Synthesis and cytotoxic evaluation of novel N-substituted amidino-1-hydroxybenzimidazole derivatives

Article abstract of DOI:10.1007/s12272-013-0197-0

A new class of N-substituted amidino-1-hydroxybenzimidazole derivatives (15-24) were synthesized and evaluated for their in vitro cytotoxic activities against human leukemia cell lines, HL-60 and K562. The preliminary results showed that compounds 16, 20, 21 and 23 had moderate antitumor activity against HL-60 cell line. Further investigation on the mechanism of the observed cytotoxic effects demonstrated that compound 21 increased the expression of autophagic and apoptotic genes and induced apoptosis of HL-60 cells.

Full text of DOI:10.1007/s12272-013-0197-0

Arch. Pharm. Res.
DOI 10.1007/s12272-013-0197-0
RESEARCH ARTICLE
Synthesis and cytotoxic evaluation of novel N-substituted
amidino-1-hydroxybenzimidazole derivatives
•
Mehmet Alp Hakan Goker Tulin Ozkan
•
•
¨
Asuman Sunguroglu
Received: 22 March 2013 / Accepted: 23 June 2013
Ó The Pharmaceutical Society of Korea 2013
Abstract A new class of N-substituted amidino-1-
hydroxybenzimidazole derivatives (15–24) were synthe-
sized and evaluated for their in vitro cytotoxic activities
against human leukemia cell lines, HL-60 and K562. The
preliminary results showed that compounds 16, 20, 21 and
23 had moderate antitumor activity against HL-60 cell line.
Further investigation on the mechanism of the observed
cytotoxic effects demonstrated that compound 21 increased
the expression of autophagic and apoptotic genes and
induced apoptosis of HL-60 cells.
Anticancer activity of various benzimidazoles (Fig. 1)
I (Karpinska et al. 2011), II (Romero-Castro et al. 2011),
III (Gowda et al. 2009) and amidinobenzimidazoles IV
(Starcevic et al. 2007) have been reported. These results
prompted us to investigate the cytotoxic activity of a new
series of 1-hydroxybenzimidazole derivatives carrying
N-substituted amidine groups against acute myeloid leu-
kemia (AML) cell line HL-60 and chronic myeloid leukemia
(CML) cell line K562. Effects of these novel compounds
on expression of apoptotic (Tzifi et al. 2012) and auto-
phagic (Wirawan et al. 2012) genes were also evaluated.
Keywords 1H-benzimidazole Á Amidinobenzimidazole Á
Cytotoxic activity Á K562 Á HL-60
Materials and methods
Chemistry
Introduction
Pentamidine, an aromatic diamidine, is used against early
stage human African tryponosomiasis (HAT) (Apted
1980), antimony-resistant leishmaniasis (Bryceson et al.
1985) and AIDS-related P. jiroveci pneumonia (Ivady and
Paldy 1958). Pentamidine is also reported to exert anti-
cancer activity against different cancers such as human
melanoma (Pathak et al. 2002) and human leukemia (Qiu
et al. 2012).
Experimental
Uncorrected melting points were measured on a Bu
¨chi
1
B-540 capillary melting point apparatus. H NMR spectra
were recorded in deuterated dimethyl sulfoxide (DMSO-d6)
on a Varian Mercury 400 MHz FT spectrometer, chemical
shifts (d) are in ppm relative to tetramethylsilane (TMS),
and coupling constants (J) are reported in Hertz. Mass
spectra were taken on a Waters Micromass ZQ connected
with Waters Alliance HPLC, using ESI(?) method, with
C-18 column. Elemental analyses were performed by Leco
CHNS-932. Some HCl salts of compounds were prepared
by using dry HCl gas in MetOH. All the reagents and
solvents were purchased from Sigma–Aldrich Chemical
¨
M. Alp (&) Á H. Goker
Department of Pharmaceutical Chemistry, Faculty of Pharmacy,
Ankara University, 06100 Tandogan, Ankara, Turkey
e-mail: malp@pharmacy.ankara.edu.tr
¨
Co. or Fischer Scientific. Compounds 1, 2 (Goker et al.
¨
¨
2002), 3 (Goker et al. 2005a), 4, 5, 7, 12, 13 (Goker et al.
2005b), 9 and 14 (Ates-Alagoz et al. 2006) were synthe-
sized as described in literature (Scheme 1).
T. Ozkan Á A. Sunguroglu
Department of Medical Biology, Faculty of Medicine,
Ankara University, 06100 Sıhhiye, Ankara, Turkey
123

M. Alp et al.
suspension of imidate ester HCl in absolute EtOH was
stirred with corresponding the amines (1.5- to 2-fold
excess) overnight at 25–30 °C. The reaction mixture was
evaporated and diluted with ether, the precipitate was fil-
tered, washed with ether, then dried. Compounds 5–14
were used without purification as HCl salts for the next
steps since they were prepared completely pure.
4-(Benzylamino)-3-nitrobenzamidine (6)
Yield 74 %, mp 268–269 °C; 1H NMR (DMSO-d6) d: 4.70
(d, 2H, J = 6.4 Hz), 7.03 (d, 1H, J = 9.6 Hz), 7.22 (t, 1H,
J = 7.0 Hz), 7.29–7.36 (m, 4H), 7.81 (dd, 1H, J = 9.2,
J = 2 Hz), 8.67 (d, 1H, J = 2.4 Hz), 8.93 (s), 9.18 (t). MS
(ESI?) m/z (rel intensity): 271 (M?H, 100), C14H14N4O2.
Fig. 1 The structures of some benzimidazoles having anticancer
activity
General synthesis of 5–14
4-(Benzylamino)-N-butyl-3-nitrobenzamidine (8)
Compound 1–4 (2 mmol) were suspended in absolute
EtOH, cooled in an ice-salt bath, and dry HCl gas was
passed through the solution for 40 min. The solution was
stirred in a stoppered flask at room temperature for 3 days
and then diluted with dry ether. The imidate esters pre-
cipitated as yellow solids, which were washed with ether
then dried under vacuum at room temperature. All imidate
esters were used directly without characterisation. A
Yield 65 %, mp 280–282 °C(bubbling), 1H NMR (DMSO-
d6) d: 0.90 (t, 3H, J = 7.2 Hz), 1.35 (m, 2H), 1.59 (m, 2H),
3.37 (overlapped with DMSO), 4.73 (d, 2H, J = 6.4 Hz),
7.05 (d, 1H, J = 9.2 Hz), 7.24–7.40 (m, 5H), 7.80 (dd, 1H,
J = 9.2, J = 2.4 Hz), 8.59 (d, 1H, J = 2.4), 9.17 (t), MS
(ESI?) m/z (rel intensity): 327 (M?H, 100), C18H22N4O2.
Scheme 1 General synthesis of novel 1-hydroxybenzimidazole carboxamidines. Reagents and condition: i). Corresponding amines, DMF.
ii). HCl (g), EtOH. iii). Corresponding amines, EtOH. iv). NaH, DMF
123

Novel amidino-1-hydroxybenzimidazole derivatives
N-benzyl-4-(benzylamino)-3-nitrobenzamidine (10)
1-Hydroxy-N-isopropyl-2-phenyl-1H-benzo[d]imidazole-6-
carboxamidine HCl (17)
Yield 70 %, mp 278–279 °C, 1H NMR (DMSO-d6)
d: 4.63(s, 2H), 4.70 (d, 2H, J = 6.4 Hz), 7.03 (d, 1H,
J = 9.6 Hz), 7.22 (t, 1H, J = 6.8 Hz), 7.31–7.41 (m, 9H),
7.82 (dd, 1H, J = 6.8, J = 2.4 Hz), 8.62 (d, 1H,
J = 2.4 Hz), 9.15(t), MS (ESI?) m/z (rel intensity): 361
(M?H, 100), C21H20N4O2.
Yield 60 %, mp 271–272 °C (bubbling), 1H NMR (DMSO-
d6?D2O) d: 1.33 (d, 6H, J = 6.8 Hz), 4.05 (m, 1H),
7.59–7.64 (m, 4H), 7.86 (d, 1H, J = 8.8 Hz), 7.95 (d, 1H,
J = 1.6 Hz), 8.29(m, 2H), MS(ESI?) m/z (relintensity): 295
(M?H, 100), Anal. for C17H18N4O.HCl.0,75H2O, Calcd. C,
59.29 H, 6.00 N, 16.27 Found C, 59.09 H, 6.24 N, 16.19.
N-benzyl-4-(2,4-dichlorobenzylamino)-3-nitrobenzamidine
(11)
N-butyl-1-hydroxy-2-phenyl-1H-benzo[d]imidazole-6-
carboxamidine HCl (18)
Yield 68 %, mp 268–270 °C, 1H NMR (DMSO-d6) d: 4.60
(s, 2H), 4.73 (d, 2H, J = 6 Hz), 6.91 (d, 1H, J = 9.2 Hz),
6.28–6.38 (m, 7H), 7.67 (d, 1H, J = 2 Hz), 7.79 (d, 1H,
J = 9.6 Hz), 8.62 (d, 1H, J = 2.4 Hz), 9.08(t), MS (ESI?)
m/z (rel intensity): 429 (M?H, 100), 431(M?H?2, 66),
433 (M?H?4, 10), C21H18Cl2N4O2.
Yield55 %, mp221–223 °C (bubbling), 1H NMR (DMSO-d6)
d: 0.95 (t, 3H, J = 7.6 Hz), 1.41 (m, 2H), 1.67 (m, 2H), 3.45
(q, 2H), 7.60–7.67 (m, 4H), 7.89 (d, 1H, J = 8 Hz), 8.04 (d,
1H, J = 1.6 Hz), 8.35 (m, 2H), 9.09(s), 9.53 (s), 9.83(s), MS
(ESI?) m/z (rel intensity): 309 (M?H, 100), Anal. for
C18H20N4O.1HCl.1,66H2O, Calcd. C, 57.69 H, 6.54 N,
14.95 Found C, 57.42 H, 6.36 N, 14.96.
General synthesis of 15–24
Compound 5–14 (0.5 mmol) were dissolved in dimethyl-
formamide (DMF) (2–3 ml) and the solution was then trea-
ted with NaH (0.5 mmol, 60 % suspension in paraffin oil).
The mixture was stirred overnight at room temperature
(Bowser et al. 2007). At the end of this time, the solution was
added to H2O (2 ml) and EtOH (2 ml) and all solvents were
evaporated in vacuo. The residue was purified by silica gel
column chromatography using chloroform/methanol/
ammonium hydroxide solution (100:20:1) as eluent.
N-(2-dimethylamino)ethyl-1-hydroxy-2-phenyl-1H-
benzo[d]imidazole-6-carboxamidine (19)
Yield 53 %, mp 198–200 °C (bubbling), 1H NMR (DMSO-
d6?D2O) d: 2.19 (s, 6H), 2.52 (t, 2H, J = 6 Hz), 3.44 (t, 2H,
J = 6 Hz), 7.26 (dd, 1H, J = 8.4, J = 2 Hz), 7.35–7.39
(m, 3H), 7.47 (d, 1H, J = 8.4 Hz), 7.67 (s, 1H), 8.57 (d, 2H,
J = 7.2 Hz), MS(ESI?) m/z (relintensity): 324 (M?H, 100),
Anal. for C18H21N5O.1,75.H2O, Calcd. C, 60.91 H, 6.96 N,
19.73 Found C, 60.77 H, 6.83 N, 19.34.
1-Hydroxy-N-isopropyl-2-propyl-1H-benzo[d]imidazole-6-
carboxamidine HCl (15)
N-benzyl-1-hydroxy-2-phenyl-1H-benzo[d]imidazole-6-
carboxamidine HCl (20)
Yield 53 %, mp 207–209 °C (bubbling), 1H NMR (DMSO-d6)
d: 0.99 (t, 3H, J = 7.6 Hz), 1.30 (d, 6H, J = 6 Hz), 1.88
(m, 2H), 3.03 (t, 2H, J = 7.2 Hz), 4.10 (m, 1H), 7.67
(d, 1H, J = 8.8 Hz), 7.85 (d, 1H, J = 8.4 Hz), 8.014 (s,
1H), 9.12 (s, 1H), 9.51 (s, 1H), 9.66 (d, 1H, J = 8 Hz). MS
(ESI?) m/z (rel intensity): 261 (M?H, 82), 172 (100),
Anal. for C14H20N4O.1,5HCl.H2O, Calcd. C, 50,49 H,
7.11 N, 16.82 Found C, 50.11, H, 7.22 N, 16.66.
Yield 30 %, mp 240–242 °C (bubbling), 1H NMR (DMSO-
d6?D2O) d: 4.74 (s, 2H), 7.39–7.49 (m, 5H), 7.65 (m, 3H),
7.73 (dd, 1H, J = 8.4, J = 1.6 Hz), 7.92 (d, 1H,
J = 8.8 Hz), 8.08 (d, 1H, J = 2 Hz), 8.28 (m, 2H), MS
(ESI?) m/z (rel intensity): 343 (M?H, 100), Anal. for
C21H18N4O.2HCl.1,75H2O, Calcd. C, 56.44 H, 5.30 N,
12.54 Found C, 56.18 H, 5.18 N, 12.82.
1-Hydroxy-2-phenyl-1H-benzo[d]imidazole-6-
N-benzyl-2-(2,4-dichlorophenyl)-1-hydroxy-1H-
carboxamidine HCl (16)
benzo[d]imidazole-6-carboxamidine (21)
1
Yield24 %, mp267–269 °C (bubbling), 1H NMR (DMSO-d6)
d: 7.62 (m, 3H), 7.76 (dd, 1H, J = 8.8, J = 2 Hz), 7.90 (d,
1H, J = 8.4 Hz), 8.17 (d, 1H, J = 1.2 Hz), 8.35 (m, 2H),
9.17 (s), 9.46 (s), MS (ESI?) m/z (rel intensity): 253 (M?H,
60), 189(100), Anal. for C14H12N4O.2HCl.0,5H2O, Calcd. C,
50,31, H, 4.52 N, 16.76 Found C, 50.08 H, 4.74 N, 16.36.
Yield 22 %, mp 279–280 °C (bubbling), H NMR (DMSO-
d6?D2O) d: 4.67 (s, 2H), 7.36–7.67 (m, 11H), MS (ESI?) m/z
(rel intensity): 411 (M?H, 100), 413 (M?H?2, 63), 415
(M?H?4, 12), Anal. for C21H16Cl2N4O.2HCl.2,75H2O,
Calcd. C, 47.25 H, 4.43 N, 10.50 Found C, 47.28 H, 4.16 N,
10.11.
123

M. Alp et al.
1-Hydroxy-N-isopropyl-2-(naphthalen-1-yl)-1H-
cell growth. Camptothecin was used as a positive control in
all viability experiments.
benzo[d]imidazole-6-carboxamidine (22)
Yield 24 %, mp 233–235 °C (bubbling), 1H NMR (DMSO-
d6?D2O)d: 1.14(d, 6H, J = 6 Hz), 3.82(m, 1H), 7.21(d, 1H,
J = 8.8 Hz), 7.49–7.59 (m, 4H), 7.79 (s, 1H), 7.96–8.01
(m, 2H), 8.10 (d, 1H, J = 6.8 Hz), 8.35 (d, 1H, J = 7.6 Hz),
MS (ESI?) m/z (rel intensity): 345 (M?H, 100), Anal. for
C21H20N4O.2HCl.2H2O, Calcd. C, 55.63 H, 5.78 N, 12.35
Found C, 55.30 H, 6.02 N, 12.28.
Cell viability test/cytotoxicity test
MTT test was used to determine cell viability. Briefly, cells
(4 9 104 cells/well) were seeded to 96-well plates. Cell
proliferation assay was carried out using the Cell Prolif-
eration Kit I [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltet-
razolium bromide; (MTT)] (Roche, Germany) as described
by the manufacturer using cells treated at various concen-
trations (1, 25, 50, 75, 100 lM) of new synthesized benz-
imidazoles (compounds 15–23) for 72 h. Mitochondrial
succinate dehydrogenase of living cell reduces tetrazolium
dye and constitutes formazan crystals which can be mea-
sured colorimetrically and correlate with number of living
cells (Mosmann 1983). The spectrophotometric absorbance
was measured using a microplate reader (Biotek, USA) at
wavelength 550 nm with a reference wavelength of
690 nm. Number of viable cells was calculated from
untreated cells, and the data were expressed as percent cell
viability. All the experiments were conducted in triplicate
and DMSO was used as negative control in corresponding
concentrations.
1-Hydroxy-N-isopentyl-2-(naphthalen-1-yl)-1H-
benzo[d]imidazole-6-carboxamidine (23)
Yield 21 %, mp 245–247 °C (bubbling), 1H NMR (DMSO-
d6?D2O) d: 0.92 (d, 6H, J = 6.4 Hz), 1.53 (m, 2H), 1.67
(m, 1H), 3.28 (t, 2H, J = 7.2 Hz), 7.39 (dd, 1H, J = 8.4,
J = 2 Hz), 7.47–7.57 (m, 3H), 7.66 (d, 1H, J = 8.8 Hz), 7.73
(s, 1H), 7.95 (d, 1H, J = 7.2 Hz), 7.99 (d, 1H, J = 8.4 Hz),
8.03 (d, 1H, J = 8.8 Hz), 8.22 (d, 1H, J = 8 Hz), MS (ESI?)
m/z (rel intensity): 373 (M?H, 45), 208 (100), Anal. for
C23H24N4O.3HCl.2,5H2O, Calcd. C, 52.43 H, 6.12 N, 10.63
Found C, 52.59 H, 6.00 N, 10.48.
2-Phenyl-6-(1,4,5,6-tetrahydropyrimidin-2-yl)-1H-
benzo[d]imidazol-1-ol (24)
Quantitative RT-PCR
Yield 58 %, mp 255–257 °C, 1H NMR (DMSO-d6?D2O) d:
1.93 (m, 2H), 3.45 (m, 4H), 7.26 (dd, 1H, J = 8.4 Hz),
7.40–7.47 (m, 3H), 7.52 (d, 1H, J = 8.4 Hz), 7.75 (s, 1H),
8.65 (d, 2H, J = 6.4 Hz), MS (ESI?) m/z (rel intensity): 293
(M?H, 45), 188(100), Anal. for C17H16N4O.2,75H2O, Calcd.
C, 59.72 H, 6.33 N, 16.39 Found C, 59.51 H, 6.48 N, 16.13.
Total RNA was extracted from HL-60 cell line by using the
High Pure RNA kit (Roche, Mannheim, Germany)
according to the manufacturer’s protocols. cDNA was
generated from RNA by reverse transcriptase (Transcriptor
High Fidelity cDNA Synthesis Kit; Roche). Quantitative
real-time RT-PCR was performed using SYBR Green PCR
Master Mix (Roche) on LC480 instrument. mRNA was
measured relative to HPRT as an endogenous control.
Experiments were performed in biological triplicates. For
primer sequences see Table 1.
Biological tests
Cell culture
Human leukemia cell lines (HL-60, K562) were grown in
RPMI 1640 supplemented with 10 % fetal bovine serum,
penicillin (100 U/ml) and streptomycin (100 mg/ml) in a
5 % CO2 atmosphere at 37 °C. Sterile bovine serum was
inactivated in 60 °C water bath for 30 min before prepar-
ing medium. Cells were counted with trypan blue to seed
equal number of cells to each well of 6, 24 and 96 well
plates.
Cell morphology determination
Cells (4 9 105 cells/well) were seeded to 6-well plates and
treated with different concentrations of compounds for
72 h. After treatment protocol, cells were washed with PBS
two times and then fixed with 1:3 volume of acetic acid/
methanol. Cells on slides were then soaked into 1:20
diluted Giemsa solution for 15 min and then washed with
distilled water and visualized under a microscope.
Preparation of compounds
Annexin V–propidium iodide staining for apoptosis
determination
Compounds were dissolved in DMSO in a stock solution at
a concentration of 20 mM, stored at -20 °C and protected
from light. In each experiment DMSO concentration never
exceeded 0.5 % and this percentage did not interfere with
HL-60 cells (4 9 105 cells/well) were seeded in 6 well-
plates. Cells were incubated with different concentrations of
123

Novel amidino-1-hydroxybenzimidazole derivatives
Table 1 Primer sequences used
in RT-PCR
Genes
Primer Sequences
Products (bp)
94
HPRT
Atg5
Atg7
Atg12
Beclin 1
Bad
Forward: TGACACTGGCAAAACAATGCA
Reverse: GGTCCTTTTCACCAGCAAGCT
Forward: TGGGCCATCAATCGGAAACTC
Reverse: TGCAGCCACAGGACGAAACAG
Forward: GATCCGGGGATTTCTTTCACG
Reverse: CAGCAATGTAAGACCAGTCAAGT
Forward: TCCGAGCCAGCGGCCTAACT
Reverse: AAGGAGGCGCCGGAGTAGGG
Forward: AGCTGCCGTTATACTGTTCTG
Reverse: ACTGCCTCCTGTGTCTTCAATCTT
Forward: GATGAGTGACGAGTTTGTGGA
Reverse: CAAGTTCCGATCCCACCAG
Forward: GACGGCAACTTCAACTGGG
Reverse: AGGAGTCTCACCCAACCAC
Forward: ATCTCAGTGCAATGGCTTCC
Reverse: CATAGTAAGCGTTAAACTCGTCTCC
Forward: CGCCCTGTGGATGACTGAGT
Reverse: GGGCCGTACAGTTCCACAA
129
181
206
185
130
182
111
93
Bax
Bim
Bcl-2
compounds for 72 h. After all incubation period, cells were
collected, washed with PBS two times and resuspended in
binding buffer according to suppliers instructions (BD Bio-
sciences). 5 ll FITC-Annexin V and 5 ll PI was added to
100 ll of cell suspension. After a brief vortex, cells were
incubated for 15 min at room temperature. After this incu-
bation, 400 ll 1 9 binding buffer was added to cells and
cells were measured in flow cytometry (Accuri C6).
Fig. 2 a Cytotoxic activity
results of compounds 15–23
against HL-60 cells b Cytotoxic
activity results of compounds
15–23 against K562 cells
Experiments were conducted in
triplicate. Error bars indicate
s.d.,* significantly different
(p \ 0.05) from control.
Anticancer activities of
compound 24 could not be
determined due to solubility
problem in DMSO
123

M. Alp et al.
Fig. 3 Relative gene
expressions of compounds 16,
20, 21 and 23 at 100 lM
concentration. Experiments
were conducted in triplicate.
Error bars indicate s.d.,*
significantly different
(p \ 0.05) from control
Fig. 4 Giemsa staining for apoptotic cells. a Control b Compound 21 (100 lM) c Camptothecin (1 lM)
Fig. 5 Annexin V/PI staining
of HL-60 cells. a Control
b Compound 21 (100 lM)
Results and discussion
The novel N-substituted amidino-1-hydroxybenzimida
zole derivatives (15–24) were investigated for their
in vitro anticancer activities in leukemia cell lines, HL-60
and K562, using MTT assay, flow cytometry and RT-
PCR. Cell viability test results were reported in Fig. 2.
Compounds 16, 20, 21 and 23 exhibited remarkable
cytotoxic activity against HL-60 cell line. Cell viability
for these compounds at 100 lM concentration were
determined as 74, 73, 54 and 61 %, respectively when
compared with the control group. N-isopropyl (17) or
N–n-butyl (18) substitution of amidino group decreased
anticancer activity. Compound 21 which has electron-
withdrawing halogens substituted on phenyl ring was the
The synthetic pathway for the preparation of the targeted
benzimidazoles 15–24 are shown in Scheme 1. Nucleo-
philic displacement of the chloro group of 4-chloro-3-
nitrobenzonitrile, by the reaction with several amines in
DMF gave 1–4. The nitrile group of 1–4 was converted to
imidate esters (they were not characterized because of
instability), with dry HCl gas in absolute ethanol, by Pinner
reaction, and then treatment of the imidate esters with
several amines in ethanol gave 5–14. Cyclocondensation
reaction of these compounds in DMF in the presence of
NaH afforded the corresponding benzimidazoles, 15–24.
123

Novel amidino-1-hydroxybenzimidazole derivatives
Acknowledgments Central Instrumental Analysis Lab in Faculty of
Pharmacy, Ankara University provided the support for acquisition of
the NMR, Mass and Elemental analysis data used in this work.
most cytotoxic derivative in this series. Most of the
compounds displayed higher cytotoxicity to HL-60 cells
than K562 cells. Expressions of apoptotic and autophagic
genes were investigated to test the mechanism of cyto-
toxicity in HL-60 cell line. Apoptosis (type 1 cell death),
which is activated either through intrinsic (mitochondrial)
or extrinsic (death receptor) pathway is defined as a major
type of programmed cell death (Okada and Mak 2004).
Morphological changes such as membrane blebbing, cell
membrane asymmetry loss, chromatin condensation and
DNA fragmentation are among characteristics of apoptosis
(Danial and Korsmeyer 2004). Autophagy (type 2 cell
death), an intracellular degradation process which includes
transport of cytoplasmic constituents to lysosomes is
thought to play roles in cell growth, development and
energy balance. Autophagy is also considered as a
mechanism of cancer cell suicide activated by chemo-
therapy or radiation (Kuma et al. 2004). Since apoptosis
and autophagy are the two major cell death signalling
pathways, chemical agents interfering these two pathways
may have the potential to possess anticancer activity.
Therefore, we investigated the effects of compounds 16,
20, 21 and 23 on the expression of genes related to
autophagy (Atg5, Atg7, Atg12, Beclin-1) and apoptosis
(Bad, Bim, Bax, Bcl-2) (Fig. 3). According to expression
results of autophagic genes, compounds 16 and 20
increased expressions of Atg5, Atg7 and Beclin 1 and
compound 21 increased expressions of Atg5 and Atg7. We
could not find any significant change in expression of
Atg12. Compounds 16, 20, 21 and 23 increased expression
of proapoptotic Bax and also increased antiapoptotic Bcl-2
but did not exert any effect on Bim expression. Com-
pounds 16 and 21 enhanced proapoptotic bad expression.
Compound 21 induced the highest gene expression ratio of
Bax/Bcl-2. Compound 21 was shown to induce apoptotic
morphology of HL-60 cells (Fig. 4). Compound 21
exhibited 16.4 % more late apoptotic profile than control
group (Fig. 5). Considering the expression changes of
apoptotic and autophagic genes, it is thought that apop-
tosis and autophagy play important role in cytotoxic
activity of compound 21. Late apoptosis rates of cells
treated with compounds 16, 20 and 23 were found as 3.1,
2.3 and 4.3 % respectively. Increased Atg5 and Atg7
expressions and low late apoptotic rate of cells treated
with compounds 16 and 20 implied that autophagy played
more important role than apoptosis in cytotoxic activity of
these compounds.
References
Apted, F.I. 1980. Present status of chemotherapy and chemopropy-
laxis of human trypanosomiasis in the Eastern Hemisphere.
Pharmacology & Therapeutics 11: 391–413.
Ates-Alagoz, Z., M. Alp, C. Kus, S. Yildiz, E. Buyukbingol, and H.
Goker. 2006. Synthesis and potent antimicrobial activities of
some novel retinoidal monocationic benzimidazoles. Archiv der
Pharmazie 339: 74–80.
Bowser, T.E., V.J. Bartlett, M.C. Grier, A.K. Verma, T. Warchol, S.B.
Levy, and M.N. Alekshun. 2007. Novel anti-infection agents:
Small-molecule inhibitors of bacterial transcription factors.
Bioorganic & Medicinal Chemistry Letters 17: 5652–5655.
Bryceson, A.D., J.D. Chulay, M. Mugambi, J.B. Were, G. Gachihi,
C.N. Chunge, R. Muigai, S.M. Bhatt, M. Ho, H.C. Spencer, J.
Meme, and G. Anabwani. 1985. Visceral leishmaniasis unre-
sponsive to antimonial drugs. II. Response to high dosage
sodium stibogluconate or prolonged treatment with pentamidine.
Transactions of the Royal Society of Tropical Medicine and
Hygiene 79: 705–714.
Danial, N.N., and S.J. Korsmeyer. 2004. Cell Death: Critical Control
Points. Cell 116: 205–219.
Gowda, N.R.T., C.V. Kavitha, K.K. Chiruvella, O. Joy, K.S.
Rangappa, and S.C. Raghavan. 2009. Synthesis and biological
evaluation of novel 1-(4-methoxyphenethyl)-1H-benzimidazole-
5-carboxylic acid derivatives and their precursors as antileuke-
mic agents. Bioorganic & Medicinal Chemistry Letters 19:
4594–4600.
¨
Goker, H., M. Alp, and S. Yildiz. 2005a. Synthesis and potent
antimicrobial activity of some novel N-(alkyl)-2-phenyl-1H-
benzimidazole-5-carboxamidines. Molecules 10: 1377–1386.
Goker, H., C. Kus¸, D.W. Boykin, S. Yildiz, and N. Altanlar. 2002.
¨
Synthesis of some new 2-substituted-phenyl-1H-benzimidazole-
5-carbonitriles and their potent activity against Candida species.
Bioorganic & Medicinal Chemistry 10: 2589–2596.
¨
¨
Goker, H., S. Ozden, S. Yildiz, and D.W. Boykin. 2005b. Synthesis
and potent antibacterial activity against MRSA of some novel
1,2-disubstituted-1H-benzimidazole-N-alkylated-5-carboxami-
dines. European Journal of Medicinal Chemistry 40: 1062–1069.
Ivady, G., and L. Paldy. 1958. Ein neuseus behandlungsverfahren der
interstitiellen plasmazelligan pneumonie fruhgeborener mit fun-
fwertigem stibium und aromatischen diamidinen. Monatsschrift
fur Kinderheilkunde 106: 10–14.
Karpinska, M.M., J. Matysiak, and A. Niewiadomy. 2011. Synthesis
of novel 4-(1H-benzimidazol-2-yl)benzene-1,3-diols and their
cytotoxic activity against human cancer cell lines. Archives of
Pharmacal Research 34: 1639–1647.
Kuma, A., M. Hatano, M. Matsui, A. Yamamoto, H. Nakaya, T.
Yoshimori, Y. Ohsumi, T. Tokuhisa, and N. Mizushima. 2004.
The role of autophagy during the early neonatal starvation
period. Nature 432: 1032–1036.
Mosmann, T. 1983. Rapid colorimetric assay for cellular growth and
survival: Application to proliferation and cytotoxicity assays.
Journal of Immunological Methods 65: 55–63.
Okada, H., and T.W. Mak. 2004. Pathways of apoptotic and non-
apoptotic death in tumour cells. Nature Reviews Cancer 4:
592–603.
These results indicate that some of the N-substituted
amidino-1-hydroxybenzimidazole derivatives have cyto-
toxic activity in HL-60 cell line. More active derivatives
against AML can be obtained by chemical modification of
these compounds.
Pathak, M.K., D. Dhawan, D.J. Lindner, E.C. Borden, C. Farver, and
T. Yi. 2002. Pentamidine is an inhibitor of PRL phosphatases
123

M. Alp et al.
with anticancer activity. Molecular Cancer Therapeutics
1: 1255–1264.
activity of 2-substituted-5-amidino-benzimidazoles. Bioorganic
& Medicinal Chemistry 15: 4419–4426.
Qiu, G., J. Jiang, and X.S. Liu. 2012. Pentamidine sensitizes chronic
myelogenous leukemia K562 cells to TRAIL-induced apoptosis.
Leukemia Research 36: 1417–1421.
Romero-Castro, A., I. Leon-Rivera, L.C. Avila-Rojas, G. Navarrete-
Vazquez, and A. Nieto-Rodriguez. 2011. Synthesis and pre-
liminary evaluation of selected 2-aryl-5(6)-nitro-1H-benzimid-
azole derivatives as potential anticancer agents. Archives of
Pharmacal Research 34: 181–189.
Tzifi, F., C. Economopoulou, D. Gourgiotis, A. Ardavanis, S.
Papageorgiou, and A. Scorilas. 2012. The role of BCL2 family
of apoptosis regulator proteins in acute and chronic leukemias.
Advances in Hematology 2012: 524308.
Wirawan, E., T. Vanden Berghe, S. Lippens, P. Agostinis, and P.
Vandenabeele. 2012. Autophagy: For better or for worse. Cell
Research 22: 43–61.
Starcevic, K., M. Kralj, K. Ester, I. Sabol, M. Grce, K. Pavelic, and G.
Karminski-Zamola. 2007. Synthesis, antiviral and antitumor
123