent Nuclear Receptors. Nature
2003, 423, 555−560.
(2) Decressac, M.; Volakakis, N.; Björklund, A.; Perlmann, T.
NURR1 in Parkinson DiseaseFrom Pathogenesis to Therapeutic
Potential. Nat. Rev. Neurol. 2013, 9, 629−636.
(3) Kim, C.-H.; Han, B.-S.; Moon, J.; Kim, D.-J.; Shin, J.; Rajan, S.;
Nguyen, Q. T.; Sohn, M.; Kim, W.-G.; Han, M.; Jeong, I.; Kim, K.-S.;
Lee, E.-H.; Tu, Y.; Naffin-Olivos, J. L.; Park, C.-H.; Ringe, D.; Yoon,
H. S.; Petsko, G. A.; Kim, K.-S. Nuclear Receptor Nurr1 Agonists
Enhance Its Dual Functions and Improve Behavioral Deficits in an
Animal Model of Parkinson’s Disease. Proc. Natl. Acad. Sci. 2015, 112,
8756−8761.
(4) Rajan, S.; Jang, Y.; Kim, C. H.; Kim, W.; Toh, H. T.; Jeon, J.;
Song, B.; Serra, A.; Lescar, J.; Yoo, J. Y.; Beldar, S.; Ye, H.; Kang, C.;
Liu, X. W.; Feitosa, M.; Kim, Y.; Hwang, D.; Goh, G.; Lim, K. L.;
Park, H. M.; Lee, C. H.; Oh, S. F.; Petsko, G. A.; Yoon, H. S.; Kim, K.-
S. PGE1 and PGA1 Bind to Nurr1 and Activate Its Transcriptional
Function. Nat. Chem. Biol. 2020, 16, 876−886.
(5) De Bruyn, T.; Van Westen, G. J. P.; IJzerman, A. P.; Stieger, B.;
De Witte, P.; Augustijns, P. F.; Annaert, P. P. Structure-Based
Identification of Oatp1b1/3 Inhibitors. Mol. Pharmacol. 2013, 83,
1257−1267.
(6) Lee, S. G.; Alpert, T. D.; Jez, J. M. Crystal Structure of
Phosphoethanolamine Methyltransferase from Plasmodium Falcipa-
rum in Complex with Amodiaquine. Bioorganic Med. Chem. Lett. 2012,
22, 4990−4993.
(7) Ren, S.; Zeng, J.; Mei, Y.; Zhang, J. Z. H.; Yan, S. F.; Fei, J.;
Chen, L. Discovery and Characterization of Novel, Potent, and
Selective Cytochrome P450 2J2 Inhibitors. Drug Metab. Dispos. 2012,
41, 60−71.
(8) O’Neill, P. M.; Park, B. K.; Shone, A. E.; Maggs, J. L.; Roberts,
P.; Stocks, P. A.; Biagini, G. A.; Bray, P. G.; Gibbons, P.; Berry, N.;
Winstanley, P. A.; Mukhtar, A.; Bonar-Law, R.; Hindley, S.; Bambal,
R. B.; Davis, C. B.; Bates, M.; Hart, T. K.; Gresham, S. L.; Lawrence,
R. M.; Brigandi, R. A.; Gomez-delas-Heras, F. M.; Gargallo, D. V.;
Ward, S. A. Candidate Selection and Preclinical Evaluation of N-Tert-
Butyl Isoquine (GSK369796), an Affordable and Effective 4-
Aminoquinoline Antimalarial for the 21st Century. J. Med. Chem.
2009, 52, 1408−1415.
(9) Kim, T. H.; Kim, H. K.; Hwang, E. S. Novel Anti-adipogenic
Activity of Anti-malarial Amodiaquine Through Suppression of
PPARγ Activity. Arch. Pharmacal Res. 2017, 40, 1336−1343.
(10) Tang, Y.; Wu, Q.; Beland, F. A.; Chen, S.; Fang, J. L. Apoptosis
Contributes to the Cytotoxicity Induced by Amodiaquine and Its
Major Metabolite N-Desethylamodiaquine in Hepatic Cells. Toxicol.
Vitr. 2020, 62, No. 104669.
(16) Willems, S.; Kilu, W.; Ni, X.; Chaikuad, A.; Knapp, S.; Heering,
J.; Merk, D. The Orphan Nuclear Receptor Nurr1 Is Responsive to
Non-steroidal Anti-inflammatory Drugs. Commun. Chem. 2020, 3, 85.
(17) Karki, K.; Li, X.; Jin, U. H.; Mohankumar, K.; Zarei, M.;
Michelhaugh, S. K.; Mittal, S.; Tjalkens, R.; Safe, S. Nuclear Receptor
4A2 (NR4A2) Is a Druggable Target for Glioblastomas. J. Neurooncol.
2020, 146, 25−39.
(18) Hopkins, A. L.; Keseru, G. M.; Leeson, P. D.; Rees, D. C.;
̈
Reynolds, C. H. The Role of Ligand Efficiency Metrics in Drug
Discovery. Nat. Rev. Drug Discov. 2014, 13, 105−121.
(19) Tetko, I. V.; Tanchuk, V. Y. Application of Associative Neural
Networks for Prediction of Lipophilicity in ALOGPS 2.1 Program. J.
Chem. Inf. Comput. Sci. 2002, 42, 1136−1145.
(20) Niu, Y. R.; Wei, B.; Chen, B.; Xu, L. H.; Jing, X.; Peng, C. L.;
Ma, T. Z. Amodiaquine-Induced Reproductive Toxicity in Adult Male
Rats. Mol. Reprod. Dev. 2016, 83, 174−182.
(21) Bernuau, J.; Larrey, D.; Campillo, B.; Degott, C.; Verdier, F.;
Rueff, B.; Pessayre, D.; Benhamou, J. P. Amodiaquine-Induced
Fulminant Hepatitis. J. Hepatol. 1988, 6, 109−112.
́
(22) Budzynski, M. A.; Puustinen, M. C.; Joutsen, J.; Sistonen, L.
Uncoupling Stress-Inducible Phosphorylation of Heat Shock Factor 1
from Its Activation. Mol. Cell. Biol. 2015, 35, 2530−2540.
(23) Merk, D.; Lamers, C.; Ahmad, K.; Carrasco Gomez, R.;
Schneider, G.; Steinhilber, D.; Schubert-Zsilavecz, M. Extending the
Structure-Activity Relationship of Anthranilic Acid Derivatives as
Farnesoid x Receptor Modulators: Development of a Highly Potent
Partial Farnesoid X Receptor Agonist. J. Med. Chem. 2014, 57, 8035−
8055.
(11) Gordon, D. E.; Jang, G. M.; Bouhaddou, M.; Xu, J.; Obernier,
K.; White, K. M.; O’Meara, M. J.; Rezelj, V. V.; Guo, J. Z.; Swaney, D.
L.; Tummino, T. A.; Huttenhain, R.; Kaake, R. M.; Richards, A. L.;
̈
Tutuncuoglu, B.; Foussard, H.; Batra, J.; Haas, K.; Modak, M.; Kim,
M.; Haas, P.; Polacco, B. J.; Braberg, H.; Fabius, J. M.; Eckhardt, M.;
Soucheray, M.; Bennett, M. J.; Cakir, M.; McGregor, M. J.; Li, Q.;
2668
https://dx.doi.org/10.1021/acs.jmedchem.0c01779
J. Med. Chem. 2021, 64, 2659−2668