Discovery and structure-activity relationship of potent and selective covalent inhibitors of transglutaminase 2 for Huntington's disease

Article

pubs.acs.org/jmc

Discovery and Structure−Activity Relationship of Potent and

Selective Covalent Inhibitors of Transglutaminase 2 for Huntington’s

Disease

Michael E. Prime,^†Ole A. Andersen,^†John J. Barker,^†Mark A. Brooks,^†Robert K. Y. Cheng,^†

Ian Toogood-Johnson,^†Stephen M. Courtney,^†Frederick A. Brookfield,^†Christopher J. Yarnold,^†

Richard W. Marston,^†Peter D. Johnson,^†Siw F. Johnsen,^†Jordan J. Palfrey,^†Darshan Vaidya,^†

Sayeh Erfan,^†Osamu Ichihara,^†Brunella Felicetti,^†Shilpa Palan,^†Anna Pedret-Dunn,^†Sabine Schaertl,^‡

Ina Sternberger,^‡Andreas Ebneth,^‡Andreas Scheel,^‡Dirk Winkler,^‡Leticia Toledo-Sherman,^§

Maria Beconi,^§Douglas Macdonald,^§Ignacio Munoz-Sanjuan,^§Celia Dominguez,^§and John Wityak*^,§

̃

^†Evotec (UK) Ltd., 114 Milton Park, Abingdon, OX14 4SA, U.K.

^‡Evotec AG, Schnackenburgallee 114, Hamburg, Germany

^§CHDI Management/CHDI Foundation, Los Angeles, California, United States

S

* Supporting Information

ABSTRACT: Tissue transglutaminase 2 (TG2) is a multifunctional

protein primarily known for its calcium-dependent enzymatic protein

cross-linking activity via isopeptide bond formation between glutamine

and lysine residues. TG2 overexpression and activity have been found

to be associated with Huntington’s disease (HD); specifically, TG2

is up-regulated in the brains of HD patients and in animal models of

the disease. Interestingly, genetic deletion of TG2 in two different HD mouse models, R6/1 and R6/2, results in improved

phenotypes including a reduction in neuronal death and prolonged survival. Starting with phenylacrylamide screening hit 7d, we

describe the SAR of this series leading to potent and selective TG2 inhibitors. The suitability of the compounds as in vitro tools

to elucidate the biology of TG2 was demonstrated through mode of inhibition studies, characterization of druglike properties,

and inhibition profiles in a cell lysate assay.

shape with the transamidation catalytic site obscured within

the core domain (Protein Data Bank accession number 1KV3).¹³

An open form was reported by Pinkas et al. (Protein Data

Bank accession number 2Q3Z) of an enzyme−inhibitor com-

plex in which TG2 has undergone a substantial conformational

rearrangement in which it possesses a linear arrangement of the

constituent domains.¹⁴The structure of the open form protein

was obtained in the presence of 10 mM Ca²⁺and the pentapeptide

gluten protein mimic 1 bound covalently to the catalytic cysteine

(Cys277). The open form is favored under high Ca²⁺con-

centration, while the closed form predominates in the presence

of GTP/GDP.

Several groups have reported TG2 inhibitors (Figure 1);

these include gluten inspired pentapeptides such as 1 or func-

tionalized amino acids or dipeptides such as 2−4 bearing

functionality capable of reacting chemically with biological

nucleophiles.¹⁴⁻¹⁷Also known are nonpeptidic, small molecule

hydrazides represented by LDN-27219 (5)¹⁸and aryl amino-

ethyl ketones represented by 6.¹⁹Detailed mechanism of

inhibition studies failed to conclusively identify the site of

binding of 5, and it was reported to bind “at the enzyme’s GTP

INTRODUCTION

■

Tissue transglutaminase 2 (TG2, TGM2, human gene no. 7052)

is a multifunctional enzyme primarily known for its calcium-

dependent intra- and intermolecular cross-linking activity via

isopeptide bond formation between a γ-carboxamide of a

glutamine residue of the acyl-donor substrate and an ε-amino

group of a lysine residue of the acyl-acceptor substrate.¹TG2 has

also been reported to display simple amidase, GTPase, ATPase,

and protein disulfide isomerase activities.²⁻⁴The protein is the

most ubiquitously expressed of the transglutaminase family and

has been observed to be localized in the cytosol, cell nucleus, cell

membrane, and extracellular compartments.^5,6Genetic deletion

of TG2 in mice suggests a role for TG2 activity in mitochondrial

energy function.⁷TG2 overactivity has been most closely associated

with Celiac disease and Huntington’s disease, and there is growing

support for roles in inflammation and cancer.⁸⁻¹¹

TG2 has been reported to exist in at least two major con-

formations. These are the transamidation competent Ca²⁺-

activated open form and the guanosine nucleotide bound, non-

transamidating closed form. An open-inactive form charac-

terized by formation of a Cys370−Cys371 cysteine bridge has

also been described.¹²The “open” and “closed” forms are the

most studied, and X-ray crystal structures have been reported

for each. Liu et al. reported a GTP-bound form having a compact

Received: April 22, 2011

Published: January 6, 2012

1021

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

of inhibition, specific assays that were previously described were

used to triage hits resulting from the HTS.²⁷

RESULTS AND DISCUSSION

■

Hit Identification and Characterization. An HTS

campaign to identify inhibitors of TG2 transamidation activity

was run against the Evotec screening collection of 283K com-

pounds. The screen resulted in 2473 primary hits displaying at

least 28% inhibition at 10 μM compound concentration, for

a hit rate of 0.9%. The HTS was run at the EC₅₀of Ca²⁺

activation for TG2 transamidation, as it was postulated that

under these conditions TG2 would be present for inhibition

in both the open and closed conformations. In principle, we

hoped to identify hits that acted through either the cysteine

containing transamidation site or the GTPase site. In practice,

however, we did not identify any hits that were competitive

with GTP for the closed form. Consistent with this, the X-ray

structural data indicated that the guanosine nucleotide binding

site is extremely small and unlikely to accommodate molecules

of the size typified in the screening set. Furthermore, sub-

sequent virtual screening efforts based on this structure were

also unsuccessful in identifying hits that were competitive with

GTP (data not shown). In addition to the HTS, virtual screen-

ing using the 2Q3Z open form structure and a fragment-based

screen were applied to identify hits. After hit confirmation from

fresh powder samples, four chemotypes represented by com-

pounds 7a−d emerged as potential starting points for medicinal

chemistry (Figure 2). As an aside, all of the hits described re-

Figure 1. Known inhibitors of TG2.

site or a site that regulates binding of GTP”.²⁰The mechanism

of inhibition of 6 has not been reported. Limited selectivity data

are available for some of these compounds against at most one

or two transglutaminase isoforms.

As mentioned, TG2 has been implicated in the pathology

of HD, an autosomal dominant, progressive neurodegenerative

disease that is characterized clinically by motor, cognitive,

and behavioral deficits. TG2 expression and transglutaminase

activity have been shown to be increased in the brains of HD

patients and in HD mouse models. This enhanced activity has

been correlated with impaired mitochondrial function and shown

genetically to modify the progression of the pathogenic pheno-

type against the R6/1 and R6/2 HD mouse models.²¹⁻²⁵

Specifically, genetic deletion of TG2 in the context of these

models leads to improved phenotypes including a reduction in

neuronal death, improvement of motor function, and prolonged

survival. With the caveat in mind that genetic deletion of a

protein may not have the same effect as inhibition of its activity,

we sought to identify potent, selective TG2 inhibitors to

recapitulate the results of genetic deletion experiments in proof

of concept studies in animal models of HD.

Because the transamidation activity of TG2 is mediated by

an active site cysteine, it was expected that a high throughput

screening (HTS) strategy would identify electrophilic and

otherwise reactive compounds in addition to amine-bearing

compounds that could compete for the lysine-bearing sub-

strate.^26,27While compounds bearing reactive functionality

would be unsuitable starting points for a medicinal chemistry

effort directed toward identifying a drug development candi-

date, these types of hits were deemed acceptable for our more

modest goal of identifying an in vivo tool for target validation

purposes, provided they possessed adequate chemical stability

and selectivity. In particular, the selectivity profile across other

transamidating and active-site cysteine-containing enzymes is

an important factor in the development of TG2 inhibitors for

both target validation and therapeutic applications. For

example, inhibition of TG1 could result in icthyosis while

inhibition of factor XIIIa might be expected to result in com-

promised blood clot stabilization and increased bleeding.²⁸⁻³⁰

To interrogate general chemical reactivity, selectivity, and kinetics

Figure 2. TG2 screening hits and selectivity profiles.

sulted from physical compound screening; our attempts at

virtual screening did not yield additional hits.

During hit profiling, 7a was determined to have a TG2 IC₅₀

of 5.7 μM. Through kinetics studies 7a was found to have

competitive properties toward the dansyllysine substrate (KxD)

as indicated by a K_mincrease with unchanged V_max(data not

shown). This is consistent with a mode of inhibition whereby

this compound acts as a pseudo-inhibitor or alternative acyl-

acceptor substrate. While attracted by the selectivity of 7a for

TG2, the high molecular weight of this hit (MW = 594) was a

significant concern. Its viability as a starting point for medicinal

1022

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

chemistry optimization rested on being able to improve ligand

efficiency. These attempts proved unsuccessful, as a loss of

activity was observed upon paring back the molecular weight of

the compound. In support of the kinetics studies, protection or

removal of the benzylic amine resulted in a complete loss of

activity. In addition, since TG2 can catalyze deamidation and

transamidation reactions, the potency and efficacy of inhibit-

ing TG2 subsequent to formation of the key thioester bound

enzyme−substrate intermediate might not match the potency

and efficacy resulting from inhibiting thioester formation.

Because of this concern and the poor ligand efficiency, 7a fell

from consideration for further medicinal chemistry efforts. The

chemotype exemplified by bromothiophene 7b were amides

that based upon visual inspection were suspected of having

poor chemical stability. Compound 7b had a TG2 IC₅₀of 8.7 μM

and was inactive in TG3 and caspase 3 counterassays when

tested at 80 and 50 μM, respectively.²⁷The chemotype fell

from consideration when unacceptable chemical reactivity was

confirmed, as 7b reacted with methanol and readily formed a

conjugate with glutathione (GSH).³¹The pyrimidotriazine 7c

was representative of many others in the set of primary hits

and had a TG2 IC₅₀of 0.025 μM. While the activity of this com-

pound was attractive, the chemotype is a known fluorophore³²

and has been shown to participate in thiol capture processes.³³

These compounds were eliminated from further consideration

once it was determined that 7c had an IC₅₀of 0.003 μM in the

caspase 3 counterassay and had potent activity versus other

transglutaminase isoforms.

Scheme 2. General Synthesis of Sulfonamide-Bearing

Phenylacrylamides

a

Reagents and conditions: (a) DIPEA, THF, 2 h; (b) Fe, NH₄Cl (aq),

EtOH/H₂O (5:1), 80 °C, 2 h; (c) acryloyl chloride, DIPEA, THF, 18 h.

a

Scheme 3. General Synthesis of Sulfonamidopiperazines

Finally, 4-bromophenylacrylamide 7d was identified

which, as shown in Figure 2, displayed weak activity against

TG2 (IC₅₀= 3.3 μM) with an encouraging selectivity profile

against the other transglutaminases and complete selectivity

versus caspase 3 when tested at 50 μM. Upon variation of the

incubation time of 7d in the transamidation assay, the com-

pound displayed time dependent inhibition consistent with irre-

versible inhibition. In addition, 7d appeared to have acceptable

stability and did not react with methanol or readily conjugate

GSH. Preliminary evidenced suggested that the site of inhibi-

tion was Cys277 (see Supporting Information). We report here

the SAR study of this chemotype, including the mode of

inhibition, computational models to help rationalize the SAR,

transglutaminase selectivity, cell lysate TG2 data, and DMPK

profiling results of selected compounds.

a

Reagents and conditions: (a) 20% TFA/DCM, 4 h; (b) DIPEA,

THF, RCO₂Cl, 2−10 h; (c) DIPEA, THF, R₁R₂NCOCl, 2−10 h; (d)

DIPEA, THF, RCOCl, 2−10 h; (e) K₂CO₃, DMF, RX, 50 °C, 18 h.

using acryloyl chloride provided the acrylamides 10 in good

yield.

Synthesis of Inhibitors. General methods used for the

synthesis of the phenylacrylamide and heteroarylacrylamide

compounds are illustrated in Schemes 1−4. As shown in

Synthesis of phenylacrylamides bearing a sulfonamide moiety

began by treating commercially available 4-nitrophenylsulfonyl

chloride 11 with a diverse set of amines in the presence of

diisopropylethylamine (DIPEA) in tetrahydrofuran (THF) to

afford the sulfonamides 12 (Scheme 2). Subsequent reduction

of the nitro group with iron gave the anilines 13, which were

then acylated using acryloyl chloride to provide the acrylamides

14 in good yield.

a

Scheme 1. General Synthesis of Simple Phenylacrylamides

Synthesis of a wide range of substituted piperazines began

with acid catalyzed deprotection of the tert-butoxycarbamate

14a to afford piperazine 15 (Scheme 3). Base promoted acyla-

tion of 15 was achieved using a range of chloroformates, carbamoyl

chlorides, and acid chlorides, resulting in carbamates 16a−ab, ureas

17a−e, and amides 18a−d, respectively. Under slightly more

forcing conditions, piperazine 15 could be alkylated using a range

of alkyl halides to give alkyl or cycloalkyl substituted piperazines

19a,b.

a

Reagents and conditions: (a) Fe, NH₄Cl (aq), EtOH/H₂O (5:1),

80 °C, 2 h; (b) acryloyl chloride, DIPEA, THF, 18 h.

Scheme 1, commercially available nitrobenzenes 8 were re-

duced to the anilines 9 using reduced iron. Subsequent acylation

1023

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

a

Scheme 4. General Synthesis of Heterocyclic Acrylamides

a

Reagents and conditions: (a) ClSO₃H, SOCl₂, 150 °C, 2 h (X = CH)

or 72 h (X = N); (b) DIPEA, THF, 2 h; (c) acryloyl chloride, DIPEA,

DCM, −78 °C, 3 h; (d) NaH, acryloyl chloride, THF, 24 h.

Synthesis of analogues in which the phenylene group was

replaced with a heterocycle (Scheme 4) began with chlorosulfonyla-

tion of either 2-aminopyridine (20) or 2-aminopyrimidine (21)

with chlorosulfonic acid in the presence of thionyl chloride.

Base promoted sulfonamide formation then gave the substituted

piperazine heterocyclic amines 22 and 23. The pyridinyl deriv-

atives 24 were prepared in good yield using a range of acylating

agents and DIPEA in dichloromethane (DCM) at −78 °C;

however, the pyrimidinyl derivatives 25 required more forcing

conditions (NaH in THF at ambient temperature) to provide

modest yields of the desired products.

Figure 3. Structure of the peptide ligand 1 bound to TG2 and its

fragmentation for FMO calculation (blue = nitrogen, red = oxygen,

yellow = sulfur; TG2 is depicted in indigo, and the peptide ligand 1 is

multicolored with Lpro1 in green, Lgln2 in blue, Lleu3 in purple,

Lpro4 in yellow, and Lphe5 in pink).

are not parametrized in the MM potential functions. For this

reason the use of ab initio quantum mechanical (QM) methods

is highly desirable for a more accurate understanding of ligand−

protein interactions. Until recently, the application of QM

methods to rational structure-based drug design (SBDD) has

been hampered by the extremely large computational resource

required because of the scaling issues in application of the

method to large biomolecular systems.

The fragment molecular orbital (FMO) method was pro-

posed by Kitaura et al. to circumvent the scaling issue asso-

ciated with the QM calculations of large molecular systems.^34,35

The FMO method divides large molecular systems into num-

bers of fragments, and the molecular orbital calculations are

performed on the fragments (monomer) and the fragment pairs

(dimers). The total energy can be obtained as the summation

of the monomer energies and the pair interaction energies

(PIE). This method is well-suited for parallel computing and

results in a dramatic decrease of computational time. Frag-

mentation of the protein molecule is usually done with one

amino acid residue or ligand as the fragmentation unit. Detailed

pairwise interaction information between the protein residues

and the ligand is obtained as well as the total energy of the

system.

Computational Models. While we were able to replicate

the published 2Q3Z crystal structure with peptide 1,¹⁴we were

unable to obtain X-ray quality crystals of inhibitor−TG2 com-

plexes in the presence of any of our small molecule TG2 inhib-

itors despite significant efforts (data not shown). We attempted

cocrystallization experiments with multiple compounds from

our series using the hanging drop method. That compounds

were bound to TG2 was confirmed using mass spectrometry.

We suspect that the additional molecular contacts made by the

peptide based inhibitors are necessary to stabilize the open

form in a conformation favorable for crystallization. As a surro-

gate, design concepts were drawn by analyzing the interactions

between the peptidic ligand 1 and TG2 found in the X-ray

structure of the enzyme−inhibitor complex (Figure 3). As the

structure of the peptidic ligand 1 bound in TG2 is a product of

an irreversible reaction and there is no equilibrium between the

bound and unbound state, the interactions found in the X-ray

structure do not directly affect the affinity (reactivity) of 1 to

TG2. However, we assumed that the covalently bound struc-

ture is a reasonable surrogate for the transition state or the

prereaction complex, from which we obtained information on

key nonbonding interactions. For studying interactions of this

nature, molecular mechanics (MM) based potential functions

are generally used. However, the accuracy of the MM method

is often questionable, particularly where charge transfer and

polarization are important for ligand binding. Moreover, nu-

merous kinds of nonclassical intermolecular forces that may

play an important role in inter- and intramolecular interactions

Because of the large size of the TG2 protein, the complex

that consisted of the residues within a 4 Å distance from the

ligand became the basis for the calculation (70 fragments, 1208

atoms). The details of the procedures are described in the

Experimental Section. The FMO calculation was performed at

the MP2/6-31G** theory level, and the interaction energies

between each fragmented section of the ligand and TG2 are

summarized in Table 1. Detailed interaction profile diagrams

1024

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

Table 1. Summary of the Theoretical Interaction Energies

between Each Fragmented Section of Ligand 1 and TG2

interaction

energy

contribution to the

total interaction

energy (%)

a

b

fragment (kcal mol⁻¹)

key interacting residues

Ile331 (HB), Trp332

Lphe5

−64.3

38

(vdW), Asn333 (vdW),

Ala304 (vdW)

Lpro4

−17.0

10

Trp332 (vdW), Asn333

(vdW), Phe334 (vdW)

Lleu3

Lgln2

−23.3

−48.1

14

29

Asn333 (HB)

Trp241, (HB), Gln276

(HB), Asp333 (HB),

His335

Lpro1

−15.9

9

NA

a

The interaction energies considered were nonbonding interactions

only, and the covalent bonding energy between Lgln2 and Cys277 was

b

excluded from the calculation. HB = hydrogen bond. vdW = van der

Waals interaction. NA = not applicable.

are also available in the Supporting Information. The interac-

tion energy between covalently bonded fragments has no real

physical meaning. Therefore, the interaction energy between

Lgln2 and Cys277 was omitted from the table.

Figure 4. Homology models of the transglutaminase isoforms TG1,

TG3, and FXIIIa highlighting residues lining the lipophilic pocket

(green = peptide ligand 1, blue = nitrogen, red = oxygen, yellow =

sulfur, gray = carbon): (A) active site of TG2 in the open conforma-

tion, PDB code 2Q3Z¹⁴(with peptide inhibitor 1 in green), showing

the presence of Leu312 and Leu420; (B) homology model of the

active site of FXIIIa showing the presence of Gln312 and Thr420 in

the lipophilic pocket; (C) homology model of the active site of TG3

showing the presence of Ser312 and His420 in the lipophilic pocket;

(D) homology model of the active site of TG1 showing Thr312 and

Lys420.

The FMO calculation revealed that a large part of theoretical

nonbonding interactions comes from the Lphe5 and Lgln2

fragments (38% and 29% of the total, respectively). Lphe5 was

found to be particularly important, providing a strong hydrogen

bond to the backbone NH of Ile331 and also efficiently filling

the space within the lipophilic region, which consists mainly of

Phe316, Leu312, Ile331, and Leu420 (human TG2 number-

ing). Although the resulting energetic contribution to the

binding for Lpro4 did not seem to be as significant, the distinct

shape of Lpro4 was considered critical for placing the key

Lphe5 residue into this lipophilic region. The N-terminal Lpro1

also seemed to have minimal contribution to the total interac-

tion energy. The interaction energy profile of the peptidic

ligand 1 was found be in good agreement with the inhibitory

activity data for truncated analogues of 1. For example, removal

of the C-terminal phenylalanine from 1 resulted in a total loss

of TG2 activity, whereas the N-terminal proline could be

removed with minimal loss of activity (data not shown).

In order to further enhance the selectivity profile for TG2

versus other related transglutaminases, homology modeling of

the other transglutaminase isoforms was performed. Significant

differences exist between the isoforms, particularly in the lipo-

philic region of the active sites of the enzymes which could be

exploited to develop molecules with improved selectivity (Figure 4).

In the 1−TG2 complex structure the C-terminal phenylalanine

residue of the peptidic ligand is placed in its highly lipophilic

cavity.¹⁴For the isofoms of TG2, TG1, TG3, and FXIIIa, major

differences are found in this region at residue positions 312 and

420.^29,36,37The homology model of TG3 reveals that this

isoform has a serine at position 312 and a histidine residue at

position 420 that occupies the space in the middle of the cavity,

rendering this pocket unsuitable for the binding of large lipo-

philic groups (Figure 4C). The selectivity profiles of the inhib-

itors presented in Table 3 are in agreement with this model.

TG1 and FXIIIa have lipophilic pockets similar to that of TG2

in size. Docking of the pentapeptide ligand to the homology

models of these two latter isoforms suggests that the C-terminal

phenylalanine can be readily accommodated within their lipo-

philic regions. However, although they do not explicitly present

the side chain functional groups within the pocket, TG1 and

FXIIIa have polar residues at the bottom of the pocket

(Gln312, Thr420 for FXIIIa and Thr312, Lys420 for TG1

(parts B and D of Figure 4, respectively).

Simple Arylacrylamide SAR. Because of the time-

dependent nature of irreversible inhibition, the IC₅₀might

not provide a reliable assessment of biochemical activity, since

it is measured at a single time point. This was a concern

especially for slower binding inhibitors; therefore, compounds

were spot checked during the course of the SAR study to

ensure that the 30 min compound incubation used to obtain

the IC₅₀values was adequate to show full inhibition of TG2.

For many of the compounds irreversible inhibition constants

(K_i) were measured from the monoexponential curves of the

enzymatic reaction.³⁸A typical example is shown for compound

7d in Figure 5. Pseudo-first-order inactivation rate constants

(k_obs) were calculated from these curves (Figure 5A). These

values were then used to construct a plot of k_obsversus inhibitor

concentration as shown in Figure 5B. Linear regression of the

data from this plot yielded the inhibition constants k_cat, k_inact

,

and K_ifrom which k_inact/K_iwas derived and reported in the

tables. The graph in Figure 6 shows a log−log plot of the

relationship between k_inact/K_iand IC₅₀for all compounds upon

which irreversible inhibition constants were measured, demonstrat-

ing a high correlation between these values. Similar high correlation

was also observed between k_inact/K_iand IC₅₀for TG1, TG3, and

FXIIIa (available as Supporting Information), validating the use of

the IC₅₀for both the primary (TG2) and secondary assays in

guiding medicinal chemistry.

An initial SAR survey around compound 7d led to the series

of analogues shown in Table 2. Replacement of the acrylamide

with a vinylsulfonamide resulted in 10a having 5-fold lower

1025

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

Figure 5. Determination of irreversible inhibition constants for 7d: (A) exponential inactivation of TG2 by 7d at varied concentration; a mono-

exponential association equation (solid line) was used to fit k_obs; (B) plot of k_obsversus inhibitor concentration.

Extending the Sulfonamide into the Lipophilic

Region. On the basis of examination of the binding mode

proposed for our inhibitors, we began to investigate extending

the sulfonamide using a diaminoalkylene linker to tether a

lipophilic group in order to reach the lipophilic region. As

shown in Table 3, many examples of this set showed signif-

icantly improved TG2 activity and selectivity compared to 10g.

All of the compounds showed improved selectivity against TG1

and FXIIIa and were inactive against TG3. The activity and

selectivity of peptide 1 are shown for comparison. Given that

Figure 6. Correlation of TG2 inhibition log IC₅₀versus the irreversible

transglutaminase isoform testing occurred over several days

from the same DMSO stock solutions beginning with TG2

inhibition log k_inact/K_i(r²= 0.95).

followed by other TG isoforms over the course of days, one

potency than 7d. As expected, reduction of the acrylamide to

could hypothesize that the observed selectivity was a result of

the propionamide caused a complete loss of activity for 10b,

compound degradation in the DMSO solution. To address this,

while inserting a methylene spacer into the aniline C−N bond

we reassayed selected inhibitors from the same stocks against

in 10c also resulted in a large decrease in activity. Comparison

TG2 after the selectivity panel was completed and were able to

of the 2-bromo and 3-bromo analogues 10d and 10e with 7d

confirm TG2 potency, thus verifying the previously observed

showed that 3-bromo and 4-bromo were equipotent while the

selectivity.

2-bromo analogue was inactive. In a comparison of substituents

Benzyl carbamate 16a was one of the earliest potent com-

at the 4-position (10f−o), there was in general a strong correla-

pounds synthesized and displayed TG2 IC₅₀of 0.12 μM and an

tion of TG2 potency with the electron withdrawing ability of

the substituent.

Molecular docking was used to aid inhibitor design, prioritize

compound targets for synthesis, and help in the understanding

of binding interactions between our inhibitors and TG2. The

open form of TG2 in complex with compound 1 (PDB code

2Q3Z) was prepared for docking. Given that our inhibitors

covalently bind to the catalytic cysteine, Cys277, the covalent

irreversible inhibition constant k_inact/K_iof 1087 M⁻¹s⁻¹. When

docked into TG2, 16a appeared to conserve all interactions

of 10g while positioning the Cbz group for interaction with

the lipophilic region (Figure 7B). The Boc-derivative 14a was

equipotent with 16a, while piperazine 15, which lacks

a lipophilic substituent, was equipotent with 10g. Of the

aminopyrrolidines (16b−e), 3(R)-aminopyrrolidine 16b was

equipotent with 16a, with the other isomers being 4- to 5-fold

docking procedure provided by Gold was used for routine

docking in which both protein and ligand contain the linking

sulfur atom of Cys277. This required that the structures of the

less potent. Of the remaining compounds from Table 3, only

the diazabicyclooctane 16f showed TG2 activity comparable to

that of 16a. Rendering the linker acyclic (16g), constraining the

piperazine (16h), increasing the linker length by one to two

atoms (16i−l), or increasing the ring size by 1 to the

homopiperazine (16m) all resulted in decreased TG2 potency.

Interestingly, the m-phenylacrylamide 16n was only 3-fold less

potent than 16a.

The importance of the putative hydrogen bonding interac-

tions between the acrylamide amide and Trp241/Gln276 is

illustrated by the N-methylation of 14a to afford acrylamide 26

and the isomer of 16a, piperazine 27 (Figure 8). Compound

26 was approximately 40-fold less potent compared to 14a.

Similarly, compound 27 in which the piperazinyl and phenyl

moieties of 16a are transposed was approximately 25-fold less

potent than 16a. Taken together, these results suggest the im-

portance of the acrylamide-Trp241/Gln276 interaction; how-

ever, confirmation of this and other aspects of the binding

ligands be prepared as their corresponding thiol addition prod-

ucts with one open valence at sulfur. The docking procedure

confirmed that the terminal vinylic carbon of the acrylamide

moiety was indeed the site of reactivity with Cys277. In addi-

tion, docking of compound 10g suggested hydrogen bonding

interactions between the acrylamide CONH with the side

chains of Trp241 and Gln276 (Figure 7A). In addition to these

interactions, the model suggested that the sulfonyl might be

engaged in a hydrogen bonding interaction with the side chain

of Asn333. Furthermore, it was apparent that the sp³hybridiza-

tion of the sulfonamide appeared capable of directing substituents

toward the lipophilic region. Thus, significant activity and selec-

tivity improvements might be achieved by extending the sul-

fonamide to better occupy this region and take advantage of

this hydrophobic pocket and its potential for offering selectivity

against other transglutaminases.

1026

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

a

Table 2. TG2 Activity of Simple Arylacrylamides

Figure 7. Binding model for interaction of 10g (in indigo, part A) and

16a (in green, part B) with TG2.

of these compounds, irreversible inhibition constants were

determined for many of them, the results of which continued to

reinforce the good correlation observed between the two inhibi-

tion constants and ensure that weak activity was not due to

unfavorable kinetics of inhibition. Surprisingly, racemic epoxide

28b showed a 750-fold lower potency against TG2 relative to

28a. A series of acrylamides bearing substituents at the α- and/

or β-positions was next explored (28c−k). Other than

β-Z-chloroacrylamide 28j, none of these compounds showed

comparable or improved TG2 potency relative to 14a. Some-

what surprisingly, a series comprised of ketones, esters, and

nitriles (28l−q) were all determined to be completely inactive

versus TG2. These results perhaps underscore fundamental

differences in the topography of the catalytic tunnel proximal to

Cys277 with the corresponding catalytic region in the cathepsins,

which can accommodate and react with these warheads.³⁹Activated

nitriles are particularly good inhibitors of the cathepsins, which

have a more open architecture in the region of the active site. In

contrast, the catalytic tunnel of TG2 as exemplified in the

2Q3Z structure appears much narrower. In light of this, the

micromolar TG2 potency of acetylene 28r, which would not be

predicted as being a particularly good Michael acceptor, is

noteworthy. Reversing the polarity of the Michael acceptor as

in 28s and 28t also proved to be unrewarding. Only slightly

better was tethering a diazoketone as in peptide 1; compounds

28u and 28v had TG2 potencies of 4 and 16 μM, respectively.

An interesting finding was the 50-fold potency disparity

between 28j and the β-E-chloro analogue 28k. This difference

may be rationalized based on modeling the interactions in the

catalytic region as shown in Figure 9. In preparing for such an

analysis several assumptions were made: (1) the carbonyl

oxygen of the acrylamide needs stabilization by one or more

H-bond donor residues; (2) the carbonyl and double bond are

required to be coplanar; (3) the acrylamide is required to be in

the s-cis conformation, (4) the steric bulk of the chlorine atom

has to be accommodated in the small catalytic cavity, (5) the

incoming thiol needs to attack perpendicular to the plane of the

acrylamide. With these assumptions in place β-chloroacryla-

mide fragments with (S)- and (R)-configurations were each

covalently docked to TG2. In examination of the (S)-

configuration adduct that would arise from Z-alkene 28j, it

was noted that in the (S)-configuration the carbonyl oxygen is

stabilized by Trp241 in the transition state and the carbonyl

and (ex)double bond are nearly coplanar. By comparison,

binding interactions between TG2 and the (R)-adduct that

would result from E-alkene 28k were less energetically favored

a

Values accompanied by standard deviation were averaged from at

least two independent experiments; they were otherwise obtained in a

single determination. NT = not tested.

model would require additional experimentation, such as X-ray

crystallography of an inhibitor−protein complex.

Defining the SAR of the Covalent Warhead. The SAR

with respect to the acrylamide moiety was next investigated

(Table 4). Because of the weak TG2 activity observed for most

1027

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

Table 3. TG2 Activity and Transglutaminase Selectivity of

a

Sulfonamides

Figure 8. Inhibitors designed to interrogate specific putative hydrogen

bonding interactions with Trp241/Gln276 of TG2.

phenyl moiety of 16a was identified as a design strategy to

potentially take advantage of these differences (Table 5). It was

quickly determined that substitution at the 2-position was not

well-tolerated (29a and 29b). For the 3-position, methoxy

(29c) or methyl (29d) resulted in an order of magnitude loss

of potency relative to 14a. Substitution with 3-trifluoromethyl

(29e), 3-fluoro (29f), or 3-chloro (29g) was better tolerated

with respect to TG2 activity; however, decreased selectivity

against FXIIIa was observed. As highlights to this, 14a and 16a

were 3- to 4-fold more active on TG2 than FXIIIa while 29e−g

were approximately 2- to 4-fold more active on FXIIIa than

TG2.

Beyond Cbz: Filling the Lipophilic Region for Activity

and Selectivity. For the lipophilic tail, replacement of the Cbz

moiety with a variety of substituted benzyl carbamates resulted

in compounds 16o−ab (Table 6). Many of these showed com-

parable or improved TG2 potency when compared to 16a.

The 4-fluoro and the 2,3- and 3,5-difluorobenzyls 16o−q all

showed improved TG2 potency, with 16o showing TG2 IC₅₀of

0.046 μM. Ortho substituents, as in 16r−u were well-tolerated

but showed at best a 2-fold improvement in TG2 potency for

16u. Of the 1- and 2-naphthylmethyl carbamates 16v and 16w,

1-naphthyl 16v showed a slight improvement in TG2 potency

while 16w was approximately 2-fold less potent relative to 16a.

In comparing the 2-, 3-, and 4-phenoxybenzyl carbamates, the

3- and 4-derivatives 16x and 16y each showed 2-fold improve-

ment in potency, while 16t had potency comparable to that

of 16a. Moving away from the benzyl carbamate motif led to

alkyl carbamates 16z−ab. Unexpectedly, methyl carbamate 16z

was found to be equipotent with 16a. Ethyl carbamate 16aa

improved on this potency by nearly 2-fold, and cyclopentyl

carbamate 16ab showed a further incremental improvement.

These results may indicate that the sp²-hybridized aryl moieties

of the benzyl type carbamates are not fully engaged with the

lipophilic region and that sp³-hybridized groups might make

stronger interactions. Amides 18a−c were prepared to inves-

tigate the contribution of the carbamate linkage to TG2 activity

and to reduce the number of rotatable bonds. Compared to

16a, amide 18a displayed a slight decrease in TG2 potency,

whereas trans-2-phenylcyclopropylamide 18b, which was

prepared as the racemic mixture, was 2- to 3-fold more potent

than 16a. Cyclopropylamide 18c, which lacks the pendant

phenyl group, was equipotent with 16a.

a

Values accompanied by standard deviation were averaged from at

least two independent experiments; they were otherwise obtained in a

single determination. NT = not tested.

and do not benefit from stabilization of the transition state by

the protein.

SAR of the Phenylene Linker. In a comparison of peptide

1 with piperazine 16a, it is immediately apparent that the

N-acetylPro residue of the peptide inhibitor has no counterpart

in 16a. Furthermore, deletion of the Pro residue from 1 re-

sulted in a nominal 3-fold loss in TG2 activity but more

importantly significantly reduced transglutaminase selectivity

(data not shown). As depicted in Figure 10, examination of the

homology model suggests that FXIIIa is considerably more

polar than TG2 in the region proximal to the N-acetylPro:

Tyr169, Ser252, and Tyr334 in FXIIIa versus Gln169, Met252,

and Phe334 in TG2. Substitution at the 2- or 3-position of the

A series of lipophilic N,N-dialkylureas (17a−e) were next

evaluated (Table 6). These compounds show improved TG2

potency compared to 16a, with octahydroisoquinoline 17a

showing TG2 IC₅₀of 0.020 μM and greater than 10-fold selec-

tivity versus FXIIIa. Similar results were seen with the lipophilic

1028

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

a

Table 4. TG2 Activity and Transglutaminase Selectivity of Acrylamide Replacements

a

Values accompanied by standard deviation were averaged from at least two independent experiments; they were otherwise obtained in a single

determination. NT = not tested.

Figure 9. Models for the binding of β-chloroacrylamides 28j and 28k (magenta) with TG2 (indigo): (A) covalent adduct of (S)-chloride fragment

and TG2 showing hydrogen bonding interactions of carbonyl with Trp241 and Gln276; (B) covalent adduct of (R)-chloride fragment and TG2

showing lack of stabilization from Trp241 and Cys277.

amides 28a and 18d, with the adamantyl derivative 18d show-

ing a TG2 IC₅₀of 0.010 μM and 18-fold selectivity versus

FXIIIa. With large lipophilic groups as are present in 18d,

ligand efficiency becomes a concern relative to compounds such

as 17c and 28a; however, further transglutaminase profiling

revealed that 18d had superior selectivity across all isoforms.

Adamantylamide 18d was 340-fold selective for TG2 versus TG1

and >8000-fold selective for TG2 versus TG3, while it had a

1029

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

alkyl-substituted analogues 19a and 19b. These compounds

lack the terminal carbonyl but still bear a pendent phenyl sub-

stituent that could interact with the lipophilic region. These

were 3- to 4-fold less potent against TG2 than 16a, suggesting

the importance of a lipophilic group attached to a carbonyl

moiety or carbonyl mimetic for a productive interaction with

the lipophilic pocket.

Replacement of the Phenylene Moiety with Pyridine

and Pyrimidine. As a final chapter of the SAR investigation,

replacement of the phenylene moiety with 2-pyridin-5-yl and

2-pyrimidin-5-yl heterocycles was investigated (Table 8). Overall,

the pyrimidines 24a−d and pyrimidines 25a−c were approx-

imately equipotent for TG2 as their phenylene counterparts

14a, 16a, 18c, and 18d. Strikingly, selectivity versus FXIIIa

improved across the board with these changes, going from a

maximum of 18-fold selectivity for 18d to 145- and 175-fold

for 24d and 25c, respectively. Rationalizing these selectivity

findings using our FXIIIa homology model would be pure

speculation, as the residues that are expected to stabilize the

binding interactions, Trp241 and Gln276, are conserved

between TG2 and FXIIIa. While encouraged by the improved

selectivity, concern was mounting that increased electronega-

tivity of the acrylamide might render it unacceptably reactive

toward other biological nucleophiles. To investigate, the half-

lives of three respective compounds, 14a (phenylene), 24a

(2-pyridin-5-yl), and 25a (2-pyrimidin-5-yl), were determined

in the presence of 5 mM GSH as a prototypical biological nu-

cleophile.³¹The rate of disappearance of compound 14a with

glutathione was relatively low as indicated by an observed half-

life of >24 h. By comparison 24a and 25a reacted much more

rapidly, in line with the increased electronegativity of the

heterocycle, showing half-lives for the disappearance of parent

of 1 and 0.5 h, respectively. Although compounds like 24a

and 25a demonstrated that a high degree of selectivity for

inhibition of TG2 was possible, their reactivity in the presence

of glutathione severely restricted their utility.

Figure 10. Homology model of FXIIIa (magenta) overlaid on the

2Q3Z TG2 structure (green) with peptide ligand 1 (gray).

TG6 IC₅₀of 0.84 μM (84-fold selectivity). In addition, when

tested against mouse TG2, 18d showed an IC₅₀of 0.016 μM.

That no significant species difference was demonstrated for inhi-

bition of the mouse and human isoforms is important for poten-

tial in vivo efficacy studies, given that our HD models are mouse

models. If inhibition were significantly weaker in the mouse, higher

tissue exposure levels would be required to affect pharmacody-

namic and efficacy readouts.

A limited number of heterocyclic replacements intended to

probe the contribution of the carbonyl group of the terminal

lipophilic acyl moiety to transglutaminase activity were also

investigated (Table 7). Pyridin-2-yl analogues 14b−f showed

improved potency versus 16a, with 3-methylpyridin-2-yl 14c

having TG2 IC₅₀of 0.025 μM and 14-fold selectivity against

FXIIIa. The requirement of the carbonyl or a carbonyl mimetic

for potent inhibition of TG2 and selectivity over FXIIIa was

underscored by comparison of unsubstituted phenyl 14g and

2-trifluoromethylphenyl 14h with pyridines 14b and 14e, re-

spectively, which were 3- to 4-fold more potent against TG2.

The significance of the carbonyl was further underscored by

Cell Lysate Activity of TG2 Inhibitors. We had previously

developed a cellular assay measuring transamidation based on

incorporation of radioactive putrescine in HEK cells stably

expressing TG2 (HEK-TG2).²⁷Our inability to show potent

(IC₅₀< 1 μM) inhibition of transamidation in this cell line with

highly potent irreversible inhibitors from numerous chemical

classes,²⁷including those from the present study, was cause for

a

Table 5. Effect of Phenyl Substituents on Transglutaminase Activity

R₁

R₂

compd

TG2 IC₅₀SD (μM)

TG1 IC₅₀(μM)

TG3 IC₅₀(μM)

FXIIIa IC₅₀(μM)

Boc

Cbz

Boc

Cbz

Boc

H

14a

16a

29a

29b

29c

29d

29e

29f

0.12 0.00

0.12 0.05

76 21

4.9

3.7

14

>80

69

0.43

0.42

>80

2-N(CH₃)CH₂CH(CH₃)₂

2-F

13

4

20

16

3-OCH₃

3-CH₃

3-CF₃

3-F

2.5 0.1

0.91 0.12

0.18 0.00

0.19

19

0.74

0.21

0.039

0.051

0.066

6.5

1.4

2.4

0.95

3-Cl

29g

0.11 0.06

a

Values accompanied by standard deviation were averaged from at least two independent experiments; they were otherwise obtained in a single

determination.

1030

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

a

Table 6. TG2 Activity and Selectivity of Selected Carbamates, Ureas, and Amides

a

Values accompanied by standard deviation were averaged from at least two independent experiments; they were otherwise obtained in a single

determination. NT = not tested.

serious concern (data not shown). Additionally, establishing a

potency rank ordering from the assay was made impossible,

since the IC₅₀values obtained were all in the range of 5−20 μM

regardless of biochemical potency. In unsuccessful attempts

to address this we investigated variables such as Ca²⁺concentra-

tion, substrate, and compound incubation times. In addition

to our HEK-TG2 cellular assay, also without success, we (1)

employed a striatal cell line expressing mutant huntingtin as a

“stressor”, (2) attempted to exploit the finding that TG2 inhibi-

tion results in protection from 3-nitropropionic acid mediated

toxicity,⁴⁰(3) employed an assay in SH-SY5Y cells using en-

dogenously expressed TG2,⁴¹and (4) attempted to measure

the effect of TG2 activity on formation of γ-Glu-ε-Lys (GGEL).⁴²

Intractable technical issues were noted with several of these

alternatives.

compared to the whole cell assay, compounds displayed a

reasonable translation of biochemical potency to lysate potency,

and the correlation allowed them to be rank ordered. Notably,

the assay required 10 mM calcium ion concentration to observe

good translation. Reducing the calcium ion concentration by

10-fold begins to negatively affect potency (data not shown).

These results diminish concerns that compound-centric effects

such as nonspecific binding to cellular proteins or poor solubility

might be the root cause of weak activity in the whole cell assay

and show that the compounds have submicromolar potency in

a more complex assay system. While the translation and corre-

lation between biochemical and lysate were reasonable, the

physiological relevance of this assay is low; using it as a model

to help predict the exposure necessary for in vivo efficacy would

be inadvisable.

Unable to identify potent activity in a whole cell assay, we

took a step back and focused on developing a cell lysate model

from our HEK-TG2 cells as a surrogate. As shown in Table 9,

markedly improved potency was observed in cell lysates when

DMPK Profiling. Evaluation of druggability characteristics

continued with mouse plasma stability, Caco2 permeability,

and mouse liver microsomal profiling of selected compounds

(Table 10). In general, the compounds showed reasonable

1031

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

Table 7. TG2 Activity and Selectivity of Selected Aryl,

Heteroaryl, and Alkyl Substituted Piperazines

Table 8. Transglutaminase Activity of Pyridinylacrylamides

and Pyrimidinylacrylamides

a

Values accompanied by standard deviation were averaged from at

least two independent experiments; they were otherwise obtained in a

single determination. NT = not tested.

a

Values accompanied by standard deviation were averaged from at

a

Table 9. HEK-TG2 Cellular Lysate Activity

least two independent experiments; they were otherwise obtained in a

single determination.

TG2

IC₅₀

HEK-TG2

compd

(μM)

lysate IC₅₀(μM) (HEK-TG2 lysate IC₅₀)/(TG2 IC₅₀)

protein binding, low solubility, and low to moderate Caco2

permeability. From this short survey the phenylacrylamides

16n, 15, 18c, 18d, and 28a had plasma half-lives of more than

2 h. The pyridines and pyrimidine (24a, 24c, and 25a) had

plasma half-lives on the order of 30 min or less. While we

cannot be certain of the cause of the shorter plasma half-lives of

these compounds, shorter half-lives could have been predicted

from their half-lives in the presence of 5 mM glutathione.

Evidence in support of the acrylamide amide linkage as the site

of metabolic instability was then obtained by testing the plasma

stability of the aniline analogue 30 of cyclopropylamide 18c.

Aniline 30 showed no indication of metabolism over 24 h and

appeared stable indefinitely in mouse plasma. This putative

metabolite was determined to be inactive, as expected, when

tested against TG2 at 80 μM. Compounds with reasonable

plasma stability were progressed to mouse liver microsomal

stability studies. Unfortunately, the results of these tests sug-

gested that with the exception of 15, all compounds were

predicted to be rapidly cleared in vivo.

26

4.5

32

7

10g

16m

16k

14a

14f

1.9

20.3

3.2

11

7

0.46

0.22

5.0

23

5

0.12

0.62

1.8

0.076

0.070

0.046

0.044

0.041

0.037

0.034

0.032

0.026

0.025

0.010

24

43

35

25

20

35

38

17

40

77

16q

16o

16aa

17d

17c

18b

28a

17b

14c

18d

3.0

1.6

1.1

0.81

0.36

1.2

0.45

0.99

0.77

a

Values accompanied by standard deviation were averaged from at

least two independent experiments; they were otherwise obtained in a

single determination.

CONCLUSIONS

■

had TG2 IC₅₀of 10 nM and had 18, 84, 340, and >8000-fold

selectivity against FXIIIa, TG6, TG1, and TG3, respectively.

We further demonstrated that the compounds were stable in

DMSO solution over the course of the selectivity evaluation,

establishing that the observed selectivity was not an artifact of

compound handling. To establish the relevance of compound

IC₅₀values for what are time-dependent inhibitors, a correlation

Evidence for direct covalent binding of screening hit 7d at

Cys277 of TG2 was obtained through inhibition studies with

wild type and mutant forms of TG2. Using the published open-

form X-ray crystal structure and with the aid of various com-

putational models, we improved on the TG2 potency of 7d by

over 2 orders of magnitude while improving selectivity for other

transglutaminase isoforms. Notable in this regard is 18d, which

1032

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

a

Table 10. DMPK Profile of Selected Inhibitors

b

TG2 IC₅₀

(μM)

aq sol.

(mg/mL)

Hu PPB (%

unbound)

PSA

(Å²)

cLogP Caco2 P_app(A−B) Caco2 P_app(B−A) mouse plasma

mLM Cl_int

−1

compd

pH 7

(nm s⁻¹)

T_1/2(min)

(mL min⁻¹kg⁻¹)

(L h⁻¹kg )

16n

15

0.072

1.3

0.01

1.04

0.05

0.01

0.05

0.04

0.25

0.07

1.8

2

96

3.9

NT

0

NT

9

126

162

209

248

305

31.5

33.5

14.3

>240

2465

<50.8

119.9 68.8

3203

228.7

NT

148

4

79

1.0

<3.0

7.2 4.1

192

18c

18d

28a

24a

24c

25a

30

0.11

11

2

87

1.2

65

115

193

97

0.010

0.032

0.097

0.18

87

3.2

102

136

NT

11

7

87

1.62

2.1

13.7

NT

96

NT

108

99

NT

6

0.26

2.1

NT

0.026

>80

108

84

NT

0.71

NT

a

Values accompanied by standard deviation were averaged from at least two independent experiments; they were otherwise obtained in a single

b

determination. Human plasma protein binding. NT = not tested.

N-terminal His-tag, generating the plasmid pET28a:hTG2. Muta-

genesis of TG2 to generate the C285A point mutation was performed

using a Quikchange kit (Stratagene). Complementary primers that in-

clude sequences flanking the site of the mutation (C285A_sense,

CGCCGCCGTGGCCGCCACAGTGCTGAGG; C285A_antisense,

CCTCAGCACTGTGGCGGCCACGGCGGCG) were used in a

mutagenesis reaction according to the manufacturer’s instructions,

using pET28a:hTG2 as template DNA, yielding the plasmid

pET28a:TG2_C285A.

was established between these values and the irreversible inhibi-

tion constants for several transglutaminase isoforms, with the

finding that the IC₅₀values are an accurate means to rank-order

compound potency and selectivity.

In a cellular lysate assay a reasonable translation of bio-

chemical activity to lysate potency was achieved and IC₅₀< 1 μM

was observed for several compounds; however, this assay

required a nonphysiologically high Ca²⁺concentration. Addi-

tionally, DMPK profiling showed that the compounds have

relatively poor solubility, poor to moderate permeability, and

poor plasma stability, this last deficit being attributed to the

labile acrylamide amide linkage. The phenylacrylamides dis-

played low reactivity in the presence of GSH, belying their

acrylamide functionality.

Our inability to potently inhibit TG2 transamidation in

whole cells using irreversible inhibitors has caused us to re-

evaluate our effort. Efficacy end points in HD mouse models

require 6 months or more of dosing. To manage risk in running

such trials and to facilitate interpretation of results, it is imper-

ative that compounds possess cellular activity and pharmaco-

kinetic exposure levels in brain to cover, preferentially, some

multiple of the cellular activity. This is to facilitate the modula-

tion of pharmacodynamic markers needed to demonstrate in

vivo target engagement. Given the weak cellular potency and

poor plasma stability, it is unlikely that any of the inhibitors

described would have adequate brain exposure to test our

hypothesis. For this to occur, a better understanding of intra-

cellular TG2 biology is likely needed, and perhaps only then

can a physiologically meaningful transamidation-dependent

cellular assay readout be validated. Such an assay is needed to

facilitate compound selection for DMPK and in vivo studies.

Since our current understanding of the biology is limiting in

HD, we are continuing in our efforts to deepen this under-

standing while working to address the plasma stability issue. We

will report our findings in due course. While these studies are

ongoing, the current inhibitors may represent attractive agents

for studies of TG2’s role in cancer or celiac disease.

The constructs were transformed into E. coli Rosetta 2 (DE3) cells,

and cells were grown overnight at 37 °C in 6 L of 2xYT medium con-

taining 50 μg/mL kanamycin. The cells were grown to OD₆₀₀= 0.6

before addition of 100 μM isopropyl-β-^D-thiogalactopyranoside to

induce expression at 20 °C overnight. The cells were harvested by

centrifugation, flash frozen in liquid nitrogen, thawed at 37 °C, and

resuspended in 90 mL of lysis buffer (50 mM potassium phosphate,

pH 8.0, 300 mM NaCl, and 1 EDTA-free protease inhibitor tablet

(Roche)) plus 4 μL of 250 U/μL benzonase (Merck) at 4 °C. Lysis

was achieved using 5 × 30 s bursts of sonication on ice. The lysate was

then centrifuged at 28000g and the supernatant recovered. The sample

was loaded onto a column of 5 mL of TALON resin at 2 mL/min and

eluted with 50 mM potassium phosphate, pH 8.0, 150 mM imidazole.

Fractions were collected and loaded onto a 1 mL anion exchange

column at 4 mL/min in 20 mM Tris, pH 7.2, 1 mM DTT, and 1 mM

EDTA and eluted using a 1 M NaCl gradient. Selected fractions were

loaded onto a Superdex 200, 26/60 gel filtration column pre-equilibrated

in buffer (20 mM Tris, pH 7.2, 150 mM NaCl, 1 mM DTT, and 1 mM

EDTA) at 2.4 mL/min. The pure fractions were verified by SDS−PAGE

and pooled. Complex formation with 7d was done as previously

described.¹⁴Briefly, 50 molar excess of CHDI-00201241 was

incubated with 5 mg of pure TG2 in incubation buffer (20 mM

Tris-HCl, pH 7.2, 1 mM DTT, 1 mM EDTA, 150 mM NaCl, 10 mM

CaCl₂) at room temperature for 30 min and then at 4 °C overnight.

Fractions were loaded onto a second 1 mL anion exchange column at

4 mL/min in 20 mM Tris, pH 7.2, 1 mM DTT, and 1 mM EDTA and

eluted using a 1 M NaCl gradient. Selected fractions were pooled.

The full length mouse TG2 (Met-1 to Ala-686) PCR product was

subcloned into the vector pETIJ-HV (Evotec in-house vector) using

the EcoRI and Not I restriction sites for expression in E. coli incor-

porating an N-terminal His-tag. The construct was transformed into

E. coli Rosetta 2 (DE3) cells, and cells were grown overnight at 37 °C

in 6 L of 2xYT medium containing 50 μg/mL kanamycin. The cells

were grown to OD₆₀₀= 0.6 before addition of 500 μM isopropyl-β-D-

thiogalactopyranoside to induce expression at 25 °C overnight. The

cells were harvested by centrifugation, flash frozen in liquid nitrogen,

thawed at 37 °C, and resuspended in 80 mL of lysis buffer (50 mM

potassium phosphate, pH 8.0, 300 mM NaCl, and 1 non-EDTA

EXPERIMENTAL SECTION

■

Cloning, Expression, and Purification of Transglutaminases.

The full length (Met-1 to Ala-687) human TG2 PCR product was

subcloned into the pET28a vector (Novagen) using the Nde I and

Hind III restriction sites for expression in E. coli, incorporating an

1033

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

protease inhibitor tablet (Roche)) plus 4 μL of 250 U/μL benzonase

(Merck) at 4 °C. Lysis was achieved by five steps of 30 s sonication

on ice. The lysate was centrifuged at 16 500 rpm for 60 min using a

Beckman Avanti 30 centrifuge and an F0850 rotor and the supernatant

recovered. The sample was loaded onto a 5 mL TALON column at

2 mL/min and eluted with 50 mM potassium phosphate, pH 8.0,

150 mM imidazole. Fractions were collected and loaded onto a 1 mL

anion exchange column at 4 mL/min in 20 mM Tris, pH 7.2, 1 mM

DTT, and 1 mM EDTA and eluted using a 1 M NaCl gradient.

Selected fractions were loaded onto a Superdex 200, 26/60 gel filtra-

tion column pre-equilibrated in buffer (50 mM potassium phosphate,

pH 8.0, 300 mM NaCl) at 2.0 mL/min. The pure fractions were

analyzed using SDS−PAGE and pooled.

Additionally, human TG1, human TG3, human TG6, and human

factor XIIIa were purchased from Zedira (Darmstadt, Germany).

Transamidation Inhibition Assays for Recombinant TG and

TG2 HEK Cell Lysates. The fluorescent transamidation assay was

performed as described.²⁷In summary, 8 μM N,N-dimethylated casein

(NMC) and 16 μM dansyl-labeled amine nucleophile (KxD) were

used as substrates in 25 mM Hepes, pH 7.4, 250 mM NaCl, 2 mM

MgCl₂, 10 mM CaCl₂, 0.2 mM DTT, and 0.05% Pluronic F-127 at

37 °C. A kinetic measurement was recorded (Safire or Ultra, Tecan;

excitation, 350 nm; emission, 535 nm), and the reaction velocity

derived from a linear fit was used as a measure for enzyme activity. All

data points were normalized between 0% and 100% inhibition using

the appropriate positive (full inhibition) and negative (no inhibition)

controls. IC₅₀values were determined using an automated in-house

data evaluation software package by means of a hyperbolic binding

model with a variable Hill slope. Assay conditions were similar for

recombinant TG isoforms TG2 (human and mouse), TG1, and TG6

apart from CaCl₂concentrations, which were adjusted at half-maximal

transamidation activity (0.5 mM for hTG2 and TG6; 0.2 mM for

mTG2; 0.05 mM for TG1), and enzyme concentrations (20 nM hTG2

and TG6, 5 nM mTG2, 10 nM TG1). Factor XIII was activated using

0.1 μg/μL thrombin (Sigma) in 35 mM Tris, pH 8.0, for 20 min at

30 °C, and the transamidation reaction was performed with 20 nM

factor XIIIa in 50 mM Tris, pH 8.0, 1.25 mM CaCl₂, 0.05% Pluronic

F-127, 0.2 mM DTT. TG3 was activated with 0.02 μg/μL thrombin

under the same conditions as factor XIII, and assay conditions were

10 nM TG3 in 50 mM Hepes, pH 8.0, 20 mM CaCl₂, 0.2 mM DTT,

0.05% Pluronic F-127.

For the lysate assay, HEK cells engineered to express human TG2

were cultured as previously described.²⁷Cellular lysates were prepared

by washing cultured cells twice with ice-cold PBS and harvesting them

with a rubber policeman. The cells were then pelleted by centrifuga-

tion and lysed in 10 mM Tris-HCl, pH 7.5, 10 mM CaCl₂, 1 mM EDTA,

1 mM PMSF with protease inhibitors (Roche protease inhibitor cocktail)

followed by sonication using a Branson Sonifier 450 with 50 pulses (duty

cycle 20, output control 6). The protein content was determined using

the Bradford method, and 1.5 μg/μL total protein was used in the

fluorescent transamidation assay as described above.

MALDI ToF MS Analysis. Mass spectometry analyses were

performed using a Voyager-DE PRO BioSpectrometry workstation

(matrix assisted laser desorption ionization time-of-flight mass

spectrometer, PerSeptive Biosystems). Intact apoprotein and protein

complexes with assumed covalent binders were measured following a

sample workup procedure. An amount of 2 μL of the protein solution

(1 μg/μL protein in 20 mM Tris buffer, pH 7.2, 1 mM DTT, 1 mM

EDTA, 150 mM NaCl) was placed on a nitrocellulose membrane filter

(Millipore, 9004-70-O) and dialyzed against 100 mL of deionized

water. After 30 min 1 μL of the sample was taken and mixed with 1 μL

of sinapinic acid solution (hydroxycinnamic acid, supernatant of a

10 mg/mL solution in 70% acetonitrile, 30% proteomics grade water,

and 0.1% TFA) used as a matrix. Resulting samples were placed on a

MALDI target plate and allowed to cocrystallize through evaporation

at room temperature. Measurements were performed in linear detec-

tion mode in the mass range of 10 000 to 100 000 Da. Data analysis

was performed using Data Explorer, version 4.0.0, data analysis soft-

ware (PerSeptive Biosystems). For analysis of the potentially modified

amino acid residues a tryptic digestion of the apoprotein with the

protein inhibitor complexes was performed. An amount of 100 μL of

each sample (1 μg/μL protein in 20 mM Tris buffer, pH 7.2, 1 mM

DTT, 1 mM EDTA, 150 mM NaCl) was acidified with 1 μL of

100 mM HCl, and 5 μL of a 1 mg/mL mass spectrometry grade trypsin

solution (Sigma) was added. Following an overnight incubation at

37 °C the reaction was terminated by addition of 100 μL of acetonitrile.

Samples were subsequently evaporated under reduced pressure and

redissolved in 10 μL of water. To remove remaining buffer salts inter-

fering with the sample ionization, all samples were desalted using

ZipTip μ-C18 desalting tips (Millipore). Final MALDI samples were

prepared by mixing 1 μL of the desalted digest with 1 μL of α-cyano-4-

hydroxycinnamic acid (supernatant of a 10 mg/mL solution in 70%

acetonitrile, 30% proteomics grade water, and 0.1% TFA). Spectra

were recorded in linear detection mode in the mass range of 500−

5000 Da. For data analysis expected peptide fragments were compared

with experimentally determined m/z values.

Molecular Docking Procedures. The X-ray structure data of

TG2 with peptide ligand 1 covalently bound (PDB code 2Q3Z) were

used for docking. The structure was prepared by removing all water

molecules and the peptide ligand. Hydrogen atoms were added where

needed, and the protonation state of charged residues was adjusted to

reflect their state at pH7 using the Protonate 3D tool implemented in

the MOE molecular modeling package (Chemical Computing Group

Inc.). Amino acid residues within 13 Å of the sulfur atom of Cys277

were defined as the binding site. The docking was accomplished using

the covalent docking option of the GOLD docking software (version

4.0 or 4.1).⁴³A covalent link for use with individual ligands was used in

this work wherein both the protein and the ligand incorporate the

linking sulfur atom of Cys277. This required that the structures of the

ligands be prepared as their corresponding thiol addition products

with one open valence at the sulfur. Other settings were set at the

default values. The bound structure of peptide ligand 1 to TG2 was

reproduced with satisfactory accuracy (rmsd of Cα of 0.68 Å).

Computational Method for FMO Calculation. All the

molecular modeling work necessary for preparation of the input

structures for the FMO calculations was carried out in the MOE

molecular modeling package. TG2−peptide ligand 1 complex structure

was prepared based on the published X-ray data (PDB code 2Q3Z). A

truncated partial structure of the TG2−peptidic ligand 1 complex was

prepared by selecting the amino acid residues within 4 Å from 1.

The new C-terminals created by truncation were modeled as

N-methylamides, and acetyl groups were added to the N-terminals.

Hydrogen atoms were added, and the protonation state of the acidic

and basic amino acid residues were adjusted at pH 7 using the Protonate

3D tool within MOE. The positions of the hydrogen atoms in the com-

plex were optimized using the MMFF94x force field in the presence of

the Born continuous water model while fixing the coordinates of the

heavy atoms. The protein was fragmented using a one-fragment-per-

residue fragmentation scheme, and the peptide ligand was fragmented

similarly into five sections as shown in Figure 3. The FMO calculations

in this work were performed using GAMESS software (April 2008

version)⁴⁴at the MP2/6-31G** theory level. The calculations were run

on PC clusters consisting of 24−40 CPU cores. The input files were

prepared using Facio software^45,46after preprocessing of the structure in

MOE.

Homology Model Construction. The sequences of human TG1

(P22735), TG3 (Q08188), and FXIII (P00488) were retrieved from

the Swiss-Protein Database. All of the molecular modeling studies

were carried out using the MOE software. The structure of TG2

deposited in the protein data bank (PDB code 2Q3Z) was used as the

structure template for homology model construction. Ten models

were constructed for each transglutaminase isoform, and the models

with the lowest Coulomb and generalized Born⁴⁷interaction energies

were further optimized using force field energy minimization followed

by short molecular dynamics (MD) simulations (simulated annealing).

The coordinates of the α-carbons of the amino acids were fixed during

the MD simulations.

General Synthetic Procedures. Commercially available reagents

and solvents (HPLC grade) were used without further purification. ¹H

NMR spectra were recorded on a Bruker DRX 500 MHz spectrometer

1034

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

1

or Bruker DPX 250 MHz spectrometer in deuterated solvents, and ¹³

C

M + H); H NMR (500 MHz, DMSO) 10.21 (s, 1H), 7.68−7.61

(m, 2H), 7.19−7.11 (m, 2H), 6.42−6.23 (m, 2H), 5.74−5.71 (m, 1H);

¹³C NMR (126 MHz, DMSO-d₆) δ 163.1, 158.1 (d, J = 249 Hz),

135.4, 131.7, 127.0, 121.1, 115.4 (d, J = 22 Hz).

NMR spectra were recorded on a Bruker DPX 250 MHz spectrometer

equipped with a B-VT 3300 variable temperature controller unit (high

temperature only) and a four nucleus (QNP) switchable probe for

1

2

observation of H, ¹³C, ¹⁹F, ³¹P with H lock in deuterated solvents.

Chemical shifts (δ) are in parts per million. Thin-layer chromatog-

raphy (TLC) analysis was performed with Kieselgel 60 F₂₅₄(Merck)

plates and visualized using UV light.

N-[4-(Pyrrolidine-1-sulfonyl)phenyl]acrylamide (10g). MS

(ES⁺) m/z (M + 1) 281; HRMS (ES+) m/z 281.0950 (281.0960

calcd for C₁₃H₁₆N₂O₃S, M + H); ¹H NMR (500 MHz, DMSO) 10.56

(s, 1H), 7.84−7.96 (m, 2H), 7.77 (d, J = 8.67 Hz, 2H), 6.41−6.52

(m, 1H), 6.28−6.38 (m, 1H), 5.84 (d, J = 9.93 Hz, 1H), 3.12 (t, J =

6.62Hz, 4H), 1.59−1.71 (m, 4H); ¹³C NMR (126 MHz, DMSO-d₆) δ

163.7, 143.0, 131.4, 130.2, 128.6, 128.1, 119.2, 47.8, 24.7.

Analytical HPLC−MS was performed on Shimadzu LCMS-2010EV

systems using reverse phase Atlantis dC18 columns (3 μm, 2.1 mm ×

50 mm), gradient 5−100% B (A = water/0.1% formic acid, B =

acetonitrile/0.1% formic acid) over 3 min, injection volume of 3 μL,

flow of 1.0 mL/min. UV spectra were recorded at 215 nm using a

Waters 2788 dual wavelength UV detector. Mass spectra were ob-

tained over the range m/z 150−850 at a sampling rate of 2 scans per

second using Waters LCT or analytical HPLC−MS on Shimadzu

LCMS-2010EV systems using reverse phase Water Atlantis dC18

columns (3 μm, 2.1 mm × 100 mm), gradient 5−100% B (A = water/

0.1% formic acid, B = acetonitrile/0.1% formic acid) over 7 min,

injection volume of 3 μL, flow of 0.6 mL/min. UV spectra were

recorded at 215 nm using a Waters 2996 photodiode array. Data were

integrated and reported using Shimadzu PsiPort software. Accurate

mass measurement was carried out using a Waters Micromass LCT

Premier orthogonal acceleration time-of-flight mass spectrometer

4 GHz TDC with LockSpray enable. All compounds display purity

of >95% as determined by this method, unless stated otherwise.

N-(4-Bromophenyl)acrylamide (7d). 4-Bromoaniline (0.3 g,

1.74 mmol) was dissolved in THF (5 mL). To this was added

diisopropylethylamine (0.5 mL, 5.2 mmol) in one portion followed by

the dropwise addition of acryloyl chloride (0.19 mL, 1.91 mmol), and

the mixture was stirred at room temperature under a nitrogen atmo-

sphere for 3 h. The THF was removed under vacuum, and the

resulting crude material was diluted with DCM (20 mL) and washed

sequentially with NaOH (1 M solution, 10 mL), HCl (1 M solution,

10 mL), and brine (10 mL) before being dried (MgSO₄), filtered, and

concentrated to give the title compound (0.34 g, 90% yield) as a white

powder. MS (ES⁺) m/z (M + 1) 228; HRMS (ES+) m/z 225.9859

(225.9868 calcd for C₉H₈BrNO, M + H); ¹H NMR (500 MHz,

DMSO) 10.28 (s, 1H), 7.59−7.71 (m, 2H), 7.46−7.56 (m, 2H), 6.35−

6.48 (m, 1H), 6.22−6.32 (m, 1H), 5.69−5.84 (m, 1H); ¹³C NMR

(126 MHz, DMSO-d₆) δ 163.2, 138.4, 131.6, 127.3, 121.2, 115.1.

Ethenesulfonic Acid (4-Bromophenyl)amide (10a). MS (ES⁺)

m/z (M + 1) 263; δ_H(500 MHz, DMSO-d₆) 7.41−7.55 (2H, m),

7.03−7.14 (2H, m), 6.77 (dd, J = 16.39, 9.93 Hz, 1H), 5.97−6.17 (2H, m).

N-(4-Bromophenyl)propionamide (10b). MS (ES⁺) m/z (M + 1)

230; HRMS (ES+) m/z 228.0034 (228.0024 calcd for C₉H₁₀BrNO,

M + H); ¹H NMR (500 MHz, DMSO) 9.98 (s, 1H) 7.58 (d, J = 9.92

Hz, 2H), 7.48 (d, J = 9.92 Hz, 2H), 2.28 (q, J = 6.2 Hz, 2H), 1.04

(t, J = 6.2 Hz, 3H); ¹³C NMR (126 MHz, DMSO-d₆) δ 172.2, 138.7,

131.5, 120.9, 114.4, 29.5, 9.6.

N-[4-Methanesulfonylphenyl]acrylamide (10h). MS (ES⁺)

m/z (M + 1) 226; HRMS (ES+) m/z 226.0544 (226.0538 calcd for

C₁₀H₁₁NO₃S, M + H); ¹H NMR (500 MHz, DMSO) 9.70 (br s, 1H),

6.89−7.08 (m, 4H), 5.49−5.65 (m, 1H), 5.35−5.46 (m, 1H), 4.94 (dd,

J = 10.09, 1.89 Hz, 1H), 2.23−2.29 (m, 3 H); ¹³C NMR (126 MHz,

DMSO-d₆) δ 163.9, 143.7, 135.1, 131.5, 128.4, 119.3, 44.0.

N-[4-Nitrophenyl]acrylamide (10i). MS (ES⁺) m/z (M + 1) 193;

HRMS (ES+) m/z 193.0622 (193.0613 calcd for C₉H₈N₂O₃, M + H);

¹H NMR (500 MHz, DMSO) 10.76 (s, 1H), 8.19−8.30 (m, 2H),

7.86−7.97 (m, 2H), 6.30−6.55 (m, 2H), 5.87 (dd, J = 10.09, 1.73 Hz,

1 H); ¹³C NMR (126 MHz, DMSO-d₆) δ 163.9, 145.2, 142.4, 131.2,

128.6, 125.0, 119.1.

N-[4-Trifluoromethylphenyl]acrylamide (10j). MS (ES⁺) m/z

(M + 1) 216; HRMS (ES+) m/z 216.0627 (216.0636 calcd for

1

C₁₀H₈F₃NO, M + H); H NMR (500 MHz, DMSO) 10.50 (s, 1H),

7.88 (d, J = 8.51 Hz, 2H), 7.70 (d, J = 8.51 Hz, 2H), 6.41−6.52

(m, 1H), 6.23−6.38 (m, 1H), 5.83 (dd, J = 10.09, 1.89 Hz, 1H); ¹³C NMR

(126 MHz, DMSO-d₆) δ 163.66, 142.59, 131.46, 127.94, 126.15,

125.46, 123.35, 119.26.

N-Phenylacrylamide (10k). MS (ES⁺) m/z (M + 1) 148; HRMS

(ES+) m/z 148.0772 (148.0762 calcd for C₉H₉NO, M + H); ¹H NMR

(500 MHz, DMSO) 10.13 (s, 1H), 7.68−7.63 (m, 2H), 7.32−7.29

(m, 2H), 7.08−7.04 (m, 1H), 6.42−6.23 (m, 2H), 5.81−5.78 (m, 1H);

¹³C NMR (126 MHz, DMSO-d₆) δ 163.2, 139.0, 131.9, 128.8, 126.9,

123.5, 119.3.

N-[4-Toluyl]acrylamide (10l). MS (ES⁺) m/z (M + 1) 162;

HRMS (ES+) m/z 162.0923 (162.0919 calcd for C₁₀H₁₁NO, M + H);

¹H NMR (500 MHz, DMSO) 10.05 (s, 1H), 7.55 (d, J = 8.35 Hz,

2H), 7.06−7.17 (m, 2H), 6.42 (dd, J = 17.02, 10.09 Hz, 1H), 6.24 (dd,

J = 17.02, 2.05 Hz, 1H), 5.67−5.79 (m, 1H), 2.21−2.31 (m, 3H); ¹³

C

NMR (126 MHz, DMSO-d₆) δ 162.9, 136.5, 132.4, 132.0, 129.2,

126.6, 119.3, 20.5.

N-[4-Phenoxyphenyl]acrylamide (10m). MS (ES⁺) m/z

(M + 1) 240; HRMS (ES+) m/z 240.1032 (240.1025 calcd for

1

C₁₅H₁₃NO₂, M + H); H NMR (500 MHz, DMSO) 10.56 (s, 1H),

7.68−7.64 (m, 2H), 7.33−7.31 (m, 2H), 7.11−7.08 (m, 1H), 7.01−

6.95 (m, 4H), 6.52−6.28 (m, 2H), 5.72 (m, 1H).

N-[4-Methoxyphenyl]acrylamide (10n). MS (ES⁺) m/z (M + 1)

178; HRMS (ES+) m/z 178.0876 (178.0868 calcd for C₁₀H₁₁NO₂,

N-(4-Bromobenzyl)acrylamide (10c). MS (ES⁺) m/z (M + 1)

241, 243; HRMS (ES+) m/z 240.0027 (240.0024 calcd for

1

M + H); H NMR (500 MHz, DMSO) 10.02 (s, 1H), 8.07 (s, 1H),

1

C₁₀H₁₀BrNO, M + H); H NMR (500 MHz, DMSO) 7.79 (br s,

7.34−7.57 (m, 4H), 6.40 (dd, J = 17.02, 10.09 Hz, 1H), 6.22 (dd, J =

17.02, 1.89 Hz, 1H), 5.64−5.79 (m, 1H), 3.33 (br s, 4H), 1.77−1.90

(m, 4H); ¹³C NMR (126 MHz, DMSO-d₆) δ 162.7, 155.4, 132.2,

132.0, 126.3, 120.8, 113.9, 55.2.

4-[4-(2-Fluoroacryloylamino)benzenesulfonyl]piperazine-1-

carboxylic Acid tert-Butyl Ester (28c). MS (ES⁺) m/z (M + 23)

436; HRMS (ES+) m/z 314.0973 (314.0975 calcd for C₁₈H₂₄FN₃O₅S,

M + H, loss of tert-butyl); ¹H NMR (500 MHz, DMSO) 10.71

(s, 1H), 8.01 (d, J = 8.80 Hz, 2H), 7.72 (d, J = 8.80 Hz, 2H), 5.68−

5.86 (m, 1H), 5.51 (dd, J = 15.59, 3.85 Hz, 1H), 2.83 (t, J = 4.68 Hz,

4H), 1.33 (s, 9H); ¹³C NMR (126 MHz, DMSO-d₆) δ 157.4 (d, J =

192.5 Hz), 154.5, 153.4, 142.3, 129.7, 128.7, 120.5, 100.9 (d, J = 14.7

Hz), 79.3, 45.8, 27.9.

1H), 6.61−6.73 (m, 2H), 6.38 (d, J = 8.39 Hz, 2H), 5.37−5.49

(m, 1H), 5.22−5.33 (m, 1H), 4.79 (dd, J = 10.07, 2.14 Hz, 1H), 3.47

(d, J = 6.10 Hz, 2H); ¹³C NMR (126 MHz, DMSO-d₆) δ 164.7, 138.8,

131.5, 131.2, 129.6, 125.6, 119.9, 41.5.

N-(3-Bromophenyl)acrylamide (10d). MS (ES⁺) m/z (M + 1)

227, 229; HRMS (ES+) m/z 225.9877 (225.9868 calcd for C₉H₈BrNO,

1

M + H); H NMR (500 MHz, DMSO) 10.31 (s, 1H), 8.05 (s, 1H),

7.62−7.52 (m, 1H), 7.30−7.22 (m, 2H), 6.48−6.24 (m, 2H), 5.83−5.78

(m, 1H); ¹³C NMR (126 MHz, DMSO-d₆) δ 163.4, 140.6, 131.5, 130.8,

127.6, 126.1, 121.6, 118.1.

N-(2-Bromophenyl)acrylamide (10e). MS (ES⁺) m/z (M + 1)

227, 229; δ_H(500 MHz, DMSO-d₆) 8.84 (1H, br s), 6.75−6.87 (2H, m),

6.55 (td, J = 7.67, 1.45 Hz, 1H), 6.32 (td, J = 7.71, 1.68 Hz, 1H), 5.74

(dd, J = 17.01, 10.30 Hz, 1H), 5.43 (dd, J = 17.01, 1.91 Hz, 1H),

4.86−5.01 (1H, m).

4-[4-(2-Methylacryloylamino)benzenesulfonyl]piperazine-1-

carboxylic Acid tert-Butyl Ester (28d). MS (ES⁺) m/z (M + 23)

432; δ_H(500 MHz, DMSO-d₆) 10.24 (1H, s), 7.97 (d, J = 8.80 Hz,

2H), 7.69 (d, J = 8.62 Hz, 2H), 5.86 (1H, s), 5.61 (1H, s), 3.39 (4H,

br s), 2.82 (t, J = 4.68 Hz, 4H), 1.96 (3H, s), 1.34 (9H, s).

N-(4-Fluorophenyl)acrylamide (10f). MS (ES⁺) m/z (M + 1)

166; HRMS (ES+) m/z 166.0675 (166.0668 calcd for C₉H₈FNO,

1035

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

4-(4-But-2-enoylaminobenzenesulfonyl)piperazine-1-car-

boxylic Acid tert-Butyl Ester (28f). MS (ES⁺) m/z (M + 23) 432;

HRMS (ES+) m/z 310.1213 (310.1225 calcd for C₁₉H₂₇N₃O₅S, M + H,

loss of tert-butyl); ¹H NMR (500 MHz, CDCl₃) 7.61−7.81 (m, 4H), 7.42

(s, 1H), 6.92−7.16 (m, 1H), 5.98 (dd, J = 15.13, 1.56 Hz, 1H), 3.51

(t, J = 4.77 Hz, 4H), 2.96 (br s, 4H), 1.96 (dd, J = 6.88, 1.38 Hz, 3H), 1.42

(s, 9H); ¹³C NMR (126 MHz, DMSO-d₆) δ 167.4, 153.4, 143.6, 140.0,

128.6, 128.5, 121.0, 119.7, 79.3, 45.8, 27.9, 18.6.

4-[4-(2-Methylbut-2-enoylamino)benzenesulfonyl]-

piperazine-1-carboxylic Acid tert-Butyl Ester (28g). MS (ES⁺)

m/z (M + 23) 446; HRMS (ES+) m/z 324.1384 (324.1382 calcd for

C₂₀H₂₉N₃O₅S, M + H, loss of tert-butyl); ¹H NMR (500 MHz,

DMSO) 10.10 (s, 1H), 7.93 (d, J = 8.83 Hz, 2H), 7.64 (d, J = 8.83 Hz, 2H),

6.35−6.60 (m, 1H), 3.41−3.49 (m, 4H), 2.79 (t, J = 4.87 Hz, 4H),

1.70−1.86 (m, 6H), 1.28−1.43 (m, 9H); ¹³C NMR (126 MHz,

DMSO-d₆) δ 168.3, 153.4, 143.9, 132.4, 131.6, 128.6, 128.1, 119.5,

79.3, 45.8, 27.9, 13.9, 12.5.

for 18 h. After this time the reaction mixture was concentrated, and the

residue was purified using flash column chromatography (elution, 1%

methanol, 99% DCM) to give the title compound (0.06 g, 45% yield)

as a white powder. MS (ES⁺) m/z (M + 1) 260; HRMS (ES+) m/z

1

260.1390 (260.1399 calcd for C₁₄H₁₇N₃O₂, M + H); H NMR (500

MHz, DMSO) 10.02 (s, 1H), 8.07 (s, 1H), 7.37−7.56 (m, 4H), 6.40

(dd, J = 17.02, 10.09 Hz, 1H), 6.22 (dd, J = 17.02, 1.89 Hz, 1H),

5.64−5.81 (m, 1H), 3.28−3.35 (m, 4H), 1.75−1.93 (m, 4H); ¹³C

NMR (126 MHz, DMSO-d₆) δ 162.7, 154.0, 136.4, 133.1, 132.0,

126.3, 120.0, 119.5, 45.7, 25.0.

4-[4-(3-(Z)-Chloroacryloylamino)benzenesulfonyl]-

piperazine-1-carboxylic Acid tert-Butyl Ester (28j). 3-Chloroa-

crylic acid (0.12 g, 1.1 mmol) followed by pyridine (0.3 mL) was

added sequentially portionwise to a stirred solution of 4-(4-amino-

benzenesulfonyl)piperazine-1-carboxylic acid tert-butyl ester (0.1 g,

0.29 mmol) in THF/DMA (3:2, 5 mL) at room temperature. To this

mixture was added EDC (0.29 g, 1.5 mmol) in one portion, and the

mixture was stirred at room temperature under a nitrogen atmosphere

for 1 h. After this time the mixture was diluted with ethyl acetate (50 mL)

and washed with water (100 mL), saturated NaHCO₃(100 mL), and

HCl (100 mL, 2M). The organic layer was separated, dried (MgSO₄),

filtered, and concentrated under vacuum and the resulting residue was

purified using flash column chromatography (elution, 40% ethyl acetate,

60% heptane) to give the title compound (0.009 g, 5% yield) as a white

solid. MS (ES⁺) m/z (M + 23) 452; δ_H(250 MHz, DMSO-d₆) 10.66

(1H, s), 7.88 (d, J = 8.68 Hz, 2H), 7.69 (d, J = 8.68 Hz, 2H), 7.00 (d, J =

8.07 Hz, 1H), 6.57 (d, J = 7.77 Hz, 1H), 3.40−3.57 (4H, m), 2.77−2.89

(5H, m), 1.33 (10H, s).

4-[4-(3-(E)-Chloroacryloylamino)benzenesulfonyl]-

piperazine-1-carboxylic Acid tert-Butyl Ester (28k). MS (ES⁺)

m/z (M + 23) 452, 453; δ_H(250 MHz, DMSO-d₆) 10.65 (1H, br s),

7.83−7.92 (2H, 2), 7.69 (d, J = 8.83 Hz, 2H), 7.47 (1H, s), 6.63 (d, J =

13.10 Hz, 1H), 2.72−2.96 (6H, m), 1.32 (11H, s).

4-[4-(2-Oxopropionylamino)benzenesulfonyl]piperazine-1-

carboxylic Acid tert-Butyl Ester (28p). MS (ES⁺) m/z (M + 23)

434; δ_H(500 MHz, DMSO-d₆) 10.88 (1H, s), 8.09 (d, J = 8.80 Hz,

2H), 7.65−7.79 (3H, m), 3.44−3.50 (4H, m), 2.83 (t, J = 4.77 Hz,

4H), 2.44 (3H, s), 1.34 (9H, s).

4-[4-(3-Cyanomethylureido)benzenesulfonyl]piperazine-1-

carboxylic Acid tert-Butyl Ester (28l). Phosgene (20% solution in

toluene, 0.34 mL, 1.7 mmol) was added dropwise to a stirred solu-

tion of 4-(4-aminobenzenesulfonyl)piperazine-1-carboxylic acid tert-

butyl ester (0.18 g, 5.3 mmol) and diisopropylethylamine (0.18 mL,

6.4 mmol) in THF (5 mL) at room temperature. To this mixture was

added aminoacetonitrile (0.035 g, 6.4 mmol) in one portion, and the

mixture was stirred at room temperature under a nitrogen atmosphere

overnight. After this time the mixture was concentrated, diluted with

DCM (20 mL), and washed with water (10 mL), saturated NaHCO₃

(10 mL), and HCl (10 mL, 2 M solution). The organic layer was

separated, dried (MgSO₄), filtered, and concentrated under vacuum

and the resulting residue was purified using flash column chroma-

tography (elution, 70% DCM, 30% ethyl acetate) to give the title com-

pound (0.045 g, 20% yield) as a white solid. MS (ES⁺) m/z (M + 23)

446; HRMS (ES+) m/z 424.1646 (424.1655 calcd for C₁₈H₂₅N₅O₅S,

M + H); ¹H NMR (250 MHz, DMSO) 9.52 (s, 1H), 7.52−7.69

(m, 4H), 6.91 (t, J = 5.94 Hz, 1H), 4.13 (d, J = 5.79 Hz, 2H), 3.21−3.29

(m, 4H), 2.69−2.84 (m, 4H), 1.32 (s, 9H); ¹³C NMR (126 MHz,

DMSO-d₆) δ 154.4, 153.4, 144.5, 128.9, 126.6, 118.3, 117.6, 79.2, 45.8,

28.4, 27.9.

4-(4-Nitrobenzenesulfonyl)piperazine-1-carboxylic Acid

Benzyl Ester. Diisopropylethylamine (0.82 mL, 4.95 mmol) was

added in one portion to a stirred solution of piperazine-1-carboxylic

acid benzyl ester (1.0 g, 4.5 mmol) in DCM (10 mL) at room

temperature. To this mixture was added 4-nitrophenylsulfonyl chloride

(1.1 g, 4.95 mmol) in one portion, and the mixture was stirred at room

temperature under a nitrogen atmosphere for 1 h. After this time the

solvent was removed under vacuum and the resulting residue was

purified using flash column chromatography (elution, 70% heptane,

30% ethyl acetate) to give the title compound (1.82 g, 100% yield) as a

white solid. t_R= 1.43 min; MS (ES⁺) m/z (M + Na⁺) 428.

4-[4-(4,4,4-Trifluorobut-2-enoylamino)benzenesulfonyl]-

piperazine-1-carboxylic Acid tert-Butyl Ester (28h). MS (ES⁺)

m/z (M + 23) 486; HRMS (ES+) m/z 364.0939 (364.0943 calcd for

1

C₁₉H₂₄F₃N₃O₅S, M + H, loss of tert-butyl); H NMR (500 MHz,

DMSO) 11.00 (s, 1H), 7.91 (d, J = 8.62 Hz, 2H), 7.74 (d, J = 8.62 Hz,

2H), 6.86−7.09 (m, 2H), 3.40−3.45 (m, 4H), 2.84 (br s, 4H), 1.34

(s, 9H); ¹³C NMR (126 MHz, DMSO-d₆) δ 161.0, 153.4, 142.6, 132.7

(q, J = 6 Hz), 129.5, 129.0, 127.4 (q, J = 34 Hz), 123.0 (q, J = 270 Hz),

119.5, 79.4, 45.8, 43.0 (br), 42.0 (br), 27.9.

4-[4-(4,4,4-Trifluoro-3-methylbut-2-enoylamino)-

benzenesulfonyl]piperazine-1-carboxylic Acid tert-Butyl Ester

(28i). MS (ES⁺) m/z (M + 23) 500; HRMS (ES+) m/z 378.1096

1

(378.1099 calcd for C₂₀H₂₆F₃N₃O₅S, M + H, loss of tert-butyl); H

NMR (500 MHz, DMSO) 7.89 (d, J = 8.62 Hz, 2H), 7.72 (d, J = 8.80 Hz,

2H), 6.72 (s, 1H), 3.40−3.50 (m, 4H), 2.83 (t, J = 4.77 Hz, 4H), 2.25

(s, 3H), 1.34 (s, 9H); ¹³C NMR (126 MHz, DMSO-d₆) δ 162.7,

153.4, 142.8, 129.1, 129.0, 125.1 (q, J = 6 Hz), 119.2, 79.3, 45.7,

27.9, 11.7.

4-[4-(Ethoxycarbonylmethylamino)benzenesulfonyl]-

piperazine-1-carboxylic Acid tert-Butyl Ester (28m). MS (ES⁺)

m/z (M + 23) 450; δ_H(500 MHz, DMSO-d₆) 7.42 (d, J = 8.83 Hz,

2H), 7.02 (t, J = 6.23 Hz, 1H), 6.69 (d, J = 8.83 Hz, 2H), 4.13 (q, J =

7.09 Hz, 2H), 4.01 (d, J = 6.15 Hz, 2H), 3.39−3.42 (4H, m), 2.75

(t, J = 4.89 Hz, 4H), 1.35 (9H, s).

4-[4-(2-Cyanoacetylamino)benzenesulfonyl]piperazine-1-

carboxylic Acid tert-Butyl Ester (28o). MS (ES⁺) m/z (M + 23)

431; HRMS (ES+) m/z 309.1033 (309.1021 calcd for C₁₈H₂₄N₄O₅S,

M + H, loss of tert-butyl); ¹H NMR (250 MHz, DMSO) 10.74

(s, 1H), 7.60−7.86 (m, 4H), 3.97 (s, 2H), 3.38−3.46 (m, 4H), 2.73−2.87

(m, 4H), 1.32 (s, 9H); ¹³C NMR (126 MHz, DMSO-d₆) δ 162.0, 153.4,

142.7, 129.1, 129.0, 119.1, 115.6, 79.3, 45.7, 27.9, 27.1.

N-(4-Aminophenyl)acrylamide. N-[4-Nitrophenyl]acrylamide

(10i, 0.38 g, 1.98 mmol) was suspended in a 5:1 mixture of ethanol

and water (10 mL). To this solution was added iron powder (0.22 g,

4.00 mmol) followed by saturated ammonium chloride solution

(1 mL), and the mixture was heated to 80 °C for 3 h. After this time,

the reaction mixture was cooled to room temperature and filtered

through a pad of Celite. The Celite was washed with ethanol (10 mL)

and ethyl acetate (50 mL), and the solution was concentrated under

vacuum. The resulting residue was partitioned between DCM (50 mL)

and water (20 mL). The organic layer was separated, dried with MgSO₄,

filtered, and concentrated to afford the title compound (0.32 g, 99%

yield) as a white solid. MS (ES⁺) m/z (M + H)⁺163. δ_H(500 MHz,

DMSO-d₆) 9.73 (1H, s), 7.30 (d, J = 8.67 Hz, 2H), 6.47−6.58 (2H, m),

6.37 (dd, J = 17.02, 10.25 Hz, 1H), 6.16 (dd, J = 16.95, 1.81 Hz, 1H),

5.65 (dd, J = 10.09, 1.73 Hz, 1H), 4.90 (2H, br s).

Pyrrolidine-1-carboxylic Acid (4-Acryloylaminophenyl)-

amide (10o). Triphosgene (0.05 g, 0.17 mmol) was added in one

portion to a stirred solution of N-(4-aminophenyl)acrylamide (0.1 g,

0.57 mmol) and diisopropylethylamine (0.09 mL, 0.57 mmol) in THF

(5 mL), and the resulting mixture was stirred at room temperature

under a nitrogen atmosphere for 5 min. After this time pyrrolidine

(0.04 mL, 0.57 mmol) was added in one portion and the resulting

mixture was stirred at room temperature under a nitrogen atmosphere

1036

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

1

4-(4-Cyanobenzenesulfonyl)piperazine-1-carboxylic Acid

tert-Butyl Ester (28q). MS (ES⁺) m/z (M + 1) 252; HRMS (ES+)

m/z 252.0800 (252.0807 calcd for C₁₆H₂₁N₃O₄S, M + H, loss of tert-

butyl); ¹H NMR (500 MHz, DMSO) 8.14 (d, J = 8.25 Hz, 2H), 7.91

(d, J = 8.25 Hz, 2H), 3.39 (br s, 4H), 2.92 (t, J = 4.86 Hz, 4H), 1.35

(s, 9H); ¹³C NMR (126 MHz, DMSO-d₆) δ 153.3, 139.2, 133.7, 128.3,

117.7, 115.8, 79.4, 45.6, 27.9.

4-(4-Aminobenzenesulfonyl)piperazine-1-carboxylic Acid

Benzyl Ester. 4-(4-Nitro-benzenesulfonyl)piperazine-1-carboxylic

acid benzyl ester (1.82 g, 4.5 mmol) was suspended in a 5:1 mixture

of ethanol and water (30 mL). To this solution was added iron powder

(0.65 g, 11.7 mmol) followed by saturated ammonium chloride

solution (1 mL), and the mixture was heated to 80 °C for 3 h. After

this time, the reaction mixture was cooled to room temperature and

filtered through a pad of Celite, the Celite was washed with ethanol

(10 mL) and ethyl acetate (50 mL), and the solution was concentrated

under vacuum. The resulting residue was partitioned between DCM

(50 mL) and water (20 mL). The organic layer was separated, dried

with MgSO₄, filtered, and concentrated to afford the title com-

pound (1.5 g, 89% yield) as a white solid. t_R= 1.29 min; MS (ES⁺)

m/z (M + H)⁺376.

4-(4-Acryloylaminobenzenesulfonyl)piperazine-1-carboxylic

Acid Benzyl Ester (16a). 4-(4-Aminobenzenesulfonyl)piperazine-1-

carboxylic acid benzyl ester (0.25 g, 0.67 mmol) was dissolved in THF

(10 mL). To this was added diisopropylethylamine (0.33 mL, 1.9

mmol) in one portion followed by the dropwise addition of acryloyl

chloride (0.06 mL, 0.74 mmol), and the mixture was stirred at room

temperature under a nitrogen atmosphere for 3 h. The THF was

removed under vacuum and the resulting crude material was purified

using column chromatography (elution, 20% heptane, 80% ethyl acetate)

to give the title compound (57 mg, 20% yield) as a white powder. MS

(ES⁺) m/z (M + 1) 430; HRMS (ES+) m/z 430.1431 (430.1437 calcd

for C₂₁H₂₃N₃O₅S, M + H); ¹H NMR (500 MHz, DMSO) 10.60

(s, 1H) 7.92 (d, J = 8.70 Hz, 2H), 7.70 (d, J = 8.85 Hz, 2H), 7.18−7.44

(m, 5H), 6.41−6.52 (m, 1H), 6.27−6.38 (m, 1H), 5.84 (dd, J = 10.07,

1.83 Hz, 1H), 5.02 (s, 2H), 3.48 (br s, 4H), 2.87 (br s, 4H); ¹³C NMR

(126 MHz, DMSO-d₆) δ 163.8, 154.2, 143.4, 136.6, 131.4, 128.9,

128.6, 128.4, 128.2, 127.9, 127.6, 119.2, 66.5, 45.7, 42.8.

M + H); H NMR (500 MHz, DMSO) 10.54 (s, 1H), 7.84−8.00

(m, 3H), 7.78 (d, J = 8.70 Hz, 2H), 7.22−7.42 (m, 5H) 6.40−6.52

(m, 1H), 6.23−6.37 (m, 1H), 5.83 (d, J = 10.07 Hz, 1H), 5.02 (d, J =

11.44 Hz, 2H), 3.66 (d, J = 3.66 Hz, 1H), 3.19−3.27 (m, 1H), 3.00−

3.15 (m, 1H), 1.83−1.97 (m, 1H), 1.62−1.79 (m, 1H).

3-(4-Acryloylaminobenzenesulfonylamino)-(R)-pyrrolidine-

1-carboxylic Acid Benzyl Ester (16e). MS (ES⁺) m/z (M + 23)

430; HRMS (ES+) m/z 430.1434 (430.1437 calcd for C₂₁H₂₃N₃O₅S,

1

M + H); H NMR (500 MHz, DMSO) 9.73 (br s, 1H), 7.09 (d, J =

8.62 Hz, 2H), 6.93 (d, J = 8.44 Hz, 2H), 6.36−6.64 (m, 7H), 5.43−

5.70 (m, 2H), 5.01 (dd, J = 10.18, 1.56 Hz, 1H), 3.98−4.27 (m, 2H),

3.03 (sxt, J = 5.94 Hz, 1H), 2.11−2.47 (m, 4H), 1.09 (dq, J = 13.18,

6.79 Hz, 1H), 0.83 (dq, J = 12.56, 6.20 Hz, 1H); ¹³C NMR (126 MHz,

DMSO-d₆) δ 163.7, 155.6, 143.1, 136.8, 131.4, 129.9, 128.6, 128.4,

128.1, 127.9, 119.1, 65.4, 52.9, 50.1, 46.2, 30.2.

5-(4-Acryloylaminobenzenesulfonyl)hexahydropyrrolo[3,4-

c]pyrrole-2-carboxylic Acid Benzyl Ester (16f). MS (ES⁺) m/z

(M + 1) 456; HRMS (ES+) m/z 456.1585 (456.1593 calcd for

1

C₂₃H₂₅N₃O₅S, M + H); H NMR (250 MHz, DMSO) 9.74 (s, 1 H),

7.02−7.15 (m, 2 H), 6.87−6.98 (m, 2 H), 6.37−6.61 (m, 5 H), 5.40−

5.71 (m, 2 H), 4.92−5.07 (m, 1 H), 4.06−4.25 (m, 2 H), 2.59 (d, J =

7.01 Hz, 2 H), 2.43 (d, J = 7.31 Hz, 2 H), 2.16 (d, J = 8.68 Hz, 4 H),

1.85−2.03 (m, 2 H); ¹³C NMR (126 MHz, DMSO-d₆) δ 163.7, 153.7,

143.2, 137.0, 131.4, 129.3, 128.8, 128.4, 128.1, 127.8, 127.4, 119.1,

65.8, 52.0, 50.0, 49.4, 41.6, 40.7.

{2-[(4-Acryloylaminobenzenesulfonyl)methylamino]ethyl}-

methylcarbamic Acid Benzyl Ester (16g). MS (ES⁺) m/z (M + 1)

432; δ_H(500 MHz, CDCl₃) 7.72−7.56 (5H, m), 7.31−7.18 (5H, m),

6.44−6.15 (2H, m), 5.77−5.72 (1H, m), 5.06 (2H, s), 3.45−3.36 (2H, m),

3.16−3.03 (2H, m), 2.94−2.91 (3H, m), 2.74 (3H, s), 2.55 (2H, s).

5-(4-Acryloylaminobenzenesulfonyl)-2,5-diazabicyclo-

[2.2.1]heptane-2-carboxylic Acid tert-Butyl Ester (16h). MS

(ES⁺) m/z (M + 23) 430; δ_H(500 MHz, CDCl₃) 7.86−7.77 (4H, m),

7.58 (1H, s), 6.51−6.25 (2H, m), 5.86 (d, J = 10.2 Hz, 1H), 4.47 (2H, s),

3.51−3.13 (4H, m), 1.74−1.66 (1H, m), 1.46−1.24 (1H, m).

N-[4-(4-Pyridin-2-ylpiperazine-1-sulfonyl)phenyl]acrylamide

(14b). MS (ES⁺) m/z (M + 1) 373; HRMS (ES+) m/z 373.1351

1

(373.1334 calcd for C₁₈H₂₀N₄O₃S, M + H); H NMR (500 MHz,

4-(4-Acryloylaminobenzenesulfonyl)piperazine-1-carboxylic

Acid tert-Butyl Ester (14a). MS (ES⁺) m/z (M + 23) 418; HRMS

(ES+) m/z 418.1400 (418.1413 calcd for C₁₈H₂₅N₃O₅SNa, M + Na);

¹H NMR (500 MHz, DMSO) 10.60 (br s, 1H), 7.92 (d, J = 8.67 Hz,

2H), 7.70 (d, J = 8.67 Hz, 2H), 6.27−6.54 (m, 2H), 5.84 (dd, J =

10.17, 1.50 Hz, 1H), 3.38−3.45 (m, 4H), 2.83 (t, J = 4.65 Hz, 4H),

1.36 (s, 9H); ¹³C NMR (126 MHz, DMSO-d₆) δ 163.7, 153.4, 143.3,

131.3, 128.9, 128.6, 128.1, 119.1, 79.3, 45.7, 43.0, 41.9, 27.9.

3-(4-Acryloylaminobenzenesulfonylamino)-(S)-pyrrolidine-

1-carboxylic Acid Benzyl Ester (16b). MS (ES⁺) m/z (M + 1) 430;

HRMS (ES+) m/z 430.1441 (430.1437 calcd for C₂₁H₂₃N₃O₅S, M + H);

¹H NMR (500 MHz, DMSO) 10.54 (s, 1H), 7.92 (d, J = 8.65 Hz,

1H), 7.85 (d, J = 8.65 Hz, 2H), 7.76 (d, J = 8.65 Hz, 2H), 7.39−7.26

(m, 5H), 6.50−6.27 (m, 2H), 5.83 (d, J = 1.52 Hz, 2H), 5.02 (d, J =

1.52 Hz, 2H), 3.71−3.62 (m, 1H), 3.34 (obscured, 2H), 3.28−3.21

(m, 1H), 3.11−3.04 (m, 1H), 1.91−1.84 (m, 1H), 1.72−1.61 (m, 1H);

¹³C NMR (126 MHz, DMSO-d₆) δ 163.7, 153.8, 142.6, 137.0, 134.9,

131.4, 119.2, 119.1, 65.8, 52.3, 51.5, 51.3, 50.8, 44.0, 43.5, 31.3, 30.5.

3-(4-Acryloylaminobenzenesulfonylamino)-(S)-pyrrolidine-

1-carboxylic Acid Benzyl Ester (16c). MS m/z (M + 1) 430;

HRMS (ES+) m/z 430.1449 (430.1437 calcd for C₂₁H₂₃N₃O₅S, M + H);

¹H NMR (500 MHz, DMSO) 9.72 (s, 1H), 7.08 (d, J = 8.54 Hz, 2H),

6.92 (d, J = 8.39 Hz, 2H), 6.44−6.58 (m, 6H), 5.57−5.70 (m, 1H),

5.42−5.54 (m, 1H), 5.00 (dd, J = 10.15, 1.60 Hz, 1H), 3.94−4.25

(m, 2H), 3.02 (sxt, J = 5.92 Hz, 1H), 2.27−2.46 (m, 3H), 2.19 (dd, J =

10.15, 4.65 Hz, 1H), 1.02−1.10 (m, 1H), 0.76−0.89 (m, 1H), 0.38−

0.51 (m, 1H); ¹³C NMR (126 MHz, DMSO-d₆) δ 163.9, 155.8, 143.3,

137.0, 131.6, 130.1, 128.8, 128.5, 128.3, 128.1 (two peaks), 119.3, 65.6,

53.0, 50.3, 46.4, 30.4.

CDCl₃) 8.15 (dd, J = 4.58, 1.47 Hz, 1H), 7.69−7.81 (m, 4H), 7.44−

7.58 (m, 2H), 6.58−6.69 (m, 2H), 6.50 (d, J = 16.87 Hz, 1H), 6.27

(dd, J = 16.87, 10.27 Hz, 1H), 5.86 (d, J = 10.27 Hz, 1H), 3.60−3.71

(m, 4H), 3.08−3.17 (m, 4H); ¹³C NMR (126 MHz, DMSO-d₆) δ

163.7, 158.3, 147.5, 143.3, 137.7, 131.4, 128.9, 128.6, 128.2, 119.2,

113.6, 107.5, 45.6, 44.0.

N-{4-[4-(3-Methylpyridin-2-yl)piperazine-1-sulfonyl]phenyl}-

acrylamide (14c). MS (ES⁺) m/z (M + 1) 387; HRMS (ES+) m/z

1

387.1480 (387.1491 calcd for C₁₉H₂₂N₄O₃S, M + H); H NMR (500

MHz, CDCl₃) 8.11−8.16 (m, 1H), 7.73−7.85 (m, 4H), 7.58 (s, 1H),

7.40 (d, J = 6.97 Hz, 1H), 6.88 (dd, J = 7.15, 4.95 Hz, 1H), 6.51 (dd,

J = 16.87, 0.92 Hz, 1H), 6.29 (dd, J = 16.87, 10.27 Hz, 1H), 5.80−5.93

(m, 1H), 3.11−3.33 (m, 8H), 2.19 (s, 3H); ¹³C NMR (126 MHz,

DMSO-d₆) δ 163.8, 160.4, 145.0, 143.3, 139.4, 131.4, 129.0, 128.8,

128.2, 124.4, 119.2, 118.4, 48.5, 46.0, 17.7.

N-{4-[4-(6-Methylpyridin-2-yl)piperazine-1-sulfonyl]phenyl}-

acrylamide (14d). MS (ES⁺) m/z (M + 1) 387; HRMS (ES+) m/z

1

387.1494 (387.1491 calcd for C₁₉H₂₂N₄O₃S, M + H); H NMR (500

MHz, CDCl₃) 7.69−7.82 (m, 4H), 7.60 (s, 1H), 7.37 (dd, J = 8.22,

7.46 Hz, 1H), 6.44−6.55 (m, 2H), 6.39 (d, J = 8.38 Hz, 1H), 6.20−

6.34 (m, 1H), 5.85 (dd, J = 10.13, 1.29 Hz, 1H), 3.58−3.69 (m, 4H),

3.06−3.16 (m, 4H), 2.37 (s, 3H); ¹³C NMR (126 MHz, DMSO-d₆) δ

163.7, 157.8, 155.8, 143.3, 138.0, 131.4, 128.9, 128.6, 128.2, 119.2,

112.7, 104.2, 45.6, 43.9, 24.2.

N-{4-[4-(3-Trifluoromethylpyridin-2-yl)piperazine-1-

sulfonyl]phenyl}acrylamide (14e). MS (ES⁺) m/z (M + 1) 441;

HRMS (ES+) m/z 441.1220 (441.1208 calcd for C₁₉H₁₉F₃N₄O₃S,

M + H); ¹H NMR (500 MHz, CDCl₃) 8.38−8.48 (m, 1H), 7.71−7.90

(m, 5H), 7.48 (s, 1H), 7.04 (dd, J = 7.70, 4.77 Hz, 1H), 6.51 (d, J =

16.69 Hz, 1H), 6.28 (dd, J = 16.87, 10.27 Hz, 1H), 5.87 (d, J = 10.64 Hz,

1H), 3.31−3.41 (m, 4H), 3.11−3.24 (m, 4H); ¹³C NMR (126 MHz,

DMSO-d₆) δ 163.8, 158.8, 151.7, 143.4, 137.7 (q, J = 5 Hz), 131.4,

3-(4-Acryloylaminobenzenesulfonylamino)-(R)-pyrrolidine-

1-carboxylic Acid Benzyl Ester (16d). MS (ES⁺) m/z (M + 23)

430; HRMS (ES+) m/z 430.1435 (430.1437 calcd for C₂₁H₂₃N₃O₅S,

1037

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

129.0, 128.7, 128.2, 123.8 (q, J = 273 Hz), 119.2, 118.7, 116.1 (q, J =

31 Hz), 49.9, 45.9.

(500 MHz, DMSO-d₆) 10.66 (1H, s), 8.62 (1H, br s), 7.96 (d, J = 8.67 Hz,

2H), 7.76 (d, J = 8.67 Hz, 2H), 6.41−6.54 (1H, m), 6.28−6.39

(1H, m), 5.86 (dd, J = 10.17, 1.50 Hz, 1H), 3.15−3.25 (4H, m), 3.08

(4H, br s).

N-{4-[4-(6-Trifluoromethylpyridin-3-yl)piperazine-1-

sulfonyl]phenyl}acrylamide (14f). MS (ES⁺) m/z (M + 1) 441; δ_H

(500 MHz, MeOD) 8.33 (1H, s), 7.91 (d, J = 8.85 Hz, 2H), 7.68−7.81

(m, 3H), 6.88 (d, J = 9.16 Hz, 1H), 6.34−6.52 (2H, m), 5.83 (dd, J =

8.62, 3.13 Hz, 1H), 3.70−3.83 (4H, m), 3.05−3.14 (4H, m).

N-[4-(4-Phenylpiperazine-1-sulfonyl)phenyl]acrylamide

(14g). MS (ES⁺) m/z (M + 1) 372; HRMS (ES+) m/z 372.1377

4-Benzyloxycarbonylaminopiperidine-1-carboxylic Acid

tert-Butyl Ester. Diisopropylethylamine (0.9 mL, 5.5 mmol) was

added in one portion to a stirred solution of 4-aminopiperidine-1-

carboxylic acid tert-butyl ester (1.0 g, 5.0 mmol) in THF (10 mL) at

room temperature. To this mixture was added benzyl chloroformate

(0.78 mL, 5.5 mmol) dropwise, and the mixture was stirred at room

temperature under a nitrogen atmosphere for 18 h. After this time the

mixture was diluted with ethyl acetate (50 mL) and washed with water

(100 mL), saturated NaHCO₃(100 mL), and HCl (100 mL, 2M).

The organic layer was separated, dried (MgSO₄), filtered, and con-

centrated under vacuum. The resulting residue was purified using flash

column chromatography (elution, 50% heptane, 50% ethyl acetate) to

give the title compound (1.2 g, 73% yield) as a colorless oil. MS (ES⁺) m/z

(M + 23) 357.

Piperidin-4-ylcarbamic Acid Benzyl Ester. HCl (10 mL, 4 M

solution in dioxane) was added in one portion to a stirred solution of

4-benzyloxycarbonylaminopiperidine-1-carboxylic acid tert-butyl ester

(1.2 g, 3.6 mmol) in dioxane (5 mL), and the suspension was stirred at

room temperature under a nitrogen atmosphere for 3 h. After this time

the mixture was concentrated under vacuum and the resulting solid

was collected by filtration, washed with TBME (3 × 100 mL), and

dried under vacuum to give the title compound (0.74 g, 88% yield) as

a white solid. MS (ES⁺) m/z (M + 1) 236.

[1-(4-Nitrobenzenesulfonyl)piperidin-4-yl]carbamic Acid

Benzyl Ester. Diisopropylethylamine (1.04 mL, 7.0 mmol) was

added in one portion to a stirred solution of piperidin-4-yl-carbamic

acid benzyl ester (0.74 g, 3.1 mmol) in THF (10 mL) at room

temperature. To this mixture was added 4-nitrophenylsulfonyl chloride

(0.77 g, 3.5 mmol) in one portion, and the mixture was stirred at room

temperature under a nitrogen atmosphere for 1 h. After this time the

solvent was removed under vacuum and the resulting residue was

partitioned between ethyl acetate (50 mL) and HCl (50 mL, 1 M

solution). The organic layer was separated and washed with brine

(50 mL) before being dried (MgSO₄), filtered, and concentrated

under vacuum. The resulting white solid was suspended in heptane,

collected by filtration, and washed with water (50 mL), heptane

(50 mL), and TBME (50 mL) before being dried under vacuum to

afford the title compound (1.3 g, 100% yield) as a white solid. MS

(ES⁺) m/z (M + 1) 420.

[1-(4-Aminobenzenesulfonyl)piperidin-4-yl]carbamic Acid

Benzyl Ester. [1-(4-Nitrobenzenesulfonyl)piperidin-4-yl]carbamic

acid benzyl ester (1.3 g, 3.5 mmol) was suspended in a 5:1 mixture

of ethanol and water (30 mL). To this solution was added iron powder

(0.48 g, 9.1 mmol) followed by saturated ammonium chloride solu-

tion (1 mL), and the mixture was heated to 80 °C for 3 h. After this

time, the reaction mixture was cooled to room temperature and

filtered through a pad of Celite, the Celite was washed with ethanol

(10 mL) and ethyl acetate (50 mL), and the solution was concentrated

under vacuum. The resulting residue was partitioned between DCM

(50 mL) and water (20 mL). The organic layer was separated, dried

with MgSO₄, filtered, and concentrated to afford the title compound

(1.25 g, 99% yield) as a brown solid. MS (ES⁺) m/z (M + 1) 390.

[1-(4-Acryloylaminobenzenesulfonyl)piperidin-4-yl]-

carbamic Acid Benzyl Ester (16k). [1-(4-Aminobenzenesulfonyl)-

piperidin-4-yl]carbamic acid benzyl ester (1.29 g, 3.3 mmol) was

dissolved in DCM (20 mL). To this was added diisopropylethylamine

(1.64 mL, 9.9 mmol) in one portion followed by the dropwise addition

of acryloyl chloride (0.3 mL, 3.6 mmol), and the mixture was stirred at

room temperature under a nitrogen atmosphere for 18 h. The THF

was removed under vacuum and the resulting crude material was

purified using preparative HPLC to give the title compound (10.4 mg,

1% yield) as a white powder. MS (ES⁺) m/z (M + 1) 444; δ_H(250

MHz, DMSO-d₆) 10.56 (1H, s), 7.89 (d, J = 8.83 Hz, 2H), 7.68 (d, J =

8.68 Hz, 2H), 7.20−7.42 (m6H, m), 6.19−6.56 (2H, m), 5.74−5.90

(1H, m), 4.96 (2H, s), 3.40−3.50 (2H, m), 2.40 (2H, br s), 1.78 (d,

J = 9.59 Hz, 2H), 1.26−1.53 (2H, m).

1

(372.1382 calcd for C₁₉H₂₁N₃O₃S, M + H); H NMR (500 MHz,

DMSO) 10.59 (s, 1H), 7.94 (d, J = 8.70 Hz, 2H), 7.75 (d, J = 8.70 Hz,

2H), 7.20 (t, J = 7.93 Hz, 2H), 6.90 (d, J = 8.09 Hz, 2H), 6.80 (t, J =

7.25 Hz, 1H), 6.40−6.51 (m, 1H), 6.25−6.35 (m, 1H), 5.84 (dd, J =

10.07, 1.68 Hz, 1H), 3.16−3.25 (m, 4H), 2.95−3.05 (m, 4H); ¹³C

NMR (126 MHz, DMSO-d₆) δ 163.7, 150.4, 143.4, 131.4, 129.0,

128.5, 128.2, 119.7, 119.2, 116.2, 47.9, 45.8.

N-{4-[4-(2-Trifluoromethylphenyl)piperazine-1-sulfonyl]-

phenyl}acrylamide (14h). MS (ES⁺) m/z (M + 1) 440; HRMS

1

(ES+) m/z 440.1273 (440.1256 calcd for C₂₀H₂₀F₃N₃O₃S, M + H); H

NMR (500 MHz, DMSO) 7.72−7.90 (m, 4H), 7.47−7.65 (m, 3H),

7.35 (d, J = 7.89 Hz, 1H), 7.21−7.30 (m, 3H), 6.52 (d, J = 16.87 Hz,

1H), 6.30 (dd, J = 16.87, 10.27 Hz, 1H), 5.88 (d, J = 10.27 Hz, 1H),

3.17 (br s, 4H), 3.01 (t, J = 4.77 Hz, 4H).

N-{4-[4-(3-Phenylpropyl)piperazine-1-sulfonyl]phenyl}-

acrylamide (19a). MS (ES⁺) m/z (M + 1) 415; HRMS (ES+) m/z

1

414.1844 (414.1851 calcd for C₂₂H₂₇N₃O₃S, M + H); H NMR (500

MHz, DMSO) 10.59 (s, 1H), 7.93 (d, J = 8.70 Hz, 2H), 7.70 (d, J =

8.70 Hz, 2H), 7.05−7.30 (m, 5H), 6.41−6.53 (m, 1H), 6.26−6.37

(m, 1H), 5.84 (dd, J = 10.15, 1.60 Hz, 1H), 2.86 (br s, 4H), 2.53−2.56

(m, 2H), 2.35−2.46 (m, 4H), 2.26 (t, J = 7.10 Hz, 2H), 1.65 (quin, J =

7.36 Hz, 2H); ¹³C NMR (126 MHz, DMSO-d₆) δ 163.7, 143.3, 142.0,

131.4, 128.9, 128.6, 128.3, 128.2, 125.6, 119.1, 56.5, 51.6, 45.9, 32.7,

28.0.

N-{4-[4-(4-Phenylbutyl)piperazine-1-sulfonyl]phenyl}-

acrylamide (19b). MS (ES⁺) m/z (M + 1) 428; δ_H(250 MHz,

DMSO-d₆) 9.75 (1H, s), 7.09 (d, J = 8.68 Hz, 2H), 6.86 (d, J = 8.83 Hz,

2H), 6.22−6.47 (5H, m), 5.39−5.76 (2H, m), 4.88−5.08 (1H, m),

1.93−2.09 (4H, m), 1.33−1.58 (6H, m), 0.32−0.75 (5H, m).

4-[4-Acryloylamino-3-(isobutylmethylamino)-

benzenesulfonyl]piperazine-1-carboxylic Acid Benzyl Ester

(29a). MS (ES⁺) m/z (M + 1) 515; HRMS (ES+) m/z 515.2345

1

(515.2328 calcd for C₂₆H₃₄N₄O₅S, M + H); H NMR (500 MHz,

DMSO) 9.32 (s, 1H), 7.56 (d, J = 8.80 Hz, 1H), 7.25−7.41 (m, 5H),

7.00 (dd, J = 8.99, 2.93 Hz, 1H), 6.89 (d, J = 2.93 Hz, 1H), 6.49 (dd,

J = 17.06, 10.27 Hz, 1H), 6.21 (dd, J = 17.06, 1.47 Hz, 1H), 5.74 (d,

J = 10.09 Hz, 1H), 5.04 (s, 2H), 3.41 (br s, 4H), 3.17 (d, J = 7.15 Hz,

2H), 2.85−3.02 (m, 8H), 1.98 (dquin, J = 13.58, 6.83, 6.83, 6.83, 6.83 Hz,

1H), 0.79−0.95 (m, 7H); ¹³C NMR (126 MHz, DMSO-d₆) δ 163.7,

154.1, 146.7, 136.6, 131.9, 129.2, 128.9, 128.4, 127.9, 127.6, 126.8, 122.8,

116.4, 110.7, 66.5, 59.4, 45.1, 42.9 (br), 26.8, 20.1.

4-[4-(Acryloylmethyl-amino)benzenesulfonyl]piperazine-1-

carboxylic Acid tert-Butyl Ester (26). Sodium hydride (0.050 g,

26 mmol) was added in one portion to a stirred solution of 4-(4-

acryloylaminobenzenesulfonyl)piperazine-1-carboxylic acid tert-butyl

ester (14a, 0.1 g, 0.25 mmol) in THF (1 mL). The mixture was

stirred at room temperature for 5 min before methyl iodide (0.05 g,

0.25 mmol) was added in one portion, and stirring continued for 1 h.

After this time, the reaction mixture was concentrated under vacuum

and the resulting residue purified using preparative HPLC to give the

title compound (6.6 mg, 7% yield) as a white solid. MS (ES⁺) m/z

(M + 23) 432; δ_H(500 MHz, MeOD) 7.69−7.82 (2H, m), 7.33−7.50

(2H, m), 6.01−6.27 (2H, m), 5.50−5.61 (1H, m), 3.41 (4H, br s),

3.29 (3H, s), 2.90 (t, J = 5.04 Hz, 4H), 1.31 (9H, s).

N-[4-(Piperazine-1-sulfonyl)phenyl]acrylamide (15). Tri-

fluoroacetic acid (3 mL) was added in one portion to a solution of

4-(4-acryloylaminobenzenesulfonyl)piperazine-1-carboxylic acid tert-

butyl ester (3, 1.23 g, 3.11 mmol) in DCM (6 mL). The resulting mix-

ture was stirred at room temperature for 2 h under a nitrogen atmo-

sphere, after which time, the mixture was concentrated under vacuum

to give the title compound (0.9 g, 98% yield) as an orange foam which

was used without further purification. MS (ES⁺) m/z (M + 1) 296; δ_H

1038

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

[1-(4-Acryloylaminobenzenesulfonyl)piperidin-4-ylmethyl]-

carbamic Acid Benzyl Ester (16i). MS (ES⁺) m/z (M + 1) 458; δ_H

(500 MHz, DMSO-d₆) 10.57 (1H, s), 7.90 (d, J = 8.70 Hz, 2H), 7.69

(d, J = 8.70 Hz, 2H), 7.22−7.40 (6H, m), 6.41−6.53 (1H, m), 6.22−

6.38 (1H, m), 5.84 (dd, J = 10.07, 1.68 Hz, 1H), 4.96−5.02 (2H, m),

3.59 (d, J = 11.60 Hz, 2H), 2.86 (t, J = 6.26 Hz, 2H), 2.18 (t, J = 11.06 Hz,

2H), 1.67 (d, J = 11.75 Hz, 2H), 1.33 (d, J = 10.68 Hz, 1H), 1.05−1.20

(2H, m).

filtered through a pad of Celite. The Celite was washed with ethanol

(10 mL) and ethyl acetate (50 mL), and the solution was concentrated

under vacuum. The resulting residue was partitioned between DCM

(50 mL) and water (20 mL). The organic layer was separated, dried

with MgSO₄, filtered, and concentrated to afford the title compound

(1 g, 100% yield) as a brown solid. MS (ES⁺) m/z (M + 1) 390.

4-(4-Acryloylaminobenzenesulfonylamino)piperidine-1-car-

boxylic Acid Benzyl Ester (16l). 4-(4-Aminobenzenesulfonyl-

amino)piperidine-1-carboxylic acid benzyl ester (1 g, 2.4 mmol) was

dissolved in THF (10 mL). To this was added diisopropylethylamine

(1.27 mL, 7.2 mmol) in one portion followed by the dropwise addition

of acryloyl chloride (0.2 mL, 2.6 mmol), and the mixture was stirred at

room temperature under a nitrogen atmosphere for 3 h. The THF was

removed under vacuum and the resulting crude material was purified

using column chromatography (elution, 40% heptane, 60% ethyl acetate)

to give the title compound (89 mg, 8% yield) as a white powder. MS

(ES⁺) m/z (M + 1) 444; HRMS (ES+) m/z 444.1603 (444.1593 calcd

for C₂₂H₂₅N₃O₅S, M + H); ¹H NMR (500 MHz, DMSO) 10.58

(s, 1H), 7.70−7.95 (m, 5H), 7.28−7.47 (m, 5H), 6.30−6.58 (m, 2H),

5.84−5.97 (m, 1H), 5.10 (s, 2H), 3.84 (d, J = 13.43 Hz, 2H), 3.13−

3.26 (m, 1H), 2.95 (d, J = 7.17 Hz, 2H), 1.63 (dd, J = 12.89, 3.13 Hz,

2H), 1.17−1.39 (m, 2H); ¹³C NMR (126 MHz, DMSO-d₆) δ 163.6,

154.3, 142.4, 136.9, 136.1, 131.4, 128.4, 128.0, 127.8, 127.5, 119.1,

66.1, 49.7, 42.0, 32.0.

4-[(4-Acryloylaminobenzenesulfonylamino)methyl]-

piperidine-1-carboxylic Acid Benzyl Ester (16j). MS (ES⁺) m/z

(M + 1) 458; HRMS (ES+) m/z 458.1738 (458.1750 calcd for

1

C₂₃H₂₇N₃O₅S, M + H); H NMR (500 MHz, DMSO) 9.66 (s, 1H),

6.86−7.05 (m, 4H), 6.71 (t, J = 6.18 Hz, 1H), 6.40−6.58 (m, 6H),

5.54−5.68 (m, 1H), 5.40−5.50 (m, 1H), 4.98 (dd, J = 10.07, 1.83 Hz,

1H), 4.20 (s, 2H), 3.11 (d, J = 13.28 Hz, 2H), 1.70−2.02 (m, 4H),

0.59−0.83 (m, 3H), 0.11 (qd, J = 12.21, 4.27 Hz, 2H); ¹³C NMR

(126 MHz, DMSO-d₆) δ 163.8, 154.5, 142.5, 137.2, 135.0, 131.6, 128.6,

128.1, 128.0, 127.8, 127.7, 119.3, 66.2, 47.9, 43.5, 35.8, 29.1.

4-(4-Acryloylaminobenzenesulfonyl)[1,4]diazepane-1-car-

boxylic Acid Benzyl Ester (16m). MS (ES⁺) m/z (M + 1) 444; δ_H

(500 MHz, DMSO-d₆) 10.55 (1H, s), 7.83−7.93 (2H, m), 7.75 (dd,

J = 8.47, 4.65 Hz, 2H), 7.26−7.40 (5H, m), 6.23−6.51 (2H, m), 5.72−

5.86 (2H, m), 4.94−5.11 (2H, m), 3.51 (dt, J = 11.71, 5.82 Hz, 2H),

3.41 (d, J = 8.39 Hz, 3H), 1.67−1.78 (2H, m).

4-(3-Acryloylaminobenzenesulfonyl)piperazine-1-carboxylic

Acid Benzyl Ester (16n). MS (ES⁺) m/z (M + 1) 430; HRMS (ES+)

N-[4-(4-Cyclopentanecarbonylpiperazine-1-sulfonyl)-

phenyl]acrylamide (28a). Diisopropylethylamine (0.24 mL, 1.36

mmol) was added in one portion to a stirred solution of N-[4-

(piperazine-1-sulfonyl)phenyl]acrylamide (15, 0.1 g, 0.34 mmol) in

THF (5 mL). The mixture was stirred at room temperature for 5 min

before cyclopentanecarbonyl chloride (0.06 g, 0.44 mmol) was added

dropwise, and the resulting mixture was stirred at room temperature

under a nitrogen atmosphere for 18 h. The crude reaction mixture was

concentrated under vacuum and the residue was purified using

preparative HPLC to give the title compound (0.012 g, 11% yield) as a

white powder. MS (ES⁺) m/z (M + 1) 392; HRMS (ES+) m/z

1

m/z 430.1432 (430.1437 calcd for C₂₁H₂₃N₃O₅S, M + H); H NMR

(500 MHz, DMSO) 10.55 (s, 1H), 8.15 (s, 1H), 7.94 (d, J = 8.25 Hz,

1H), 7.61 (t, J = 7.98 Hz, 1H), 7.42 (d, J = 7.70 Hz, 1H), 7.25−7.35

(m, 5H), 6.27−6.48 (m, 2H), 5.83 (dd, J = 10.09, 1.65 Hz, 1H), 5.02

(s, 2H), 3.49 (br s, 4H), 2.90 (br s, 4H); ¹³C NMR (126 MHz,

DMSO-d₆) δ 163.6, 154.2, 139.9, 136.6, 135.2, 131.4, 130.1, 128.4,

127.9, 127.6, 123.6, 122.2, 117.7, 66.5, 45.7, 42.8.

4-(4-Nitrobenzenesulfonylamino)piperidine-1-carboxylic

Acid tert-Butyl Ester. 4-Nitrophenylsulfonyl chloride (1.1 g,

5.4 mmol) was added in one portion to a stirred solution of

4-aminopiperidine-1-carboxylic acid tert-butyl ester (1.0 g, 4.9 mmol)

and diisopropylethylamine (1.3 mL, 7.3 mmol) in THF (10 mL). The

resulting mixture was stirred at room temperature under a nitrogen

atmosphere for 1 h, after which time the solvent was removed under

vacuum to give the title compound (1.92 g, 100% yield) as an orange

solid which was used without further purification. MS (ES⁺) m/z (M +

23) 408.

1

392.1649 (392.1644 calcd for C₁₉H₂₅N₃O₄S, M + H); H NMR (500

MHz, DMSO) 10.61 (s, 1H), 7.92 (d, J = 8.80 Hz, 2H), 7.70 (d, J =

8.80 Hz, 2H), 6.40−6.54 (m, 1H), 6.27−6.36 (m, 1H), 5.84 (dd, J =

10.09, 1.83 Hz, 1H), 3.51−3.66 (m, 4H), 2.78−2.96 (m, 4H), 1.64−

1.79 (m, 2H), 1.37−1.61 (m, 7H); ¹³C NMR (126 MHz, DMSO-d₆) δ

173.5, 163.7, 143.4, 131.4, 128.9, 128.6, 128.2, 119.2, 46.2 (br), 45.8

(br), 44.1 (br), 40.4 (br), 39.9, 29.5, 25.6.

4-Nitro-N-piperidin-4-ylbenzenesulfonamide. HCl (20 mL, 4

M solution in dioxane) was added in one portion to a stirred solution

of 4-(4-nitrobenzenesulfonylamino)piperidine-1-carboxylic acid tert-

butyl ester (1.92 g, 4.9 mmol) in dioxane (5 mL), and the suspension

was stirred at room temperature under a nitrogen atmosphere for 3 h.

After this time the mixture was concentrated under vacuum and the

resulting solid was collected by filtration, washed with TBME (3 × 100 mL),

and dried under vacuum to give the title compound (1.4 g, 100% yield) as a

white solid. MS (ES⁺) m/z (M + 1) 286.

4-(4-Acryloylaminobenzenesulfonyl)piperazine-1-carboxylic

Acid Methyl Ester (16z). MS (ES⁺) m/z (M + 23) 354; HRMS

1

(ES+) m/z 354.1126 (354.1124 calcd for C₁₅H₁₉N₃O₅S, M + H); H

NMR (500 MHz, DMSO) 10.57 (s, 1H), 7.91 (d, J = 8.83 Hz, 2H),

7.69 (d, J = 8.67 Hz, 2H), 6.41−6.51 (m, 1H), 6.27−6.38 (m, 1H),

5.83 (dd, J = 10.17, 1.65 Hz, 1H), 3.54 (s, 3H), 3.43 (t, J = 4.65 Hz,

4H), 2.85 (t, J = 4.73 Hz, 4H); ¹³C NMR (126 MHz, DMSO-d₆)

δ 163.8, 154.8, 143.4, 131.4, 128.9, 128.7, 128.2, 119.2, 52.5, 45.6,

42.6 (br).

4-(4-Nitrobenzenesulfonylamino)piperidine-1-carboxylic

Acid Benzyl Ester. Benzyl chloroformate (0.7 mL, 4.9 mmol) was

added dropwise to a cool (0 °C) solution of 4-nitro-N-piperidin-4-

ylbenzenesulfonamide (1.4 g, 4.9 mmol) and diisopropylethylamine

(1.6 mL, 9.8 mmol) in THF (10 mL). The resulting mixture was

warmed to room temperature and stirred under a nitrogen atmosphere

for 18 h. After this time, the mixture was diluted with ethyl acetate (50 mL)

and washed with water (50 mL). The organic layer was separated,

dried (MgSO₄), filtered, and concentrated under vacuum. The

resulting residue was purified using flash column chromatography

(elution, 50% heptane, 50% ethyl acetate) to give the title compound

(0.98 g, 48% yield) as a white solid. MS (ES⁺) m/z (M + 1) 420.

4-(4-Aminobenzenesulfonylamino)piperidine-1-carboxylic

Acid Benzyl Ester. 4-(4-Nitrobenzenesulfonylamino)piperidine-1-

carboxylic acid benzyl ester (0.98 g, 2.4 mmol) was suspended in a 5:1

mixture of ethanol and water (30 mL). To this solution was added iron

powder (0.34 g, 6.1 mmol) followed by saturated ammonium chloride

solution (1 mL), and the mixture was heated to 80 °C for 3 h. After

this time, the reaction mixture was cooled to room temperature and

4-(4-Acryloylaminobenzenesulfonyl)piperazine-1-carboxylic

Acid Ethyl Ester (16aa). MS (ES⁺) m/z (M + 23) 368; HRMS

1

(ES+) m/z 368.1294 (368.1280 calcd for C₁₆H₂₁N₃O₅S, M + H); H

NMR (500 MHz, DMSO) 10.58 (s, 1H), 7.91 (d, J = 8.83 Hz, 2H),

7.69 (d, J = 8.83 Hz, 2H), 6.41−6.50 (m, 1H), 6.28−6.37 (m, 1H),

5.83 (dd, J = 10.09, 1.73 Hz, 1H), 3.98 (q, J = 7.09 Hz, 2H), 3.43 (br s,

4H), 2.85 (t, J = 4.81 Hz, 4H), 1.03−1.18 (m, 3H); ¹³C NMR (126

MHz, DMSO-d₆) δ 163.7, 154.3, 143.4, 131.4, 128.9, 128.6, 128.2,

119.2, 61.0, 45.7, 42.6 (br), 14.5.

4-(4-Acryloylaminobenzenesulfonyl)piperazine-1-carboxylic

Acid Cyclopentyl Ester (16ab). MS (ES⁺) m/z (M + 23) 408;

HRMS (ES+) m/z 408.1604 (408.1593 calcd for C₁₉H₂₅N₃O₅S, M + H);

¹H NMR (500 MHz, DMSO) 10.58 (s, 1H), 7.91 (d, J = 8.67 Hz,

2H), 7.69 (d, J = 8.83 Hz, 2H), 6.42−6.50 (m, 1H), 6.27−6.36

(m, 1H), 5.77−5.88 (m, 1H), 4.91 (dt, J = 5.60, 3.03 Hz, 1H), 3.41

(t, J = 4.89 Hz, 4H), 2.84 (t, J = 4.49 Hz, 4H), 1.68−1.78 (m, 2H), 1.43−

1.63 (m, 6H); ¹³C NMR (126 MHz, DMSO-d₆) δ 163.7, 154.1, 143.4,

131.4, 128.9, 128.6, 128.2, 119.2, 77.5, 45.7, 42.5 (br), 32.3, 23.1.

1039

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

N-{4-[4-(3-Phenylpropionyl)piperazine-1-sulfonyl]phenyl}-

acrylamide (18a). MS (ES⁺) m/z (M + 23) 428; HRMS (ES+) m/z

428.1628 (428.1644 calcd for C₂₂H₂₅N₃O₄S, M + H); ¹H NMR (500 MHz,

DMSO) 10.64 (s, 1H), 7.93 (d, J = 8.70 Hz, 2H), 7.68 (d, J = 8.70 Hz,

2H), 7.01−7.22 (m, 5H), 6.42−6.53 (m, 1H), 6.26−6.38 (m, 1H),

5.85 (d, J = 11.29 Hz, 1H), 3.45−3.61 (m, 4H), 2.66−2.87 (m, 6H),

2.56 (t, J = 7.71 Hz, 2H); ¹³C NMR (126 MHz, DMSO-d₆) δ 170.17,

163.93, 143.57, 141.30, 131.52, 129.06, 128.71, 128.55, 128.41, 128.30,

125.99, 119.39, 46.08, 45.98, 44.33, 33.78, 30.87.

N-{4-[4-(2-Phenylcyclopropanecarbonyl)piperazine-1-

sulfonyl]phenyl}acrylamide (18b). MS (ES⁺) m/z (M + 23) 440; δ_H

(500 MHz, DMSO-d₆) 10.58 (1H, s), 7.91 (d, J = 8.67 Hz, 2H), 7.64−

7.76 (2H, m), 7.04−7.31 (5H, m), 6.40−6.52 (1H, m), 6.24−6.35

(1H, m), 5.83 (dd, J = 10.09, 1.73 Hz, 1H), 3.46−3.84 (4H, m), 2.73−

3.02 (4H, m), 2.24 (t, J = 6.70 Hz, 2H), 1.28−1.36 (1H, m), 1.15

(td, J = 7.21, 3.86 Hz, 1H).

1.34 (s, 10H); ¹³C NMR (126 MHz, DMSO-d₆) δ 165.0, 153.4, 143.7,

142.6, 128.8, 128.1, 123.3, 118.8, 79.3, 45.8, 27.9, 15.0.

4-Nitro-2-trifluoromethylbenzenesulfonyl Chloride. Sodium

nitrite (1.8 g, 26 mmol) was added portionwise to a stirred solution of

4-nitro-2-trifluoromethylphenylamine (5.0 g, 24 mmol) in acetic acid

(37 mL) and HCl (concentrated, 7.5 mL) while maintaining the

temperature below 15 °C. This solution was then added dropwise to a

stirred solution of saturated sulfur dioxide, copper(II) chloride (0.6 g,

4.5 mmol), and water (7.5 mL) in acetic acid (24 mL) at 5 °C. The

reaction mixture was allowed to warm to room temperature and

poured over ice−water and stirred for a further 15 min. The resulting

precipitate was collected by filtration, washed with water, and dried

overnight in a vacuum oven to give the title compound (3.5 g, 71%

yield) as a yellow solid which was used without further purification.

4-(4-Nitro-2-trifluoromethylbenzenesulfonyl)piperazine-1-car-

boxylic Acid Benzyl Ester. Diisopropylethylamine (1.2 mL, 7.0 mmol)

was added in one portion to a stirred solution of piperazine-1-

carboxylic acid benzyl ester (0.76 g, 3.5 mmol) in DCM (15 mL) at

room temperature. To this mixture was added 4-nitro-2-trifluorome-

thylbenzenesulfonyl chloride (1.0 g, 3.5 mmol) in one portion, and the

mixture was stirred at room temperature under a nitrogen atmosphere

for 1 h. After this time, the mixture was diluted with DCM (20 mL)

and washed with HCl (1 M, 20 mL) and NaOH (1 M, 20 mL). The

organic layer was separated, dried (MgSO₄), filtered, and concentrated

under vacuum to give the title compound (1.43 g, 87% yield) as a

purple solid. MS (ES⁺) m/z (M + 23) 496; δ_H(500 MHz, DMSO-d₆)

8.65−8.60 (2H, m), 8.31−8.33 (1H, m), 7.38−7.29 (5H, m), 5.07

(2H, m), 3.56−3.46 (4H, m), 3.30−3.25 (4H, m).

4-(4-Amino-2-trifluoromethylbenzenesulfonyl)piperazine-1-

carboxylic Acid Benzyl Ester. 4-(4-Nitro-2-trifluoromethylbenze-

nesulfonyl)piperazine-1-carboxylic acid benzyl ester (0.5 g, 1.0 mmol)

was suspended in a 5:1 mixture of ethanol and water (20 mL). To this

solution was added iron powder (0.16 g, 2.6 mmol) followed by

saturated ammonium chloride solution (1 mL), and the mixture was

heated to 80 °C for 3 h. After this time, the reaction mixture was

cooled to room temperature and filtered through a pad of Celite, the

Celite was washed with ethanol (10 mL) and ethyl acetate (50 mL),

and the solution was concentrated under vacuum. The resulting

residue was partitioned between DCM (50 mL) and water (20 mL).

The organic layer was separated, dried with MgSO₄, filtered, and

concentrated to afford the title compound (0.44 g, 94% yield) as a

yellow solid. MS (ES⁺) m/z (M + 1) 444.

4-(4-Acryloylamino-2-trifluoromethylbenzenesulfonyl)-

piperazine-1-carboxylic Acid Benzyl Ester (29e). 4-(4-Amino-2-

trifluoromethylbenzenesulfonyl)piperazine-1-carboxylic acid benzyl

ester (0.44 g, 0.11 mmol) was dissolved in THF (15 mL). To this

solution was added diisopropylethylamine (0.52 mL, 0.33 mmol) in

one portion followed by the dropwise addition of acryloyl chloride

(0.09 mL, 0.11 mmol), and the mixture was stirred at room tempera-

ture under a nitrogen atmosphere for 3 h. The THF was removed

under vacuum and the resulting crude material was purified using

preparative HPLC to give the title compound (70 mg, 14% yield) as a

white solid. MS (ES⁺) m/z (M + 23) 520; δ_H(250 MHz, DMSO-d₆)

10.31 (1H, s), 7.57−7.78 (4H, m), 7.27−7.50 (5H, m), 6.69 (dd, J =

16.75, 10.36 Hz, 1H), 6.03 (dd, J = 16.75, 2.28 Hz, 1H), 5.63 (dd, J =

10.51, 2.28 Hz, 1H), 5.17 (2H, s), 3.59 (4H, br s), 2.84 (t, J =

4.72 Hz, 4H).

4-(4-Acryloylamino-3-fluorobenzenesulfonyl)piperazine-1-

carboxylic Acid Benzyl Ester (29b). MS (ES⁺) m/z (M + 1) 448;

HRMS (ES+) m/z 448.1349 (448.1342 calcd for C₂₁H₂₂FN₃O₅S, M + H);

¹H NMR (250 MHz, DMSO) 9.63 (s, 1H), 7.87−8.04 (m, 1H),

7.54−7.68 (m, 2H), 7.24−7.42 (m, 5H), 6.42−6.60 (m, 1H), 6.15−

6.31 (m, 1H), 5.73−5.88 (m, 1H), 5.02 (s, 2H), 3.41 (br s, 4H), 2.97

(t, J = 4.95 Hz, 4H); ¹³C NMR (126 MHz, DMSO-d₆) δ 163.8, 158.3

(d, J = 248 Hz), 154.1, 136.5, 132.1 (d, J = 3 Hz), 131.4, 129.6 (d, J =

8 Hz), 129.4 (d, J = 6 Hz), 128.4, 128.0, 127.9, 127.6, 121.3 (d, J = 23 Hz),

116.4 (d, J = 27 Hz), 66.5, 45.1, 42.9 (br).

N-[4-(4-Cyclopropanecarbonylpiperazine-1-sulfonyl)-

phenyl]acrylamide (18c). MS (ES⁺) m/z (M + 23) 364; HRMS

1

(ES+) m/z 364.1336 (364.1331 calcd for C₁₇H₂₁N₃O₄S, M + H); H

NMR (500 MHz, DMSO) 10.60 (s, 1H), 7.92 (d, J = 8.83 Hz, 2H),

7.71 (d, J = 8.83 Hz, 2H), 6.42−6.52 (m, 1H), 6.21−6.36 (m, 1H),

5.84 (dd, J = 10.17, 1.81 Hz, 1H), 3.47−3.85 (m, 4H), 2.72−3.02

(m, 4H), 1.81−1.96 (m, 1H), 0.59−0.71 (m, 4H); ¹³C NMR (126 MHz,

DMSO-d₆) δ 171.1, 163.7, 143.4, 131.4, 128.9, 128.6, 128.2, 119.2, 46.3

(br), 45.8 (br), 44.1 (br), 40.7 (br), 10.2, 7.1.

N-{4-[4-(Pyrrolidine-1-carbonyl)piperazine-1-sulfonyl]-

phenyl}acrylamide (17e). MS (ES⁺) m/z (M + 1) 393; δ_H(500

MHz, DMSO-d₆) 10.58 (1H, s), 7.92 (d, J = 8.83 Hz, 2H), 7.70 (d, J =

8.83 Hz, 2H), 6.40−6.52 (1H, m), 6.23−6.37 (1H, m), 5.83 (dd, J =

10.09, 1.73 Hz, 1H), 3.11−3.27 (8H, m), 2.79−2.96 (4H, m), 1.60−

1.75 (4H, m).

N-{4-[4-(Adamantane-1-carbonyl)piperazine-1-sulfonyl]-

phenyl}acrylamide (18d). MS (ES⁺) m/z (M + 1) 458; HRMS

1

(ES+) m/z 458.2121 (458.2114 calcd for C₂₄H₃₁N₃O₄S, M + H); H

NMR (500 MHz, DMSO) 10.57 (s, 1H), 7.89 (d, J = 8.67 Hz, 2H),

7.67 (d, J = 8.83 Hz, 2H), 6.38−6.48 (m, 1H), 6.21−6.34 (m, 1H),

5.81 (dd, J = 10.09, 1.73 Hz, 1H), 3.63 (br s, 4H), 2.81 (t, J = 4.33 Hz,

4H), 1.47−1.95 (m, 14H); ¹³C NMR (126 MHz, DMSO-d₆) δ 174.6,

163.8, 143.4, 131.4, 128.9, 128.5, 128.2, 119.2, 46.2, 43.9 (br), 40.9,

38.3, 35.9, 27.8.

4-[4-(1-Oxobut-2-ynylamino)benzenesulfonyl]piperazine-1-

carboxylic Acid tert-Butyl Ester (28r). But-2-ynoic acid (0.19 g,

2.36 mmol) followed by pyridine (0.6 mL) was added sequentially

portionwise to a stirred solution of 4-(4-aminobenzenesulfonyl)-

piperazine-1-carboxylic acid tert-butyl ester (0.2 g, 0.59 mmol) in

THF/DMA (3:2, 5 mL) at room temperature. To this mixture was

added EDC (0.6 g, 3.1 mmol) in one portion, and the mixture was

stirred at room temperature under a nitrogen atmosphere for 1 h. After

this time the mixture was diluted with ethyl acetate (50 mL) and

washed with water (100 mL), saturated NaHCO₃(100 mL), and HCl

(100 mL, 2M). The organic layer was separated, dried (MgSO₄),

filtered, and concentrated under vacuum and the resulting residue was

purified using flash column chromatography (elution, 20% ethyl

acetate, 80% DCM) to give the title compound (0.05 g, 19% yield) as

a white solid. MS (ES⁺) m/z) (M + 23) 430; δ_H(250 MHz, DMSO-d₆)

11.07 (1H, s), 7.76−7.89 (2H, m), 7.66 (d, J = 8.68 Hz, 2H), 2.79 (t, J =

4.64 Hz, 4H), 1.94−2.16 (3H, m), 1.32 (9H, s).

4-(4-But-2-enoylaminobenzenesulfonyl)piperazine-1-car-

boxylic Acid tert-Butyl Ester (28e). Lindlar’s catalyst (0.005 g,

0.001 mmol) was added in one portion to a stirred solution of 4-[4-(1-

oxobut-2-ynylamino)benzenesulfonyl]piperazine-1-carboxylic acid tert-

butyl ester (0.05 g, 0.11 mmol) in methanol (5 mL) at room tempera-

ture. The resulting mixture was then stirred at room temperature

under a hydrogen atmosphere for 2 h. After this time, the reaction

mixture was filtered through Celite and concentrated under vacuum to

give the title compound (0.02 g, 40% yield) as a white solid. MS (ES⁺)

m/z (M + 23) 432; HRMS (ES+) m/z 310.1232 (310.1225 calcd for

C₁₉H₂₇N₃O₅S, M + H, loss of tert-butyl); ¹H NMR (500 MHz,

DMSO) 10.44 (s, 1H), 7.89 (d, J = 8.62 Hz, 2H), 7.67 (d, J = 8.62 Hz,

2H), 6.31 (dq, J = 11.42, 7.26 Hz, 1H), 6.04 (dd, J = 11.37, 1.65 Hz, 1H),

3.39 (br s, 3H), 2.82 (t, J = 4.68 Hz, 4H), 2.13 (dd, J = 7.15, 1.47 Hz, 3H),

4-(4-Acryloylamino-2-methoxybenzenesulfonyl)piperazine-

1-carboxylic Acid tert-Butyl Ester (29c). MS (ES⁺) m/z (M + 23)

448; HRMS (ES+) m/z 326.1170 (326.1175 calcd for C₁₉H₂₇N₃O₆S,

1040

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

M + H, loss of tert-butyl); ¹H NMR (500 MHz, DMSO) 10.54

(s, 1H), 7.62−7.72 (m, 2H), 7.28−7.38 (m, 1H), 6.39−6.53 (m, 1H),

6.27−6.35 (m, 1H), 5.79−5.86 (m, 1H), 3.86 (s, 3H), 3.38−3.44 (m, 4H),

2.95−3.13 (m, 4H), 1.37 (s, 9H); ¹³C NMR (126 MHz, DMSO-d₆)

δ 163.8, 157.4, 153.6, 145.0, 131.9, 131.4, 128.2, 119.3, 110.4, 103.0, 79.3,

55.8, 45.5, 28.0.

4-(4-Acryloylamino-2-methylbenzenesulfonyl)piperazine-1-

carboxylic Acid tert-Butyl Ester (29d). MS (ES⁺) m/z (M + 23)

432; δ_H(500 MHz, DMSO-d₆) 10.49 (1H, s), 7.61−7.82 (3H, m),

6.41−6.51 (1H, m), 6.25−6.36 (1H, m), 5.83 (dd, J = 10.09, 1.65 Hz,

1H), 3.38 (4H, br s), 2.93−3.02 (4H, m), 2.54 (3H, s), 1.37 (9H, s).

4-(4-Acryloylamino-2-fluorobenzenesulfonyl)piperazine-1-

carboxylic Acid tert-Butyl Ester (29f). MS (ES⁺) m/z (M + 23)

436; HRMS (ES+) m/z 310.1228 (310.1225 calcd for C₁₉H₂₇N₃O₅S,

M + H, loss of tert-butyl); ¹H NMR (250 MHz, DMSO) 7.80 (dd, J =

12.94, 1.98 Hz, 1H), 7.66 (t, J = 8.38 Hz, 1H), 7.38 (dd, J = 8.76, 1.90 Hz,

1H), 6.21−6.40 (m, 2H), 5.74 (dd, J = 6.24, 5.63 Hz, 1H), 3.31−3.48

(m, 5H), 3.01 (t, J = 4.72 Hz, 4H), 1.24−1.37 (m, 9H); ¹³C NMR

(126 MHz, DMSO-d₆) δ 163.7, 153.5, 143.1, 138.6, 131.4, 131.3, 128.8,

128.1, 122.4, 116.4, 79.3, 45.0, 28.0, 20.7.

4-(4-Acryloylaminobenzenesulfonyl)piperazine-1-carboxylic

Acid 2-Trifluoromethylbenzyl Ester (16s). MS (ES⁺) m/z (M + 1)

498; HRMS (ES+) m/z 498.1298 (498.1311 calcd for

1

C₂₂H₂₂F₃N₃O₅S, M + H); H NMR (500 MHz, DMSO) 10.60 (br s,

1H), 7.91 (d, J = 8.83 Hz, 1H), 7.48−7.79 (m, 4H), 6.40−6.53 (m, 1H),

6.26−6.37 (m, 1H), 5.78−5.92 (m, 1H), 5.18 (s, 2H), 3.48 (br s, 4H),

2.87 (br s, 4H); ¹³C NMR (126 MHz, DMSO-d₆) δ 162.6, 152.6,

142.3, 133.3, 131.7, 130.2, 128.9, 127.7, 127.5, 127.4, 127.1, 125.4

(q, J = 30 Hz), 124.9 (q, J = 6 Hz), 123.0 (q, J = 274 Hz), 118.0, 62.0,

44.5, 41.6 (br).

N-(4-{4-[2-(2-Phenoxyphenyl)acetyl]piperazine-1-sulfonyl}-

phenyl)acrylamide (16t). MS (ES⁺) m/z (M + 1) 506; HRMS

1

(ES+) m/z 506.1755 (506.1750 calcd for C₂₇H₂₇N₃O₅S, M + H); H

NMR (500 MHz, DMSO) 10.62 (s, 1H), 7.93 (d, J = 8.83 Hz, 2H),

7.66 (d, J = 8.83 Hz, 2H), 7.15−7.31 (m, 4H), 6.91−7.08 (m, 2H),

6.72−6.85 (m, 3H), 6.43−6.55 (m, 1H), 6.25−6.39 (m, 1H), 5.77−

5.92 (m, 1H), 3.43−3.66 (m, 6H), 2.74 (t, J = 4.73 Hz, 3H); ¹³C

NMR (126 MHz, DMSO-d₆) δ 168.4, 163.8, 156.9, 154.2, 143.4,

131.9, 131.4, 129.7, 128.9, 128.5, 128.3, 127.5, 123.6, 122.9, 119.2,

118.8, 117.8, 45.8, 45.7, 44.5, 40.5, 33.6.

4-(4-Acryloylaminobenzenesulfonyl)piperazine-1-carboxylic

Acid 2-Methylbenzyl Ester (16u). MS (ES⁺) m/z (M + 1) 444;

HRMS (ES+) m/z 444.1597 (444.1593 calcd for C₂₂H₂₅N₃O₅S,

M + H); ¹H NMR (500 MHz, DMSO) 10.58 (s, 1H), 7.91 (d, J = 8.67

Hz, 2H), 7.68 (d, J = 8.83 Hz, 2H), 7.00−7.29 (m, 4H), 6.40−6.50

(m, 1H), 6.26−6.37 (m, 1H), 5.83 (dd, J = 10.17, 1.66 Hz, 1H), 5.02

(s, 2H), 3.46 (br s, 4H), 2.80−2.95 (m, 4H), 2.22 (s, 3H); ¹³C NMR

(126 MHz, DMSO-d₆) δ 163.8, 154.1, 143.4, 136.4, 134.4, 131.4,

130.1, 128.9, 128.6, 128.6, 128.2, 128.1, 125.8, 119.2, 65.1, 45.7, 42.7,

18.4.

4-(4-Acryloylamino-2-chlorobenzenesulfonyl)piperazine-1-

carboxylic Acid tert-Butyl Ester (29g). MS (ES⁺) m/z (M + 1)

423; δ_H(250 MHz, DMSO-d₆) 10.68 (1H, s), 8.07 (d, J = 2.13 Hz,

1H), 7.90 (d, J = 8.83 Hz, 1H), 7.70 (dd, J = 8.76, 2.06 Hz, 1H), 6.24−

6.53 (2H, m), 5.74−5.96 (1H, m), 3.33−3.42 (4H, m), 3.02−3.18

(4H, m), 1.36 (9H, s).

4-(4-Acryloylaminobenzenesulfonyl)piperazine-1-carboxylic

Acid 2,3-Difluorobenzyl Ester (16o). Phosgene (0.5 mL, 20%

solution in toluene) was added in one portion to a stirred solution of

2,3-difluorobenzyl alcohol (0.2 g, 1.36 mmol) in THF (2 mL), and the

resulting mixture was stirred at room temperature under a nitrogen

atmosphere for 3 h. After this time the reaction mixture was concentrated

under vacuum and the resulting residue was diluted with DMF (2 mL)

and added dropwise to a stirred solution of N-[4-(piperazine-1-sulfonyl)-

phenyl]acrylamide (15, 0.2 g, 0.68 mmol) and diisopropylethylamine

(0.35 mL, 2.04 mmol) in DMF (4 mL). The resulting mixture was

stirred at room temperature under a nitrogen atmosphere for 18 h.

After this time the reaction mixture was concentrated under vacuum

and the residue was purified using preparative HPLC to give the title

compound (0.029 g, 12% yield) as a white powder. MS (ES⁺) m/z

(M + 1) 466; δ_H(500 MHz, DMSO-d₆) 10.58 (1H, s), 7.92 (d, J =

8.35 Hz, 2H), 7.70 (d, J = 8.20 Hz, 2H), 7.35−7.45 (1H, m), 7.14−

7.27 (2H, m), 6.43−6.53 (1H, m), 6.30−6.40 (1H, m), 5.85 (d, J =

10.09 Hz, 1H), 5.11 (2H, s), 3.47 (4H, br s), 2.87 (4H, br s).

4-(4-Acryloylaminobenzenesulfonyl)piperazine-1-carboxylic

Acid 4-Fluorobenzyl Ester (16p). MS (ES⁺) m/z (M + 1) 448; δ_H

(500 MHz, DMSO-d₆) 10.61 (1H, br s), 7.93 (d, J = 8.32 Hz, 2H),

7.69 (d, J = 8.32 Hz, 2H), 7.38−7.31 (2H, m), 7.16−7.11 (2H, m),

6.50−6.27 (2H, m), 5.83 (d, J = 10.12 Hz, 1H), 4.98 (2H, s), 3.51−

3.42 (4H, m), 2.89−2.81 (4H, m).

4-(4-Acryloylaminobenzenesulfonyl)piperazine-1-carboxylic

Acid 3,5-Difluorobenzyl Ester (16q). MS (ES⁺) m/z (M + 1) 466;

HRMS (ES+) m/z 466.1233 (466.1248 calcd for C₂₁H₂₁F₂N₃O₅S,

M + H); ¹H NMR (500 MHz, DMSO) 10.57 (s, 1H), 7.91 (d, J = 8.83

Hz, 2H), 7.70 (d, J = 8.67 Hz, 2H), 7.12−7.19 (m, 1H), 7.05 (d, J =

6.46 Hz, 2H), 6.41−6.51 (m, 1H), 6.27−6.38 (m, 1H), 5.83 (dd, J =

10.17, 1.66 Hz, 1H), 5.03 (s, 2H), 3.49 (br s, 4H), 2.89 (t, J = 4.81 Hz,

4H); ¹³C NMR (126 MHz, DMSO-d₆) δ 163.7, 162.3 (dd, J = 247, 14

Hz), 153.8, 143.4, 141.2 (t, J = 10 Hz), 131.4, 128.9, 128.6, 128.2,

119.2, 110.4 (dd, J = 20, 6 Hz), 103.2 (t, J = 26 Hz), 65.1, 45.6, 42.7

(br).

4-(4-Acryloylaminobenzenesulfonyl)piperazine-1-carboxylic

Acid Naphthalen-1-ylmethyl Ester (16v). MS (ES⁺) m/z (M + 23)

502; δ_H(500 MHz, DMSO-d₆) 10.61 (1H, br s), 7.80−7.99 (5H, m),

7.67 (d, J = 8.67 Hz, 2H), 7.29−7.59 (4H, m), 6.42−6.53 (1H, m),

6.27−6.39 (1H, m), 5.85 (dd, J = 10.09, 1.73 Hz, 1H), 5.48 (2H, s),

3.45 (4H, br s), 2.69−2.96 (4H, m).

4-(4-Acryloylaminobenzenesulfonyl)piperazine-1-carboxylic

Acid Naphthalen-2-ylmethyl Ester (16w). MS (ES⁺) m/z (M + 23)

502; HRMS (ES+) m/z 480.1577 (480.1593 calcd for C₂₅H₂₅N₃O₅S,

1

M + H); H NMR (500 MHz, DMSO) 10.61 (br s, 1H), 7.64−7.97

(m, 11H), 7.38−7.59 (m, 4H), 6.26−6.53 (m, 2H), 5.80−5.91

(m, 1H), 5.19 (s, 2H), 3.51 (br s, 4H), 2.89 (t, J = 4.89 Hz, 4H); ¹³C

NMR (126 MHz, DMSO-d₆) δ 163.8, 154.2, 143.4, 134.2, 132.7,

132.5, 131.4, 128.9, 128.6, 128.2, 128.1, 127.8, 127.6, 126.4, 126.3,

126.2, 125.6, 119.7, 66.6, 45.7, 42.8.

N-(4-{4-[2-(3-Phenoxyphenyl)acetyl]piperazine-1-sulfonyl}-

phenyl)acrylamide (16x). MS (ES⁺) m/z (M + 1) 506; δ_H(500

MHz, DMSO-d₆) 10.59 (1H, s), 7.91 (d, J = 8.67 Hz, 2H), 7.67 (d, J =

8.83 Hz, 2H), 7.35 (t, J = 7.88 Hz, 2H), 7.22 (t, J = 7.88 Hz, 1H), 7.11

(t, J = 7.33 Hz, 1H), 6.75−7.01 (5H, m), 6.26−6.51 (2H, m), 5.83

(dd, J = 10.09, 1.73 Hz, 1H), 3.65 (2H, s), 3.53 (d, J = 3.78 Hz, 4H),

2.72−2.90 (4H, m).

N-(4-{4-[2-(4-Phenoxyphenyl)acetyl]piperazine-1-sulfonyl}-

phenyl)acrylamide (16y). MS (ES⁺) m/z (M + 1) 506; δ_H(500 MHz,

DMSO-d₆) 10.59 (1H, s), 7.91 (d, J = 8.67 Hz, 2H), 7.69 (d, J =

8.83 Hz, 2H), 7.36 (t, J = 7.88 Hz, 2H), 7.06−7.20 (3H, m), 6.79−

7.00 (4H, m), 6.40−6.50 (1H, m), 6.25−6.37 (1H, m), 5.83 (dd, J =

10.17, 1.81 Hz, 1H), 3.50−3.68 (6H, m), 2.75−2.88 (4H, m).

N-{4-[4-(Octahydroisoquinoline-2-carbonyl)piperazine-1-

sulfonyl]phenyl}acrylamide (17a). MS (ES⁺) m/z (M + 1) 461; δ_H

(500 MHz, DMSO-d₆) 10.59 (1H, s), 7.92 (d, J = 8.83 Hz, 2H), 7.70

(d, J = 8.83 Hz, 2H), 6.39−6.53 (1H, m), 6.25−6.36 (1H, m), 5.71−

5.89 (1H, m), 3.06−3.28 (5H, m), 2.72−2.95 (6H, m), 1.05−1.80

(12H, m).

4-(4-Acryloylaminobenzenesulfonyl)piperazine-1-carboxylic

Acid 2-Chlorobenzyl Ester (16r). MS (ES⁺) m/z (M + 1) 464;

HRMS (ES+) m/z 464.1058 (464.1047 calcd for C₂₁H₂₂ClN₃O₅S,

M + H); ¹H NMR (500 MHz, DMSO) 10.60 (br s, 1H), 7.91 (d, J = 8.67

Hz, 2H), 7.69 (d, J = 8.67 Hz, 2H), 7.27−7.50 (m, 3H), 6.41−6.51

(m, 1H), 6.26−6.37 (m, 1H), 5.80−5.89 (m, 1H), 5.09 (s, 2H), 3.48

(br s, 3H), 2.87 (d, J = 4.26 Hz, 3H); ¹³C NMR (126 MHz, DMSO-d₆)

δ 163.7, 153.9, 143.4, 133.9, 132.9, 132.4, 131.3, 129.9, 129.9, 129.3, 128.9,

128.5, 128.2, 127.3, 119.2, 64.0, 45.6, 42.8.

N-{4-[4-(Octahydroquinoline-1-carbonyl)piperazine-1-

sulfonyl]phenyl}acrylamide (17b). MS (ES⁺) m/z (M + 1) 461;

HRMS (ES+) m/z 461.2210 (461.2223 calcd for C₂₃H₃₂N₄O₄S,

M + H); ¹H NMR (500 MHz, DMSO) 10.59 (s, 1H), 7.92 (d, J = 8.67

Hz, 2H), 7.70 (d, J = 8.67 Hz, 2H), 6.41−6.52 (m, 1H), 6.25−6.37

(m, 1H), 5.83 (dd, J = 10.17, 1.66 Hz, 1H), 3.59 (d, J = 12.14 Hz, 1H),

3.04−3.28 (m, 5H), 2.74−2.93 (m, 5H), 1.06−1.81 (m, 13H); ¹³C

1041

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

NMR (126 MHz, DMSO-d₆) δ 163.7, 162.7, 143.4, 131.4, 128.9,

128.7, 128.2, 119.2, 54.7, 46.1, 45.6, 41.3, 34.6, 31.0, 25.5, 25.4, 23.6,

23.3, 19.9.

NMR (500 MHz, MeOD) 8.68 (d, J = 2.52 Hz, 1H), 8.46 (d, J = 8.83 Hz,

1H), 8.13 (dd, J = 8.83, 2.52 Hz, 1H), 6.31−6.65 (m, 2H), 5.86 (dd,

J = 9.77, 2.05 Hz, 1H), 3.86 (br s, 2H), 3.63−3.75 (m, 2H), 2.99−3.19

(m, 4H), 1.82−1.97 (m, 1H), 0.66−0.88 (m, 4H); ¹³C NMR (126 MHz,

DMSO-d₆) δ 171.1, 164.3, 155.3, 147.5, 138.3, 131.0, 129.2, 126.3, 113.3,

46.0, 45.6, 44.1, 40.7, 10.3, 7.1.

N-{4-[4-(Piperidine-1-carbonyl)piperazine-1-sulfonyl]-

phenyl}acrylamide (17c). MS (ES⁺) m/z (M + 1) 407; HRMS

1

(ES+) m/z 407.1746 (407.1753 calcd for C₁₉H₂₆N₄O₄S, M + H); H

NMR (500 MHz, DMSO) 10.58 (s, 1H), 7.92 (d, J = 8.83 Hz, 2H),

7.70 (d, J = 8.67 Hz, 2H), 6.44−6.52 (m, 1H), 6.27−6.37 (m, 1H),

5.78−5.88 (m, 1H), 3.16 (t, J = 4.81 Hz, 4H), 2.98−3.08 (m, 4H),

2.86 (d, J = 4.26 Hz, 4H), 1.33−1.56 (m, 6H); ¹³C NMR (126 MHz,

DMSO-d₆) δ 163.7, 162.8, 143.4, 131.4, 128.9, 128.6, 128.2, 119.2,

47.0, 45.8, 45.6, 25.2, 24.1.

N-{4-[4-(4,4-Difluoropiperidine-1-carbonyl)piperazine-1-

sulfonyl]phenyl}acrylamide (17d). MS (ES⁺) m/z (M + 1) 443;

HRMS (ES+) m/z 443.1564 (443.1565 calcd for C₁₉H₂₄F₂N₄O₄S,

M + H); ¹H NMR (500 MHz, DMSO) 10.66 (s, 1H), 7.98 (d, J = 8.80 Hz,

2H), 7.77 (d, J = 8.80 Hz, 2H), 6.47−6.56 (m, 1H), 6.34−6.44

(m, 1H), 5.90 (dd, J = 10.18, 1.74 Hz, 1H), 3.21−3.33 (m, 8H), 2.93

(d, J = 4.40 Hz, 4H), 1.89−2.03 (m, 4H).

6-Aminopyridine-3-sulfonyl Chloride. 2-Aminopyridine (3.0 g,

32.0 mmol) was added portionwise to neat chlorosulfonic acid (18.0

mL, 270.0 mmol) at 0 °C. Upon complete addition the mixture was

heated to reflux for 2 h, after which time the hot mixture was poured

onto ice (600 mL) and the solution carefully neutralized by the por-

tionwise addition of solid NaHCO₃. The resulting mixture was extracted

with ethyl acetate (3 × 200 mL), and the organic layer was separated,

dried (MgSO₄), filtered, and concentrated under vacuum. The resulting

solid was recrystallized from heptane/diethyl ether to afford the title

compound (2.23 g, 36% yield) as a white solid. δ_H(250 MHz, CDCl₃)

8.63 (1H, s), 7.91−7.85 (1H, m), 6.50−6.47 (1H, m), 5.24 (2H, br s).

4-(6-Aminopyridine-3-sulfonyl)piperazine-1-carboxylic Acid

tert-Butyl Ester. Diisopropylethylamine (0.4 mL, 2.4 mmol) was

added in one portion to a stirred solution of piperazine-1-carboxylic

acid tert-butyl ester (0.41 g, 2.2 mmol) in THF (10 mL) at room

temperature. To this mixture was added 6-aminopyridine-3-sulfonyl

chloride (0.5 g, 2.4 mmol) in one portion, and the mixture was stirred

at room temperature under a nitrogen atmosphere for 1 h. After this

time, the resulting solid was collected by filtration, washed with ether,

and dried under vacuum to afford the title compound (0.49 g, 86%

yield) as a white solid. MS (ES⁺) m/z (M + 1) 261.

N-{5-[4-(Adamantane-1-carbonyl)piperazine-1-sulfonyl]-

pyridin-2-yl}acrylamide (24d). MS (ES⁺) m/z (M + 1) 459; δ_H

(500 MHz, DMSO-d₆) 11.28 (1H, s), 8.64 (d, J = 2.21 Hz, 1H), 8.41

(d, J = 8.98 Hz, 1H), 8.14 (dd, J = 8.91, 2.44 Hz, 1H), 6.64 (dd, J =

17.02, 10.25 Hz, 1H), 6.37 (dd, J = 17.02, 1.42 Hz, 1H), 5.86 (dd, J =

10.17, 1.50 Hz, 1H), 3.68 (4H, br s), 2.92 (d, J = 4.26 Hz, 4H), 1.92

(3H, br s), 1.80 (6H, br s), 1.56−1.70 (6H, m).

2-Aminopyrimidine-5-sulfonyl Chloride. 2-Aminopyrimidine

(3.0 g, 32.0 mmol) was added portionwise to neat chlorosulfonic

acid (18.0 mL, 270.0 mmol) at 0 °C. Upon complete addition, thionyl

chloride (10.0 mL, 137.0 mmol) was added and the mixture was

heated to 150 °C for 92 h. After this time the hot mixture was poured

dropwise onto ice (600 mL) and the resulting mixture was extracted

with ethyl acetate (3 × 200 mL). The organic layer was separated,

dried (MgSO₄), filtered, and concentrated under vacuum. The re-

sulting solid was recrystallized from heptane/diethyl ether to afford the

title compound (1.5 g, 25% yield) as a white solid. δ_H(500 MHz,

CDCl₃) 8.72 (2H, s), 5.79 (2H, br s).

4-(2-Aminopyrimidine-5-sulfonyl)piperazine-1-carboxylic

Acid tert-Butyl Ester. Diisopropylethylamine (0.9 mL, 5.4 mmol)

was added in one portion to a stirred solution of piperazine-1-carboxylic

acid tert-butyl ester (0.45 g, 2.4 mmol) in DCM (10 mL) at room

temperature. To this mixture was added 2-aminopyrimidine-5-sulfonyl

chloride (0.4 g, 2.4 mmol) in one portion, and the mixture was stirred at

room temperature under a nitrogen atmosphere for 1 h. After this time,

the resulting solid was collected by filtration, washed with ether, and

dried under vacuum to afford the title compound (0.44 g, 56% yield) as

a white solid. m/z (ES⁺) (M + 1) 357.

4-(2-Acryloylaminopyrimidine-5-sulfonyl)piperazine-1-car-

boxylic Acid tert-Butyl Ester (25a). Sodium hydride (0.058 g,

1.46 mmol) was added in one portion to a stirred solution of 4-

(2-aminopyrimidine-5-sulfonyl)piperazine-1-carboxylic acid tert-butyl

ester (0.250 g, 0.73 mmol) in THF (5 mL), and the mixture stirred for

5 min. After this time, acryloyl chloride (0.145 g, 1.60 mmol)

was added dropwise and the reaction mixture was stirred at room

temperature overnight before being diluted with ethyl acetate (50 mL)

and washed sequentially with water (20 mL) and brine (20 mL) before

being dried (MgSO₄), filtered, and concentrated under vacuum. The

resulting residue was purified using preparative HPLC to give the title

compound (0.002 g, 1% yield) as an off white solid. MS (ES⁺) m/z

(M + 23) 420; δ_H(500 MHz, DMSO-d₆) 11.41 (1H, br s), 8.85−9.01

(2H, m), 6.71 (dd, J = 17.10, 10.17 Hz, 1H), 6.36 (dd, J = 17.02, 1.58 Hz,

1H), 5.78−5.92 (1H, m), 3.42−3.50 (4H, m), 3.01 (t, J = 4.81 Hz,

4H), 1.36 (9H, s).

4-(2-Acryloylaminopyrimidine-5-sulfonyl)piperazine-1-car-

boxylic Acid Benzyl Ester (25b). MS (ES⁺) m/z (M + 1) 432; δ_H

(500 MHz, MeOD) 8.72−8.86 (2H, m), 7.11−7.27 (5H, m), 6.47−

6.58 (1H, m), 6.37−6.46 (1H, m), 5.73−5.87 (1H, m), 4.98 (2H, s),

3.51 (4H, br s), 2.99 (4H, br s).

N-{5-[4-(Adamantane-1-carbonyl)piperazine-1-sulfonyl]-

pyrimidin-2-yl}acrylamide (25c). MS (ES⁺) m/z (M + 1) 460; δ_H

(500 MHz, CDCl₃) 8.81 (2H, s), 8.21 (1H, s), 6.73 (dd, J = 16.96,

10.36 Hz, 1H), 6.43−6.59 (1H, m), 5.89 (d, J = 11.19 Hz, 1H), 3.74

(t, J = 4.58 Hz, 4H), 2.90−3.09 (4H, m), 1.91−2.00 (4H, m), 1.84

(d, J = 2.02 Hz, 7H), 1.54−1.75 (7H, m).

4-(4-Carboxybenzenesulfonyl)piperazine-1-carboxylic Acid

tert-Butyl Ester. Diisopropylethylamine (2.0 mL, 10.8 mmol) was

added in one portion to a stirred solution of piperazine-1-carboxylic

acid tert-butyl ester (1.0 g, 5.38 mmol) in THF (20 mL) at room tem-

perature. To this mixture was added 4-(chlorosulfonyl)benzoic acid

(1.18 g, 5.38 mmol) portionwise, and the mixture was stirred at room

temperature under a nitrogen atmosphere for 1 h. After this time the

mixture was diluted with DCM (100 mL) and washed with water

(50 mL) before being dried (MgSO₄), filtered, and concentrated to

4-(6-Acryloylaminopyridine-3-sulfonyl)piperazine-1-carbox-

ylic Acid tert-Butyl Ester (24a). 4-(6-Aminopyridine-3-sulfonyl)-

piperazine-1-carboxylic acid tert-butyl ester (0.67 g, 0.51 mmol)

was dissolved in DCM (5 mL). To this solution was added

diisopropylethylamine (0.17 mL, 1.0 mmol) in one portion, and the

resulting mixture was cooled to −78 °C, followed by the dropwise

addition of acryloyl chloride (0.05 mL, 0.61 mmol), and the mixture

was stirred at room temperature under a nitrogen atmosphere for 3 h.

The reaction mixture was then diluted with DCM (20 mL), and the

organic layer was washed sequentially with water (20 mL) and brine

(20 mL) before being dried (MgSO₄), filtered, and concentrated

under vacuum. The resulting residue was purified using flash column

chromatography (elution:, 20% heptane, 80% ethyl acetate) to give the

title compound (0.1 g, 45% yield) as a white solid. MS (ES⁺) m/z

(M + 1) 397; HRMS (ES+) m/z 397.1541 (397.1546 calcd for

1

C₁₇H₂₄N₄O₅S, M + H); H NMR (500 MHz, DMSO) 11.28 (s, 1H),

8.65 (d, J = 2.21 Hz, 1H), 8.41 (d, J = 8.83 Hz, 1H), 8.15 (dd, J = 8.91,

2.44 Hz, 1H), 6.65 (dd, J = 17.02, 10.09 Hz, 1H), 6.38 (dd, J = 16.95,

1.66 Hz, 1H), 5.78−5.94 (m, 1H), 3.41 (br s, 4H), 2.92 (t, J = 4.89 Hz,

4H), 1.35 (s, 9H); ¹³C NMR (126 MHz, DMSO-d₆) δ 164.3, 155.3,

153.4, 147.5, 138.3, 131.0, 129.2, 126.3, 113.3, 79.3, 45.6, 27.9.

4-(6-Acryloylaminopyridine-3-sulfonyl)piperazine-1-carbox-

ylic Acid Benzyl Ester (24b). MS (ES⁺) m/z (M + 1) 431; δ_H(500

MHz, CDCl₃) 8.56 (d, J = 2.02 Hz, 1H), 8.41 (d, J = 8.80 Hz, 1H),

8.12 (1H, s), 7.95 (dd, J = 8.80, 2.38 Hz, 1H), 7.20−7.31 (5H, m),

6.39−6.52 (1H, m), 6.12−6.31 (1H, m), 5.79−5.90 (1H, m), 4.95−

5.07 (2H, m), 3.55 (t, J = 4.86 Hz, 4H), 2.96 (4H, br s).

N-[5-(4-Cyclopropanecarbonylpiperazine-1-sulfonyl)-

pyridin-2-yl]acrylamide (24c). MS (ES⁺) m/z (M + 1) 365; HRMS

1

(ES+) m/z 365.1284 (365.1284 calcd for C₁₆H₂₀N₄O₄S, M + H); H

1042

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

give the title compound (1.41 g, 71% yield) as a white solid. MS (ES⁺) m/z

(M + 23) 393.

4-[4-(3-Ethoxycarbonylallyl)benzenesulfonyl]piperazine-1-

carboxylic Acid Benzyl Ester (28t). (Triphenyl-λ5-phos-

phanylidene)acetic acid ethyl ester (0.08 g, 0.24 mmol) was added

portionwise to a stirred solution of 4-[4-(2-oxoethyl)benzenesulfonyl]-

piperazine-1-carboxylic acid benzyl ester (0.06 g, 0.16 mmol) in

toluene (2 mL), and the mixture was stirred at room temperature

under a nitrogen atmosphere for 24 h. After this time the reaction

mixture was concentrated and the resulting residue was purified using

flash column chromatography (elution, 60% heptane, 40% ethyl

acetate) to give the title compound (0.028 g, 36% yield) as a white

solid. MS (ES⁺) m/z (M + 23) 495; δ_H(500 MHz, DMSO-d₆) 7.63−

7.75 (4H, m), 6.46−6.71 (2H, m), 5.01 (2H, s), 4.02−4.20 (2H, m),

3.41−3.54 (4H, m), 2.88 (4H, br s), 1.15−1.29 (3H, m).

4-[4-(Cyanomethylcarbamoyl)benzenesulfonyl]piperazine-

1-carboxylic Acid tert-Butyl Ester (28n). Diisopropylethylamine

(0.36 mL, 2.16 mmol) was added in one portion to a stirred solution

of 4-(4-carboxybenzenesulfonyl)piperazine-1-carboxylic acid tert-butyl

ester (0.2 g, 0.54 mmol), HATU (0.23 g, 0.59 mmol), and amino-

acetonitrile (0.061 g, 1.8 mmol) in DMF (5 mL), and the mixture was

stirred at room temperature under a nitrogen atmosphere for 18 h.

After this time the mixture was concentrated and the resulting residue

diluted with DCM (100 mL) and washed with water (50 mL) before

being dried (MgSO₄), filtered, and concentrated. The resulting residue

was purified using flash column chromatography (elution, 70% ethyl

acetate, 30% heptane) to give the title compound (0.1 g, 45% yield) as

a white solid. MS (ES⁺) m/z (M + 23) 431; δ_H(500 MHz, DMSO-d₆)

9.50 (1H, br s), 8.10 (d, J = 8.44 Hz, 2H), 7.87 (d, J = 8.44 Hz, 2H),

4.36 (2H, s), 3.40 (4H, br s), 2.89 (t, J = 4.68 Hz, 4H), 1.34 (9H, s).

4-[4-(Cyanomethylcarbamoyl)benzenesulfonyl]piperazine-

1-carboxylic Acid tert-Butyl Ester (28b). Oxone (0.12 g, 0.19

mmol) was added portionwise to a stirred solution of N-[4-(4-cyclo-

pentanecarbonylpiperazine-1-sulfonyl)phenyl]acrylamide (28a, 0.05 g,

0.13 mmol) and sodium bicarbonate (0.05 g, 0.57 mmol) in a 1:1

mixture of acetone−water (2 mL), and the mixture was stirred at room

temperature under a nitrogen atmosphere for 30 min. After this time

the mixture was poured onto water (10 mL) and extracted with ethyl

acetate (3 × 20 mL). The organic extracts were combined and washed

with saturated sodium sulfite (20 mL) and brine (20 mL) before being

dried (MgSO₄), filtered, and concentrated. The resulting residue was

purified using flash column chromatography (elution, 1% methanol,

99% DCM) to give the title compound (0.1 g, 45% yield) as a white

solid. MS (ES⁺) m/z (M + 23) 414; δ_H(500 MHz, CDCl₃) 7.94 (1H, s),

7.51−7.72 (4H, m), 3.64 (2H, br s), 3.48−3.57 (3H, m), 3.08

(t, J = 5.04 Hz, 1H), 2.86−2.97 (5H, m), 2.71 (quin, J = 7.84 Hz, 1H),

1.56−1.74 (7H, m), 1.41−1.53 (8H, m).

4-(4-Carboxymethylbenzenesulfonyl)piperazine-1-carbox-

ylic Acid Benzyl Ester. Diisopropylethylamine (0.93 mL, 5.33

mmol) was added in one portion to a stirred solution of piperazine-1-

carboxylic acid benzyl ester (0.47 g, 2.13 mmol) in THF (10 mL) at

room temperature. To this mixture was added 4-(chlorosulfonyl)-

phenylacetic acid (0.5 g, 2.13 mmol) in one portion, and the mixture

was stirred at room temperature under a nitrogen atmosphere for 1 h.

After this time the solvent was removed under vacuum and the

resulting residue was dissolved in DCM (50 mL) and washed with

HCl (1M, 50 mL) before being dried (MgSO₄), filtered, and con-

centrated to give the title compound (0.72 g, 88% yield) as a white

foam. MS (ES⁺) m/z (M + 1) 419.

4-[4-(2-Hydroxyethyl)benzenesulfonyl]piperazine-1-carbox-

ylic Acid Benzyl Ester. Borane (1 M solution, 3.0 mL, 2.96 mmol)

was added dropwise to a cool (0 °C), stirred solution of 4-

(4-carboxymethylbenzenesulfonyl)piperazine-1-carboxylic acid benzyl ester

(0.62 g, 1.48 mmol) in THF (5 mL), and the mixture was stirred at this

temperature under a nitrogen atmosphere for 2 h. After this time the

reaction mixture was diluted with ethyl acetate (50 mL) and washed with

saturated sodium bicarbonate (50 mL) and water (50 mL) before being

dried (MgSO₄), filtered, and concentrated. The resulting residue was

purified using flash column chromatography (elution, 20% heptane, 80%

ethyl acetate) to give the title compound (0.32 g, 54% yield) as a yellow

oil. MS (ES⁺) m/z (M + 23) 426.

4-[4-(2-Ethoxycarbonylvinyl)benzenesulfonyl]piperazine-1-

carboxylic Acid Benzyl Ester (28s). MS (ES⁺) m/z (M + 23) 481;

δ_H(500 MHz, DMSO-d₆) 8.06 (d, J = 8.20 Hz, 2H), 7.76−7.83 (3H, m),

7.27−7.44 (5H, m), 6.87 (1H, s), 5.08 (2H, s), 4.28 (q, J = 6.94 Hz, 2H),

3.54 (4H, br s), 2.92−3.03 (4H, m), 1.31−1.35 (2H, m).

4-[4-(3-Diazo-2-oxopropyl)benzenesulfonyl]piperazine-1-

carboxylic Acid Benzyl Ester (28v). Thionyl chloride (0.47 mL)

was added dropwise to a stirred solution of 4-(4-carboxy-

methylbenzenesulfonyl)piperazine-1-carboxylic acid benzyl ester

(0.2 g, 0.47 mmol) in toluene (3 mL) at room temperature before

being heated to reflux for 1 h. After this time, the mixture was cooled

to room temperature and concentrated. The resulting residue was

dissolved in ether (5 mL) and added portionwise to a 2 M solution of

diazomethane in ether (20 mL), and the mixture was stirred at room

temperature under a nitrogen atmosphere for 12 h. The resulting solid

precipitate was collected by filtration, washed with ether (50 mL), and

dried under vacuum to give the title compound (0.055 g, 26% yield)

as a white solid. MS (ES⁺) m/z (M + 23) 465; HRMS (ES+) m/z

443.1393 (443.1389 calcd for C₂₁H₂₂N₄O₅S, M + H); ¹H NMR (500 MHz,

DMSO) 7.96 (d, J = 8.24 Hz, 2H), 7.52 (d, J = 8.24 Hz, 2H), 7.33−

7.15 (m, 5H), 6.127 (s, 1H), 5.02 (s, 2H), 3.81 (s, 2H), 3.56−3.51

(m, 4H), 2.92−2.85 (m, 4H); ¹³C NMR (126 MHz, DMSO-d₆) δ

191.7, 154.1, 141.0, 136.5, 133.1, 130.5, 128.4, 127.9, 127.6, 68.5, 54.9,

46.0, 45.6, 42.6 (br).

4-[4-(4-Diazo-3-oxobutyl)benzenesulfonyl]piperazine-1-car-

boxylic Acid Benzyl Ester (28u). MS (ES⁺) m/z (M + 23) 479;

HRMS (ES+) m/z 457.1534 (457.1546 calcd for C₂₂H₂₄N₄O₅S, M + H);

¹H NMR (500 MHz, DMSO) 7.64 (d, J = 8.09 Hz, 2H), 7.50

(d, J = 8.09 Hz, 2H), 7.24−7.39 (m, 5H), 6.11 (br s, 1H), 5.02 (s, 2H),

3.47 (br s, 4H), 2.80−2.98 (m, 6H), 2.69 (br s, 2H).

4-(4-Nitrobenzenesulfonyl)piperazine-1-carboxylic Acid

tert-Butyl Ester. Diisopropylethylamine (3.14 mL, 18.0 mmol) was

added in one portion to a stirred solution of piperazine-1-carboxylic

acid tert-butyl ester (3.05 g, 16.4 mmol) in DCM (20 mL) at room

temperature. To this mixture was added 4-nitrophenylsulfonyl chloride

(3.99 g, 18.01 mmol) portionwise, and the mixture was stirred at room

temperature under a nitrogen atmosphere for 1 h. After this time the

mixture was diluted with DCM (100 mL) and washed with water (50 mL)

before being dried (MgSO₄), filtered, and concentrated to give the title

compound (5.45 g, 90% yield) as a white solid. MS (ES⁺) m/z (M + 1)

372.

1-(4-Nitrobenzenesulfonyl)piperazine. Trifluoroacetic acid

(25 mL) was added dropwise to a cool (0 °C), stirred solution of

4-(4-nitrobenzenesulfonyl)piperazine-1-carboxylic acid tert-butyl ester

(5.45 g, 14.6 mmol) in DCM (25 mL) under a nitrogen atmosphere.

The mixture was allowed to warm to room temperature and stirred

overnight at this temperature. After this time the mixture was con-

centrated to give the title compound (3.95 g, 99% yield) as a yellow

solid. MS (ES⁺) m/z (M + 1) 272.

1-[4-(4-Nitrobenzenesulfonyl)piperazin-1-yl]propenone.

1-(4-Nitrobenzenesulfonyl)piperazine (0.5 g, 1.9 mmol) was dissolved

in THF (5 mL). To this was added diisopropylethylamine (0.98 mL,

5.7 mmol) in one portion followed by the dropwise addition of

acryloyl chloride (0.16 mL, 2.09 mmol), and the mixture was stirred at

room temperature under a nitrogen atmosphere for 3 h. The THF was

removed under vacuum, and the resulting crude material was diluted

with DCM (20 mL) and washed sequentially with NaOH (1 M solution,

4-[4-(2-Oxoethyl)benzenesulfonyl]piperazine-1-carboxylic

Acid Benzyl Ester. Pyridinium chlorochromate (0.05 g, 0.25 mmol)

was added portionwise to a cool (0 °C), stirred solution of 4-[4-(2-

hydroxyethyl)benzenesulfonyl]piperazine-1-carboxylic acid benzyl

ester (0.1 g, 0.25 mmol) in DCM (5 mL) under a nitrogen atmo-

sphere. The mixture was allowed to warm to room temperature before

being stirred at this temperature overnight. After this time the reaction

mixture was concentrated and the resulting residue was purified using

flash column chromatography (elution, 60% heptane, 40% ethyl

acetate) to give the title compound (0.025 g, 25% yield) as a white

solid. MS (ES⁺) m/z (M + 23) 425.

1043

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

10 mL), HCl (1 M solution, 10 mL), and brine (10 mL) before being

dried (MgSO₄), filtered, and concentrated to give the title compound

(0.22 g, 37% yield) as a white powder. MS (ES⁺) m/z (M + 1) 326.

1-[4-(4-Aminobenzenesulfonyl)piperazin-1-yl]propenone.

1-[4-(4-Nitrobenzenesulfonyl)piperazin-1-yl]propenone (0.22 g, 0.68

mmol) was suspended in a 5:1 mixture of ethanol and water (30 mL).

To this solution was added iron powder (0.44 g, 1.8 mmol) followed

by saturated ammonium chloride solution (1 mL), and the mixture

was heated to 80 °C for 3 h. After this time, the reaction mixture was

cooled to room temperature and filtered through a pad of Celite, the

Celite was washed with ethanol (10 mL) and ethyl acetate (50 mL),

and the solution was concentrated under vacuum. The resulting re-

sidue was partitioned between DCM (50 mL) and water (20 mL). The

organic layer was separated, dried with MgSO₄, filtered, and

concentrated to afford the title compound (0.18 g, 89% yield) as a

white solid. MS (ES⁺) m/z (M + H)⁺296.

[4-(4-Acryloylpiperazine-1-sulfonyl)phenyl]carbamic Acid

Benzyl Ester (27). Diisopropylethylamine (0.22 mL, 1.2 mmol)

was added in one portion to a stirred solution of 1-[4-(4-amino-

benzenesulfonyl)piperazin-1-yl]propenone (0.18 g, 0.6 mmol) in THF

(10 mL) at room temperature. To this mixture was added benzyl

chloroformate (0.13 mL, 0.72 mmol) portionwise, and the mixture was

stirred at room temperature under a nitrogen atmosphere for 1 h. After

this time the mixture was diluted with DCM (100 mL) and washed

with water (50 mL) before being dried (MgSO₄), filtered, and con-

centrated. The resulting residue was purified using flash column

chromatography (elution, 100% ethyl acetate) to give the title com-

pound (0.021 g, 8% yield) as a white solid. MS (ES⁺) m/z (M + 1)

430; δ_H(250 MHz, DMSO-d₆) 10.31 (1H, s), 7.58−7.76 (4H, m),

7.26−7.53 (5H, m), 6.69 (dd, J = 16.75, 10.36 Hz, 1H), 6.03 (dd, J =

16.75, 2.28 Hz, 1H), 5.63 (dd, J = 10.51, 2.28 Hz, 1H), 5.17 (2H, s),

3.50−3.69 (4H, m), 2.84 (t, J = 4.72 Hz, 4H).

Incubations in Hepatic Microsomes. Test compound (1 μM)

was incubated in 0.5 mg/mL of pooled male rat, mouse, or human

liver microsomes (obtained commercially) in 0.1 M phosphate buffer

at 37 °C. After the mixture was prewarmed for 5 min, reactions were

initiated by the addition of NADPH (1 mM). Aliquots (80 μL),

samples were taken from the incubation at 0 (control), 5, 10, 20, and

40 min, and the reaction was immediately terminated by adding the

aliquot into 80 μL of acetonitrile containing an analytical internal

standard (IS). Samples were centrifuged and the supernatant fractions

analyzed by LC−MS/MS with multiple reaction monitoring (MRM).

All incubations were performed in duplicate using testosterone as the

positive control. The MRM area response ratio of the analyte over IS

for time = 0 min control was set to 100%. The relative decrease in

MRM area ratio intensity over time against that of the control (percent

parent decrease) was used to determine the half-life (t_1/2) of

memantine in the incubation. Half-life values were calculated from

the relationship t_1/2(min) = −0.693/λ, where λ is the slope of the ln

concentration vs time curve. The intrinsic clearance (Cl_int) was

calculated as Cl_int= (0.693 × incubation volume (μL))/(t_1/2(min) × mg

of microsomal protein)

wherein V_ais the volume in the acceptor compartment and A is the

surface area on the cell membrane.

The efflux ratio (Er) was calculated from the relationship Er =

P_app(B to A)/P_app(A to B), wherein the following assay acceptance

criteria were used: propranolol, P_app(A>B) ≥ 20 (×10⁻⁶cm/s);

vinblastine, P_app(A>B) < 5 (×10⁻⁶cm/s) with Er ≥ 5; Lucifer yellow

permeability of ≤100 nm/s.

Kinetic Solubility (2% DMSO). By use of a 10 mM stock solution

of each compound in 100% DMSO, dilutions are prepared to a

theoretical concentration of 200 μM in phosphate buffered saline

(PBS), pH 7.4 (2% DMSO final concentration), and in 100% DMSO.

An aliquot of the 200 μM DMSO solution is then further diluted to

10 μM, and all dilutions (n = 2 in 96-well plates) were allowed to

equilibrate at room temperature on an orbital shaker for 2 h. The PBS

dilutions are filtered using a Multiscreen HTS solubility filter plate

(Millipore), and filtrates are analyzed by LC−UV and LC−MS. The

concentration of compound in the PBS filtrate is determined by

comparing the UV absorbance peak with that of the two DMSO dilu-

tions which are used as calibration standards. Mass spectrometry is

used to confirm the presence of the expected molecular ion in the UV

peak measured. The effective range of the assay is 5−200 μM, and

compounds returning values close to the upper limit may have much

higher solubility.

Plasma Protein Binding. Compounds (10 μM) are added to

plasma (n = 2) and dialyzed, using a 96-well equilibrium dialysis device

(HT Dialysis), against phosphate buffered saline (pH 7.4) for 6 h at

37 °C. After incubation the contents of each plasma and buffer com-

partment are removed and mixed with equal volumes of control buffer

or plasma as appropriate to maintain matrix similarity for analysis.

Plasma proteins are then precipitated by the addition of acetonitrile

containing analytical internal standard and centrifuged, and the

supernatant is removed for analysis by mass spectrometry (LC−MS/MS).

The percentage drug bound is determined using the following

relationship, where total plasma concentration and free concentration

are the MS responses obtained from analysis of the plasma and buffer

compartments, respectively: % bound = (total plasma concentration −

free concentration) × 100 total plasma concentration. Compound

recovery in the assay and stability in plasma were determined simul-

taneously in the same assay.

ASSOCIATED CONTENT

■

S

* Supporting Information

Interaction profile diagrams of TG2 with peptide 1 generated

using the fragment molecular orbital (FMO) method and k_inact/K_i

versus IC₅₀correlation data for TG1, TG3, and FXIIIa consisting

of data tables and attending graphs. This material is available free

of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION

■

Corresponding Author

*Phone: (310) 342-5518. Fax: (310) 342-5519. E-mail:

john.wityak@chdifoundation.org.

Bidirectional Caco Permeability. CacoReady 24-transwell plates

with plated Caco cells were purchased from Advancell and were

prepared for the experiments following manufacturer’s instructions.

Test compound and reference compounds (propranolol, digoxin, and

vinblastine) were added to either the apical or basolateral chambers of

the transwell plate assembly at a concentration of 10 μM prepared in

Hanks’ balanced salt solution containing 25 mM HEPES (pH 7.4).

Lucifer yellow (LY) was added to the donor buffer in all wells to assess

viability of the cell layer. Since LY cannot freely permeate lipophilic

barriers, results are rejected when a high degree of LY transport (>100 nm/s)

was observed. After 1 h of incubation at 37 °C, aliquots were taken

from both chambers and added to acetonitrile containing an analytical

internal standard in a 96-well plate. Concentrations of compound in

the samples were measured by high performance liquid chromatography/

mass spectrometry (LC−MS/MS).

ACKNOWLEDGMENTS

■

The authors thank Wayne Thomas and Jonathan Austin for

DMPK profiling of program compounds.

ABBREVIATIONS USED

■

TG2, transglutaminase 2; FXIIIa, factor XIIIa; HD, Huntington’s

disease; HTS, high-throughput sceening; GSH, glutathione; DMPK,

drug metabolism and pharmacokinetics; MALDI ToF MS, matrix-

assisted laser desorption/ionization time of flight mass spectrometry;

MM, molecular mechanics; QM, quantun mechanical; FMO,

fragment molecular orbital; SBDD, structure-based drug discovery;

PIE, pair interaction energies; HEK, human embryonic kidney 293;

P_appvalues were calculated from the relationship P_app

=

([compound]_acceptor× V_a)/(A × time([compound]_{donor initial})),

final

1044

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

(20) Case, A.; Stein, R. L. Kinetic analysis of the interaction of tissue

transglutaminase with a nonpeptidic slow-binding inhibitor. Biochem-

istry 2007, 46, 1106−1115.

HEK-TG2, human embryonic kidney cells stably expressing TG2;

PMSF, phenylmethylsulfonyl fluoride

(21) Mastroberardino, P. G.; Iannicola, C.; Nardacci, R.; Bernassola,

F.; DeLaurenzi, V.; Melino, G.; Moreno, S.; Pavone, F.; Oliverio, S.;

Fesus, L.; Piacentini, M. Tissue transglutaminase ablation reduces

neuronal death and prolongs survival in a mouse model of

Huntington’s disease. Cell Death Differ. 2002, 9, 873−880.

(22) Bailey, C.; Johnson, G. Tissue transglutaminase contributes to

disease progression in the R6/2 Huntington’s disease mouse model via

aggregate-independent mechanisms. J. Neurochem. 2005, 92, 83−92.

(23) Chun, W.; Lesort, M.; Tucholski, J.; Faber, P. W.; MacDonald,

M. E.; Ross, C. A.; Johnson, G. V. W. Tissue transglutaminase

selectively modifies proteins associated with truncated mutant

Huntingtin in intact cells. Neurobiol. Dis. 2001, 8, 391−404.

(24) Ruan, Q.; Quintanilla, R. A.; Johnson, G. V. Type 2

transglutaminase differentially modulates striatal cell death in the

presence of wild type or mutant huntingtin. J. Neurochem. 2007, 102,

25−36.

(25) Cariello, L.; de Cristofaro, T.; Zanetti, L.; Cuomo, T.; Di Maio,

L.; Campanella, G.; Rinaldi, S.; Zanetti, P.; Di Lauro, R.; Varrone, S.

Transglutaminase activity is related to CAG repeat length in patients

with Huntington’s disease. Hum. Genet. 1996, 98, 633−635.

(26) Lai, T.-S.; Liu, Y.; Tucker, T.; Daniel, K. R.; Sane, D. C.; Toone,

E.; Burke, J. R.; Strittmatter, W. J.; Greenberg, C. S. Identification of

chemical inhibitors to human tissue transglutaminase by screening

existing drug libraries. Chem. Biol. 2008, 15, 969−978.

(27) Schaertl, S.; Prime, M.; Wityak, J.; Dominguez, C.; Munoz-

Sanjuan, I.; Pacifici, R.; Courtney, S.; Scheel, A.; Macdonald, D. A

profiling platform for the characterisation of transglutaminase 2 (TG2)

inhibitors. J. Biomol. Screening 2010, 15, 478−487.

(28) Huber, M.; Rettler, I.; Bernasconi, K.; Frenk, E.; Lavrijsen, S. P.;

Ponec, M.; Bon, A.; Lautenschlager, S.; Schorderet, D. F.; Hohl, D.

Mutations of keratinocyte transglutaminase in lamellar ichthyosis.

Science 1995, 267, 525−528.

(29) Boeshans, K. M.; Mueser, T. C.; Ahvazi, B. A three-dimensional

model of the human transglutaminase 1: insights into the under-

standing of lamellar ichthyosis. J. Mol. Model. 2007, 13, 233−246.

(30) Seitz, R.; Duckert, F.; Lopaciuk, S.; Muszbek, L.; Rodeghiero, F.;

Seligsohn, U. ETRO working party on factor XIII questionnaire on

congenital FXIII deficiency in Europe: status and perspective. Semin.

Thromb. Hemostasis 1996, 22, 415−425.

(31) MacFaul, P. A.; Morley, A. D.; Crawford, J. J. A simple in vitro

assay for assessing the reactivity of nitrile containing compounds.

Bioorg. Med. Chem. Lett. 2009, 19, 1136−1138.

REFERENCES

■

(1) Greenberg, C. S.; Birckbichler, R. H. Transglutaminases:

multifunctional cross-linking enzymes that stabilize tissues. FASEB J.

1991, 5, 3071−3077.

(2) Im, M.-J.; Riek, P.; Graham, R. A novel guanine nucleotide-

binding protein coupled to the α1-adrenergic receptor. J. Biol. Chem.

1990, 265, 18952−18960.

(3) Lai, T.-S.; Slaughter, T.; Peoples, K.; Hettasch, J.; Greenburg, C.

Regulation of human tissue transglutaminase function by magnesium−

nucleotide complexes. J. Biol. Chem. 1998, 273, 1776−1781.

(4) Hasegawa, G.; Suwa, M.; Ichikawa, Y.; Ohtsuka, T.; Kumagai, S.;

Kikuchi, M.; Sato, Y.; Saito, Y. A novel function of tissue-type

transglutaminase: protein disulfide isomerase. Biochem. J. 2003, 373,

793−803.

(5) Appelt, D. M.; Kopen, G. C.; Boyne, L. J.; Balin, B. J. Localization

of transglutaminase in hippocampal neurons: implications for

Alzheimer’s disease. J. Histochem. Cytochem. 1996, 44, 1421−1427.

(6) Aeschlimann, D.; Kaupp, O.; Paulsson, M. Transglutaminase-

catalyzed matrix cross-linking in differentiating cartilage: identification

of osteonectin as a major glutaminyl substrate. J. Cell Biol. 1995, 129,

881−892.

(7) Mastroberardino, P. G.; Farrace, M.; Viti, I.; Pavone, F.; Fimia,

G.; Melino, G.; Kodolfo, C.; Piacentini, M. Tissue transglutaminase

contributes to the formation of disulphide bridges in proteins of

mitochondrial respiratory complexes. Biochim. Biophys. Acta 2006,

1757, 1357−1365.

(8) Molberg, O.; McAdam, S.; Sollid, L. Role of tissue trans-

glutaminase in celiac disease. Journal of Paediatr., Gastroenterol. Nutr.

2000, 30, 232−240.

(9) Mangala, L.; Mehta, K. Tissue Transglutaminase (TG2) in

Cancer Biology. In Transglutaminases: The Family of Enzymes with

Diverse Functions; Mehta, K., Eckert, R., Eds.; Karger: Basel,

Switzerland, 2005; pp 125−138.

(10) Siegel, M.; Khosla, C. Transglutaminase 2 inhibitors and their

therapeutic role in disease states. Pharmacol. Ther. 2007, 115, 232−

245.

(11) Jeitner, T.; Pinto, J.; Krasnikov, B.; Horswill, M.; Cooper, A.

Transglutaminases and neurodegeneration. J. Neurochem. 2009, 109,

160−166.

(12) Stamnaes, J.; Pinkas, D. M.; Fleckenstein, B.; Khosla, C.; Sollid,

L. M. Redox regulation of transglutaminase 2 activity. J. Biol. Chem.

2010, 285, 25402−25409.

(13) Liu, S.; Cerione, R. A.; Clardy, J. Structural basis for the guanine

nucleotide-binding activity of tissue transglutaminase and its regulation

of transamidation activity. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 2743−

2747.

(32) Simeonov, A.; Jadhav, A.; Thomas, C. J.; Wang, Y.; Huang, R.;

Southall, N. T.; Shinn, P.; Smith, J.; Austin, C. P.; Auld, D. S.; Inglese,

J. Fluorescence spectroscopic profiling of compound libraries. J. Med.

Chem. 2008, 51, 2363−2371.

(33) Lor, L. A.; Schneck, J.; McNulty, D. E.; Diaz, E.; Brandt, M.;

Thrall, S. H.; Schwartz, B. A simple assay for detection of small-

molecule redox activity. J. Biomol. Screening 2007, 12, 881−890.

(34) Kitaura, K.; Ikeo, E.; Asada, T.; Nakano, T.; Uebayasi, M.

Fragment molecular orbital method: an approximate computational

method for large molecules. Chem. Phys. Lett. 1999, 313, 701−706.

(35) Fedorov, D. G.; Kitaura, K. Extending the power of quantum

chemistry to large systems with the fragment molecular orbital

method. J. Phys. Chem. 2007, 111, 6904−6914.

(14) Pinkas, D.; Strop, P.; Brunger, A.; Khosla, C. Transglutaminase

2 undergoes a large conformational change upon activation. PLOS Biol.

2007, 5, 2788−2796.

(15) Pardin, C.; Gillet, S. M. F. G.; Keillor, J. W. Synthesis and

evaluation of peptidic irreversible inhibitors of tissue transglutaminase.

Bioorg. Med. Chem. 2006, 14, 8379−8385.

(16) Watts, R. E.; Siegel, M.; Khosla, C. Structure−activity

relationship analysis of the selective inhibition of transglutaminase 2

by dihydroisoxazoles. J. Med. Chem. 2006, 49, 7493−7501.

(17) Griffin, M.; Mongeot, A.; Collighan, R.; Saint, R. E.; Jones,

R. A.; Coutts, I. G. C.; Rathbone, D. L. Synthesis of potent water-soluble

tissue transglutaminase inhibitors. Bioorg. Med. Chem. Lett. 2008, 18,

5559−5562.

(18) Duval, E.; Case, A.; Stein, R. L.; Cuny, G. D. Structure−activity

relationship study of novel tissue transglutaminase inhibitors. Bioorg.

Med. Chem. Lett. 2005, 15, 1885−1889.

(19) Ozaki, S.; Ebisui, E.; Hamada, K.; Goto, J.-I.; Suzuki, A. Z.;

Terauchi, A.; Mikoshiba, K. Potent transglutaminase inhibitors, aryl

β-aminoethyl ketones. Bioorg. Med. Chem. Lett. 2010, 20, 1141−1144.

(36) Ahvazi, B.; Boeshans, K. M.; Rastinejad, F. The emerging

structural understanding of transglutaminase 3. J. Struct. Biol. 2004,

147, 200−207.

(37) Yee, V. C.; Pedersen, L. C.; Trong, I. L.; Bishop, P. D.;

Stenkamp, R. E.; Teller, D. C. Three-dimensional structure of a

transglutaminase: human blood coagulation factor XIII. Proc. Natl.

Acad. Sci. U.S.A. 1994, 91, 7296−7300.

(38) Halim, D.; Caron, K.; Keillor, J. W. Synthesis and evaluation of

peptidic maleimides as transglutaminase inhibitors. Bioorg. Med. Chem.

Lett. 2007, 17, 305−308.

1045

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Journal of Medicinal Chemistry

Article

(39) Boyd, M. J.; Crane, S. N.; Robichaud, J.; Scheigetz, J.; Black,

́

W. C.; Chauret, N.; Wang, Q.; Masse, F.; Oballa, R. M. Investigation

of ketone warheads as alternatives to the nitrile for preparation of

potent and selective cathepsin K inhibitors. Bioorg. Med. Chem. Lett.

2009, 19, 675−679.

(40) McConoughey, S. J.; Basso, M.; Niatsetskaya, Z. V.; Sleiman,

S. F.; Smirnova, N. A.; Brett C. Langley, B. C.; Mahishi, L.; Cooper,

A. J. L.; Antonyak, M. A.; Cerione, R. A.; Li, B.; Starkov, A.; Chaturvedi, R.;

Beal, M. F.; Coppola, G.; Geschwind, D. H.; Ryu, H.; Li, X.; Lismaa, S. E.;

Pallos, J.; Pasternack, R.; Hils, M.; Fan, J.; Lynn A. Raymond, L. A.; Marsh,

J. L.; Thompson, L. M.; Ratan, R. R. Inhibition of transglutaminase 2

mitigates transcriptional dysregulation in models of Huntington disease.

EMBO Mol. Med. 2010, 2, 1−22.

(41) Chun, W.; Lesort, M.; Tucholski, J.; Faber, P. W.; MacDonald,

M. E.; Ross, C. A.; Johnson, G. V. W. Tissue transglutaminase

selectively modifies proteins associated with truncated mutant

huntingtin in intact cells. Neurobiol. Dis. 2001, 8, 391−404.

(42) Jeitner, T. M.; Matson, W. R.; Folk, J. E.; Blass, J. P.; Cooper,

A. J. L. Increased levels of γ-glutamylamines in Huntington disease

CSF. J. Neurochem. 2008, 106, 37−44.

(43) Verdonk, M. L.; Cole, J. C.; Hartshorn, M. J.; Murray, C. W.;

Taylor, R. D. Improved protein−ligand docking using GOLD. Proteins:

Struct., Funct., Genet. 2003, 52, 609−623.

(44) Schmidt, M. W.; Baldridge, K. K.; Boatz, J. A.; Elbert, S. T.;

Gordon, M. S.; Jensen, J. H.; Koseki, S.; Matsunaga, N.; Nguyen, K. A.;

Su, S.; Windus, T. L.; Dupuis, M.; Montgomery, J. A. General atomic

and molecular electronic structure system. J. Comput. Chem. 1993, 14,

1347−1363.

(45) Suenaga, M. Facio: new computational chemistry environment

for PC GAMESS. J. Comput. Chem. Jpn 2005, 4, 25−32.

(46) Suenaga, M. Development of GUI for GAMESS/FMO

Calculation. J. Comput. Chem. Jpn 2008, 7, 33−53.

(47) Labute, P. The generalized Born/volume integral implicit

solvent model: estimation of the free energy of hydration using

London dispersion instead of atomic surface area. J. Comput. Chem.

2008, 29, 1693−1698.

1046

dx.doi.org/10.1021/jm201310y | J. Med. Chem. 2012, 55, 1021−1046

Article Doi

Discovery and structure-activity relationship of potent and selective covalent inhibitors of transglutaminase 2 for Huntington's disease

DOI: 10.1021/jm201310y

Source and publish data:

Authors:

Article abstract of DOI:10.1021/jm201310y

Full text of DOI:10.1021/jm201310y

Products guided by the article

R&D Labs maybe for 1306723-08-9

Relevant to this article

Hot Product