On the substrate- and stereospecificity of the plant carotenoid cleavage dioxygenase 7

Article abstract of DOI:10.1016/j.febslet.2014.03.041

Strigolactones are phytohormones synthesized from carotenoids via a stereospecific pathway involving the carotenoid cleavage dioxygenases 7 (CCD7) and 8. CCD7 cleaves 9-cis-β-carotene to form a supposedly 9-cis-configured β-apo-10′-carotenal. CCD8 converts this intermediate through a combination of yet undetermined reactions into the strigolactone-like compound carlactone. Here, we investigated the substrate and stereo-specificity of the Arabidopsis and pea CCD7 and determined the stereo-configuration of the β-apo-10′-carotenal intermediate by using Nuclear Magnetic Resonance Spectroscopy. Our data unequivocally demonstrate the 9-cis-configuration of the intermediate. Both CCD7s cleave different 9-cis-carotenoids, yielding hydroxylated 9-cis-apo-10′-carotenals that may lead to hydroxylated carlactones, but show highest affinity for 9-cis-β-carotene.

Full text of DOI:10.1016/j.febslet.2014.03.041

FEBS Letters 588 (2014) 1802–1807
journal homepage: www.FEBSLetters.org
On the substrate- and stereospecificity of the plant carotenoid cleavage
dioxygenase 7
Mark Bruno a,1, Manuel Hofmann a,1, Martina Vermathen b, Adrian Alder a, Peter Beyer a,
Salim Al-Babili a,c,
⇑
a Albert-Ludwigs University of Freiburg, Faculty of Biology, Schaenzlestr. 1, D-79104 Freiburg, Germany
b Department of Chemistry and Biochemistry, University of Bern, 3012 Bern, Switzerland
c Center for Desert Agriculture, BESE Division, King Abdullah University of Science and Technology (KAUST), 23955-6900 Thuwal, Saudi Arabia
a r t i c l e i n f o
a b s t r a c t
Article history:
Strigolactones are phytohormones synthesized from carotenoids via a stereospecific pathway
involving the carotenoid cleavage dioxygenases 7 (CCD7) and 8. CCD7 cleaves 9-cis-b-carotene to form
a supposedly 9-cis-configured b-apo-100-carotenal. CCD8 converts this intermediate through a
combination of yet undetermined reactions into the strigolactone-like compound carlactone. Here,
we investigated the substrate and stereo-specificity of the Arabidopsis and pea CCD7 and determined
the stereo-configuration of the b-apo-100-carotenal intermediate by using Nuclear Magnetic
Resonance Spectroscopy. Our data unequivocally demonstrate the 9-cis-configuration of the
intermediate. Both CCD7s cleave different 9-cis-carotenoids, yielding hydroxylated 9-cis-apo-100-
carotenals that may lead to hydroxylated carlactones, but show highest affinity for 9-cis-b-carotene.
Ó 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Received 11 February 2014
Revised 17 March 2014
Accepted 19 March 2014
Available online 28 March 2014
Edited by Julian Schroeder
Keywords:
Apocarotenoid
Carlactone
Carotenoid
Carotenoid cleavage dioxygenase
Strigolactone
1. Introduction
carotenoids that derive from the colorless carotene phytoene.
Desaturation and isomerization reactions lead to lycopene, the
Strigolactones (SLs) are a novel class of plant hormones that
determine various aspects of plant development [1–6], including
shoot branching [7,8], root architecture [9–11], senescence [12]
and cambium secondary growth [13]. Released by plants into the
rhizosphere, SLs also induce hyphal branching of symbiotic fungi
[14], a prerequisite for establishing mycorrhizal symbiosis that
provides the plant hosts with water and minerals. SLs also trigger
seed germination of obligate root parasitic plants, such as Striga
and Orobanche species [1–3].
SLs belong to the apocarotenoids [15–18], a group of carotenoid-
derived, physiologically important compounds that includes reti-
noids, the phytohormone abscisic acid and the fungal pheromone
trisporic acid [19]. The precursors of SLs, the carotenoids, are
isoprenoid pigments with an extended conjugated double bond
system synthesized by all photosynthetic organisms and many het-
erotrophic bacteria and fungi [20–23]. Plants accumulate several
red linear precursor of the bicyclic b-and
of the b- and -ring of b-carotene and of the
-carotene give rise to zeaxanthin and lutein, respectively.
e
-carotene. Hydroxylation
e
e-ionone rings of
e
Zeaxanthin can be epoxydated to yield violaxanthin the precursor
of neoxanthin that carries an epoxydated b-ionone ring on the
one end and an allen system on the other. Plant carotenoids also
differ in their stereo-configuration and occur all-trans configured
as well as in different cis-isomeric forms like 9-cis-violaxanthin
and 9-cis-b-carotene, the precursors of abscisic acid and SLs, respec-
tively [15,16,24]. Like with other apocarotenoids, the synthesis of
these hormones is initiated by oxidative cleavage of double bonds
in carotenoid backbones, a reaction that is generally catalyzed by
carotenoid cleavage oxygenases.
Plant carotenoid cleavage oxygenases are classified into nine-
cis-epoxy-carotenoid-dioxygenases that cleave 9-cis-violaxanthin
and 90-cis-neoxanthin to yield xanthoxin the precursor of ABA,
and carotenoid cleavage dioxygenases (CCDs), a general term ap-
plied for all other members of this plant enzyme family [15–17].
Plant CCDs are divided into 4 groups, CCD1, CCD4, CCD7 and
CCD8, differing in their substrate specificities and cleavage sites
[15–17]. CCD1 enzymes are characterized by wide substrate and
cleavage-site specificity [15,16,25], cleaving cyclic and acyclic
⇑
Corresponding author at: Center for Desert Agriculture, BESE Division, King
Abdullah University of Science and Technology (KAUST), 23955-6900 Thuwal, Saudi
Arabia.
E-mail address: salim.babili@kaust.edu.sa (S. Al-Babili).
These authors contributed equally to this work.
1
http://dx.doi.org/10.1016/j.febslet.2014.03.041
0014-5793/Ó 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

M. Bruno et al. / FEBS Letters 588 (2014) 1802–1807
1803
all-trans-carotenoids [17], as well as apocarotenoids, like b-apo-80-
carotenal [26,27], b-apo-100-carotenal and apolycopenals [28]. This
activity leads to various volatiles like b-ionone, 6-methyl-5 hep-
ten-2-one (MHO; C8) [27] and geranial [28], and indicates a func-
tion in scavenging destructed carotenoids [29]. CCD4 enzymes
from different plants produce b-ionone by cleaving b-carotene or
b-apo-80-carotenal at the C9–C10 double bond [30,31], and studies
on the Arabidopsis CCD4 suggested its role as a negative regulator
of the b-carotene level in seeds [32,33]. Similarly, decreasing the
activity of CCD enzymes lead to an enhancement in carotenoid
content of chrysanthemum flowers [34], potato tubers [35] and
peach fruits [36]. However, it was recently reported that CCD4
enzymes contributes to the deep color of Citrus fruit peels by
cleaving the 70,80 double bond in b-carotene, b-cryptoxanthin
and zeaxanthin, leading to the pigments b-apo-80-carotenal and
3-OH-b-apo-80-carotenal (b-citraurin) [37,38].
CCD7 and CCD8 are involved in SLs biosynthesis [7,8].
Expression of CCD7 from Arabidopsis and tomato in carotenoid
accumulating Escherichia coli strains suggested the cleavage at
the 9,10 or 90,100 site, leading to C13 volatiles, e.g. b-ionone, and
C27 apocarotenals such as b-apo-100-carotenal [39,40], which is
converted upon co-expression of the Arabidopsis CCD8 into
b-apo-13-carotenone [40]. Considering that the E. coli strains used
mainly accumulate all-trans-configured carotenoids, these results
indicated that SLs are synthesized via the intermediate b-apo-13-
carotenone produced by CCD7 and CCD8 from all-trans-b-carotene.
However, a recent in vitro study suggested a new path to SLs via
carlactone [24], a SLs-like compound that has been very recently
also identified in planta [41]. This pathway starts with the D27-cat-
alyzed isomerization of all-trans- into 9-cis-b-carotene that is
cleaved by CCD7 to yield b-ionone and 9-cis-b-apo-100-carotenal
used by CCD8 to form carlactone, supposedly by catalyzing a
combination of different reactions [24]. The 9-cis identity of the
apocarotenal produced by CCD7 was determined by HPLC-compar-
ison with a synthetic all-trans-b-apocarotenal and to a supposedly
9-cis-configured b-apo-100-carotenal produced by a CCD1 from
9-cis-b-carotene [42].
added. The Solution was exposed to a table lamp for 30 min. Lipo-
philic pigments were partitioned using water, petroleum ether/
diethyl ether (1:4) and acetone, washed several times with water
and dried. Isomers obtained were separated and collected by HPLC.
2.3. HPLC
For preparative isolation, we used a Waters separation system
2695 equipped with a photodiode array detector (model 2996)
and a YMC-Pack C30-reversed phase column (250 ꢀ 10 mm i.d.,
5 lm; YMC Europe, Schermbeck, Germany). The collected fractions
were dried and resolved in CH2Cl2. Lutein, zeaxanthin and crypto-
xanthin isomers were separated with the solvents B: MeOH/H2O/
TBME (60:12:12, v/v/v) and A: MeOH/TBME (50:50, v/v). The col-
umn was developed isocratically with 50% A at a flow-rate of
2.4 ml/min for 5 min, followed by a linear gradient to 80% A within
20 min, then to 100% A within 2 min. The final conditions were
kept at a flow rate of 3 ml/min for 5.5 min. Violaxanthin isomers
were separated with the solvents B: MeOH/H2O/TBME (30:10:1,
v/v/v) and A: MeOH/TBME (50:50, v/v). The column was developed
isocratically with 65% A at a flow-rate of 2.4 ml/min for 8 min, fol-
lowed by a linear gradient to 75% A within 8 min. The final condi-
tions were kept for 6 min.
In vitro assays were analyzed using a YMC-Pack C30-reversed
phase column (150 ꢀ 4.6 mm i.d., 5
lm; YMC Europe, Schermbeck,
Germany) and the solvent B: MeOH/H2O/TBME (5:1:1, v/v/v) and
A: MeOH/TBME (1:1, v/v). The column was developed at a flow-
rate of 0.75 ml/min with a gradient from 100% B to 100% A within
20 min, maintaining these final conditions for 4 min.
2.4. In vitro assays
BL21(DE3) E. coli cells that contain the plasmid pGro7 were
transformed with pThio-AtCCD7 and pThio-PsCCD7 expressing
the thioredoxin-fusion of each enzyme [24]. Control cells were
transformed with the void plasmid pBAD/THIO-TOPOÒTA
(Invitrogen). Crude lysates were obtained and prepared as
described previously [43]. Standard in vitro assays were performed
The stereo-configuration of the b-apo-100-carotenal produced
by CCD7 determines the nature of the CCD8 product and is crucial
for identifying and understanding the reactions leading to
carlactone [24,43]. In addition, the cleavage of 9-cis-configured
carotenoids other than 9-cis-b-carotene by CCD7 may lead to the
formation of novel carlactone species, like 3-OH-carlactone,
and, hence, to novel types of strigolactones. In this study, we
unequivocally determined the configuration of the b-apo-100-car-
otenal produced by the Arabidopsis CCD7, using NMR, and
investigated the substrate specificity of the Arabidopsis and pea
CCD7.
in a total volume of 200
ll containing the substrate at a 160 lM
concentration and 50 l of crude lysate of expressing E. coli cells.
l
Crude lysates and assays were prepared and conducted according
to [43]. The plasmid pThio-DAN2-AtNCED2 was used as a positive
control in the 9-cis-violaxanthin assay (Supplementary Fig. 2)
prepared like other assays. It was constructed by amplifying the
AtNCED2 [45] cDNA from Arabidopsis total cDNA, using the Phusion
High-Fidelity DNA Polymerase (Finnzymes) and the primers:
AtNCED2for: 50atggtttctcttcttacaatgccgatgag30 and AtNCED2rev: 50
ttataattgatcaacgagttcattcgaatcc 30. The obtained fragment was
ligated into pCR2.1 (Invitrogen) and subsequently inserted into
pThio-DAN2, a derivative of pBADÒ/Thio-TOPOÒ (Invitrogen).
2. Materials and methods
2.5. Michaelis–Menten kinetics
2.1. Photometrical measurements
2.5.1. In vitro assays for Michaelis–Menten
Kinetic measurements were performed in vitro like standard
assays, however, with substrate concentrations ranging from 5 to
140 lM and 3.75 lg/ll total protein concentration. Assays were
incubated for 5 min at 28 °C under shaking. Three technical repli-
Substrates were quantified spectrophotometrically at their
individual kmax according to the extinction coefficients calculated
from E1% as given by [44]. Protein contents were determined using
a Biorad Bradford protein assay (BIO-RAD).
cates of each substrate concentration were performed. Assays were
extracted according to [43], and extracts were dissolved in 40 ll
2.2. Isomerization and preparation of carotenoids
CHCl3 and analyzed by HPLC, using tocopherole acetate as internal
standard. Total amounts of products were calculated based on
calibration with synthetic all-trans-b-apo-100-carotenal. Curve
fitting was done, using the Michaelis–Menten equation, with the
GraphPad Prism 6 software (GraphPad Software, La Jolla, USA).
9-cis-b-carotene
was
purchased
from
Carotenature.
Cryptoxanthin and zeaxanthin were kindly provided by the BASF
(Ludwigshafen). Lutein and violaxanthin were isolated from spin-
ach. For isomerization, carotenoids were dissolved in n-hexan or
CH2Cl2, and a catalytic quantity of iodine solved in n-hexan was

1804
M. Bruno et al. / FEBS Letters 588 (2014) 1802–1807
2.6. Large scale in vitro assay and purification of 9-cis-b-apo-100-
carotenal
tion. For 2D 1H–13C-HMBC, the gradient-enhanced HMBC experi-
ment with twofold low-pass J-filter to suppress one-bond
correlations and echo-antiecho acquisition mode (hmbcetgpl3nd),
64 transients, a relaxation time of 1 s, an acquisition time of
0.21 s, spectral widths (in f2 and f1) of 12 ppm and 240 ppm with
2048 and 256 acquired data points respectively, were used. Data
were processed by zero-filling (to 1024) and linear prediction in
f1, and by using shifted sine window functions in both dimensions
prior to Fourier transformation.
The assay was performed in a total volume of 100 ml. 8.28 ml of
1.45 mM CH2Cl2 solution of 9-cis-b-carotene was mixed with 10 ml
of 0.8%, v/v ethanolic Triton X-100 (Sigma, Deisenhofen) solution,
Sigma, Deisenhofen, Germany), dried and re-suspended in 25 ml
H2O. The micelles were mixed with 50 ml 2 ꢀ incubation buffer
[43], and 25 ml of crude lysate was then added. After incubation
for 6 h at 28 °C, lipophilic compounds were extracted according
to [43], dried and dissolved in CH2Cl2. The extract was then sepa-
rated by thin-layer silica reverse phase plates (RP-18; Merk,
Darmstadt) developed in methanol/water (100:1, v/v), and 9-cis-
b-apo-100-carotenal was scraped off in dim daylight and eluted
with CH2Cl2. For purification, we used two different HPLC systems.
The first consisted of a YMC-Pack C30-reversed phase column
3. Results and discussion
To investigate the substrate specificity of AtCCD7 and PsCCD7,
we expressed both enzymes as thioredoxin-fusion in BL21(DE3)
E. coli cells, transformed with the plasmid pGro7 that encodes
the groES-groEL-chaperone system, and performed in vitro
assays with crude lysates according to [43]. Incubation with
9-cis-b-carotene led, as previously reported [24], to the supposed
9-cis-b-apo-100-carotenal (Fig. 1, P1), besides b-ionone. Similarly,
both enzymes cleaved the 90,100 double bond in 9-cis-zeaxanthin,
leading to 9-cis-3-OH-b-apo-100-carotenal (Fig. 1, P2) and
3-OH-b-ionone whose identities were confirmed by LC-MS
(Supplementary Fig. 1). Due to the presence of two different
ionone rings, lutein can occur as 9-cis- (the cis double bond is on
(250 ꢀ 10 mm i.d., 5
lm; YMC Europe, Schermbeck, Germany)
with the solvent B: MeOH/H2O/TBME (60:12:12, v/v/v) and A:
MeOH/TBME (50:50, v/v). The column was developed isocratically
with 40% A at a flow-rate of 2.1 ml/min for 24 min, followed by
switching to 100% A within 1 min and enhancing the flow-rate to
3 ml/min within 3 min. The second purification step was per-
formed using a MN Nucleosil 100 C18-reversed phase column
(250 ꢀ 4 mm i.d., 10
lm; Machery-Nagel, Düren, Germany). The
column was developed isocratically with MeOH/H2O (4:1, v/v) at
the
e
-ionone site) and 90-cis-isomer (the cis double bond is on
a flow rate of 1 ml/min.
2.7. NMR measurement
For NMR analyses, a sample of ca. 700 l
g b-apo-100-carotenal
was dissolved in 500 ll CD2Cl2. The NMR experiments were per-
formed on a Bruker AVANCE II spectrometer operating at a 1H res-
onance frequency of 400.13 MHz and equipped with a 5 mm ATM
BBFO SmartProbe with a z-gradient coil and with pulse angles of
10 l l
s (1H) and 10 s (13C), respectively. Bruker TOPSPIN software
(version 3.0, patch level 3) was used to acquire and process the
NMR data. The measurements were carried out at room tempera-
ture (298 K). For the 1D 1H experiment, a standard one-pulse
experiment (zg) was used with 32 transients, a spectral width of
12 ppm, a data size of 32 K points, a relaxation delay of 5 s, and
an acquisition time of 3.41 s Unambiguous signal assignment of
the 1H resonances was performed based on 2D 1H–1H-COSY,
1H–13C-HSQC, and 1H–13C-HMBC experiments. For 2D 1H–1H-
NOESY (Supplementary Fig. 12), the gradient-enhanced phase-sen-
sitive NOESY experiment (noesygpphpp) was applied with a mix-
ing time of 200 ms. 32 transients, a relaxation delay of 1 s, an
acquisition time of 0.22 s, a spectral width of 11.5 ppm in both
dimensions (f2, f1), 2048 and 256 acquired data points in f2 and
f1 respectively were used. Data were processed by zero filling (to
1024) in f1 and by using shifted squared sine window functions
in both dimensions prior to 2D Fourier transformation. For 2D
1H–1H-COSY the gradient-enhanced COSY experiment for magni-
tude mode of detection (cosygpqf), 32 scans, a relaxation delay of
1 s, an acquisition time of 0.43 s, a spectral width in both dimen-
sions (f2, f1) of 12 ppm, 4096 and 256 acquired data points in f2
and f1 respectively were used. Data were processed by zero filling
(to 1024) in f1 and by using unshifted squared sine window func-
tions in both dimensions prior to 2D Fourier transformation. For 2D
1H–13C-HSQC, the gradient-enhanced HSQC experiment with car-
bon multiplicity editing and echo–antiecho acquisition mode
(hsqcedetgpsisp2.2), 32 transients, a relaxation time of 1.5 s, an
acquisition time of 0.21 s, spectral widths of 12 ppm and
190 ppm (in f2 and f1), with 2048 and 256 acquired data points
respectively, were used. Data were processed by zero-filling (to
1024) and linear prediction in f1, and by using shifted squared sine
window functions in both dimensions prior to Fourier transforma-
Fig. 1. HPLC analysis of AtCCD7 and PsCCD7 substrate specificity. Incubations with
9-cis-b-carotene (A) led to the 9-cis-b-apo-100-carotenal (P1). Both enzymes
converted also 9-cis-zeaxanthin into 9-cis-3-OH-b-apo-100-carotenal (P2). Incuba-
tion of the two lutein isomers (9- and 90-cis-lutein) unraveled the cleavage of the
former into 9-cis-3-OH-e
-apo-100-carotenal (P3), while the second substrate (peak
⁄) remained unconverted. UV–Vis-spectra of the products are depicted in the insets.
Above structures of the substrates tested showing the cleavage site at the 90–100
double bond.

M. Bruno et al. / FEBS Letters 588 (2014) 1802–1807
1805
100
B
A
C
1500
1000
500
0
80
60
40
20
0
0
50
100
0
9-cis-β5-C0 arotene (µM1)00
9-cis-β-Carotene (µM)
30
20
10
0
D
2000
1500
1000
500
0
0
100
0
50
100
9-cis-Z5e0axanthin (µM)
9-cis-Zeaxanthin (µM)
Fig. 2. Kinetics of AtCCD7 and PsCCD7. AtCCD7 and PsCCD7 were incubated with 9-cis-b-carotene (A, C) and 9-cis-zeaxanthin (B, D), respectively. Curves were fitted using the
Michaelis–Menten equation (goodness of fit was determined as follows: R2 = 0.97 for A, 0.97 for B, 0.96 for C, and 0.91 for D). Curves represent the average of three technical
replicates ( S.E.).
Table 1
Vmax and Km of AtCCD7 and PsCCD8. Values are deduced from Michaelis–Menten plots.
AtCCD7
PsCCD7
9-cis-b-carotene
9-cis-zeaxanthin
9-cis-b-carotene
9-cis-zeaxanthin
Vmax (pmol/min)
Km M)
2251 283
41.1 11.9
4989 1873
148.7 81.7
129.2 17.4
59.6 17.2
181.5*
626.0*
(
l
*
Values given are approximations. Due to the high Km value, experiments with higher substrate concentrations would be needed, which are beyond the scale of
feasibility.
the b-ionone site, peak ⁄ in Fig. 1C). As shown in Fig. 1, the two en-
zymes converted mainly the tentative 9-cis-lutein into an apoca-
rotenal (Fig. 1, P3) with a lightly shorter retention time and
lower absorption maximum than those of 9-cis-3-OH-b-apo-100-
carotenal. Both features together with the nature of the precursor
Table 2
13
1H and C NMR data of b-apo-100-carotenal produced by AtCCD7. Experimental
resonance assignments (ppm) and relevant NOE cross peaks observed in the 2D-
NOESY experiment of b-apo-100-carotenal dissolved in CD2Cl2.
1H
13C
1H–1H-NOESY
suggest that this product (P3) is 9-cis-3-OH-e
-apo-100-carotenal.
1
2
3
4
5
6
7
8
9
10
–
34.1
In contrast, we did not observe significant conversion of 90-cis-
lutein, indicating that the presence of a b-ionone ring on the all-
trans-configured moiety of the substrate is a prerequisite for the
cleavage. We also tested the conversion of 9-cis/90-cis-cryptoxathin
and 9-cis-violaxanthin. Both enzymes did not show any detectable
conversion of 9-cis-violaxanthin (Supplementary Fig. 2A), indicat-
ing that CCD7 activity does not interfere with ABA biosynthesis
that utilizes 9-cis-violaxanthin/90-cis-neoxanthin as precursor,
while 9-cis- and 90-cis-cryptoxanthin were converted. The latter
result is consistent with the activity with 9-cis-b-carotene and -
zeaxanthin, to 9-cis-b-apo-100- or 9-cis-3-OH-b-apo-100-carotenal,
respectively (Supplementary Fig. 2B). Supporting the previously
reported stereo-specificity observed with b-carotene-isomers, both
enzymes did not show detectable conversion of all-trans-lutein,
-zeaxanthin or cryptoxanthin (data not shown).
To address the question on the substrate preference, we deter-
mined the Km and Vmax values of both enzymes for the substrates
9-cis-b-carotene and -zeaxanthin (Fig. 2). As shown in Table 1,
the two enzymes displayed large differences in their kinetic
parameters. AtCCD7 showed much higher Vmax values and also
higher affinity towards both substrates, compared with PsCCD7.
Both enzymes have higher affinity to 9-cis-b-carotene than to -zea-
xanthin, but convert the latter with higher rates.
1.53 (2H, m)
1.68 (2H, m)
2.09 (2H, t)
–
39.5
19.1
32.9
129.5
138.1
129.0
129.5
135.8
128.8
–
6.29 (1H, d)
6.74 (1H, d)
–
H-19
H-11, no NOE for H-10
6.12 (1H, d)
H-12 and H-19
no NOE for H-8
H-8
11
12
13
14
15
16
17
18
19
20
100
110
120
130
140
150
200
6.92 (1H, t)
6.36 (1H, d)
–
125.5
135.6
H-10, no NOE for H-11
6.33 (1H, d)
6.94 (1H, m)
1.08 (3H, s)
1.08 (3H, s)
1.79 (3H, s)
2.03 (3H, s)
2.04 (3H, s)
9.6 (1H, d)
6.20 (1H, dd)
7.23 (1H, d)
–
131.2
135.0
28.6
28.6
21.4
20.3
12.6
H-7 and H-10
193.4
126.9
156.3
133.6
128.2
140.8
12.3
6.68 (1H, d)
6.68 (1H, m)
2.00 (3H, s)

1806
M. Bruno et al. / FEBS Letters 588 (2014) 1802–1807
H-20 H-19
H-20‘
NOE
H
12
19
11
13
10
NOE
9
8
7
H
H-19/H-10
H-19/H-7
20
H
H
NOE
H-20‘/H -11‘
6
1
5
4
H-20‘/H -15‘
2
3
H-20/H-11
2.08
2.06
2.04
2.02
2.00
1.98 ppm
Fig. 3. Nuclear Overhauser effect spectroscopy plot. The structure of the apocarotenoid fragment shows the spatial proximity between the relevant H-protons of the 9-cis-
structure. The stereochemistry was confirmed by the observed NOEs reported in Table 2 and shown on the right for an expansion of the 2D-NOESY spectrum revealing NOEs
between methyl and olefinic proton signals.
The configuration of the apocarotenal produced by CCD7 is
crucial for the investigation and mechanistic interpretation of
the complex reactions sequence catalyzed by CCD8, yielding
carlactone. Therefore, we determined the structure of the AtCCD7
product, using one- (1D, s. Supplementary Figs. 3–6) and two-
dimensional (2D) NMR techniques. The 1H and 13C resonance
assignments, which were based on the 2D HSQC, COSY and HMBC
data (Supplementary Figs. 7–11), are summarized in Table 2. The
2D NOESY experiment allows detecting spatial proximity among
protons and was thus most important for proving the 9-cis-
configuration of the apocarotenal (see Fig. 3 and Supplementary
Fig. 12). The most relevant observed NOEs are given in Table 2
and displayed for an expansion of the 2D-NOESY spectrum in
Fig. 3. As is indicated by arrows in the apocarotenoid structure
fragment (Fig. 3), the NOEs clearly supported the 9-cis-structure.
This was proved by the existence of NOEs between the protons
of the H-C19 methyl and the H-C10 olefinic groups, as well as
between the H-C8 and H-C11 groups. Simultaneously, the absence
of NOEs between the protons of the H-C19 methyl and the H-C11
olefinic groups on one hand, and the H-C8 and H-C10 groups on
the other hand exclude the 9-trans structure.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.febslet.2014.03.
041.
References
[1] Xie, X., Yoneyama, K. and Yoneyama, K. (2010) The strigolactone story. Annu.
Rev. Phytopathol. 48, 93–117.
[2] Seto, Y., Kameoka, H., Yamaguchi, S. and Kyozuka, J. (2012) Recent advances in
strigolactone research: chemical and biological aspects. Plant Cell Physiol. 53
(11), 1843–1853.
[3] Ruyter-Spira, C., Al-Babili, S., van der Krol, S. and Bouwmeester, H. (2013) The
biology of strigolactones. Trends Plant Sci. 18 (2), 72–83.
[4] Brewer, P.B., Koltai, H. and Beveridge, C.A. (2013) Diverse roles of
strigolactones in plant development. Mol. Plant 6 (1), 18–28.
[5] de Saint Germain, A., Bonhomme, S., Boyer, F.D. and Rameau, C. (2013) Novel
insights into strigolactone distribution and signalling. Curr. Opin. Plant Biol. 16
(5), 583–589.
[6] Waldie, T., McCulloch, H. and Leyser, O. (2014) Strigolactones and the control
of plant development: Lessons from shoot branching. Plant J., http://
dx.doi.org/10.1111/tpj.12488.
[7] Umehara, M., Hanada, A., Yoshida, S., Akiyama, K., Arite, T., Takeda-Kamiya, N.,
Magome, H., Kamiya, Y., Shirasu, K., Yoneyama, K., et al. (2008) Inhibition of shoot
branching by new terpenoid plant hormones. Nature 455 (7210), 195–200.
[8] Gomez-Roldan, V., Fermas, S., Brewer, P.B., Puech-Pages, V., Dun, E.A., Pillot,
J.P., Letisse, F., Matusova, R., Danoun, S., Portais, J.C., et al. (2008) Strigolactone
inhibition of shoot branching. Nature 455 (7210), 189–194.
[9] Kapulnik, Y., Delaux, P.M., Resnick, N., Mayzlish-Gati, E., Wininger, S.,
Bhattacharya, C., Sejalon-Delmas, N., Combier, J.P., Becard, G., Belausov, E.,
et al. (2011) Strigolactones affect lateral root formation and root-hair
elongation in Arabidopsis. Planta 233 (1), 209–216.
Taken together, the two CCD7 are stereospecific enzymes that
should be considered and designated nine-cis-carotenoid cleavage
dioxygenases (NCCDs) and can be distinguished from NCEDs
involved in ABA biosynthesis by the incapability of cleaving
9-cis-violaxanthin and by the different cleavage site. We are
currently investigating whether CCD8 converts the hydroxylated
apocarotenals produced from 9-cis-zeaxanthin and -lutein into
[10] Ruyter-Spira, C., Kohlen, W., Charnikhova, T., van Zeijl, A., van Bezouwen, L., de
Ruijter, N., Cardoso, C., Lopez-Raez, J.A., Matusova, R., Bours, R., et al. (2011)
Physiological effects of the synthetic strigolactone analog GR24 on root
system architecture in Arabidopsis: another belowground role for
strigolactones? Plant Physiol. 155 (2), 721–734.
carlactones with a hydroxylated b- or e-ionone ring, which may
be precursors of new strigolactones.
[11] Rasmussen, A., Mason, M.G., De Cuyper, C., Brewer, P.B., Herold, S., Agusti, J.,
Geelen, D., Greb, T., Goormachtig, S., Beeckman, T., et al. (2012) Strigolactones
suppress adventitious rooting in Arabidopsis and pea. Plant Physiol. 158 (4),
1976–1987.
[12] Snowden, K.C., Simkin, A.J., Janssen, B.J., Templeton, K.R., Loucas, H.M., Simons,
J.L., Karunairetnam, S., Gleave, A.P., Clark, D.G. and Klee, H.J. (2005) The
Decreased apical dominance1/Petunia hybrida CAROTENOID CLEAVAGE
Acknowledgements
This work was supported by the German Research Foundation
(DFG) Grant AL 892/1-4 and by the EU (METAPRO; FP7 KBBE-
2009-3-1-01).

M. Bruno et al. / FEBS Letters 588 (2014) 1802–1807
1807
DIOXYGENASE8 gene affects branch production and plays
a
role in leaf
[32] Auldridge, M.E., Block, A., Vogel, J.T., Dabney-Smith, C., Mila, I., Bouzayen, M.,
Magallanes-Lundback, M., DellaPenna, D., McCarty, D.R. and Klee, H.J. (2006)
Characterization of three members of the Arabidopsis carotenoid cleavage
dioxygenase family demonstrates the divergent roles of this multifunctional
enzyme family. Plant J. 45 (6), 982–993.
[33] Gonzalez-Jorge, S., Ha, S.H., Magallanes-Lundback, M., Gilliland, L.U., Zhou, A.,
Lipka, A.E., Nguyen, Y.N., Angelovici, R., Lin, H., Cepela, J., et al. (2013)
Carotenoid cleavage dioxygenase4 is a negative regulator of beta-carotene
content in Arabidopsis seeds. Plant Cell 25 (12), 4812–4826.
[34] Ohmiya, A., Kishimoto, S., Aida, R., Yoshioka, S. and Sumitomo, K.
(2006) Carotenoid cleavage dioxygenase (CmCCD4a) contributes to
white color formation in chrysanthemum petals. Plant Physiol. 142
(3), 1193–1201.
[35] Campbell, R., Ducreux, L.J., Morris, W.L., Morris, J.A., Suttle, J.C., Ramsay, G.,
Bryan, G.J., Hedley, P.E. and Taylor, M.A. (2010) The metabolic and
developmental roles of carotenoid cleavage dioxygenase4 from potato. Plant
Physiol. 154 (2), 656–664.
senescence, root growth, and flower development. Plant Cell 17 (3), 746–759.
[13] Agusti, J., Herold, S., Schwarz, M., Sanchez, P., Ljung, K., Dun, E.A., Brewer, P.B.,
Beveridge, C.A., Sieberer, T., Sehr, E.M., et al. (2011) Strigolactone signaling is
required for auxin-dependent stimulation of secondary growth in plants. Proc.
Natl. Acad. Sci. USA 108 (50), 20242–20247.
[14] Akiyama, K., Matsuzaki, K. and Hayashi, H. (2005) Plant sesquiterpenes induce
hyphal branching in arbuscular mycorrhizal fungi. Nature 435 (7043), 824–827.
[15] Bouvier, F., Isner, J.C., Dogbo, O. and Camara, B. (2005) Oxidative tailoring of
carotenoids: a prospect towards novel functions in plants. Trends Plant Sci. 10
(4), 187–194.
[16] Auldridge, M.E., McCarty, D.R. and Klee, H.J. (2006) Plant carotenoid cleavage
oxygenases and their apocarotenoid products. Curr. Opin. Plant Biol. 9 (3),
315–321.
[17] Walter, M.H. and Strack, D. (2011) Carotenoids and their cleavage products:
biosynthesis and functions. Nat. Prod. Rep. 28 (4), 663–692.
[18] Giuliano, G., Al-Babili, S. and Von Lintig, J. (2003) Carotenoid oxygenases:
cleave it or leave it. Trends Plant Sci. 8 (4), 145–149.
[19] Medina, H.R., Cerda-Olmedo, E. and Al-Babili, S. (2011) Cleavage oxygenases
for the biosynthesis of trisporoids and other apocarotenoids in Phycomyces.
Mol. Microbiol. 82 (1), 199–208.
[20] Fraser, P.D. and Bramley, P.M. (2004) The biosynthesis and nutritional uses of
carotenoids. Prog. Lipid Res. 43 (3), 228–265.
[21] DellaPenna, D. and Pogson, B.J. (2006) Vitamin synthesis in plants: tocopherols
and carotenoids. Annu. Rev. Plant Biol. 57, 711–738.
[36] Brandi, F., Bar, E., Mourgues, F., Horvath, G., Turcsi, E., Giuliano, G., Liverani, A.,
Tartarini, S., Lewinsohn, E. and Rosati, C. (2011) Study of ‘Redhaven’ peach
and its white-fleshed mutant suggests
a key role of CCD4 carotenoid
dioxygenase in carotenoid and norisoprenoid volatile metabolism. BMC
Plant Biol. 11, 24.
[37] Rodrigo, M.J., Alquezar, B., Alos, E., Medina, V., Carmona, L., Bruno, M., Al-
Babili, S. and Zacarias, L. (2013) A novel carotenoid cleavage activity involved
in the biosynthesis of Citrus fruit-specific apocarotenoid pigments. J. Exp. Bot.
64 (14), 4461–4478.
[38] Ma, G., Zhang, L., Matsuta, A., Matsutani, K., Yamawaki, K., Yahata, M.,
Wahyudi, A., Motohashi, R. and Kato, M. (2013) Enzymatic formation of
beta-citraurin from beta-cryptoxanthin and Zeaxanthin by carotenoid
cleavage dioxygenase4 in the flavedo of citrus fruit. Plant Physiol. 163 (2),
682–695.
[22] Cazzonelli, C.I. and Pogson, B.J. (2010) Source to sink: regulation of carotenoid
biosynthesis in plants. Trends Plant Sci. 15 (5), 266–274.
[23] Moise, A.R., Al-Babili, S. and Wurtzel, E.T. (2013) Mechanistic aspects of
carotenoid biosynthesis. Chem. Rev. 114 (1), 164–193.
[24] Alder, A., Jamil, M., Marzorati, M., Bruno, M., Vermathen, M., Bigler, P., Ghisla,
S., Bouwmeester, H., Beyer, P. and Al-Babili, S. (2012) The path from beta-
carotene to carlactone,
(6074), 1348–1351.
a
strigolactone-like plant hormone. Science 335
[39] Vogel, J.T., Walter, M.H., Giavalisco, P., Lytovchenko, A., Kohlen, W.,
Charnikhova, T., Simkin, A.J., Goulet, C., Strack, D., Bouwmeester, H.J., et al.
(2010) SlCCD7 controls strigolactone biosynthesis, shoot branching and
mycorrhiza-induced apocarotenoid formation in tomato. Plant J. 61 (2),
300–311.
[40] Schwartz, S.H., Qin, X. and Loewen, M.C. (2004) The biochemical
characterization of two carotenoid cleavage enzymes from Arabidopsis
indicates that a carotenoid-derived compound inhibits lateral branching. J.
Biol. Chem. 279 (45), 46940–46945.
[25] Walter, M.H., Floss, D.S. and Strack, D. (2010) Apocarotenoids: hormones,
mycorrhizal metabolites and aroma volatiles. Planta 232 (1), 1–17.
[26] Schmidt, H., Kurtzer, R., Eisenreich, W. and Schwab, W. (2006) The carotenase
AtCCD1 from Arabidopsis thaliana is a dioxygenase. J. Biol. Chem. 281 (15),
9845–9851.
[27] Vogel, J.T., Tan, B.C., McCarty, D.R. and Klee, H.J. (2008) The carotenoid
cleavage dioxygenase
1 enzyme has broad substrate specificity, cleaving
multiple carotenoids at two different bond positions. J. Biol. Chem. 283 (17),
11364–11373.
[28] Ilg, A., Beyer, P. and Al-Babili, S. (2009) Characterization of the rice carotenoid
cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis. FEBS J.
276 (3), 736–747.
[41] Seto, Y., Sado, A., Asami, K., Hanada, A., Umehara, M., Akiyama, K. and
Yamaguchi, S. (2014) Carlactone is an endogenous biosynthetic precursor for
strigolactones. Proc. Natl. Acad. Sci. USA 111, 1640–1645.
[42] Schwartz, S.H., Qin, X. and Zeevaart, J.A. (2001) Characterization of
a
novel carotenoid cleavage dioxygenase from plants. J. Biol. Chem. 276 (27),
25208–25211.
[29] Ilg, A., Yu, Q., Schaub, P., Beyer, P. and Al-Babili, S. (2010) Overexpression of the
rice carotenoid cleavage dioxygenase
1
gene in Golden Rice endosperm
[43] Alder, A., Holdermann, I., Beyer, P. and Al-Babili, S. (2008) Carotenoid
suggests apocarotenoids as substrates in planta. Planta 232 (3), 691–699.
[30] Huang, F.C., Molnar, P. and Schwab, W. (2009) Cloning and functional
characterization of carotenoid cleavage dioxygenase 4 genes. J. Exp. Bot. 60
(11), 3011–3022.
oxygenases involved in plant branching catalyse
a
highly specific
conserved apocarotenoid cleavage reaction. Biochem. J. 416 (2), 289–296.
[44] Barua, A.B. and Olson, J.A. (2000) B-carotene is converted primarily to
retinoids in rats in vivo. J. Nutr. 130, 1996–2001.
[31] Rubio, A., Rambla, J.L., Santaella, M., Gomez, M.D., Orzaez, D., Granell, A. and
Gomez-Gomez, L. (2008) Cytosolic and plastoglobule-targeted carotenoid
dioxygenases from Crocus sativus are both involved in beta-ionone release. J.
Biol. Chem. 283 (36), 24816–24825.
[45] Tan, B.C., Joseph, L.M., Deng, W.T., Liu, L., Li, Q.-B., Cline, K. and McCarty, D.R.
(2003) Molecular characterization of the Arabidopsis 9-cis epoxycarotenoid
dioxygenase gene family. Plant J. 35, 44–56.