Pure enantiomers of benzoylamino-tranylcypromine: LSD1 inhibition, gene modulation in human leukemia cells and effects on clonogenic potential of murine promyelocytic blasts

Article abstract of DOI:10.1016/j.ejmech.2015.02.060

The pure enantiomers of the N-(2-, 3-, and 4-(2-aminocyclopropyl)phenyl)benzamides hydrochlorides 11a-j were prepared and tested against LSD1 and MAO enzymes. The evaluation of the regioisomers 11a-j highlighted a net increase of the anti-LSD1 potency by

Full text of DOI:10.1016/j.ejmech.2015.02.060

European Journal of Medicinal Chemistry 94 (2015) 163e174
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Original article
Pure enantiomers of benzoylamino-tranylcypromine: LSD1 inhibition,
gene modulation in human leukemia cells and effects on clonogenic
potential of murine promyelocytic blasts
Sergio Valente a, Veronica Rodriguez a, Ciro Mercurio b, Paola Vianello c, Bruna Saponara d,
Roberto Cirilli d, Giuseppe Ciossani e, Donatella Labella a, Biagina Marrocco a,
Daria Monaldi a, Giovanni Ruoppolo f, Mats Tilset g, Oronza A. Botrugno c, Paola Dessanti c,
,
, i, *
Saverio Minucci c h, Andrea Mattevi e, Mario Varasi c, Antonello Mai a
a Department of Drug Chemistry and Technologies, Sapienza University of Roma, P.le A. Moro 5, 00185 Roma, Italy
b Genextra Group, DAC s.r.l. Via Adamello 16, 20139 Milano, Italy
c Dipartimento di Oncologia Sperimentale, IEO e European Institute of Oncology, Via Adamello 16, 20139 Milano, Italy
d Italian National Institute of Health, Department of Therapeutic Research and Medicines Evaluation, Via Regina Elena 299, 00161 Roma, Italy
e Department of Biology and Biotechnology, University of Pavia, Via Ferrata 1, 27100 Pavia, Italy
f Department of Sense Organs, Sapienza University of Roma, P.le A. Moro 5, 00185 Roma, Italy
g Centre of Theoretical and Computational Chemistry (CTCC), Department of Chemistry, P.O. Box 1033, Blindern, N-0315 Oslo, Norway
h Department of Biosciences, University of Milan, 20100 Milan, Italy
i Pasteur Institute e Cenci Bolognetti Foundation, Sapienza University of Roma, P.le A. Moro 5, 00185 Roma, Italy
a r t i c l e i n f o
a b s t r a c t
Article history:
The pure enantiomers of the N-(2-, 3-, and 4-(2-aminocyclopropyl)phenyl)benzamides hydrochlorides
11aej were prepared and tested against LSD1 and MAO enzymes. The evaluation of the regioisomers 11a
ej highlighted a net increase of the anti-LSD1 potency by shifting the benzamide moiety from ortho to
meta and mainly to para position of tranylcypromine phenyl ring, independently from their trans or cis
stereochemistry. In particular, the para-substituted 11a,b (trans) and 11g,h (cis) compounds displayed
LSD1 and MAO-A inhibition at low nanomolar levels, while were less potent against MAO-B. The meta
analogs 11c,d (trans) and 11i,j (cis) were in general less potent, but more efficient against MAO-A than
against LSD1. In cellular assays, all the para and meta enantiomers were able to inhibit LSD1 by inducing
Gfi-1b and ITGAM gene expression, with 11b,c and 11gei giving the highest effects. Moreover, 11b and
11g,h strongly inhibited the clonogenic potential of murine promyelocytic blasts.
Received 15 October 2014
Received in revised form
27 February 2015
Accepted 28 February 2015
Available online 3 March 2015
Keywords:
Epigenetics
Leukemia
Lysine-specific demethylase 1
Stereoisomers
Tranylcypromine
© 2015 Elsevier Masson SAS. All rights reserved.
1. Introduction
H3K27, or H4K20 are markers of gene silencing [1e4]. Lys meth-
ylations are reversible marks due to the action of histone Lys
Post-translational methylation of histones is a covalent modifi-
cation intimately linked with either transcriptional activation or
repression. The histone lysine (Lys, K) residues can undergo mono-,
di- and trimethylation, and each methylation state represents a
specific epigenetic marker with a precise biological meaning and a
well-defined chromatin localization [1e4]. In particular, methyl-
ation at the histone 3 lysine 4 (H3K4), H3K36, or H3K79 residue
leads to transcriptional activation, whereas methylation at H3K9,
demethylases (KDMs), a large family of “erasers” that catalyze the
removal of methyl groups from (poly)methylated Lys substrates
[5e7].
There are two known classes of KDMs, differing in their reaction
chemistry, co-factor/co-substrate used, and Lys-substrate speci-
ficity [8]. The flavin-dependent KDMs, lysine-specific demethylase
1 and 2 (LSD1 and LSD2), only act on mono- and di-methylated Lys
and produce formaldehyde and hydrogen peroxide in addition to
unmethylated or monomethylated Lys, whereas the Jumonji-
containing KDMs, utilizing Fe(II) and
a-ketoglutarate as co-
substrates, can act on mono-, di- and tri-methylated Lys side
chains [6e9]. LSD1 typically acts on mono- and di-methylated
* Corresponding author.
E-mail address: antonello.mai@uniroma1.it (A. Mai).
http://dx.doi.org/10.1016/j.ejmech.2015.02.060
0223-5234/© 2015 Elsevier Masson SAS. All rights reserved.

164
S. Valente et al. / European Journal of Medicinal Chemistry 94 (2015) 163e174
H3K4 (H3K4me1/2), by catalyzing the oxidation of the methyl-
amino group to an iminium cation, which was in turn hydrolyzed to
a carbinolamine that spontaneously give formaldehyde and the
demethylated amine [9]. Since H3K4me1/2 is an activation mark,
the removal of methyl groups from it leads to gene silencing. In
some contexts (prostate cancer), LSD1 demethylates H3K9me1/2, a
repressive mark, regulating androgen receptor-mediated tran-
scription, and thus changing its action by gene repression to gene
activation [10]. LSD1 was originally identified as a component of
transcriptional repressor complexes [11,12], being typically associ-
ated with the transcriptional corepressor protein CoREST and with
the histone deacetylases (HDAC) 1 or 2. Such stable core complex is
recruited by many chromatin remodeling multiprotein complexes
[11e15], suggesting that the LSD1 activity itself can be modulated
by its interacting proteins. LSD1 participates in several growth-
promoting pathways, and LSD1 levels are up-regulated in certain
high-risk tumors [16,17]. LSD1 is over-expressed in several cancer
cells and tissues: neuroblastoma [18], retinoblastoma [19], prostate
cancer [10,20], breast cancer [21e23], lung and bladder cancer cells
[24]. The potential link between cancer and LSD1 activity is
underlined by the finding that loss of H3K4 methylation and
enrichment of H3K9 methylation are associated with several types
of tumors [16]. Moreover, a clear role of LSD1 in sustaining the
oncogenic potential of MLL-AF9 translocation in leukemia stem
cells [25] as well as in the stem-like tumor propagating cells of
human glioblastoma [26] has been recently reported.
inhibitors to selectively target cancer stem cells derepressing
epigenetically suppressed genes in vivo. Also peptides were
described as LSD1 inhibitors, such as the pLys4Met peptide [52],
some synthetic cyclic peptides [53], and a series of short peptides
based on the SNAIL sequence exhibiting antiproliferative activities
[54]. Among reversible LSD1 inhibitors, amidoximes 7 [55], di-
thiocarbamates 8 [56], substituted triazoles 9 [57], and benzohy-
drazides 10 [58] have been recently reported. More importantly,
TCP and two TCP-based inhibitors, Ory1001 and GSK2869552, have
entered into clinical studies for treatment of cancer diseases [59].
Pursuing our researches on design, synthesis, and biological
evaluation of small molecule modulators of histone methylation
[60e73], in 2010 we described some TCP-based compounds as
novel LSD1 inhibitors [74]. Among them, the trans N-(4-((2-
aminocyclopropyl)phenyl)benzamide hydrochloride 11 (Fig. 2)
was found to be the most potent inhibitor with a Ki value of 1.1 mM
[74].
To gain insight into structureeactivity relationship (SAR) on this
benzamide-TCP prototype, we synthesized the ortho, meta and para
regioisomers of compound 11 as well as the meta and para analogs
of its corresponding cis isomer, and we did enantioseparation of all
the related stereoisomers (compounds 11aej, Fig. 2). All our at-
tempts to prepare the ortho regioisomers with the cis geometry
failed, and thus these last two enantiomers are not presented.
Compounds 11aej were tested against LSD1, and also evaluated
against MAO-A and MAO-B to assess their selectivity profile.
Selected compounds were evaluated in human leukemia NB4 cells
to explore their capability to increase transcription of genes related
to LSD1 activity and/or cell differentiation. Finally, the most potent
enantiomers 11a,b, and 11g,h were tested to determine their effects
on the clonogenic potential of murine promyelocytic blasts.
The targets of LSD1 regulatory demethylation are not limited to
histone H3 lysines, indeed LSD1 also demethylates Lys residues of
non-histone proteins such as p53 [27], DNA methyltransferase 1
[28], STAT3 [29], E2F1 [30], MYPT1 [31], and thereby regulates their
cellular functions. It has been reported that LSD1 binds several
transcription factors and negatively regulates the expression of a
number of genes, such as members of the secreted frizzle-related
2. Results
proteins (SFRPs) and the GATA family, Gfi-1b, SYN1, RARb2,
CYP26, p21 WAF1, E-cadherine, cyclin A1, Notch1 [32,33]. Increased
methylation at the H3K4 mark through either LSD1 knockdown or
pharmacological inhibition was shown to reactivate the expression
of tumor suppressor genes (TSG) in breast, bladder, lung, and
colorectal cancers [24,34]. Thus, inhibition of LSD1 is an effective
strategy to switch on epigenetically silenced TSG, to up-regulate
genes involved in cancer cell differentiation and/or invasion pro-
cess as well as to down-regulate important proliferative pathways
implicated in multiple cancer types.
Starting from the known monoamine oxidase (MAO) inhibitors,
several molecules have been developed as irreversible and, more
recently, as reversible LSD1 inhibitors (Fig. 1). In particular, the
MAO-A/B inhibitor tranylcypromine (TCP) is a known irreversible
LSD1 inhibitor recently described as able to reactivate the all-trans-
retinoic acid differentiation pathway in acute myeloid leukemia
[35], and to block repression of the E-cadherin promoter thus
inhibiting the motility and invasion of tumor cell lines [36]. Several
other TCP-containing derivatives (such as OG-L002, S-2101, NCL-1
and -2, GSK2879552, 1, and pan-demethylase inhibitors such as
2) have been reported with increased selectivity for LSD1 in com-
parison with TCP, and active in cancer and non-cancer diseases
[37e48]. Very recently a series of phenelzine analogs, such as bizine
[49], has been described as potent and selective, irreversible LSD1
inhibitors inducing cell growth arrest in H460 and LNCaP cancer
cell lines. Polyamine derivatives, such as (bis)guanidines 3 [32],
(bis)biguanides 4 [32], polyamines 5 [34], and (bis)ureas and (bis)
thioureas 6 [50], were first evaluated as reversible LSD1 inhibitors,
and some of them showed biochemical activity in the low micro-
molar range and growth inhibition in an human colon cancer
model in vivo or in Calu-6 cells [34,50]. Similarly, (bis)amidines
such as CBB1007 [51] have been reported as reversible LSD1
2.1. Chemistry
The synthetic route for the synthesis of the trans regioisomers of
11 (compounds 11aef) started from the 2-, 3-, or 4-nitrostyrene
which underwent a cyclopropanation reaction by treatment with
ethyl diazoacetate (EDA) and catalytic copper (I) chloride in anhy-
drous chloroform, to afford the ester intermediates 12aec. Hy-
drolysis of the mentioned esters with 2 N potassium hydroxide
solution in ethanol afforded the corresponding carboxylic acids
13aec, which were in turn converted into the related carbamates
14aec through a Curtius rearrangement in the presence of diphe-
nylphosphoryl azide (DPPA), triethylamine and tert-butanol in
refluxing anhydrous benzene. Further hydrogenation reaction
performed on 14aec with 10% palladium on carbon in a Parr
apparatus at 32 psi led to the aniline derivatives 15a,b and the
known 15c [74], which were treated with benzoyl chloride in
presence of triethylamine in anhydrous dichloromethane at 0 ꢀC to
give the intermediates 16aec. The enantioseparation of each iso-
mer of 16aec furnished the pure stereoisomers 17cef together
with 17a,b, the two ortho-substituted enantiomers for which it was
no possible to assign the absolute configuration (see below), which
were cleaved at the Boc protection by using 4 N hydrochloric acid in
dioxane/tetrahydrofuran affording the final compounds 11aef
(Scheme 1).
The synthetic route to obtain the cis regioisomers of 11 (com-
pounds 11gej) began from a very highly cis-selective, rhodium (I)-
catalyzed cyclopropanation reaction. In particular, 3- or 4-
nitrostyrene was treated with EDA in the presence of a rodium (I)
complex [75,76] and sodium tetrakis[3,5-bis(trifluoromethyl)
phenyl]borate (NaBArf) at 0 ꢀC to obtain the cis nitroesters 18a,b,
which were reduced by stannous chloride in presence of 37%

S. Valente et al. / European Journal of Medicinal Chemistry 94 (2015) 163e174
165
Fig. 1. Known irreversible and reversible LSD1 inhibitors.
hydrochloric acid in ethanol to the corresponding amino esters
19a,b. The acylation reaction with benzoyl chloride, using the same
conditions as for 16aec, provided the amide esters 20a,b, which
were in turn hydrolyzed by 2 N potassium hydroxide in ethanol to
afford the corresponding carboxylic acids 21a,b. Subsequent Cur-
tius reaction on 21a,b with DDPA, triethylamine and tert-butanol
followed by enantioseparation of the obtained amidocarbamates
22a,b and removal of the Boc protection with 4 N hydrochloric acid
afforded the final compounds 11gej (Scheme 2).
polysaccharide-based chiral stationary phases (CSPs) under the
operating conditions summarised in Table 1. Resolution was good in
all cases and several tens of mg of both enantiomers were collected
in a pure state (enantiomeric excess (ee) >98%). The stereochemical
characterization procedure was based on the determination of the
absolute configuration of the Boc intermediates by CD correlation
using the enantiomers of Br-tPCPA and Br-cPCPA as reference
samples [66]. Comparison of the CD spectra shown in Fig. S1 and
Fig. S2 (Supporting Information) allowed us to assign the (1R,2S)
and (1R,2R) absolute configuration to the first eluting enantiomer of
the Boc-protected derivatives 16b,c and 22a,b, respectively
(Table 1).
Only in the case of the trans ortho-Boc intermediate (16a), the
replacing of the p-Br atom by the o-benzoylamino group led to a
significant and unpredictable change in the spectral location of the
representative CD bands (CD spectra not shown) which did not
permit the empirical absolute configuration assignment. Thus, we
called 17a the first and 17b the latter eluted enantiomer.
The stereochemical properties of the corresponding hydro-
chlorides of all the Boc intermediates were easily determined by
chemical correlation method.
2.2. Preparation and absolute configuration assignment of the trans
ortho-, meta-, and para-benzamidoTCP stereoisomers 11aef, and of
their cis meta- and para-analogs 11gej
The enantiomers shown in Fig. 2 were prepared by a procedure
divided into three phases: 1) synthesis of the racemic form of the
corresponding Boc derivatives; 2) direct HPLC resolution of the
chiral Boc derivatives on a semipreparative scale; 3) removal of the
Boc group and conversion to the corresponding hydrochlorides by
treatment of the collected enantiomers with 4 N hydrochloric acid.
The enantiomeric separations were carried out on immobilized

166
S. Valente et al. / European Journal of Medicinal Chemistry 94 (2015) 163e174
Fig. 2. Regioisomers and relative enantiomers based on the structure of 11, compounds 11aej.
Scheme 1. Reagents and conditions: (a) EDA, CuCl (cat.), anhydrous CHCl3, N2 atmosphere, 2e5 h, 60 ꢀC; (b) 2 N KOH, EtOH, overnight, rt; (c) DPPA, Et3N, anhydrous tert-BuOH,
anhydrous benzene, N2 atmosphere, 16 h, 95 ꢀC; (d) H2, 10% Pd/C, anhydrous MeOH, 1 h, rt; (e) benzoyl cloride, Et3N, anhydrous CH2Cl2, 1.5 h, 0 ꢀC; (f) 4 N HCl, anhydrous dioxane/
THF, overnight, rt.

S. Valente et al. / European Journal of Medicinal Chemistry 94 (2015) 163e174
167
Scheme 2. Reagents and conditions: (a) Rhodium (I)-complex, NaBArf, EDA, anhydrous CH2Cl2, N2 atmosphere, 3 h, 0 ꢀC; (b) SnCl2, 37% HCl, EtOH, overnight, 0 ꢀC; (c) benzoyl
cloride, Et3N, anhydrous CH2Cl2, 1.5 h, 0 ꢀC; (d) 2 N KOH, EtOH, overnight, rt; (e) DPPA, Et3N, anhydrous tert-BuOH, anhydrous benzene, N2 atmosphere, 16 h, 95 ꢀC; (f) 4 N HCl,
anhydrous dioxane/THF, overnight, rt.
2.3. In vitro LSD1, MAO-A and MAO-B biochemical assays
The insertion of the benzamide moiety at the meta position of
the TCP phenyl ring led to compounds with decreased inhibitory
potency against both LSD1 and MAO-A; nevertheless, this drop of
potency is much more evident with the trans 11c,d than with the cis
11i,j isomers, and more marked for LSD1 than for MAO-A (11c,d
were 520/900-fold less potent against LSD1, and 21/105-fold less
potent against MAO-A, than 11a,b; 11i,j were 34/64-fold less potent
against LSD1, and 3/17-fold less potent against MAO-A, than 11g,h).
In fact, the meta-substituted trans enantiomers 11c,d displayed
similar inhibition towards LSD1 and MAO-A as TCP, whereas the cis
analogs 1i,j were more potent. In addition, similarly toTCP, both the
trans (11c,d) and cis (11i,j) enantiomers were more potent against
MAO-A than against LSD1, and among them 11i,j were more
The pure enantiomers 11aej were tested against LSD1, in com-
parison with the related para-substituted racemic mixture 11 and
with TCP (Table 2). The same compounds were also tested against
MAO-A and MAO-B, to assess their selectivity (Table 2).
Against LSD1 as well as against MAO-A, the para-substituted
compounds displayed the highest inhibitory activity in the low
nanomolar range, regardless to their trans (11a,b) or cis (11g,h)
geometry. Among them, 11a and 11g showed slightly increased
effects against LSD1 than against MAO-A. Against MAO-B, the four
isomers were always less potent, with inhibition at micromolar
level.
Table 1
HPLC conditions for the enantioseparation of the chiral boc-derivatives 16aec and 22a,b on a semipreparative scale.
Columna
Eluent
k1
k2
Ad (mg)
F1e
F2e
b
c
Cpd
ee (%)f
ACg
n.d.
ee (%)f
ACg
n.d.
16a
16b
16c
22a
22b
IB
IC
IC
IA
IC
n-hexane-ethyl acetate -2-propanol
60:40:5
dicloromethane-methanol
100:1
n-hexane-ethyl acetate
50:50
n-hexane-ethyl acetate
50:50
n-hexane -2-propanol
70:30
0.58
0.96
1.19
1.18
1.91
1.20
1.88
2.05
2.95
3.85
5.0
2.3
1.5
5.0
1.7
>99
>99
98
98
(1R,2S)
(1R,2S)
(1R,2R)
(1R,2R)
98
99
(1S,2R)
(1S,2R)
(1S,2S)
(1S,2S)
>99
>99
>99
>99
a
Columns: chiralpak IA, IB and IC 250 mm ꢁ 10 mm (i.d.); flow rate: 4.5 mL minꢂ1; detector: UV at 300 nm; temperature: 25 ꢀC.
Retention factor of the first eluted enantiomer.
Retention factor of the second eluted enantiomer.
A, amount of racemic sample resolved in a single run.
F1 and F2, first (F1) and second (F2) eluted enantiomer.
Yields ranged from about 65 to 80%.
b
c
d
e
f
g
AC, absolute configuration.

168
S. Valente et al. / European Journal of Medicinal Chemistry 94 (2015) 163e174
Table 2
LSD1, MAO-A and MAO-B enzyme inhibiting activity of the pure enantiomers 11aej
in comparison with the para-substituted trans racemic mixture 11.
Compd Regioisomer ACa
IC50
LSD1
racemate 0.019 0.004 0.031 0.0001 8.98 0.51
, m
Mb
MAO-A
MAO-B
11
para
para
para
meta
meta
ortho
ortho
para
para
meta
meta
11a
11b
11c
11d
11e
11f
11g
11h
11i
1R,2S
1S,2R
1R,2S
1S,2R
NE1
NE2
1R,2R
1S,2S
1R,2R
1S,2S
0.013 0.005 0.039 0.01
12.29 6.27
0.021 0.006 0.024 0.0001 16.81 4.95
11.69 2.84 1.37 0.16
10.89 1.92 1.54 0.18
74.65 0.50 NDe
29 5%c
84.7 7.0
ND
d
0%c
ND
ND
d
0.026 0.001 0.037 0.01
0.022 0.001 0.025 0.01
19.17 5.11
21.20 3.88
34 4%c
80.07 9.35
0.89 0.36
2.73 0.67
0.45 0.10
0.65 0.03
0.070 0.01
11j
Fig. 3. Gfi-1b and ITGAM gene expression modulation by 11aed,gej in NB4 cells.
Compounds were tested at their own anti-LSD1 IC50 values. Data are expressed as
average fold induction versus the vehicle (DMSO).
TCP
racemate 13.40 2.99 1.07 0.4
a
AC, absolute configuration.
Data represent mean values of at least two separate experiments in duplicate.
b
Standard deviations for 11a (MAO-A and eB), 11g and 11h (MAO-A) are higher
respect the other reported data, but the mean data, with the exception of MAO-B
data of 11a, are more than two times the standard deviation that, assuming a
normal distribution data, it is a threshold generally accepted to consider the ob-
able to induce Gfi-1b as well as ITGAM gene expressions respect to
DMSO as a control. The strongest effects were detected with the
two para-substituted cis enantiomers 11g and 11h and with the
meta-substituted cis 1R,2R analog 11i, which displayed up to 6-fold
induction. Other high effects were shown by the para- and meta-
substituted isomers 11b and 11c, respectively, both having a trans
geometry.
tained data statistical significant.
c
Percentage of inhibition at 100 mM.
NE1 and NE2, not established, first and second eluted enantiomer.
ND, not determined.
d
e
effective than 11c,d by inhibiting MAO-A at nanomolar/sub-
micromolar level. Against MAO-B, all the four meta-substituted
analogs 11c,d and 11i,j showed very low inhibition.
2.5. Pharmacological inhibition of LSD1 affects the clonogenic
potential of murine acute myeloid leukemia blasts
Finally, the ortho substituted compounds (only the trans isomers
11e,f were prepared and tested) displayed very low or no LSD1
inhibition, and were not tested against MAOs.
Finally, the most potent compounds 11a,b and 11g,h were tested
for their ability to inhibit colony formation of murine acute myeloid
leukemia blasts (originated by a murine model of acute promye-
locytic leukemia [80]) at the fixed concentration of 0.25
mM.
2.4. Gene expression modulation
Importantly, following seven days of semi-solid culture, all the
tested compounds displayed strong inhibition on colony formation,
ranging from 64% for 11a to 72% for 11g and 83% for both 11b and
11h (Table 3).
Growth factor independence 1 (Gfi-1) is a transcription factor
required for multilineage blood cell development, from stem and
progenitor cells to differentiated lymphoid and myeloid cells. In
erythroid cells, Gfi-1b is part of a multiprotein complex containing
LSD1 and CoREST via the SNAG repression domain [77], thus
regulating differential transcription of some target genes such as
meis1 [78]. Consistently, LSD1 depletion derepresses Gfi-1b targets
in lineage-specific patterns [73,77]. Gfi-1 itself represses the
expression of genes implicated in cell survival, proliferation and
differentiation. Changes in Gfi-1 expression and function have not
only been implicated in neutropenia, allergy, autoimmunity and
hyper inflammatory responses, but also in lymphoma and more
recently in the development of leukemia [79]. Integrin alpha M
(ITGAM), also known as CR3A and cluster of differentiation mole-
cule 11B (CD11B), is a typical protein marker used to assess in-
duction of differentiation such as in leukemia cells.
All these findings, joined to the fact that by ChIPseq experiments
(data not shown) we confirmed Gfi-1b and identified ITGAM as
direct transcriptional targets of LSD1, and that LSD1 inhibition can
cause the activation of epigenetically suppressed genes by main-
taining methylation at the H3K4 mark, prompted us to assess the
capability of selected 11aej enantiomers to induce Gfi-1b and
ITGAM genes expression in NB4 cells, in comparison with the para-
substituted racemic mixture 11. For this scope, human promyelo-
cytic leukemia NB4 cells were incubated with the inhibitors at a
concentration equal to their respective biochemical IC50 value. After
24 h, the mRNA expression of the Gfi-1b and ITGAM genes was
measured by quantitative RT-PCR and expressed as fold-induction
respect to the control (DMSO).
3. Discussion and conclusion
Among TCP-based compounds, the trans N-(4-((2-
aminocyclopropyl)phenyl)benzamide hydrochloride 11 was previ-
ously described by us as an efficient inhibitor of LSD1 [74]. Since 11
is a trans racemic mixture of two enantiomers, and in 11 the TCP
fragment is substituted at the para phenyl position with the ben-
zamide moiety, we prepared the meta and ortho regioisomers of 11
as well as its cis para and meta analogs, and we separated all the
related pure trans and cis enantiomers (11aef and 11gej, respec-
tively). Compounds 11aej were tested against LSD1 and MAO en-
zymes, and then in leukemia NB4 cells to assess their effect on
transcription of genes related to LSD1 (such as Gfi-1b) and differ-
entiation (such as ITGAM).
Table 3
Anti-clonogenic activity of selected 11a,b and 11g,h derivatives in primary murine
APL blasts.
Compd
ACa
Colony forming unit assay, % of
inhibition at 0.25 m
Mb
11a
11b
11g
11h
1R,2S
1S,2R
1R,2R
1S,2S
64.0
83.4
72.0
83.8
a
AC, absolute configuration.
b
Data represent mean values of at least two separate experiments in duplicate;
the error is within 10%.
Data depicted in Fig. 3 show that all the tested compounds were

S. Valente et al. / European Journal of Medicinal Chemistry 94 (2015) 163e174
169
Through the various regioisomers, the para-benzamido
substituted derivatives 11a,b and 11g,h, regardless to their trans or
cis geometry, displayed the highest LSD1 as well as MAO-A inhi-
bition at nanomolar levels. The same compounds showed less po-
tency, at micromolar levels, against MAO-B. The meta-benzamido
substituted compounds 11c,d and 11i,j exerted micromolar or
submicromolar LSD1 and MAO-A inhibition, and scarce inhibition
of MAO-B, but in this case the cis enantiomers 11i,j were 22/26-
times more potent than the corresponding trans derivatives 11c,d
against both LSD1 and MAO-A enzymes, with a 4/6-times prefer-
ence for MAO-A. Thus, the shift of the benzamide moiety from para
to meta position in these derivatives led to less potent inhibitors
(more evident with trans than with cis enantiomers), they being in
any case more potent against MAO-A than against LSD1. Finally, the
ortho-benzamide compounds 11e,f displayed very low, if any, LSD1
inhibition: in this case, only the trans stereoisomers have been
obtained and tested.
All the tested (trans and cis) para and meta enantiomers were
able to highly induce Gfi-1b and ITGAM gene expression in NB4
cells, with the highest effects observed with 11b,c and 11gei. The
para-trans (11a,b) and ecis (11g,h) enantiomers, the most potent
nanomolar LSD1 inhibitors of this series, when tested in murine
promyelocytic blasts, displayed strong inhibition of their clono-
genic potential.
eluted the cis isomer (18a) in 5/1 ratio. 1H NMR (CDCl3, 400 MHz):
1.06 (t, 3H, eCH2CH3), 1.48 (m, 1H, eCHH- cyclopropane), 1.79
(m, 1H, eCHH- cyclopropane), 2.20 (m, 1H, PhCH- cyclopropane),
2.65 (m, 1H, CHCOOEt cyclopropane), 3.93 (q, 2H, eCH2CH3), 7.46 (t,
1H, benzene proton), 7.63 (d, 1H, benzene proton), 8.10 (d, 1H,
benzene proton), 8.17 (s, 1H, benzene proton) ppm; 13C NMR
d
d
d
d
(CDCl3, 100 MHz):
d 14.1, 16.9, 24.2, 25.2, 61.6, 120.0, 120.3, 129.0,
131.1, 144.2, 147.3, 171.2 ppm; MS (EI) m/z [M]þ C12H13NO4 calcd
235.0845, found 235.0848.
4.1.2. General procedure for the synthesis of cis ethyl 2-(3- and 4-
nitrophenyl)cyclopropanecarboxylates 18a,b. Example: cis ethyl 2-
(4-nitrophenyl)cyclopropanecarboxylate (18b)
Rh(I) complex [75,76] (0.025 mmol, 0.0114 g) and sodium tet-
rakis[3,5-bis(trifluoromethyl)phenyl]borate (NaBArf) (0.025 mmol,
0.0221 g) were stirred in dry dichloromethane (13 mL) at room
temperature for 1 h under an argon atmosphere. The reaction
mixture was cooled to 0 ꢀC, then 4-nitrostyrene and ethyl diazo-
acetate (1.0 mmol, 0.12 mL) in dry dichloromethane (7 mL) were
added in one portion. The reaction mixture was stirred at 0 ꢀC for
3 h, then the solvent was removed under vacuum and the crude
product was purified by chromatography on silica gel 60 eluting
with ethyl acetate:n-hexane (1:6) to afford the pure 18b. 1H NMR
(CDCl3, 400 MHz):
d 1.06 (t, 3H, eCH2CH3), 1.49 (m, 1H, eCHH-
The high biochemical potency as well as the ability to inhibit
LSD1 in cells in the same range of concentration, associated to the
excellent inhibitory effect on murine promyelocytic blasts lead to
consider both 11b and 11h as lead compounds to be considered for
future in vivo efficacy studies.
cyclopropane), 1.79 (m, 1H, eCHH- cyclopropane), 2.22 (m, 1H,
eCHCOOEt cyclopropane), 2.64 (m, 1H, PhCH cyclopropane), 3.94
(q, 2H, eCH2CH3), 7.45 (d, 2H, benzene protons), 8.16 (d, 2H, ben-
zene protons) ppm; 13C NMR (CDCl3, 100 MHz):
d 14.1, 16.9, 24.2,
26.2, 61.6, 123.3 (2C), 125.9 (2C), 144.3, 147.9, 171.2 ppm; MS (EI) m/z
[M]þ C12H13NO4 calcd 235.0845, found 235.0848.
4. Experimental section
4.1.3. General procedure for the synthesis of cis ethyl 2-(3- and 4-
aminophenyl)cyclopropanecarboxylates 19a,b. Example: synthesis
of cis ethyl 2-(3-aminophenyl)cyclopropanecarboxylate (19a)
4.1. Chemistry
Melting points were determined on a Buchi 530 melting point
apparatus and are uncorrected. 1H NMR and 13C NMR spectra were
recorded at 400 MHz and 100 MHz, respectively, on a Bruker AC
To
a
solution of cis ethyl 2-(3-nitrophenyl)cyclo-
propanecarboxylate (18a) (2.98 mmol, 0.70 g) in ethanol (3 mL),
stannous chloride dihydrate (2.38 g, 10.55 mmol) and 37% hydro-
chloric acid (1.5 mL) were slowly added at 0 ꢀC. The resulting
mixture was stirred at room temperature overnight. The reaction
was quenched by 2 N sodium carbonate solution (30 mL) and
extracted with dichloromethane (3 ꢁ 30 mL), washed with satu-
rated sodium chloride solution, and dried with sodium sulfate. The
solvent was removed under vacuum and the residue purified by
chromatography on silica gel 60 eluting with ethyl acetate:ch-
loroform (1:30) to provide the pure 19a. 1H NMR (CDCl3, 400 MHz):
400 spectrometer; chemical shifts are reported in
d (ppm) units
relative to the internal reference tetramethylsilane (Me4Si). EIMS
spectra were recorded with a Fisons Trio 1000 spectrometer; only
molecular ions (Mþ) and base peaks are given. All compounds were
routinely checked by TLC, 1H NMR and 13C NMR spectra. TLC was
performed on aluminum-backed silica gel plates (Merck DC, Alu-
folien Kieselgel 60 F254) with spots visualized by UV light. All
solvents were reagent grade and, when necessary, were purified
and dried by standard methods. Concentration of solutions after
reactions and extractions involved the use of a rotary evaporator
operating at reduced pressure of ca. 20 Torr. Organic solutions were
dried over anhydrous sodium sulfate. Elemental analysis has been
used to determine purity of the described compounds, that is >95%.
Analytical results are within 0.40% of the theoretical values. All
chemicals were purchased from Aldrich Chimica, Milan (Italy), or
from Alfa Aesar, Milan (Italy), and were of the highest purity.
d
1.02e1.05 (t, 3H, eCH2CH3), 1.27e1.32 (m, 1H, eCHH- cyclopro-
pane), 1.66e1.70 (m, 1H, eCHH- cyclopropane), 2.03e2.09 (m, 1H,
eCHCOOEt cyclopropane), 2.49e2.55 (m, 1H, PhCH- cyclopropane),
3.60 (bs, 2H, eNH2), 3.89e3.94 (q, 2H, eCH2CH3), 6.54e6.56 (d, 1H,
benzene proton), 6.63 (s, 1H, benzene proton), 6.68e6.70 (d, 1H,
benzene proton), 7.04e7.08 (t, 1H, benzene proton) ppm; 13C NMR
(CDCl3, 100 MHz):
d 14.1, 16.9, 24.2, 26.2, 61.6, 111.4, 112.0, 115.0,
128.9, 144.1, 147.8, 171.2 ppm; MS (EI) m/z [M]þ C12H15NO2 calcd
205.1103, found 205.1108.
4.1.1. General procedure for the synthesis of trans ethyl 2-(2-, 3-,
and 4- nitrophenyl)cyclopropanecarboxylates 12aec. Example:
trans ethyl 2-(3-nitrophenyl)cyclopropanecarboxylate (12b)
4.1.4. General procedure for the synthesis of trans tert-butyl 2-(2-,
3- and 4-benzamidophenyl)cyclopropylcarbamates (16aec) and cis
ethyl 2-(3- and 4-benzamidophenyl)cyclopropanecarboxylates
(20a,b). Example: cis ethyl 2-(4-benzamidophenyl)
To a stirring solution of 3-nitrostyrene (16.76 mmol; 2.34 mL) in
dry chloroform (30 mL), copper (I) chloride (0.014 mmol; 1.38 mg)
and a solution of ethyl diazoacetate (13.96 mmol; 1.47 mL) in dry
chloroform (5 mL) were added dropwise and under nitrogen at-
mosphere. The resulting mixture was then stirred at 60 ꢀC for 4 h.
After this time, the solvent was removed and the residue chroma-
tographed on silica gel 60 and eluted with ethyl acetate/n-hexane
1:20 to obtain as first eluted the trans isomer (12b) and as second
cyclopropanecarboxylate (20b)
Triethylamine (0.59 mmol; 0.08 mL) and benzoyl cloride
(0.59 mmol; 0.07 mL) were added dropwise to a cooled (0 ꢀC) so-
lution of cis ethyl 2-(4-aminophenyl)cyclopropanecarboxylate
(19b) (0.49 mmol, 0.1 g) in dry dichloromethane (5 mL). The
mixture was stirred at room temperature for 1 h, afterwards the

170
S. Valente et al. / European Journal of Medicinal Chemistry 94 (2015) 163e174
reaction was quenched by water (20 mL) and extracted with
dichloromethane (3 ꢁ 30 mL), washed with saturated sodium
chloride solution and dried with sodium sulfate. The solvent was
removed under vacuum and the residue purified by chromatog-
raphy on silica gel 60 eluting with ethyl acetate:chloroform (1:40)
(d, 1H, benzene proton), 7.90 (bs, 1H, eNHCOPh) ppm; 13C NMR
(CDCl3, 100 MHz): 14.6, 17.8, 28.5 (3C), 32.7, 79.7, 114.3, 123.8,
125.2, 125.4, 127.5 (2C), 129.0 (2C), 130.9, 132.4, 135.1, 136.7, 155.8,
164.8 ppm; MS (EI) m/z [M]þ C21H24N2O3 calcd 352.1787, found
352.1790.
d
to provide pure 20b. 1H NMR (CDCl3, 400 MHz):
d 1.04e1.08 (t, 3H,
eCH2CH3), 1.33e1.37 (m, 1H, eCHH- cyclopropane), 1.70e1.74 (m,
1H, eCHH- cyclopropane), 2.09e2.13 (m, 1H, eCHCOOEt cyclopro-
pane), 2.49e2.55 (m, 1H, PhCH- cyclopropane), 3.90e3.96 (q, 2H,
eCH2CH3), 7.28e7.30 (d, 2H, benzene protons), 7.49e7.58 (m, 5H,
benzene protons), 7.81 (bs, 1H, eNHCOPh), 7.86e7.88 (d, 2H, ben-
4.1.7.2. Tert-butyl-2-(2-benzamidophenyl)cyclopropylcarbamate
(17b, second eluted). 1H NMR (CDCl3, 400 MHz):
d 1.20e1.24 (m, 1H,
eCHH- cyclopropane),1.29e1.33 (m,1H, eCHH- cyclopropane),1.48
(s, 9H, e(CH3)3), 2.49e2.53 (m, 1H, eCHNHCOO(CH3)3 cyclopro-
pane), 2.90e2.94 (m, 1H, PhCH- cyclopropane), 5.00 (bs,
eNHCOO(CH3)3), 6.93e6.95 (d, 1H, benzene proton), 7.36e7.42 (m,
2H, benzene protons), 7.53e7.57 (t, 1H, benzene proton), 7.90e7.93
(d, 1H, benzene proton), 7.90 (bs, 1H, eNHCOPh) ppm; 13C NMR
zene protons) ppm; 13C NMR (CDCl3, 100 MHz):
d 14.1, 16.9, 24.2,
26.2, 61.6, 121.0 (2C), 125.2 (2C), 127.5 (2C), 128.8 (2C), 132.1, 134.2,
134.3, 137.4, 164.7, 171.2 ppm; MS (EI) m/z [M]þ C19H19NO3 calcd
309.1365, found 309.1370.
(CDCl3, 100 MHz):
d 14.6, 17.8, 28.5 (3C), 32.7, 79.7, 114.3, 123.8,
125.2, 125.4, 127.5 (2C), 129.0 (2C), 130.9, 132.4, 135.1, 136.7, 155.8,
164.8 ppm; MS (EI) m/z [M]þ C21H24N2O3 calcd 352.1787, found
352.1790.
4.1.5. General procedure for the synthesis of trans 2-(2-, 3-, and 4-
nitrophenyl)cyclopropanecarboxylic acids (13aec) and cis 2-(3-
and 4-benzamidophenyl)cyclopropanecarboxylic acids (21a,b).
Example: trans 2-(4-nitrophenyl)cyclopropylcarboxylic acid (13c)
A solution of 12c (9.95 mmol, 2.34 g) and 2 N KOH (19.9 mmol,
1.12 g) in ethanol (30 mL) was kept in stirring overnight at room
temperature. The reaction was quenched by addition of 2 N HCl
until pH 2; afterwards the precipitate was filtered, washed with
water (3 ꢁ 30 mL) and dried to obtain the pure 13c as a pale yellow
4.1.7.3. Tert-butyl
(1S,2R)-2-(3-benzamidophenyl)cyclo-
1.16e1.20 (m,
propylcarbamate (17c). 1H NMR (CDCl3, 400 MHz):
d
2H, eCH2- cyclopropane), 1.48 (s, 9H, e(CH3)3), 2.06e2.09 (m, 1H,
eCHNHCOO(CH3)3 cyclopropane), 2.74e2.77 (m, 1H, PhCH- cyclo-
propane), 4.89 (bs, eNHCOO(CH3)3), 6.93e6.95 (d, 1H, benzene
proton), 7.26e7.30 (t, 1H, benzene protons), 7.47e7.58 (m, 5H,
benzene protons), 7.85 (bs, 1H, eNHCOPh), 7.88e7.80 (d, 2H, ben-
solid. 1H NMR (DMSO-d6, 400 MHz,
d; ppm) d 1.52e1.56 (m, 2H, CH2
cyclopropane), 1.97e1.99 (m, 1H, eCHCOOH cyclopropane),
2.57e2.59 (m, 1H, PhCH-cyclopropane), 7.44e7.45 (d, 2H, benzene
protons), 8.11e8.13 (d, 2H, benzene protons), 12.50 (bs, 1H, COOH)
zene protons) ppm; 13C NMR (CDCl3, 100 MHz):
d 14.6, 22.9, 28.6
(3C), 32.4, 79.7, 117.6, 118.1, 120.5, 127.5 (2C), 128.5, 129.0 (2C), 132.2,
134.3, 135.6, 143.7, 155.8, 164.9 ppm; MS (EI) m/z [M]þ C21H24N2O3
calcd 352.1787, found 352.1790.
ppm; 13C NMR (DMSO-d6, 400 MHz,
d; ppm) d 16.6, 23.1, 25.9, 123.3
(2C), 125.9 (2C), 144.3, 147.9, 172.3 ppm; MS (EI) m/z [M]þ C10H9NO4
calcd 207.0532, found 207.0538.
4.1.7.4. Tert-butyl
(1R,2S)-2-(3-benzamidophenyl)cyclo-
1.16e1.20 (m,
propylcarbamate (17d). 1H NMR (CDCl3, 400 MHz):
d
4.1.6. General procedure for the synthesis of trans tert-butyl 2-(2-,
3- and 4- nitrophenyl)cyclopropylcarbamates (14aec) and cis tert-
butyl 2-(3- and 4-benzamidophenyl)cyclopropylcarbamates
(22a,b). Example: cis tert-butyl 2-(4-benzamidophenyl)
2H, eCH2- cyclopropane), 1.48 (s, 9H, e(CH3)3), 2.06e2.09 (m, 1H,
eCHNHCOO(CH3)3 cyclopropane), 2.74e2.77 (m, 1H, PhCH- cyclo-
propane), 4.89 (bs, eNHCOO(CH3)3), 6.93e6.95 (d, 1H, benzene
proton), 7.26e7.30 (t, 1H, benzene protons), 7.47e7.58 (m, 5H,
benzene protons), 7.85 (bs, 1H, eNHCOPh), 7.88e7.90 (d, 2H, ben-
cyclopropylcarbamate (22b)
A solution of 21b (0.71 mmol, 0.2 g) in dry benzene (10 mL),
triethylamine (0.78 mmol, 0.11 mL), diphenylphosphoryl azide
(0.78 mmol; 0.17 mL) and tert-butanol (53 mmol, 5 mL) was stirred
at 90 ꢀC under N2 atmosphere for 16 h. Afterwards, di-tert-butyl-
dicarbonate (8 mmol, 1.7 g) was added, and the reaction was
continued at 90 ꢀC for further 2 h. The solvent was removed under
vacuum and the residue was chromatographed by silica gel 60
eluting with ethyl acetate:n-hexane (1:3) to give pure 22b as a pale
zene protons) ppm; 13C NMR (CDCl3, 100 MHz):
d 14.6, 22.9, 28.6
(3C), 32.4, 79.7, 117.6, 118.1, 120.5, 127.5 (2C), 128.5, 129.0 (2C), 132.2,
134.3, 135.6, 143.7, 155.8, 164.9 ppm; MS (EI) m/z [M]þ C21H24N2O3
calcd 352.1787, found 352.1790.
4.1.7.5. Tert-butyl
(1S,2R)-2-(4-benzamidophenyl)cyclo-
1.16e1.20 (m,
propylcarbamate (17e). 1H NMR (CDCl3, 400 MHz):
d
2H, eCH2- cyclopropane), 1.48 (s, 9H, e(CH3)3), 2.05e2.08 (m, 1H,
eCHNHCOO(CH3)3 cyclopropane), 2.71e2.74 (m, 1H, PhCH- cyclo-
propane), 4.85 (bs, eNHCOO(CH3)3), 7.16e7.18 (d, 2H, benzene
proton), 7.49e7.57 (m, 5H, benzene protons), 7.78 (bs, 1H,
eNHCOPh), 7.88e7.90 (d, 2H, benzene protons) ppm; 13C NMR
yellow solid. 1H NMR (CDCl3, 400 MHz,
d; ppm) d 1.00e1.02 (m, 1H,
eCHH- cyclopropane), 1.32e1.34 (m, 1H, eCHH-cyclopropane),
2.23e2.25 (m, 1H, eCHCOOH), 2.93e2.96 (m, 1H, PhCH-cyclopro-
pane), 4.28 (bs, 1H, eNHCOOtBut), 7.22e7.25 (m, 2H, benzene
protons), 7.50e7.62 (m, 5H, benzene protons), 7.83 (bs, 1H,
eNHCOPh), 7.89e7.91 (d, 2H, benzene protons) ppm; 13C NMR
(CDCl3, 100 MHz): d 14.6, 22.9, 28.6 (3C), 32.8, 79.7, 121.2 (2C), 125.3
(2C), 127.9 (2C), 128.8 (2C), 132.2, 134.3, 134.4, 137.6, 155.8,
164.8 ppm; MS (EI) m/z [M]þ C21H24N2O3 calcd 352.1787, found
352.1789.
(CDCl3, 100 MHz): d 14.4, 22.8, 28.4 (3C), 32.6, 79.5, 121.0 (2C), 125.2
(2C), 127.5 (2C), 128.8 (2C), 132.1, 134.2, 134.3, 137.3, 155.6,
164.7 ppm; MS (EI) m/z [M]þ C21H24N2O3 calcd 352.1787, found
352.1791.
4.1.7.6. Tert-butyl
(1R,2S)-2-(4-benzamidophenyl)cyclo-
1.16e1.20 (m,
propylcarbamate (17f). 1H NMR (CDCl3, 400 MHz):
d
4.1.7. Spectral data for the carbamates 17aef and 23aed
2H, eCH2- cyclopropane), 1.48 (s, 9H, e(CH3)3), 2.05e2.08 (m, 1H,
eCHNHCOO(CH3)3 cyclopropane), 2.71e2.74 (m, 1H, PhCH- cyclo-
propane), 4.85 (bs, eNHCOO(CH3)3), 7.16e7.18 (d, 2H, benzene
proton), 7.49e7.57 (m, 5H, benzene protons), 7.78 (bs, 1H,
eNHCOPh), 7.88e7.90 (d, 2H, benzene protons) ppm; 13C NMR
4.1.7.1. Tert-butyl-2-(2-benzamidophenyl)cyclopropylcarbamate
(17a, first eluted). 1H NMR (CDCl3, 400 MHz):
d 1.20e1.24 (m, 1H,
eCHH- cyclopropane),1.29e1.33 (m,1H, eCHH- cyclopropane),1.48
(s, 9H, e(CH3)3), 2.49e2.53 (m, 1H, eCHNHCOO(CH3)3 cyclopro-
pane), 2.90e2.94 (m, 1H, PhCH- cyclopropane), 5.00 (bs,
eNHCOO(CH3)3), 6.93e6.95 (d, 1H, benzene proton), 7.36e7.42 (m,
2H, benzene protons), 7.53e7.57 (t, 1H, benzene proton), 7.90e7.93
(CDCl3, 100 MHz): d 14.6, 22.9, 28.6 (3C), 32.8, 79.7, 121.2 (2C), 125.3
(2C), 127.9 (2C), 128.8 (2C), 132.2, 134.3, 134.4, 137.6, 155.8,
164.8 ppm; MS (EI) m/z [M]þ C21H24N2O3 calcd 352.1787, found

S. Valente et al. / European Journal of Medicinal Chemistry 94 (2015) 163e174
171
352.1789.
2H, benzene protons), 8.43 (bs, 3H, NHþ3 ), 10.25 (bs, 1H, CONH)
ppm; 13C NMR (DMSO-d6, 100 MHz,
; ppm) 17.3, 25.6, 34.4, 121.2
d
d
4.1.7.7. Tert-butyl
(1R,2R)-2-(3-benzamidophenyl)cyclo-
1.02e1.06 (m,
(2C), 125.3 (2C), 127.6 (2C), 128.8 (2C), 132.1, 134.3, 134.5, 137.4,
164.8 ppm; MS (EI) m/z [M]þ C16H16N2O calcd 252.1263, found
252.1268.
propylcarbamate (23a). 1H NMR (CDCl3, 400 MHz):
d
1H, eCHH- cyclopropane), 1.31e1.35 (m, 1H, eCHH- cyclopropane),
1.36 (s, 9H, e(CH3)3), 2.25e2.29 (m, 1H, eCHNHCOO(CH3)3 cyclo-
propane), 2.92e2.96 (m, 1H, PhCH- cyclopropane), 4.31 (bs,
eNHCOO(CH3)3), 7.02e7.04 (d, 1H, benzene proton), 7.31e7.35 (m,
1H, benzene proton), 7.51-7.63 (m, 5H, benzene protons), 7.82 (bs,
1H, eNHCOPh), 7.88e7.90 (d, 2H, benzene protons) ppm; 13C NMR
4.1.8.1. N-(4-((1S,2R)-2-aminocyclopropyl)phenyl)benzamide hydro-
chloride (11b). 1H NMR (DMSO-d6, 400 MHz):
d 1.16e1.20 (m, 1H,
CHH cyclopropane), 1.34e1.38 (m, 1H, CHH cyclopropane),
2.29e2.33 (m, 1H, CHNHþ3 cyclopropane), 2.76e2.80 (m, 1H, PhCH
cyclopropane), 7.14e7.16 (d, 2H, benzene protons), 7.51e7.59 (m,
3H, benzene protons), 7.71e7.73 (d, 2H, benzene protons),
7.94e7.96 (d, 2H, benzene protons), 8.43 (bs, 3H, NHþ3 ), 10.25 (bs,
(CDCl3, 100 MHz):
d 14.6, 22.9, 28.5 (3C), 32.7, 79.7, 117.3, 118.1,
120.6, 127.5 (2C), 128.3, 128.8 (2C), 132.1, 134.3, 135.3, 143.6, 155.7,
164.8 ppm; MS (EI) m/z [M]þ C21H24N2O3 calcd 352.1787, found
352.1791.
1H, NHCOPh) ppm; 13C NMR (DMSO-d6,100 MHz):
d 14.1, 22.0, 28.2,
121.1 (2C), 125.3 (2C), 127.5 (2C), 128.8 (2C), 132.1, 134.3, 134.4,
138.9, 164.8 ppm; MS (EI) m/z [M]þ C16H16N2O calcd 252.1263,
found 252.1268.
4.1.7.8. Tert-butyl
(1S,2S)-2-(3-benzamidophenyl)cyclo-
1.02e1.06 (m,
propylcarbamate (23b). 1H NMR (CDCl3, 400 MHz):
d
1H, eCHH- cyclopropane), 1.31e1.35 (m, 1H, eCHH- cyclopropane),
1.36 (s, 9H, e(CH3)3), 2.25e2.29 (m, 1H, eCHNHCOO(CH3)3 cyclo-
propane), 2.92e2.96 (m, 1H, PhCH- cyclopropane), 4.31 (bs,
eNHCOO(CH3)3), 7.02e7.04 (d, 1H, benzene proton), 7.31e7.35 (m,
1H, benzene proton), 7.51e7.63 (m, 5H, benzene protons), 7.82 (bs,
1H, eNHCOPh), 7.88e7.90 (d, 2H, benzene protons) ppm; 13C NMR
4.1.8.2. N-(3-((1R,2S)-2-aminocyclopropyl)phenyl)benzamide hydro-
chloride (11c). 1H NMR (DMSO-d6, 400 MHz):
d 1.16e1.20 (m, 2H,
CH2 cyclopropane), 2.25e2.29 (m, 1H, CHNHþ3 cyclopropane),
2.74e2.77 (m, 1H, PhCH cyclopropane), 6.93e6.95 (d, 1H, benzene
proton), 7.26e7.30 (t, 1H, benzene protons), 7.47e7.58 (m, 5H,
benzene protons), 7.88e7.80 (d, 2H, benzene protons), 8.43 (bs, 3H,
NHþ3 ), 10.25 (bs, 1H, NHCOPh) ppm; 13C NMR (DMSO-d6, 100 MHz):
(CDCl3, 100 MHz):
d 14.6, 22.9, 28.5 (3C), 32.7, 79.7, 117.3, 118.1,
120.6, 127.5 (2C), 128.3, 128.8 (2C), 132.1, 134.3, 135.3, 143.6, 155.7,
164.8 ppm; MS (EI) m/z [M]þ C21H24N2O3 calcd 352.1787, found
352.1791.
d
14.1, 22.0, 28.2, 117.3, 118.1, 120.6, 127.5 (2C), 128.3, 128.9 (2C),
132.2, 134.3, 135.4, 143.5, 164.8 ppm; MS (EI) m/z [M]þ C16H16N2O
calcd 252.1263, found 252.1268.
4.1.7.9. Tert-butyl
(1R,2R)-2-(3-benzamidophenyl)cyclo-
0.98e1.02 (m,
propylcarbamate (23c). 1H NMR (CDCl3, 400 MHz):
d
1H, eCHH- cyclopropane), 1.31e1.35 (m, 1H, eCHH- cyclopropane),
1.38 (s, 9H, e(CH3)3), 2.21e2.25 (m, 1H, eCHNHCOO(CH3)3 cyclo-
propane), 2.93-2.97 (m, 1H, PhCH- cyclopropane), 4.27 (bs,
eNHCOO(CH3)3), 7.22e7.25 (d, 2H, benzene protons), 7.50e7.62 (m,
5H, benzene protons), 7.83 (bs, 1H, eNHCOPh), 7.87e7.91 (d, 2H,
4.1.8.3. N-(3-((1S,2R)-2-aminocyclopropyl)phenyl)benzamide hydro-
chloride (11d). 1H NMR (DMSO-d6, 400 MHz):
d 1.16e1.20 (m, 2H,
CH2 cyclopropane), 2.25e2.29 (m, 1H, CHNHþ3 cyclopropane),
2.74e2.77 (m, 1H, PhCH cyclopropane), 6.93e6.95 (d, 1H, benzene
proton), 7.26e7.30 (t, 1H, benzene protons), 7.47e7.58 (m, 5H,
benzene protons), 7.88e7.80 (d, 2H, benzene protons), 8.43 (bs, 3H,
NHþ3 ), 10.25 (bs, 1H, NHCOPh) ppm; 13C NMR (DMSO-d6, 100 MHz):
benzene protons) ppm; 13C NMR (CDCl3, 100 MHz):
d 14.6, 22.9,
28.5 (3C), 32.7, 79.6, 121.0 (2C), 125.3 (2C), 127.5 (2C), 128.8 (2C),
132.1, 134.3, 137.4, 143.6, 155.7, 164.8 ppm; MS (EI) m/z [M]þ
C21H24N2O3 calcd 352.1787, found 352.1790.
d
14.1, 22.0, 28.2, 117.3, 118.1, 120.6, 127.5 (2C), 128.3, 128.9 (2C),
132.2, 134.3, 135.4, 143.5, 164.8 ppm; MS (EI) m/z [M]þ C16H16N2O
calcd 252.1263, found 252.1268.
4.1.7.10. Tert-butyl
(1R,2R)-2-(3-benzamidophenyl)cyclo-
0.98e1.02 (m,
propylcarbamate (23d). 1H NMR (CDCl3, 400 MHz):
d
4.1.8.4. N-(2-(-2-aminocyclopropyl)phenyl)benzamide hydrochloride
1H, eCHH- cyclopropane), 1.31e1.35 (m, 1H, eCHH- cyclopropane),
1.38 (s, 9H, e(CH3)3), 2.21e2.25 (m, 1H, eCHNHCOO(CH3)3 cyclo-
propane), 2.93e2.97 (m, 1H, PhCH- cyclopropane), 4.27 (bs,
eNHCOO(CH3)3), 7.22e7.25 (d, 2H, benzene protons), 7.50e7.62 (m,
5H, benzene protons), 7.83 (bs, 1H, eNHCOPh), 7.87e7.91 (d, 2H,
(11e, first eluted). 1H NMR (DMSO-d6, 400 MHz):
d 1.20e1.24 (m,
1H, CHH cyclopropane), 1.29e1.33 (m, 1H, CHH cyclopropane),
2.29e2.53 (m, 1H, CHNHþ3 cyclopropane), 2.90e2.94 (m, 1H, PhCH
cyclopropane), 6.93e6.95 (d, 1H, benzene proton), 7.36e7.42 (m,
2H, benzene protons), 7.53e7.57 (t, 1H, benzene proton), 7.90e7.93
(d, 1H, benzene proton), 8.43 (bs, 3H, NHþ3 ), 10.25 (bs, 1H, NHCOPh)
benzene protons) ppm; 13C NMR (CDCl3, 100 MHz):
d 14.6, 22.9,
28.5 (3C), 32.7, 79.6, 121.0 (2C), 125.3 (2C), 127.5 (2C), 128.8 (2C),
132.1, 134.3, 137.4, 143.6, 155.7, 164.8 ppm; MS (EI) m/z [M]þ
C21H24N2O3 calcd 352.1787, found 352.1790.
ppm; 13C NMR (DMSO-d6, 100 MHz):
d 14.0, 16.9, 28.1, 114.2, 123.8,
125.2, 125.3, 127.5 (2C), 128.8 (2C), 130.8, 132.1, 134.3, 136.6,
164.8 ppm; MS (EI) m/z [M]þ C16H16N2O calcd 252.1263, found
252.1267.
4.1.8. General procedure for the synthesis of the TCP-based
enantiomers 11aej as hydrochloride salts. Example: N-(4-((1R,2S)-
2-aminocyclopropyl)phenyl)benzamide hydrochloride (11a)
4.1.8.5. N-(2-(-2-aminocyclopropyl)phenyl)benzamide hydrochloride
A solution of tert-butyl (1S,2R)-2-(4-benzamidophenyl)cyclo-
propyl)carbamate 17e (0.08 mmol, 0.03 g) and 4 N hydrochloric
acid/dioxane (0.8 mmol, 0.2 mL) in tetrahydrofuran (3 mL) was
stirred at room temperature overnight. The precipitated colorless
solid was filtered, washed with diethyl ether (3 ꢁ 5 mL) and dried
to afford 11a as a hydrochloride salt. 1H NMR (DMSO-d6, 400 MHz,
(11f, second eluted). 1H NMR (DMSO-d6, 400 MHz):
d 1.20e1.24 (m,
1H, CHH cyclopropane), 1.29e1.33 (m, 1H, CHH cyclopropane),
2.29e2.53 (m, 1H, CHNHþ3 cyclopropane), 2.90e2.94 (m, 1H, PhCH
cyclopropane), 6.93e6.95 (d, 1H, benzene proton), 7.36e7.42 (m,
2H, benzene protons), 7.53e7.57 (t, 1H, benzene proton), 7.90e7.93
(d, 1H, benzene proton), 8.43 (bs, 3H, NHþ3 ), 10.25 (bs, 1H, NHCOPh)
d; ppm)
d
1.17e1.21 (m, 1H, CHH cyclopropane), 1.35e1.39 (m, 1H,
ppm; 13C NMR (DMSO-d6, 100 MHz):
d 14.0, 16.9, 28.1, 114.2, 123.8,
CHH cyclopropane), 2.29e2.33 (m, 1H, CHNH2), 2.75e2.79 (m, 1H,
PhCH), 7.14e7.16 (m, 2H, benzene protons), 7.51e7.59 (m, 3H,
benzene protons), 7.71e7.73 (d, 2H, benzene protons), 7.94e7.96 (d,
125.2, 125.3, 127.5 (2C), 128.8 (2C), 130.8, 132.1, 134.3, 136.6,
164.8 ppm; MS (EI) m/z [M]þ C16H16N2O calcd 252.1263, found
252.1267.

172
S. Valente et al. / European Journal of Medicinal Chemistry 94 (2015) 163e174
4.1.8.6. N-(4-((1R,2R)-2-aminocyclopropyl)phenyl)benzamide
hy-
acquired and processed by Clarity software (DataApex, Prague, The
Czech Republic).
drochloride (11g). 1H NMR (DMSO-d6, 400 MHz):
d
0.98e1.02 (m,
1H, CHH cyclopropane), 1.31e1.35 (m, 1H, CHH cyclopropane),
2.23e2.27 (m, 1H, CHNHþ3 cyclopropane), 2.93e2.97 (m, 1H, PhCH
cyclopropane), 7.22e7.25 (d, 2H, benzene protons), 7.50e7.62 (m,
5H, benzene protons), 7.87e7.91 (d, 2H, benzene protons), 8.43 (bs,
3H, NHþ3 ), 10.25 (bs, 1H, NHCOPh) ppm; 13C NMR (DMSO-d6,
4.1.10. Circular dichroism spectra
The CD spectra were measured by using a Jasco Model J-700
spectropolarimeter. The optical path and temperature were set at
0.1 mm and 25 ꢀC, respectively. The spectra are average computed
over three instrumental scans and the intensities are presented in
terms of ellipticity values (mdeg).
100 MHz):
d 14.1, 22.0, 28.2, 121.1 (2C), 125.3 (2C), 127.5 (2C), 128.8
(2C), 132.1, 134.3, 134.4, 138.9, 164.8 ppm; MS (EI) m/z [M]þ
C16H16N2O calcd 252.1263, found 252.1269.
4.1.11. Enzyme assay. LSD1 inhibition
4.1.8.7. N-(4-((1S,2S)-2-aminocyclopropyl)phenyl)benzamide hydro-
The complex of human recombinant LSD1/CoREST protein was
produced in E. coli as separate proteins and co-purified following
previously reported procedures [81,82]. The experiments were
performed in 96 well half area white plates (cat. 3693, Corning,
Corning, NY) using a mono-methylated H3eK4 peptide containing
21 amino acids (custom synthesis done by Thermo Scientific) as
chloride (11h). 1H NMR (DMSO-d6, 400 MHz):
d 0.98e1.02 (m, 1H,
CHH cyclopropane), 1.31e1.35 (m, 1H, CHH cyclopropane),
2.23e2.27 (m, 1H, CHNHþ3 cyclopropane), 2.93e2.97 (m, 1H, PhCH
cyclopropane), 7.22e7.25 (d, 2H, benzene protons), 7.50e7.62 (m,
5H, benzene protons), 7.87e7.91 (d, 2H, benzene protons), 8.43 (bs,
3H, NHþ3 ), 10.25 (bs, 1H, NHCOPh) ppm; 13C NMR (DMSO-d6,
substrate in 40 mL volume of 50 mM TRIS-HCl, pH 8.0 and 0.05 mg/
100 MHz):
d
14.1, 22.0, 28.2, 121.1 (2C), 125.3 (2C), 127.5 (2C), 128.8
mL BSA buffer. The peptide purity was >95% as checked by
analytical high-pressure liquid chromatography and mass spec-
trometry. The demethylase activity was estimated under aerobic
conditions and at room temperature by measuring the release of
H2O2 produced during the catalytic process by the Amplex UltraRed
detection system coupled with horseradish peroxidase (HRP).
Briefly, 20 nM of LSD1/CoREST complex was incubated at room
temperature for 15 min in the absence and/or the presence of
(2C), 132.1, 134.3, 134.4, 138.9, 164.8 ppm; MS (EI) m/z [M]þ
C16H16N2O calcd 252.1263, found 252.1269.
4.1.8.8. N-(3-((1R,2R)-2-aminocyclopropyl)phenyl)benzamide
hy-
drochloride (11i). 1H NMR (DMSO-d6, 400 MHz):
d
1.02e1.06 (m,
1H, CHH cyclopropane), 1.31e1.35 (m, 1H, CHH cyclopropane),
2.26e2.30 (m, 1H, CHNHþ3 cyclopropane), 2.92e2.96 (m, 1H, PhCH
cyclopropane), 7.02e7.04 (d, 1H, benzene proton), 7.31e7.35 (m, 1H,
benzene proton), 7.51e7.63 (m, 5H, benzene protons), 7.88e7.90 (d,
2H, benzene protons), 8.43 (bs, 3H, NHþ3 ), 10.25 (bs, 1H, NHCOPh)
various concentrations of the inhibitors, 50
mM Amplex UltraRed
(Life Technologies) and 0.023 M HRP (Sigma) in 50 mM TriseHCl
m
pH 8.0 and 0.05 mg/mL BSA. The inhibitors were tested twice in
duplicates at each concentration. Tranylcypromine (Sigma) was
used as control. After preincubation of the enzyme with the in-
ppm; 13C NMR (DMSO-d6, 100 MHz):
d 14.1, 22.0, 28.2, 117.3, 118.1,
120.6, 127.5 (2C), 128.3, 128.9 (2C), 132.2, 134.3, 135.4, 143.5,
164.8 ppm; MS (EI) m/z [M]þ C16H16N2O calcd 252.1263, found
252.1268 ppm; MS (EI) m/z [M]þ C16H16N2O calcd 252.1263, found
252.1267.
hibitor, the reaction was initiated by addition of 4.5 mМ of mono-
methylated H3eK4 peptide. The conversion of the Amplex Ultra
Red reagent to Amplex UltroxRed was monitored by fluorescence
(excitation at 510 nm, emission at 595 nm) for 12 min and by using
a microplate reader (Infinite 200, Tecan Group, Switzerland).
Arbitrary units were used to measure the level of H2O2 produced in
the absence and/or in the presence of inhibition. The maximum
demethylase activity of LSD1/CoREST was obtained in the absence
of inhibitors and corrected for background fluorescence in the
absence of the substrate. The IC50 values were calculated using
GraphPad Prism version 4.0 (GraphPad Software, San Diego, CA).
4.1.8.9. N-(3-((1S,2S)-2-aminocyclopropyl)phenyl)benzamide hydro-
chloride (11j). 1H NMR (DMSO-d6, 400 MHz):
d 1.02e1.06 (m, 1H,
CHH cyclopropane), 1.31e1.35 (m, 1H, CHH cyclopropane),
2.26e2.30 (m, 1H, CHNHþ3 cyclopropane), 2.92e2.96 (m, 1H, PhCH
cyclopropane), 7.02e7.04 (d, 1H, benzene proton), 7.31e7.35 (m, 1H,
benzene proton), 7.51e7.63 (m, 5H, benzene protons), 7.88e7.90 (d,
2H, benzene protons), 8.43 (bs, 3H, NHþ3 ), 10.25 (bs, 1H, NHCOPh)
ppm; 13C NMR (DMSO-d6, 100 MHz):
d 14.1, 22.0, 28.2, 117.3, 118.1,
120.6, 127.5 (2C), 128.3, 128.9 (2C), 132.2, 134.3, 135.4, 143.5,
164.8 ppm; MS (EI) m/z [M]þ C16H16N2O calcd 252.1263, found
252.1268 ppm; MS (EI) m/z [M]þ C16H16N2O calcd 252.1263, found
252.1267.
4.1.12. Bioluminescent-coupled assay for monoamine oxidases
(MAO Glo Assay)
The MAO Glo Assay from Promega (cat V1402, Promega, Madi-
son, WI) was used to measure the effect of inhibitors on MAO A and
MAO B activity. Human recombinant MAO A and MAO B were
expressed in Pichia pastoris and purified as published [83]. The
4.1.9. HPLC enantioseparation
HPLC enantioseparations were performed by using the
assay was performed at room temperature in 50
mL (25 mL reaction
stainless-steel Chiralpak IA (250 mm
ꢁ
4.6 mm i.d. and
solution þ 25
m
L detection reagent) in 96 well half area white plates
250 ꢁ 10 mm i.d.), Chiralpak IB (250 mm ꢁ 4.6 mm i.d. and
250 ꢁ 10 mm i.d.), Chiralpak IC (250 mm ꢁ 4.6 mm i.d. and
250 ꢁ 10 mm i.d.) and Chiralcel OD (250 mm ꢁ 4.6 mm i.d. and
250 ꢁ 10 mm i.d.) (Chiral Technologies Europe, Illkirch, France)
columns, respectively. All chemicals solvents for HPLC were pur-
chased from Aldrich (Italy) and used without further purification.
The analytical HPLC apparatus consisted of a PerkineElmer (Nor-
walk, CT, USA) 200 lc pump equipped with a Rheodyne (Cotati, CA,
(cat. 3693, Corning, Corning, NY) on a Tecan Freedom EVO liquid
handler (Tecan Group Ltd. Månnedorf, Germany). 50 nM MAO A or
125 nM MAO B were incubated with ten different inhibitor con-
centrations (from 0.004 mM to 100 mM) for 15 min at RT in Promega
MAO Buffer or Promega MAO B Buffer (MAO Glo Assay kit, cata-
logue number V1402, Promega, Madison, WI). Reaction was started
with the addition of 40
mM Promega MAO substrate for MAO-A or
14 M for MAO-B. The reaction was stopped after 30 min with the
m
USA) injector, a 20-
m
L sample loop, an HPLC Dionex CC-100 oven
Promega detection reagent. Luminescence was measured after
20 min incubation in the dark using a microplate reader (Infinite
F200, Tecan Group, Switzerland) with an integration time of 0.25 s
per well. After 30 min of incubation the reaction was stopped with
the Promega detection reagent. All compounds were tested twice in
duplicate and IC50 values were calculated using GraphPad Prism
(Sunnyvale, CA, USA) and a Jasco (Jasco, Tokyo, Japan) Model CD
2095 Plus UV/CD detector. For semipreparative separations a Per-
kineElmer 200 LC pump equipped with a Rheodyne injector, a 1 mL
sample loop, a PerkineElmer LC 101 oven and Waters 484 detector
(Waters Corporation, Milford, MA, USA) were used. The signal was

S. Valente et al. / European Journal of Medicinal Chemistry 94 (2015) 163e174
173
M.G. Rosenfeld, P. Brehm, G. Mandel, Neuron 31 (2001) 353e365.
[12] Y. Shi, J. Sawada, G. Sui, E.B. Affar, J.R. Whetstine, F. Lan, H. Ogawa, M.P. Luke,
Y. Nakatani, Y. Shi, Nature 422 (2003) 735e738.
version 4.0 (GraphPad Software, San Diego, CA).
4.1.13. Biology. Gene modulation assay
Human APL NB4 cells were grown in RPMI supplemented with
10% fetal bovine serum, 2 mM L-glutamine, and antibiotics and
[13] G.W. Humphrey, Y. Wang, V.R. Russanova, T. Hirai, J. Qin, Y. Nakatani,
B.H. Howard, J. Biol. Chem. 276 (2001) 6817e6824.
[14] M.A. Hakimi, D.A. Bochar, J. Chenoweth, W.S. Lane, G. Mandel,
R.A. Shiekhattar, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 7420e7425.
[15] A. You, J.K. Tong, C.M. Grozinger, S.L. Schreiber, Proc. Natl. Acad. Sci. U. S. A. 98
(2001) 1454e1458.
[16] G.G. Wang, C.D. Allis, P. Chi, Trends Mol. Med. 13 (2007) 363e372.
[17] P. Kahl, L. Gullotti, L.C. Heukamp, S. Wolf, N. Friedrichs, R. Vorreuther,
G. Solleder, P.J. Bastian, J. Ellinger, E. Metzger, R. Schüle, R. Buettner, Cancer
Res. 66 (2006) 11341e11347.
[18] J.H. Schulte, S. Lim, A. Schramm, N. Friedrichs, J. Koster, R. Versteeg, I. Ora,
K. Pajtler, L. Klein-Hitpass, S. Kuhfittig-Kulle, E. Metzger, R. Schule, A. Eggert,
R. Buettner, J. Kirfel, Cancer Res. 69 (2009) 2065e2071.
[19] A. Yokoyama, S. Takezawa, R. Schule, H. Kitagawa, S. Kato, Mol. Cell. Biol. 28
(2008) 3995e4003.
[20] M. Wissmann, N. Yin, J.M. Muller, H. Greschik, B.D. Fodor, T. Jenuwein,
C. Vogler, R. Schneider, T. Gunther, R. Buettner, E. Metzger, R. Schule, Nat. Cell
Biol. 9 (2007) 347e353.
[21] A. Scoumanne, X. Chen, J. Biol. Chem. 282 (2007) 15471e15475.
[22] S. Lim, A. Janzer, A. Becker, A. Zimmer, R. Schule, R. Buettner, J. Kirfel, Carci-
nogenesis 31 (2010) 512e520.
maintained in a humidified tissue culture incubator at 37 ꢀC in 5%
CO2. Cells were treated at the biochemical IC50 or with vehicle
(DMSO). After 24 h the cells were collected for RNA analysis. Total
RNA was purified using RNeasy Mini Kit (Qiagen, Valencia, CA),
quantified and reverse transcribed. mRNA levels were measured by
quantitative RT-PCR (Fast SYBR Green Master mix, Applied Bio-
systems Foster City, CA) using specific primers and normalized
against TBP mRNA. Results are presented as fold induction relative
to vehicle treated cells (DMSO). Primers used in this study were:
Gfi1b, TCTGGCCTCATGCCCTTA e TCTGGCCTCATGCCCTTA; ITGAM,
AACCCCTGGTTCACCTCCT
e CATGACATAAGGTCAAGGCTGT; TBP,
GCTGGCCCATAGTGATCTTT e CTTCACACGCCAAGAAACAGT.
[23] Y. Wang, H. Zhang, Y. Chen, Y. Sun, F. Yang, W. Yu, J. Liang, L. Sun, X. Yang,
L. Shi, R. Li, Y. Li, Y. Zhang, Q. Li, X. Yi, Y. Shang, Cell 138 (2009) 660e672.
[24] S. Hayami, J.D. Kelly, H. Cho, M. Yoshimatsu, M. Unoki, T. Tsunoda, H.I. Field,
D.E. Neal, H. Yamaue, B.A.J. Ponder, Y. Nakamura, R. Hamamoto, Int. J. Cancer
128 (2011) 574e586.
4.1.14. Clonogenic assay
Murine Acute myeloid leukemia blasts has been recovered from
spleen of Acute Promyelocitic Leukemic mice sacrificed once that
the spleen was completed blast infiltrated. Specifically, the model
was previously characterized and obtained by injection in 129sv
mice of lineage-depleted cells from 129sv mice purified and
transduced with PML-RARA-expressing retroviral vector [83]. One
million of leukemic blast cells (from 129sv mice) injected intrave-
nously into non-irradiated syngeneic recipients are able to induce
leukemia development leading to mice death 21 days after blast
injection. For the clonogenic assay, murine Acute Myeloid Leukemic
cells (20,000 cells) originated from spleen of leukemic mice were
seeded in duplicate in methylcellulose medium (MethoCultTM GF
M3434, Stem Cell Technology, Vancouver, BC, Canada) in the
[25] W.J. Harris, X. Huang, J.T. Lynch, G.J. Spencer, J.R. Hitchin, Y. Li, F. Ciceri,
J.G. Blaser, B.F. Greystoke, A.M. Jordan, C.J. Miller, D.J. Ogilvie, T.C. Somervaille,
Cancer Cell. 21 (2012) 473e487.
ꢀ
[26] M.L. Suva, E. Rheinbay, S.M. Gillespie, A.P. Patel, H. Wakimoto, S.D. Rabkin,
N. Riggi, A.S. Chi, D.P. Cahill, B.V. Nahed, W.T. Curry, R.L. Martuza, M.N. Rivera,
N. Rossetti, S. Kasif, S. Beik, S. Kadri, I. Tirosh, I. Wortman, A.K. Shalek,
O. Rozenblatt-Rosen, A. Regev, D.N. Louis, B.E. Bernstein, Cell 157 (2014)
580e594.
[27] J. Huang, R. Sengupta, A.B. Espejo, M.G. Lee, J.A. Dorsey, M. Richter, S. Opravil,
R. Shiekhattar, M.T. Bedford, T. Jenuwein, S.L. Berger, Nature 449 (2007)
105e108.
[28] J. Wang, S. Hevi, J.K. Kurash, H. Lei, F. Gay, J. Bajko, H. Su, W. Sun, H. Chang,
G. Xu, F. Gaudet, E. Li, T. Chen, Nat. Genet. 41 (2009) 125e129.
[29] J. Yang, J. Huang, M. Dasgupta, N. Sears, M. Miyagi, B. Wang, M.R. Chance,
X. Chen, Y. Du, Y. Wang, L. An, Q. Wang, T. Lu, X. Zhang, Z. Wang, G.R. Stark,
Proc. Natl. Acad. Sci. U. S. A. 107 (2010) 21499e21504.
presence of fixed concentration (0.25 mM) of compounds. After 7
days, colonies (C.F.U.) were counted. Percentage of inhibition is
referred versus the vehicle (DMSO) treated cells.
[30] H. Kontaki, I. Talianidis, Mol. Cell 39 (2010) 152e160.
[31] H.S. Cho, T. Suzuki, N. Dohmae, S. Hayami, M. Unoki, M. Yoshimatsu,
G. Toyokawa, M. Takawa, T. Chen, J.K. Kurash, H.I. Field, B.A. Ponder,
Y. Nakamura, R. Hamamoto, Cancer Res. 71 (2011) 655e660.
Acknowledgments
[32] Y. Huang, E. Greene, T.M. Stewart, A.C. Goodwin, S.B. Baylin, P.M. Woster,
R.A. Casero, Proc. Natl. Acad. Sci. U. S. A. 104 (2007) 8023e8028.
[33] T. Suzuki, N. Miyata, J. Med. Chem. 54 (2011) 8236e8250.
[34] Y. Huang, T.M. Stewart, Y. Wu, S.B. Baylin, L.J. Marton, B. Perkins, R.J. Jones,
P.M. Woster, R.A. Casero, Clin. Cancer Res. 15 (2009) 7217e7228.
This work was supported by Fondazione Cariplo (2010.0778),
AIRC (IG-15208), MIUR (Progetto Epigen and RF-2010-2318330),
FIRB RBFR10ZJQT, Sapienza Ateneo Project 2013, IIT-Sapienza
Project, FP7 Project BLUEPRINT/282510 and A-PARADDISE/
602080, and Regione Lombardia, Fondo per la Promozione di
Accordi Istituzionale, Bando di Invito di cui al Decreto n. 4779 del
14/05/2009, Progetto DiVA.
€
[35] T. Schenk, W.C. Chen, S. Gollner, L. Howell, L. Jin, K. Hebestreit, H.U. Klein,
A.C. Popescu, A. Burnett, K. Mills, R.A. Casero, L. Marton Jr., P. Woster,
M.D. Minden, M. Dugas, J.C. Wang, J.E. Dick, C. Müller-Tidow, K. Petrie,
A. Zelent, Nat. Med. 18 (2012) 605e611.
[36] G. Ferrari-Amorotti, V. Fragliasso, R. Esteki, Z. Prudente, A.R. Soliera,
ꢀ
S. Cattelani, G. Manzotti, G. Grisendi, M. Dominici, M. Pieraccioli, G. Raschella,
C. Chiodoni, M.P. Colombo, B. Calabretta, Cancer Res. 73 (2013) 235e245.
[37] J.A. Baker, M.C.T. Fyfe. PCT Int. Appl. (2011), WO 2011106573 A2 20110901.
[38] J.A. Baker, M.C.T. Fyfe. PCT Int. Appl. (2011), WO 2011106106 A2 20110901.
[39] J.A. Baker, M.C.T. Fyfe. PCT Int. Appl. (2012), WO 2012072713 A2 20120607.
[40] J.A. Baker, J. Castro Palomino, M.C.T. Fyfe, T. Maes, M. Martinell Pedemonte.
PCT Int. Appl. (2012), WO 2012107498 A1 20120816.
[41] M.C.T. Fyfe, T. Maes, M. Martinell Pedemonte, I. Tirapu Fernandez De La
Cuesta. PCT Int. Appl. (2012), WO 2012107499 A1 20120816.
[42] T. Maes, M. Martinell Pedemonte, J.C. Castro-Palomino Laria. PCT Int. Appl.
(2012), WO 2012156531 A2 20121122.
Appendix A. Supplementary data
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.ejmech.2015.02.060.
References
[43] Y. Liang, D. Quenelle, J.L. Vogel, C.A. Ortega, T.M. Kristie, MBio 4 (2013)
e00558e12.
[44] S. Mimasu, N. Umezawa, S. Sato, T. Higuchi, T. Umehara, S. Yokoyama,
Biochemistry 49 (2010) 6494e6503.
[1] R.J. Sims, K. Nishioka, D. Reinberg, Trends Genet. 19 (2003) 629e639.
[2] C. Martin, Y. Zhang, Nat. Rev. Mol. Cell Biol. 6 (2005) 838e849.
[3] B.E. Bernstein, A. Meissner, E.S. Lander, Cell 128 (2007) 669e681.
[4] X. Cheng, X. Zhang, Mutat. Res. 618 (2007) 102e115.
[45] R. Ueda, T. Suzuki, K. Mino, H. Tsumoto, H. Nakagawa, M. Hasegawa, R. Sasaki,
T. Mizukami, N. Miyata, J. Am. Chem. Soc. 131 (2009) 17536e17537.
[46] N. Guibourt, A. Ortega Munoz, J. Castro-Palomino Laria. PCT Int. Appl. 2010,
WO 2010043721 A1 20100422.
[47] H. Mohammad, K. Smitheman, G. van Aller, M. Cusan, S. Kamat, Y. Liu,
N. Johnson, C. Hann, S. Armstrong, R. Kruger, Eur. J. Cancer 50 (2014) 72 (oral
communication # 212).
[5] W.K. Paik, D.C. Paik, S. Kim, Trends Biochem. Sci. 32 (2007) 146e152.
[6] Y. Shi, F. Lan, C. Matson, P. Mulligan, J.R. Whetstine, P.A. Cole, R.A. Casero,
Y. Shi, Cell 119 (2004) 941e953.
[7] F. Forneris, C. Binda, M.A. Vanoni, A. Mattevi, E. Battaglioli, FEBS Lett. 579
(2005) 2203e2207.
[8] R. Anand, R. Marmorstein, J. Biol. Chem. 282 (2007) 35425e35429.
[9] D. Rotili, A. Mai, Genes Cancer 2 (2011) 663e679.
[48] D. Rotili, S. Tomassi, M. Conte, R. Benedetti, M. Tortorici, G. Ciossani, S. Valente,
B. Marrocco, D. Labella, E. Novellino, A. Mattevi, L. Altucci, A. Tumber, C. Yapp,
O.N. King, R.J. Hopkinson, A. Kawamura, C.J. Schofield, A. Mai, J. Med. Chem. 57
(2014) 42e55.
[10] E. Metzger, M. Wissmann, N. Yin, J.M. Muller, R. Schneider, A.H. Peters,
T. Gunther, R. Buettner, R. Schule, Nature 437 (2005) 436e439.
[11] N. Ballas, E. Battaglioli, F. Atouf, M.E. Andres, J. Chenoweth, M.E. Anderson,
C. Burger, M. Moniwa, J.R. Davie, W.J. Bowers, H.J. Federoff, D.W. Rose,

174
S. Valente et al. / European Journal of Medicinal Chemistry 94 (2015) 163e174
[49] P.I. Prusevich, J.H. Kalin, S.A. Ming, M. Basso, J. Givens, X. Li, J. Hu, M.S. Taylor,
A.M. Cieniewicz, P.Y. Hsiao, R. Huang, H. Roberson, N. Adejola, L.B. Avery,
R.A. Casero, S.D. Taverna, J. Qian, A.J. Tackett, R.R. Ratan, O.G. McDonald,
A.P. Feinberg, P.A. Cole, ACS Chem. Biol. 9 (2014) 1284e1293.
[50] S.K. Sharma, Y. Wu, N. Steinbergs, M.L. Crowley, A.S. Hanson, R.A. Casero,
P.M. Woster, J. Med. Chem. 53 (2010) 5197e5212.
[51] J. Wang, F. Lu, Q. Ren, H. Sun, Z. Xu, R. Lan, Y. Liu, D. Ward, J. Quan, T. Ye,
H. Zhang, Cancer Res. 71 (2011) 7238e7249.
[52] F. Forneris, C. Binda, A. Adamo, E. Battaglioli, A. Mattevi, J. Biol. Chem. 282
(2007) 20070e20074.
[53] I.R. Kumarasinghe, P.M. Woster, ACS Med. Chem. Lett. 5 (2013) 29e33.
[54] M. Tortorici, M.T. Borrello, M. Tardugno, L.R. Chiarelli, S. Pilotto, G. Ciossani,
N.A. Vellore, S.G. Bailey, J. Cowan, M. O'Connell, S.J. Crabb, G. Packham, A. Mai,
R. Baron, A. Ganesan, A. Mattevi, ACS Chem. Biol. 8 (2013) 1677e1682.
[55] S. Hazeldine, B. Pachaiyappan, N. Steinbergs, S. Nowotarski, A.S. Hanson,
R.A. Casero, P.M. Woster, J. Med. Chem. 55 (2012) 7378e7391.
[56] Y.C. Zheng, Y.C. Duan, J.L. Ma, R.M. Xu, X. Zi, W.L. Lv, M.M. Wang, X.W. Ye,
S. Zhu, D. Mobley, Y.Y. Zhu, J.W. Wang, J.F. Li, Z.R. Wang, W. Zhao, H.M. Liu,
J. Med. Chem. 56 (2013) 8543e8560.
[67] A.K. Upadhyay, D. Rotili, J.W. Han, R. Hu, Y. Chang, D. Labella, X. Zhang,
Y.S. Yoon, A. Mai, X. Cheng, J. Mol. Biol. 416 (2012) 319e327.
[68] S. Valente, I. Lepore, C. Dell'Aversana, M. Tardugno, S. Castellano, G. Sbardella,
S. Tomassi, S. Di Maro, E. Novellino, R. Di Santo, R. Costi, L. Altucci, A. Mai,
Biochimie 94 (2012) 2308e2313.
[69] S. Castellano, A. Spannhoff, C. Milite, F. Dal Piaz, D. Cheng, A. Tosco, M. Viviano,
A. Yamani, A. Cianciulli, M. Sala, V. Cura, J. Cavarelli, E. Novellino, A. Mai,
M.T. Bedford, G. Sbardella, J. Med. Chem. 55 (2012) 9875e9890.
[70] R. Ciarapica, E. Carcarino, L. Adesso, M. De Salvo, G. Bracaglia, P.P. Leoncini,
A. Dall'Agnese, F. Verginelli, G.M. Milano, R. Boldrini, A. Inserra, S. Stifani,
I. Screpanti, V.E. Marquez, S. Valente, A. Mai, P.L. Puri, F. Locatelli, D. Palacios,
R. Rota, BMC Cancer 14 (2014) 139.
[71] R. Ciarapica, M. De Salvo, E. Carcarino, G. Bracaglia, L. Adesso, P.P. Leoncini,
A. Dall'Agnese, Z.S. Walters, F. Verginelli, L. De Sio, R. Boldrini, A. Inserra,
G. Bisogno, A. Rosolen, R. Alaggio, A. Ferrari, P. Collini, M. Locatelli, S. Stifani,
I. Screpanti, S. Rutella, Q. Yu, V.E. Marquez, J. Shipley, S. Valente, A. Mai,
L. Miele, P.L. Puri, F. Locatelli, D. Palacios, R. Rota, Oncogene 33 (2014)
4173e4184.
ꢁ
ꢁ
ꢁ
ꢁ
[72] J. Suchankova, S. Legartova, P. Sehnalova, S. Kozubek, S. Valente, D. Labella,
A. Mai, C. Eckerich, F.O. Fackelmayer, D.V. Sorokin, E. Bartova, Eur. J. Histo-
chem 58 (2014) 2389.
[57] C.J. Kutz, S.L. Holshouser, E.A. Marrow, P.M. Woster, Med. Chem. Commun. 5
(2014) 1863e1870.
[58] V. Sorna, E.R. Theisen, B. Stephens, S.L. Warner, D.J. Bearss, H. Vankayalapati,
S. Sharma, J. Med. Chem. 56 (2013) 9496e9508.
[73] P. Vianello, O.A. Botrugno, A. Cappa, G. Ciossani, P. Dessanti, A. Mai, A. Mattevi,
ꢁ
G. Meroni, S. Minucci, F. Thaler, M. Tortorici, P. Trifiro, S. Valente, M. Villa,
[59] http://www.clinicaltrials.gov/ct2/show/NCT02034123?term¼lsd1&rank¼3;
www.clinicaltrialsregister.eu/ctr-search/trial/2013-002447-29/ES.
[60] A. Mai, S. Valente, D. Cheng, A. Perrone, R. Ragno, S. Simeoni, G. Sbardella,
G. Brosch, A. Nebbioso, M. Conte, L. Altucci, M.T. Bedford, ChemMedChem 2
(2007) 987e991.
[61] R. Ragno, S. Simeoni, S. Castellano, C. Vicidomini, A. Mai, A. Caroli,
A. Tramontano, C. Bonaccini, P. Trojer, I. Bauer, G. Brosch, G. Sbardella, J. Med.
Chem. 50 (2007) 1241e1253.
[62] A. Mai, D. Cheng, M.T. Bedford, S. Valente, A. Nebbioso, A. Perrone, G. Brosch,
G. Sbardella, F. De Bellis, M. Miceli, L. Altucci, J. Med. Chem. 51 (2008)
2279e2290.
[63] D. Palacios, C. Mozzetta, S. Consalvi, G. Caretti, V. Saccone, V. Proserpio,
V.E. Marquez, S. Valente, A. Mai, S.V. Forcales, V. Sartorelli, P.L. Puri, Cell. Stem
Cell 7 (2010) 455e469.
M. Varasi, C. Mercurio, Eur. J. Med. Chem. 86 (2014) 352e363.
[74] C. Binda, S. Valente, M. Romanenghi, S. Pilotto, R. Cirilli, A. Karytinos,
G. Ciossani, O.A. Botrugno, F. Forneris, M. Tardugno, D.E. Edmondson,
S. Minucci, A. Mattevi, A. Mai, J. Am. Chem. Soc. 132 (2010) 6827e6833.
[75] M.L. Rosenberg, A. Krivokapic, M. Tilset, Org. Lett. 11 (2009) 547e550.
ꢂ
ꢁ
[76] M.L. Rosenberg, K. Vlasana, N. Sen Gupta, D. Wragg, M. Tilset, J. Org. Chem. 76
(2011) 2465e2470.
[77] S. Saleque, J. Kim, H.M. Rooke, S.H. Orkin, Mol. Cell 27 (2007) 562e572.
[78] A.H. Chowdhury, J.R. Ramroop, G. Upadhyay, A. Sengupta, A. Andrzejczyk,
S. Saleque, PLoS One 8 (2013) e53666.
[79] L.T. van der Meer, J.H. Jansen, B.A. van der Reijden, Leukemia 24 (2010)
1834e1843.
[80] S. Minucci, S. Monestiroli, S. Giavara, S. Ronzoni, F. Marchesi, A. Insinga,
D. Diverio, P. Gasparini, M. Capillo, E. Colombo, C. Matteucci, F. Contegno, F. Lo
Coco, E. Scanziani, A. Gobbi, P.G. Pelicci, Blood 100 (2002) 2989e2995.
[81] F. Forneris, C. Binda, E. Battaglioli, A. Mattevi, Trends Biochem. Sci. 33 (2008)
181e189.
[64] S. Castellano, C. Milite, R. Ragno, S. Simeoni, A. Mai, V. Limongelli, E. Novellino,
I. Bauer, G. Brosch, A. Spannhoff, D. Cheng, M.T. Bedford, G. Sbardella,
ChemMedChem 5 (2010) 398e414.
[65] D. Cheng, S. Valente, S. Castellano, G. Sbardella, R. Di Santo, R. Costi,
M.T. Bedford, A. Mai, J. Med. Chem. 54 (2011) 4928e4932.
[82] F. Forneris, C. Binda, A. Adamo, E. Battaglioli, A. Mattevi, J. Biol. Chem. 282
(2007) 20070e20074.
[66] A.T. Hauser, E.M. Bissinger, E. Metzger, A. Repenning, U.M. Bauer, A. Mai,
R. Schüle, M. Jung, J. Biomol. Screen 17 (2012) 18e26.
[83] C. Binda, M. Li, F. Hubalek, N. Restelli, D.E. Edmondson, A. Mattevi, Proc. Natl.
Acad. Sci. U. S. A. 100 (2003) 9750e9755.